JP2007089432A - Method for increasing production of blood platelet derived from stem cell - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a method for producing a cell preparation obtained by culturing undifferentiated hematopoietic cells to efficiently produce megakaryocyte cells, especially blood platelets, a cell treatment which is expected to be performed by domestic and foreign companies on the outsides of hospitals. <P>SOLUTION: This method for producing the blood platelets comprises (A) a process for inhibiting the functions of Lin or its equivalent in blood plate precursor cells and (B) a process for differentiating the blood plate precursor cells. The blood platelets produced by the method, and its application techniques are provided. <P>COPYRIGHT: (C)2007,JPO&INPIT

Description

  The present invention relates to a method for efficiently producing platelets and its application.

  Blood cells such as red blood cells, lymphocytes, and platelets are present in blood essential for somatic cells constituting a living body. Each blood cell shares a unique function and plays a role of keeping the living body constant. In recent years, it has been clarified that various blood cells differentiate and mature from hematopoietic undifferentiated cells in the bone marrow, and that various humoral factors are involved in the process of differentiation and maturation. It has become to.

  Platelets are cells having a diameter of 2 to 3 μm present in blood and are a kind of formed component in blood that plays an important role in hemostasis and thrombus formation in a living body. It has been revealed that hematopoietic undifferentiated cells in the bone marrow become megakaryocytes via megakaryocyte progenitor cells, and the platelets produced by fragmenting the cytoplasm of megakaryocytes are released into the blood.

  Recently, various research results on megakaryocytes and platelet systems have been reported. For example, it has been reported that megakaryocyte growth factor has an action of promoting the amplification of megakaryocytes that produce platelets ( Non-patent document 1). Cancer treatments, such as high dose chemotherapy and high dose radiation, destroy hematopoietic cells in the bone marrow and place the patient in a severely depleted state of platelets. After such treatment, thrombocytopenia occurs, resulting in decreased coagulation and bleeding disorders requiring platelet transfusion. Platelet deficiency is a major cause of illness and death after these cancer treatments, and increases the cost of cancer treatment. The recovery of megakaryocytes and platelets generally requires more than 15 days, during which time the patient's ability to clot is deficient.

  In recent years, umbilical cord blood banks and the like have been established, and allogeneic hematopoietic stem cell transplantation in which collected umbilical cord blood is transplanted to a patient different from the collected individual has begun to spread. In many cases of transplanted patients, delayed platelet recovery is a problem.

Accordingly, there is a need for a technique that can easily produce platelets.
Shunichi Kato "Umbilical cord blood stem cell transplantation" Daily medical care and blood Vol. 7, P.I. 479 Special Reprint, Pharmaceutical Journal

  An object of the present invention is to develop a method for producing a cell preparation in which hematopoietic undifferentiated cells are cultured to efficiently produce megakaryocytes, particularly platelets. Such cell treatment is expected to be performed outside the hospital by domestic and foreign companies.

  As a result of intensive research aimed at developing a culture method that acts on hematopoietic undifferentiated cells and promotes differentiation of megakaryocyte progenitor cells, the inventors succeeded in clarifying the culture method, The present invention has been completed. The present invention provides a method of promoting differentiation into platelets by promoting differentiation from hematopoietic undifferentiated cells to megakaryocyte progenitor cells, and eventually platelets, by regulating Lnk.

Accordingly, the present invention provides the following.
(1) A method for producing platelets:
A) inhibiting the function of Lnk or its equivalent in platelet progenitor cells; and B) differentiating the platelet progenitor cells,
Including the method.
(2) The method according to Item 1, wherein the platelet precursor cells include embryonic stem cells and megakaryocytes.
(3) The method according to Item 1, wherein the inhibition includes inhibition of the Lnk or an equivalent thereof by a dominant negative method.
(4) The method according to Item 3, wherein the inhibition is achieved by introducing a mutant Lnk capable of suppressing Lnk activity by a retrovirus.
(5) The method according to Item 1, wherein the Lnk has the nucleotide sequence shown in SEQ ID NO: 1, encodes the amino acid sequence shown in SEQ ID NO: 2, or is a variant or fragment thereof.
(6) The method according to Item 1, which comprises the step of bringing the platelet precursor cells into contact with stem cell factor (SCF) in the step B.
(7) The method according to Item 1, wherein the inhibition is achieved by inhibition by the nucleic acid level of Lnk.
(8) The method according to Item 1, wherein the inhibition is achieved by Lnk antisense or RNAi inhibition.
(9) The method according to Item 1, wherein the inhibition is achieved by inhibition by the product level of Lnk.
(10) The method according to Item 1, wherein the inhibition is achieved by inhibition of Lnk with an antibody.
(11) The method according to Item 1, wherein the platelet precursor cells include megakaryocytes derived from embryonic stem cells.
(12) The method according to Item 11, wherein the induction is achieved by culture on OP9 stromal cells and co-culture with bipolar hemangioblasts.
(13) In differentiation into megakaryocytes, A) differentiation and maturation from hemangioblasts (VEGF type 2 receptor; Flk-1, KDR) and c-kit positive cells; B) physical with OP9 stromal cells Contact is essential for differentiation and maturation into megakaryocytes; and C) platelet production is possible on OP9 stromal cells, but is promoted under conditions excluding contact with OP9. Item 12. The method according to Item 11, having at least one characteristic selected from the group consisting of:
(14) Platelets produced by the method according to item 1.
(15) A method for screening a substance that regulates the rate of platelet production,
A) a step of selecting a substance that interacts with Lnk or the Lnk promoter; and B) a step of determining whether to differentiate by contacting the selected substance with platelet precursor cells, and selecting the substance having a differentiation-regulating action. Including the method.
(16) A composition comprising platelets having impaired Lnk or its function.
(17) The composition according to item 16, wherein the composition is used for treating a patient having highly viscous blood.
(18) A factor that inhibits Lnk or its gene product.
(19) The factor according to item 18, wherein the factor is selected from the group consisting of a dominant negative factor, a promoter binding factor, RNAi, an antibody, and a small molecule.
(20) A composition for regulating the rate of platelet production, comprising a factor that inhibits Lnk or a gene product thereof.
(21) The composition according to item 20, wherein the factor is selected from the group consisting of a dominant negative factor, a promoter binding factor, RNAi, an antibody, and a small molecule.
(22) The composition according to item 20, wherein the factor is a functional variant of Lnk or a gene product thereof.
(23) The composition according to item 20, wherein the factor is a modified nucleic acid having the nucleotide sequence set forth in SEQ ID NO: 3.
(24) Use of an agent that inhibits Lnk or a gene product thereof for regulating the rate of platelet formation.
(25) Use of an agent that inhibits Lnk or a gene product thereof for the production of a composition for regulating the rate of platelet production.

