JP2007166962A - Method for predicting or diagnosing alzheimer's disease - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a means or a method for affording the diagnosis of Alzheimer's disease with high accuracy. <P>SOLUTION: The method for predicting or diagnosing the Alzheimer's disease comprises detecting an Alzheimer's disease-related SNP (single nucleotide polymorphism) contained in a test specimen and contained in at least one of 44 genes having JSNP (Japanese single nucleotide polymorphism database) ID, respectively described in table 1. <P>COPYRIGHT: (C)2007,JPO&INPIT

Description

  The present invention relates to a method for predicting or diagnosing Alzheimer's disease.

  In genetic studies of Alzheimer's disease, a neurodegenerative disease, mutations in the ApoE gene have been confirmed as risk factors for this disease. Although Alzheimer's disease has early, late, familial, and non-familial dementia, mutants of the ApoE gene are major risk factors for the disease, regardless of their distinction. However, based on the knowledge that this ApoE gene variant is not essential and sufficient for the development of Alzheimer's disease, other environmental elements and other genes are associated with the ApoE gene or alone, and the occurrence of Alzheimer's disease. It is believed to be involved in increasing the risk.

In addition, Alzheimer's disease is currently diagnosed by neuropsychological examinations and diagnostic imaging, and a follow-up examination of 3 to 5 years is required. These tests are not only expensive but also time consuming and above all have the disadvantage that they can only be diagnosed after onset. Apolipoprotein E4 (ApoE4) genotype is highly correlated with Alzheimer's disease. (Non-Patent Documents 1 and 2)
Strittmater, WJ et al. Binding of human apolipoprotein E to synthetic amyloid beta peptide: Isoform-specific effects and implications for late-onset Alzheimer disease.Proc. Natl. Acad. Sci. USA 90, 8098-8102, 1993. Corder EH. Et al. Gene dose of apolipprotein E type 4 allele and the risk of Alzheimer's disease in late onset families.Science 261, 921-923, 1993.

  However, the ApoE genotype alone has the drawback of low diagnostic accuracy.

  Therefore, an object of the present invention is to provide means and a method that enable highly accurate Alzheimer's disease diagnosis.

  The present inventors screened 100,000 SNPs in human genes for Alzheimer's disease patient DNA and healthy subject DNA samples, and identified 44 Alzheimer's disease-related SNPs. By detecting at least one of these 44 SNPs, Alzheimer's disease can be predicted or diagnosed, and when combined with the ApoE genotype, Alzheimer's disease can be diagnosed with higher accuracy. The present invention has been completed.

  The present invention for solving the above problems is as follows.

  According to the present invention, high-precision Alzheimer's disease diagnosis is possible, early diagnosis can be performed before onset, and there are many advantages such as no diagnostic burden on the patient and no follow-up examination.

  The present invention relates to the prediction or diagnosis of Alzheimer's disease comprising detecting an Alzheimer's disease-related single nucleotide polymorphism contained in at least one of the 44 genes having JSNP ID shown in Table 1 below contained in a subject. It is a method.

  More detailed information on 44 genes showing JSNP ID in Table 1 above is shown in Table 2 below. In addition to JSNP ID, Gene Name, chromosome, position, odds ratio, 95% confidence interval and P value are shown. These 44 genes were screened for 100,000 human SNPs (detailed in the examples), and were selected based on the following criteria.