  Preferred embodiments of the present invention will be shown below, but those skilled in the art can appropriately implement the embodiments and the like from the description of the present invention and well-known and common techniques in the field, and the effects and effects of the present invention can be easily achieved. It should be recognized to understand.

  Accordingly, it is understood that these and other advantages of the present invention will become apparent to those of ordinary skill in the art upon reading and understanding the following detailed description, with reference where appropriate to the accompanying drawings and the like.

The present invention provides a technique for providing platelets in industrial quantities. Other effects include enhancing the ability of hematopoietic stem cells and progenitor cells to proliferate and enhance hematopoiesis, and improving the functions of transplanted donor cells. Providing the technology to be provided in a quantity.

  The present invention will be described below. Throughout this specification, it should be understood that the singular forms also include the plural concept unless specifically stated otherwise. Thus, it should be understood that singular articles (eg, “a”, “an”, “the”, etc. in the case of English) also include the plural concept unless otherwise stated. In addition, it is to be understood that the terms used in the present specification are used in the meaning normally used in the art unless otherwise specified. Thus, unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In case of conflict, the present specification, including definitions, will control.

  The embodiments provided below are provided for a better understanding of the present invention, and it is understood that the scope of the present invention should not be limited to the following description. Therefore, it is obvious that those skilled in the art can make appropriate modifications within the scope of the present invention with reference to the description in the present specification.

(Definition of terms)
The definitions of terms particularly used in the present specification are described below.

  As used herein, “stem cell” refers to a cell having a self-replicating ability and having pluripotency (ie, “pluripotency”). Stem cells are usually able to regenerate the tissue when the tissue is damaged. As used herein, stem cells can be embryonic stem (ES) cells or tissue stem cells (also referred to as tissue stem cells, tissue-specific stem cells or somatic stem cells), but are not limited thereto. In addition, as long as it has the above-mentioned ability, an artificially produced cell (for example, a fusion cell described herein, a reprogrammed cell, etc.) can also be a stem cell. Embryonic stem cells refer to pluripotent stem cells derived from early embryos. Embryonic stem cells were first established in 1981 and have been applied since 1989 to the production of knockout mice. In 1998, human embryonic stem cells were established and are being used in regenerative medicine. Unlike embryonic stem cells, tissue stem cells are cells in which the direction of differentiation is limited, are present at specific positions in the tissue, and have an undifferentiated intracellular structure. Therefore, tissue stem cells have a low level of pluripotency. Tissue stem cells have a high nucleus / cytoplasm ratio and poor intracellular organelles. Tissue stem cells generally have pluripotency, have a slow cell cycle, and maintain proliferative ability over the life of the individual.

  When classified by the site of origin, tissue stem cells are classified into, for example, the skin system, digestive system, myeloid system, nervous system, and the like. Examples of skin tissue stem cells include epidermal stem cells and hair follicle stem cells. Examples of digestive tissue stem cells include pancreatic (common) stem cells and hepatic stem cells. Examples of myeloid tissue stem cells include hematopoietic stem cells and mesenchymal stem cells. Examples of nervous system tissue stem cells include neural stem cells and retinal stem cells.

  As used herein, “established” or “established” cells maintain certain properties (eg, pluripotency) and the cells continue to grow stably under culture conditions. State. Thus, established stem cells maintain pluripotency.

  As used herein, “differentiated cells” refers to cells with specialized functions and morphology (eg, muscle cells, nerve cells, etc.), and unlike stem cells, there is no or almost no pluripotency. . Examples of differentiated cells include epidermal cells, pancreatic parenchymal cells, pancreatic duct cells, hepatocytes, blood cells, cardiomyocytes, skeletal muscle cells, osteoblasts, skeletal myoblasts, neurons, vascular endothelial cells, pigment cells, Examples include smooth muscle cells, fat cells, bone cells, chondrocytes.

  As used herein, “differentiation” or “cell differentiation” refers to two or more morphologically and / or functionally qualitative differences among daughter cell populations derived from the division of one cell. A phenomenon in which types of cells are generated. Therefore, the process in which a cell population (cell lineage) derived from cells that cannot originally detect special characteristics exhibits distinct characteristics such as production of a specific protein is also included in differentiation. At present, it is common to consider cell differentiation as a state in which a specific gene group in the genome is expressed, and cell differentiation by searching for intracellular or extracellular factors or conditions that cause such gene expression state. Can be identified. The result of cell differentiation is in principle stable, especially in animal cells, which differentiates into other types of cells only in exceptional cases.

  As used herein, “pluripotency” or “pluripotency” is used interchangeably, refers to the nature of a cell, and refers to the ability to differentiate into one or more, preferably two or more, various tissues or organs. . Accordingly, “pluripotency” and “multipotency” are used interchangeably with “undifferentiated” in this specification unless otherwise specified. In general, cell pluripotency is limited as development progresses, and in adults, the constituent cells of one tissue or organ rarely change into another cell. Therefore, pluripotency is usually lost. In particular, epithelial cells are unlikely to change into other epithelial cells. When this happens, it is usually a pathological condition and is called metaplasia. However, mesenchymal cells have a high degree of pluripotency because they tend to undergo metaplasia instead of other mesenchymal cells with a relatively simple stimulus. Embryonic stem cells are pluripotent. Tissue stem cells are pluripotent. In the present specification, among pluripotency, the ability to differentiate into all types of cells constituting a living body like a fertilized egg is called totipotency, and pluripotency can encompass the concept of totipotency. Whether or not a certain cell has pluripotency includes, but is not limited to, formation of embryoid bodies and culture under differentiation-inducing conditions in an in vitro culture system. In addition, assay methods for the presence or absence of pluripotency using living organisms include the formation of teratomas by implantation into immunodeficient mice, the formation of chimeric embryos by injection into blastocysts, and transplantation into living tissues. Examples include, but are not limited to, proliferation by injection into ascites.

  Accordingly, “embryonic stem cells” or “ES cells” as used herein refers to any pluripotent stem cell that is used interchangeably and is derived from an early embryo. Usually embryonic stem cells are considered to be totipotent or nearly totipotent. A chimera was produced by introducing this embryonic stem cell into a normal host blastocyst and returning it to the foster parent uterus. As a result, a germline chimera (a chimera having a functional germ cell derived from embryonic stem cells) has high chimera-forming ability. Mouse) (A. Bradley et al .: Nature, 309, 255, 1984). The embryonic stem cell line can be applied with various gene transfer methods (for example, calcium phosphate method, retrovirus vector method, liposome method, electroporation method, etc.) in culture. In addition, a method for selecting a cell into which a gene has been incorporated has been devised, and homologous recombination (homogenous recombination) has been used to obtain a clone of a cell that has been modified (substitution, deletion, insertion) targeting a specific gene. You can also. Since embryonic stem cell lines that have been treated in vitro retain the ability to differentiate into the germ line, research on the function of a specific gene at the individual level is being actively conducted (M.R. (Capecchi: Science, 244, 1288, 1989). The transgenic mouse production method using embryonic stem cells has many advantages over the microinjection transgenic animal production method in that it enables obtaining individuals in which only a specific gene is arbitrarily modified. Conceivable. In particular, a knockout animal in which a specific gene is inactivated can be created, and the function of the gene can be elucidated or only an exogenous gene can be expressed. Therefore, if the establishment of embryonic stem cells becomes easy, the effect cannot be expected. Such embryonic stem cells retain pluripotency by transferring cells of the inner cell mass of mouse blastocysts on day 3.5 of fertilization to in vitro culture and repeating dissociation and passage of the cell mass, It can be produced by establishing stem cells that continue to grow indefinitely while maintaining a normal karyotype. Usually, in order to maintain the pluripotency of embryonic stem cells, it is preferable to culture embryonic stem cells on a feeder cell layer such as a primary cultured fibroblast prepared from an STO cell line and / or mouse embryo. .

  The “hematopoietic stem cell” used in the present invention refers to a cell that is a source of cell production in a cell neogenesis system such as a hematopoietic tissue and an intestinal epithelial tissue. This hematopoietic stem cell preserves itself and can differentiate into all blood cells. Examples of such blood cells include monocytic stem cells, B lymphocyte stem cells, T lymphocyte stem cells, myeloid stem cells, T lymphocyte cells, B lymphocyte cells, platelet cells, erythroid cells, Examples include monocyte cells. Hematopoietic stem cells are cells that have the ability to differentiate into all types of blood cells and have the ability to reconstruct hematopoiesis, and are mainly present in bone marrow, umbilical cord blood, spleen, or liver, and are also present in peripheral blood in a small amount. These hematopoietic stem cells are usually CD34 strongly positive cells, and in the present invention, high-proliferative potential colony-forming cells (HPP-CFC) are also included.

  As used herein, “progenitor cell” means a cell that can not be differentiated from pluripotent hematopoietic stem cells from each lineage of blood cells but can only differentiate into one-way blood cells such as platelets. To do. Specifically, platelet colony forming cells (CFC-MEG), eosinophil colony forming cells (EO-CFC), granulocyte monocyte colony forming cells (CFU-GM), erythropoiesis cells (BFU-E, CFU-E). ), T precursor cells, B precursor cells, and the like. These are all CD34 positive cells.

  In the present specification, the “platelet progenitor cell” is used as a generic term for any undifferentiated cell that can differentiate into platelets. Platelet progenitor cells include, for example, megakaryocytes and their progenitor cells (including hematopoietic stem cells and embryonic stem cells), hematopoietic stem cells, megakaryocytes derived from embryonic stem cells (for example, culture on OP9 stromal cells and Can be achieved by co-culture with polar hemangioblasts), but is not limited thereto.

  In the present specification, the induction from embryonic stem cells to megakaryocytes can be achieved by culturing on OP9 stromal cells and co-culturing with bipolar hemangioblasts, in particular here A) hemangioblasts ( VEGF type 2 receptor; Flk-1, KDR) and differentiation and maturation from c-kit positive cells; B) physical contact with OP9 stromal cells is essential for differentiation and maturation into megakaryocytes; and C) Platelet production is possible on OP9 stromal cells, but it may be important to be selected from the group consisting of being promoted under conditions that exclude contact with OP9.

  In the present specification, “megakaryocytes” are also called “megakaryocytes”, and when they arise from megakaryoblasts, fission occurs but nuclei do not separate and form a giant lobule nucleus. The nucleus is hyperploid. The cytoplasm is broken down and released by a demarcation membrane formed in the cytoplasm, and many of those fragments become platelets. In addition to the bone marrow, it is also found in the red pulp of the spleen and the embryonic liver.

  Megakaryocyte progenitor cells can be obtained from bone marrow, umbilical cord blood or peripheral blood. Bone marrow fluid and peripheral blood can be obtained from normal donors.

  In the present specification, hematopoietic stem cells are a generic term for pluripotent hematopoietic pluripotent stem cells obtained from bone marrow fluid, umbilical cord blood, peripheral blood, and the like, and undifferentiated cells that can form hematopoietic colonies. Includes hematopoietic cells with positive cell surface antigens. In peripheral blood, the number of CD34 positive cells constitutes only about 0.1% of total leukocytes. In umbilical cord blood, CD34 positive cells make up about 0.1-1% of total white blood cells. Typically normal bone marrow contains only 1-2% CD34 positive cells. Leukocytes are separated from bone marrow or umbilical cord blood or peripheral blood by standard methods such as centrifugation by gradient. [Geigy Scientific Tables, Vol 3, C.I. Lentner, ed. Ciba-Geigy, Basel, Switzerland, (1984)]. In the analysis of Wright-Giemsa staining, mature megakaryocytes in the bone marrow constitute only about 0.05% of the leukocyte population, whereas immunostaining specific for megakaryocyte cells is about 0.2% Labeled until. In healthy individuals, progenitor cells are found very rarely in normal blood, since megakaryocyte progenitor cells are completely differentiated in the bone marrow. After separation, the leukocytes may be cultured immediately in serum-free medium. Preferably, hematopoietic undifferentiated cells are isolated from the leukocyte population. Isolation of hematopoietic undifferentiated cells may be based on their binding to CD34 positive specific antibodies, followed by separation of antibody-bound stem cells using magnetic beads [Hardwick, R., et al. A. , Et al. , J .; Hematother. 1, 379-386 (1992)]. Isolated hematopoietic undifferentiated cells are placed in culture at a density range of 5,000 to 500,000 cells / ml, preferably 10,000 cells / ml. Any tissue culture flask or bag or hollow fiber module or filter module can be used in either a static or perfusion culture system [Koller, M. et al. R. , Et al. BIO / TECHNOLOGY, 11, 358-363, Emerson, S .; G, et al. PCT WO92 / 11355]. If a static culture system is used, the cells are fed with media at intervals of 5-7 days to replenish nutrients and remove waste products. The cells are cultured for 7-14 days, more preferably 9-12 days. At this time, the cell suspension contains a population of megakaryocyte progenitor cells suitable for use in the treatment of thrombocytopenia.