  The SNPs in Table 2 are arranged in order from the smallest P value. The odds ratio in Table 2 is an index that indicates the strength of the association between the factor and the disease. It is distributed from 0 to infinity, 1 is uncorrelated, and if it is less than 1, the person who is exposed to the factor has the disease. Lower risk means greater than 1 means higher risk to exposed people. The odds ratio shown in the table is an estimate, and its true value is considered to be in the vicinity. The 95% confidence interval is a range where a true value exists with a probability of 95%. If the lower limit of the 95% confidence interval exceeds 1, or the upper limit is less than 1, it can be said that it is significant at the 5% level. P value is the probability that an odds ratio is observed assuming that each SNP is not disease related. Since it is difficult to directly prove that SNP is related to disease, conversely, it is related to disease by making a hypothesis that SNP is not related to disease and denying it. In other words, if the SNP is not related to the disease, the odds ratio is expected to be 1, so if the odds ratio is larger or smaller than 1, it is considered that a rare event has occurred, and expresses how rare it is with the P value . A smaller P value indicates a rarer event and thinks that the assumption is wrong rather than a very rare event. In other words, the assumption that SNP is not related to disease is wrong, and SNP is related to disease.

  Further, Table 3 shows 5 ′ sequences and SNPs of sequences containing each SNP, and Table 4 shows 3 ′ sequences of sequences containing each SNP and the sequence numbers of these SNPs. In addition, Table 3 shows the bases that are frequent in the disease. Table 5 shows the sequences and sequence numbers of PCR primers (forward and backward) used for detecting these SNPs.

  The present invention includes detecting an Alzheimer's disease-related single nucleotide polymorphism contained in at least one of the 44 genes shown in the above table contained in a subject, and further comprising one of these 44 genes. In addition to detecting nucleotide polymorphisms, examine the ApoE4 genotype contained in the subject and, in combination with the results, examine the genetic predisposition affecting the likelihood of Alzheimer's disease. Can do. Methods for examining the genotype of ApoE4 are known, and can be carried out with reference to the method described in Journal of Lipid Research Vol. 31, 1990, pp545-548, for example.

  Each single nucleotide polymorphism can be detected using a method known per se based on the sequence information. For example, single nucleotide polymorphism can be detected by SNP typing (eg, Tuckman) using blood collected from a subject as a subject. A probe used for SNP typing can be appropriately synthesized based on the sequence information. As a general method for preparing probes of the Tachman method, probes with fluorescent materials (FAM or VIC) that emit different colors and quenchers are prepared on base sequences containing each of the SNPs, and 5 'and 3' If PCR is performed together with the primers, they can be identified by the color corresponding to each SNP.

  Alternatively, single nucleotide polymorphisms can be detected using a gene chip using blood collected from a subject as a subject. The gene chip may be one in which probes for determining the 44 genes and the ApoE4 genotype are immobilized. Each probe can be appropriately synthesized based on the sequence information. Moreover, a gene chip can be manufactured by a known method using these probes.

  If ApoE4 is homozygous, the risk of Alzheimer's disease is said to be 15 times higher than that of ApoE 2 or 3, and three times higher in the heterozygous case. However, about 50% can be detected with ApoE, and the rest is considered to be the effect of other genes or SNPs. The No.1 (96584) of this table 1 (96584) poliovirus receptor-related2 varies with ApoE, but other SNPs move independently. From this, by examining at least one of the 44 SNPs, preferably all 44, it is possible to detect a person who does not have ApoE4 but is likely to become Alzheimer. Specifically, the risk of developing Alzheimer's disease can be predicted or diagnosed based on whether or not each SNP has a base with a high risk of Alzheimer's disease shown in Table 3.

  According to the present invention, for example, 44 SNPs can be typed using DNA prepared from the patient's blood, and ApoE typing results can be taken into account to enable early diagnosis and prediction of Alzheimer's disease, Early intervention is possible.

Hereinafter, the present invention will be described in more detail with reference to examples.
Example 1
Screening method from 100,000 human SNPs of 44 genes Human DNA was first amplified by PCR using the forward and backward primers shown in Table 5. Next, a primer was prepared using about 24 bases of the sequences shown in Table 3 and Table 4, a Tuckman probe containing SNP was prepared, PCR was performed, and screening was performed.