  Flow cytometer analysis was performed to determine cell phenotype based on labeling with cell surface antigens. CD34 positive cells indicate hematopoietic undifferentiated cells, and CD61 (integrin β3) positive cells indicate megakaryocyte cells [CD classification handbook, Cancer and Chemotherapy Co., Ltd.]. According to the analysis by a flow cytometer, mature megakaryocytes exhibit an increase in cytoplasm and multinucleation, so that the maturity can be easily analyzed. The main trait of hematopoietic undifferentiated cells is CD34 positive CD61 negative. By treating the hematopoietic undifferentiated cells according to the present invention, differentiation into CD34-positive CD61-positive megakaryocyte progenitor cells can be efficiently promoted, and CD34-negative CD61-positive immature megakaryocyte cells can be amplified. Differentiation into megakaryocyte progenitor cells is promoted by FLT3 ligand and megakaryocyte growth factor, and proliferation of the megakaryocyte progenitor cells is promoted by stem cell factor and megakaryocyte growth factor, so that immature megakaryocytes are amplified.

  The cell suspension produced according to the present invention contains various blood cell progenitor cells, megakaryocyte progenitor cells, immature megakaryocytes, and is necessary by further culturing with various hematopoietic factors. Differentiation into megakaryocyte cells is promoted.

  The concentrated cell suspension of megakaryocyte progenitor cells of the present invention allows for effective treatment of various types of thrombocytopenia in addition to those produced by cancer treatment. For this reason, the cell suspension given here also suggests the possibility of replacing platelet infusion in the treatment of thrombocytopenia. When the above cell population is administered to a patient after chemotherapy or the like, the administered cells are expected to further differentiate in vivo to produce megakaryocytes that ultimately produce platelets. Is done. Furthermore, when placed in a fibrin clot assay, the megakaryocyte progenitor cells are observed to form mature megakaryocytes and release platelets. The results from these assays suggest that cells from the serum-free culture can be further matured after they have been attributed to in vivo conditions.

  As used herein, “CD antigen” means a phenotype of a differentiation antigen present on the surface of a mammalian cell, preferably on a human blood cell. This type of antigen is usually classified with a CD number. CD is an abbreviation for cluster of differentiation, which means a cluster of antigens recognized by a monoclonal antibody. Specific examples include CD34, CD4, CD8, CD10, CD13, CD19, CD33, CD38 and the like. Other examples include Thy-1, HLA-DR, and the like.

  In the present specification, “cytokine” is a protein factor that is released from cells and mediates cell-cell interactions, and has an action of controlling immune response, antitumor action, antiviral action, regulating action of cell proliferation / differentiation, etc. Specifically, interleukin-1 (IL-1), interleukin-2 (IL-2), interleukin-3 (IL-3), interleukin-4 (IL-4), Interleukin-5 (IL-5), interleukin-6 (IL-6), interleukin-7 (IL-7), interleukin-8 (IL-8), interleukin-9 (IL-9), Interleukin-10 (IL-10), interleukin-11 (IL-11), interleukin-12 (IL-12), interleukin-13 (IL-13), a Turleukin-14 (IL-14), interleukin-15 (IL-15), interleukin-16 (IL-16), interferon α (IFN-α), interferon β (IFN-β), interferon γ (IFN- γ), granulocyte colony stimulating factor (G-CSF), granulocyte-monocyte colony stimulating factor (GM-CSF), monocyte colony stimulating factor, granulocyte-macrophage colony stimulating factor, eosinophil colony stimulating factor, platelets Examples include colony stimulating factor, stem cell factor (SCF), stem cell growth factor, flk2 / flt3-ligand, leukemia inhibitory (blocking) factor, erythropoietin (EPO), macrophage-derived inflammatory protein 1α (MIP-1α), and preferably Interleukin-3, stem cell factor (SCF), granulocyte colony stimulating factor Granulocyte - macrophage colony stimulating factor, flk2 / flt3 ligand, and the like MIP-l [alpha] or erythropoietin.

Cytokines that can be used as hematopoietic factors used herein include granulocyte macrophage colony stimulating factor (GM-CSF), granulocyte colony stimulating factor (G-CSF), interleukin 1 (IL-1), interleukin 1 Examples include leukin 3 (IL-3), interleukin 6 (IL-6), megakaryocyte growth factor, erythropoietin (EPO), FLT3 ligand, stem cell factor (SCF), and GM-CSF / IL-3 binding protein. Megakaryocyte growth factor is known as thrombopoietin (TPO) and has been reported as a factor for proliferating megakaryocytes in vivo [Wendling, F. et al. , Et. al. , Nature, 369, 571 (1994), Masataka Teramura, Annual Review Blood, (1996)]. The megakaryocyte growth factor is commercially available from Pepro Tech (USA). The FLT3 ligand is the same molecule as the FLK2 ligand, and its gene has been cloned and its action on hematopoietic undifferentiated cells has been reported [Lyman, S .; D. , Blood, 83, 2795 (1994), Atsushi Iwama, Annual Review Blood, 12-32 (1995)). Stem cell factor was reported by Zsebo et al. (Cell, 63, 195-201 (1990)) as a Stem Cell Factor (SCF). This molecule includes KL (Huan, E., Cell 63, 225-233), which is a ligand of tyrosine kinase c-kit, and mast cell growth factor (MGF) (Williams, DE, Cell, 63, 167-174 (1990)] and reported to have an effect on hematopoietic undifferentiated cells [Shizaka, Experimental Medicine, “Cytokine and Information Transmission”, 185, (1992)]. In general, it can be used at 1 ng / ml to 1 μg / ml, but preferably 10 to 100 ng / ml.
In particular, in the culture of hematopoietic stem cells, it is preferable to add and use SCF, FL, TPO, and IL-6 to suppress differentiation to the maximum and promote self-proliferation. The addition amount at that time is preferably 1 to 20 ng / ml for SCF, FL and TPO, and preferably 50 to 200 ng / ml for IL-6.

  In the present invention, other components can be further contained. Although there is no restriction | limiting in particular as such a component, For example, soluble cytokine receptor protein is mentioned. The soluble cytokine receptor protein acts to enhance the maintenance of undifferentiation on cultured hematopoietic stem cells.

  Specifically, it is preferable to use a soluble IL-6 receptor (sIL-6R) as such a soluble cytokine receptor protein. In that case, it is preferable that the addition amount to a culture medium is 100-1000 ng / ml. Such a soluble IL-6 receptor (sIL-6R) is preferably used together with the aforementioned cytokines SCF, FL, TPO, and IL-6. This is because IL-6 and sIL-6R form a complex, and these enhance the action of maintaining the undifferentiation of hematopoietic stem cells by SCF, FL, and TPO.

  As used herein, “cell line” refers to all cultured cells after the primary culture, and means a series of lines from cells or groups of cells present in the primary culture. The cultured cells may coexist with the primary cells, may exist in contact with each other, or may exist via mediators such as liquids such as water and electrolytes, media, and culture solutions. May be.

  Hematopoietic stem cells differentiate to become hematopoietic progenitor cells, and further differentiate to become the aforementioned differentiated cells. Both hematopoietic stem cells and hematopoietic progenitor cells are pluripotent, but differentiated cells do not have pluripotency. Originally, hematopoietic stem cells and hematopoietic progenitor cells should be distinguished, but they may be conceptual definitions and are often used without distinction. Also in the present invention, both hematopoietic stem cells and hematopoietic progenitor cells are collectively referred to as “hematopoietic stem cells”. The definition of terms is described in detail in, for example, “Blood stem cell fate (Yodosha) written by Toshio Suda”.

  In the present specification, the “CD34 positive cell” means a cell expressing CD34, which is one of the antigen phenotypes, specifically, pluripotent hematopoietic stem cells, hematopoietic stem cells such as HPP-CFC, lymph Stem cells such as spherical stem cells and myeloid stem cells, progenitor cells such as T precursor cells, B precursor cells, BFU-E, CFU-E, CFU-MEG, EO-CFC, and CFU-GM fall under this category.

  In the present specification, “strongly CD34 positive cell” means a cell that particularly strongly expresses one of the antigen phenotypes, CD34, specifically, a high-proliferative potential colony forming cell (High-Proliferative Potentialial cell). It means Colony-Forming Cells (HPP-CFC)) or pluripotent hematopoietic stem cells themselves or a group of CD34 positive cells containing more of these cells.

In the present specification, “CD34-negative cells” mean functional cells that do not express one of the antigen phenotypes, specifically, T cell lineage cells after T precursor cells including T cells. B cell lineage cells after B precursor cells including B cells, red cell lineage cells after CFU-E containing red blood cells, platelet lineage cells after CFC-MEG containing platelets, EO-CFC containing eosinophils Subsequent eosinophil series cells or monocyte, neutrophil or basophil series cells after CFU-GM containing monocytes, neutrophils or basophils. As used herein, the terms “positive”, “strongly positive”, “weakly positive”, and “negative” as used above are sometimes referred to as simply “+” (plus), “high +”, “high”, “ "low" and "-" (minus). For example, “CD34 ^{high +} CD38 ^{low / −} ” means that CD34 is strongly expressed (strongly positive) and CD38 is weakly expressed or not expressed (weakly positive or negative).

  As used herein, the term “stromal cell” refers to a matrix cell or stromal cell derived from bone marrow, spleen, etc. In the present invention, any stromal cell having the ability to proliferate human CD34 positive cells can be used. Such stromal cells can also be used. For example, HESS-1, HESS-5 (international deposit number: FERM BP-5768), HESS-18 (international deposit number: FERM BP-6187), HESS-M28 (international deposit number: FERM BP-6186), SSXL CL . 1, SSXL CL3, SSXL CL. 7, SSXL CL. 9 and SSXL CL. Examples are mouse-derived stromal cells each designated 17. Preferably, HESS-5 (international deposit number: FERM BP-5768), HESS-18 (international deposit number: FERM BP-6187), HESS-M28 (international deposit number: FERM BP-6186), or SSXL CL3. Particularly preferred are HESS-5 (international deposit number: FERM BP-5768), HESS-18 (international deposit number: FERM BP-6187), and HESS-M28 (international deposit number: FERM BP-6186).

  It is known that hematopoietic stem cells are mainly present in the bone marrow, and bone marrow transplantation is a disease such as neoplastic blood diseases such as acute leukemia, severe immunodeficiency, adenosine deaminase deficiency, and aplastic anemia. It occupies a central position as a treatment for the disease. In recent years, it has been clarified that hematopoietic stem cells are also present in peripheral blood in a small amount. Therefore, transplantation using peripheral blood containing hematopoietic stem cells administered with granulocyte colony stimulating factor preparation (G-CSF) is also becoming popular (new hematopoietic stem cell transplantation, Nankodo, 1998). In this method, bone marrow transplantation requires a large amount of bone marrow cells, so the burden on the mind and body of the donor is large. On the other hand, the burden on the mind and body is reduced for the donor and the recovery of white blood cells and platelets is fast. There are advantages. However, since side effects due to relatively high doses of G-CSF are often seen, it is simpler than bone marrow collection, but it cannot be said that donor safety is high (Cytokines Cell. Mol. Ther., 3, 101-104, 1997).

  Recently, it has been clarified that umbilical cord blood contains hematopoietic stem cells similar to bone marrow, and it has been proved that it is useful for transplantation therapy (N. Engl. J. Med., 321, 1174-1178, 1989). ). Umbilical cord blood has a lower incidence of severe acute graft-versus-host disease (GVHD) than bone marrow and peripheral blood, and its usefulness is expected. However, in the case of umbilical cord blood, the problem is that the amount of collected blood is small, and the amount of umbilical cord blood derived from one individual can be transplanted only to recipients up to about 40 kg in weight. (Blood, 87, 3082, 1996).