Example 2
SNP detection of 44 genes SNP detection by typing is described below.
The composition of DNA and reaction mixture (2X Universal Master Mix, primer, probe) is shown below.
4ng / μL DNA 2.5μL
2X Universal Master Mix 6.2μL
50μM sense-primer 0.2μL (final 900nM)
50μM antisense-primer 0.2μL (final 900nM)
Fam-probe XμL (final 200nM)
Vic-probe YμL (final 200nM)
H2O ZμL
Total 18.5μL

  Each probe is calculated to a final concentration of about 200 nM, and the amount of H2O is determined accordingly. Dispense the DNA and reaction mixture into a 96-well plate, spin down, cover the plate, and start the reaction with the thermal cycler under the conditions shown in Table 6 below. After completion of the reaction, the fluorescence of each well is measured to determine which base has each SNP.

Example 3
ApoE Genotyping method (Journal of Lipid Research, 31: 545-8, 1990) is partially modified.
F6: forward primer taagcttggcacggctgtccaagga (SEQ ID NO: 177)
(7-bp cloning sequence + 18-bp apoE sequence)
F4: reverse primer acagaattcgccccggcctggtacac (SEQ ID NO: 178)
(9-bp cloning sequence + 17-bp apoE sequence)

1) PCR
Genomic DNA 200 ng
Primers 1 μM (p mol / μl) each
dNTPs 0.2 mM each
DMSO 10%
AmpliTaq (previously 1: 1 mix with AntiTaq (Toyobo)) 0.025 unit / μl
PCR buffer 1x (10 mM Tris-HCl (pH 8.3), 50 mM KCl, 1.5 mM MgCl2)
Total volume 20 μl

AntiTaq can significantly reduce the generation of non-specific amplification that can appear at 50-60 bp. As a genotype marker and control, put all known genotype samples of 2/2, 3/3, 4/4, 2/3, 2/4, 3/4

95 ° C, 4 minutes
30 cycles of:
95 ℃, 1 minute
63 ℃, 1 minute
70 ℃, 2 minutes
70 ℃, 6 minutes
15 ℃, soak

  Perform 4 μl separation under the same conditions as after the restriction enzyme treatment, and check the amplification products.

2) Restriction enzyme treatment
PCR product 15 μl
+ 0.25 μl of 10 unit / μl Hha I (Takara)
+ 4.75 μl of 1x PCR buffer
(Because the enzyme works well even in the PCR buffer, it is not necessary to add a restriction enzyme buffer, just add the enzyme directly. However, to handle many samples, dilute with 1x PCR buffer for each sample. 5 μl is added with 8 pipettes)
Incubate for more than 2 hours at 37 ℃

3) Separation
(1) 8% polyacrylamide gel (non-denaturing) ... Original method
(2) Agarose gel electrophoresis
When 10 μl of sample is added to a 5% Nusieve 3: 1 (TBE) minigel and BPB (approximately 20 bp) migrates to 3/4, bands of at least 48 bp can be clearly separated. You can
Size markers include (pUC18-Msp I (Sigma)) and 20 bp DNA ladder (Takara).
(3) How to do with WAVE
WAVE DNA fragment analysis system 3500 (Transgenomic, Inc.)
Separation conditions are performed in a mode for sizing double-stranded DNA.
The elution programs do not necessarily have to be the same, but the programs we used most often are:
Sample addition is usually 7-8 μl

The present invention is useful in the field of genetic diagnosis of Alzheimer's disease.

Claims (5)

A method for predicting or diagnosing Alzheimer's disease, comprising detecting an Alzheimer's disease-related single nucleotide polymorphism contained in at least one of the 44 genes whose JSNP IDs shown in the following table are contained in a subject.

2. The method according to claim 1, which is carried out in combination with the result of examining the genotype of ApoE4 contained in the subject. 3. The method according to claim 1, wherein the subject is blood collected from a subject, and the single nucleotide polymorphism is detected by SNP typing. 3. The method according to claim 1, wherein the subject is blood collected from a subject, and the single nucleotide polymorphism is detected using a gene chip. 5. The method according to claim 4, wherein the gene chip is obtained by immobilizing probes capable of determining the 44 genes and ApoE4 genotype.