  As used herein, hematopoietic stem cells can be enriched as a CD34 positive cell population. Moreover, unnecessary cells, specifically, lymphoid cells that do not differentiate into myeloid cells may be removed (Hematol. Oncol. Ann., 2, 78, 1994). CD34 positive cell transplantation has been performed (Blood, 77, 1717, 1991; J. Clin. Oncol., 12, 28, 1994). For this reason, attempts to efficiently amplify hematopoietic stem cells in vitro have been actively carried out in recent years in order to solve the problem that the amount of cord blood containing a large amount of hematopoietic stem cells is small as described above (Blood, 87, 3082-3088, 1996). Here, the amplification of hematopoietic stem cells is used in the meaning including both differentiation and proliferation of differentiated cells having no pluripotency and differentiation of hematopoietic stem cells and self-proliferation of hematopoietic stem cells.

  In the present specification, cytokines have been used as substances that promote proliferation in the amplification of CD34 positive cells reported so far. Cytokine candidates include stem cell factor (SCF), thrombopoietin (TPO), erythropoietin (EPO), flk2 / flt3 ligand (FL), interleukin 1 (IL-1β), IL-3, IL-6, IL-11, Various types such as granulocyte / macrophage colony forming factor (GM-CSF), granulocyte colony forming factor (G-CSF), macrophage colony forming factor (M-CSF), IL-3 / GM-CSF fusion protein (PIXY321), etc. Amplification methods combining cytokines have been studied. However, when CD34 positive cells are amplified by a combination of cytokines, the number of whole blood cells after culture increases, but differentiation of hematopoietic stem cells is induced during the culture, resulting in an increase in the number of terminally differentiated CD34 negative blood cells. On the other hand, it is considered that CD34 positive cells themselves are almost depleted (Blood, 87, 3082-3088, 1996). At present, no cytokine has been isolated that can promote self-proliferation while maintaining hematopoietic stem cells in an undifferentiated state.

  As another method for amplifying CD34-positive cells that can be used in the present invention, a method has been attempted in which human bone marrow-derived stromal cells are established and then hematopoietic stem cells / progenitor cells are maintained and proliferated (Exp. Hematol). , 22, 482-487 (1994)). JP-A-10-295369 discloses a method for producing CD34-positive hematopoietic stem cells by co-culturing stromal cells derived from mammals and CD34-positive cells. However, in this method, since the CD34 positive cells are differentiated, the hematopoietic stem cells themselves are hardly amplified or rather decreased from the initial time point. Therefore, even after transplantation, blood cells may eventually be depleted, which is inappropriate as a technique for transplantation.

  As yet another method that can be used in the present invention, CD34-positive cells can be cultured only with humoral factors produced from stromal cells, even without contact between cultivated CD34-positive cells and stromal cells. There is also a report that positive cells can be amplified (International Patent Publication No. 93/20184). However, even in this method, hematopoietic stem cells only differentiate and do not self-proliferate, and are therefore incompatible as a technique for transplantation for the same reason as described above.

In yet another aspect, the present invention is a cell culture kit, comprising any of the aforementioned cell culture equipment, a nutrient medium, and a cytokine, wherein a human-derived CD34-positive cell is a mammal-derived dead stroma. It is used for culturing with cells.
As the cytokine, SCF, FL, TPO, and IL-6 are preferably used, and in addition to this, a soluble IL-6 receptor (sIL-6R) that is a soluble cytokine receptor protein is further preferably added. As the nutrient medium, a nutrient medium necessary for culturing cells can be used.

  As used herein, “medium” or “nutrient medium” includes natural medium, semi-synthetic medium, synthetic medium, solid medium, semi-solid medium, liquid medium, etc., and CD34 positive as defined above Any medium can be used as long as it is used for cell proliferation, differentiation, maturation or preservation including self, and is usually used for cell culture. For example, an α-MEM medium, RPMI-1640 medium, MEM basic medium, or the like can be given. As basic components, sodium, potassium, calcium, magnesium, phosphorus, chlorine, amino acids, vitamins, hormones, antibiotics, fatty acids, sugars, or other chemical components or biological components such as serum may be contained depending on the purpose.

  The culture vessel that can be used in the present invention may be of any material and shape as long as it can maintain and survive the desired cells and does not inhibit differentiation, maturation, or self-replication in response to a stimulus. . Specifically, the material of the culture vessel includes glass, synthetic resin, natural resin, metal, plastic, and the shape is specifically a polygonal prism such as a triangular prism, a cube, a rectangular parallelepiped, a triangular pyramid, a quadrangular pyramid, etc. Polygonal pyramids, arbitrary shapes such as gourds, spheres, hemispheres, cylinders (including a round bottom, ellipse or semicircle) etc. can be mentioned, and for example during culturing from hemisphere to sphere The shape may be changed as necessary. Cultivation may be under open conditions or under closed (sealed) conditions.

  As such a nutrient medium, any nutrient medium may be used as long as it can be used for cell culture. A culture medium, a liquid culture medium, etc. are mentioned. Specific examples include α-MEM medium, RPMI-1640 medium, and MEM basic medium.

  In culturing, physical environmental conditions such as temperature, osmotic pressure, and light, and chemical environmental conditions such as oxygen, carbon dioxide, pH, and oxidation-reduction potential can maintain and survive stromal cells before killing treatment. CD34 positive cells Any environmental condition may be used as long as it does not inhibit maintenance, survival, differentiation, maturation, or self-replication. Preferred conditions are shown below.

  Specifically, the temperature is 30 ° C. to 40 ° C., preferably 37 ° C. The osmotic pressure is specifically an osmotic pressure under physiological conditions, and preferably an osmotic pressure equal to that of physiological saline.

  The light may be as dark as a dark room, or as bright as the brightness outside in sunny weather.

  Specifically, as for the oxygen concentration, the culture system is in contact with the gas phase having the oxygen concentration in the gas phase is in contact with the gas phase having the oxygen concentration in the gas phase is 10%. The oxygen concentration may be the oxygen concentration in the state of being dissolved, and preferably the oxygen in the state of being in contact with the gas phase of the dissolved oxygen concentration in the state of being in contact with the gas phase having an oxygen concentration in the gas phase of 20% Concentration.

  Specifically, the pH for controlling the pH in the culture system is specifically pH 6.0 to pH 8.0, and preferably the pH equivalent to physiological conditions. Carbon dioxide may be used to control the pH, or any other buffer may be used. Specifically, the concentration of carbon dioxide is the concentration of dissolved carbon dioxide in a state where the culture system is in contact with the 5% gas phase.

(Lnk)
In the present specification, Lnk refers to a protein that binds to the kinase domain of the SCF receptor c-Kit. The molecular mechanism of B cell overproduction caused by Lnk deficiency has been elucidated, and it has been clarified that Lnk is deeply involved in hematopoietic stem cell proliferation and control of its function, but it is not clear whether it is involved in platelet production. There wasn't.

As such Lnk gene, for example,
(A) (a) a polynucleotide having the base sequence set forth in SEQ ID NO: 1 or a fragment sequence thereof;
(B) a polynucleotide encoding a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 2 or a fragment thereof;
(C) a variant polypeptide having at least one mutation selected from the group consisting of substitution, addition and deletion in the amino acid sequence of SEQ ID NO: 2, wherein the biological activity A polynucleotide encoding a variant polypeptide having:
(D) a polynucleotide which is a splice variant or allelic variant of the base sequence set forth in SEQ ID NO: 1;
(E) a polynucleotide encoding a species homologue of the polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 2;
(F) a polynucleotide that hybridizes to any one of the polynucleotides of (a) to (e) under a stringent condition and encodes a polypeptide having biological activity; or (g) (a) to A polynucleotide comprising a nucleotide sequence having at least 70% identity to any one polynucleotide of (e) or a complementary sequence thereof and encoding a polypeptide having biological activity;
including,
A nucleic acid molecule; or (B) (a) a polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 2 or a fragment thereof;
(B) a polypeptide having at least one mutation selected from the group consisting of substitution, addition and deletion in the amino acid sequence of SEQ ID NO: 2 and having biological activity ;
(C) a polypeptide encoded by a splice variant or allelic variant of the base sequence set forth in SEQ ID NO: 1;
(D) a polypeptide that is a species homologue of the amino acid sequence set forth in SEQ ID NO: 2; or (e) an amino acid sequence that is at least 70% identical to any one polypeptide of (a)-(d) And a polypeptide having biological activity,
including,
Examples include, but are not limited to, a nucleic acid molecule that encodes a polypeptide, or a polypeptide that it encodes.

Mouse Lnk
Nucleotide sequence
(SEQ ID NO: 1)
Amino acid sequence
(SEQ ID NO: 2).

  The analysis is focused on Lnk, which is also an adapter protein expressed in lymphoid tissue, and its family proteins (Medical Institute Now, vol. 17, P4-5, 1991). Lnk is an adapter protein having an SH2 domain expressed mainly in lymphoid tissues. Although there is no abnormality in T cell differentiation in Lnk-deficient mice, accumulation of immature B cells in the spleen and overproduction of bone marrow B precursor cells due to increased SCF reactivity are observed, and Lnk regulates B cell production I understood it. It has also been clarified that Lnk is a 68 kDa protein having a PH domain (Immunity 13: 599, 2000). Lnk is considered to be a member of the adapter protein family that acts as a signal transduction inhibitory molecule.

  It was shown that Lnk controls the c-Kit signal transduction system and has an important role in maintaining homeostasis of B cell production, and that the growth signal via c-kit is enhanced in Lnk-deficient mice. Overexpression of the Lnk gene causes not only progenitor B cells but also suppression of proliferation and differentiation of B cell lineages and suppression of T cell differentiation (J. Immunol. 162: 2850, 2003). Lnk is also expressed in hematopoietic progenitor cells, and its deficiency significantly increases the proliferation and hematopoietic ability of hematopoietic progenitor cells (J Exp Med. 195: 151, 2002). Lnk suppresses phosphorylation of Gab2 and activation of MAPK by c-Kit activation. These findings are expected to contribute greatly to understanding the mechanism of proliferation and differentiation of hematopoietic progenitor cells and developing control methods. Recently, it was found that the ratio of hematopoietic stem cells was significantly increased in Lnk-deficient mice, and therefore the research impact of Lnk that negatively regulates the proliferation of hematopoietic stem cells is thought to greatly expand. A mutant that inhibits the action of Lnk has also been successfully produced, and the possibility that it can be applied to control the function of hematopoietic stem cells by blocking the Lnk function has been shown (FIG. 12).

  In APS gene-deficient mice belonging to the Lnk family adapter protein, abnormalities different from those of Lnk have been observed in lymphocytes and granulocytes (unpublished). Although SH2-B-deficient mice have no abnormality in lymphocyte differentiation, abnormalities in germ cell differentiation have been observed (Mol Cell Biol. 22: 3066, 2002). Thus, the study of the Lnk family adapter protein is useful for elucidating a new mechanism for studying the development and proliferation control of stem cells and progenitor B cells.

  As used herein, “inhibition by the product level of Lnk” means that the function exerted by a decrease in the activity or amount of a protein that is the gene product of Lnk or a post-translational modification thereof (eg, glycoprotein) is reduced. Or it means disappearing. Such inhibition also includes expression of non-functional variants replacing natural products. Alternatively, such inhibition can be achieved by inhibition of Lnk with an antibody.

  As used herein, the “factor” may be any substance or other element (for example, energy such as light, radioactivity, heat, and electricity) as long as the intended purpose can be achieved. Such substances include, for example, proteins, polypeptides, oligopeptides, peptides, polynucleotides, oligonucleotides, nucleotides, nucleic acids (eg, DNA such as cDNA, genomic DNA, RNA such as mRNA), poly Saccharides, oligosaccharides, lipids, small organic molecules (for example, hormones, ligands, signaling substances, small organic molecules, molecules synthesized by combinatorial chemistry, small molecules that can be used as pharmaceuticals (for example, small molecule ligands, etc.)) , These complex molecules, but not limited to. As a factor specific to a polynucleotide, typically, a polynucleotide having a certain sequence homology to the sequence of the polynucleotide (for example, 70% or more sequence identity) and a complementarity, Examples include, but are not limited to, a polypeptide such as a transcription factor that binds to the promoter region. Factors specific for a polypeptide typically include an antibody specifically directed against the polypeptide or a derivative or analog thereof (eg, a single chain antibody), and the polypeptide is a receptor. Alternatively, specific ligands or receptors in the case of ligands, and substrates thereof when the polypeptide is an enzyme include, but are not limited to.

  As used herein, “inhibitor of Lnk family member” refers to any factor capable of inhibiting any member of the Lnk family. Such factors include, for example, a variant that loses the original function of any member of the Lnk family, forms a complex with the natural product and inhibits the action of the natural product, an antibody against Lnk, and Lnk Examples include proteins, polypeptides, oligopeptides, peptides, polynucleotides, oligonucleotides, nucleotides, nucleic acids, polysaccharides, oligosaccharides, lipids, small organic molecules, and complex molecules thereof. In addition, proteins, polypeptides, oligopeptides, peptides, polynucleotides, oligonucleotides, nucleotides, nucleic acids, polysaccharides, oligosaccharides, lipids, small organic molecules, and complex molecules thereof that inhibit gene expression of any member of the Lnk family Can be mentioned.

  Whether it is a Lnk inhibitor can be confirmed by the following test method. Lnk is overexpressed by gene transfer into a cell line that grows in an SCF-dependent manner. It is expressed or acted on a transgenic cell line that is no longer capable of SCF-dependent growth due to overexpression of Lnk, and its action as a Lnk inhibitor is confirmed using recovery of SCF-dependent growth as an index. Instead of cell lines that grow in an SCF-dependent manner, cell lines that grow in a TPO-dependent manner and cell lines that grow in an EPO-dependent manner can also be used.

  Whether or not the expression of Lnk is reduced is caused to act on ES cells that endogenously express Lnk, and whether or not the expression of Lnk is reduced is examined by Western blotting.

  Whether it affects the intracellular localization is examined by observing the intracellular localization of Lnk with a fluorescence microscope by allowing it to act on a fibroblast cell line in which a fluorescent protein and a chimeric protein of Lnk are expressed by gene transfer. .

  In the present specification, “stem cell factor (SCF)” (also referred to as “stem cell factor” or “steel factor”; SCF) is a factor attracting attention in hematopoietic stem cells. A representative example of SCF has the sequence shown by SEQ ID NO: 5 (nucleic acid sequence) and SEQ ID NO: 6 (amino acid sequence).

  SCF is produced by bone marrow stromal cells and acts on pluripotent stem cells, myeloid cells such as CFU-GM and CFU-Meg of CFU-GM, and lymphoid stem cells to support their differentiation. That is, it acts on the differentiation stage cells of almost all lineages from hematopoietic stem cells to differentiated cells, and helps to induce differentiation to the final differentiation stage by other cytokines (S. Kitamura, cytokines). Forefront, Yodosha, edited by T. Hirano, pages 174-187, 2000). However, the action of SCF alone is weak and does not seem to work well without cooperating with other factors. For example, SCF strongly induces differentiation and proliferation of hematopoietic stem cells in the presence of other cytokines such as interleukin (IL) -3, IL-6, IL-11, granulocyte colony stimulating factor (G-CSF). To do. It also induces differentiation and proliferation of mast cells, erythroid progenitor cells, granulocyte macrophage progenitor cells, megakaryocyte progenitor cells and the like.

  Therefore, SCF can be positioned as enhancing the reactivity to various cytokines while supporting the survival of many types of hematopoietic cells rather than controlling differentiation itself.

(Genetic engineering)
Lnk and the like and fragments and variants thereof used in the present invention can be produced and introduced using genetic engineering techniques.

  In the present specification, when referring to a gene, a “vector” refers to one that can transfer a target polynucleotide sequence into a target cell. Such a vector can be autonomously replicated in a host cell such as an individual animal or can be integrated into a chromosome and contains a promoter at a position suitable for transcription of the polynucleotide of the present invention. Are illustrated. As used herein, a vector can be a plasmid.

  As used herein, “virus vector” refers to a vector derived from a virus. As used herein, the term “virus” refers to an infectious microstructure that has either DNA or RNA as a genome and that grows only in infected cells. Viruses include retroviridae, togaviridae, coronaviridae, flaviviridae, paramyxoviridae, orthomyxoviridae, bunyaviridae, rhabdoviridae, poxviridae, herpesviridae, baculoviridae and hepa A virus belonging to a family selected from the group consisting of the family Donnaviridae. As used herein, “retrovirus” refers to a virus having genetic information in the form of RNA and synthesizing DNA from the RNA information by reverse transcriptase.

  As used herein, “retroviral vector” refers to a form in which a retrovirus is used as a gene carrier (vector). Examples of the “retroviral vector” used in the present invention include, but are not limited to, a retroviral expression vector based on Moloney Murine Leukemia Virus (MMLV), Murine Stem Cell Virus (MSCV), and the like. Preferably, retroviral vectors include, but are not limited to, pGen-, pMSCV, and the like.

  As used herein, “expression vector” refers to a nucleic acid sequence in which various regulatory elements are operably linked in a host cell in addition to a structural gene and a promoter that regulates its expression. Regulatory elements can preferably include terminators, selectable markers such as drug resistance genes, and enhancers. It is well known to those skilled in the art that the type of expression vector of an organism (eg, animal) and the type of regulatory elements used can vary depending on the host cell. In the case of humans, the expression vector used in the present invention may further contain pCAGGS (Niwa H et al, Gene; 108: 193-9 (1991)).

  The present invention can be utilized in any animal. Techniques for use in such animals are well known and routinely used in the art, for example, see Ausubel F. et al. A. (1988), Current Protocols in Molecular Biology, Wiley, New York, NY; Sambrook J et al. (1987) Molecular Cloning: A Laboratory Manual, 2nd Ed. , Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, a separate volume of experimental medicine “Gene Transfer & Expression Analysis Experimental Method” Yodosha, 1997, and the like.

  As used herein, “transformant” refers to all or part of a living organism such as a cell produced by transformation. Examples of the transformant include animal cells. A transformant is also referred to as a transformed cell, transformed tissue, transformed host, etc., depending on the subject, and encompasses all of these forms herein, but may refer to a particular form in a particular context. .

(screening)
As used herein, “screening” refers to selecting a target such as a target organism or substance having a specific property from a large number of populations by a specific operation / evaluation method. For screening, agents (eg, antibodies), polypeptides or nucleic acid molecules of the invention can be used. For the screening, a system using an actual substance such as in vitro or in vivo may be used, or a library generated using an in silico (computer system) system may be used. In the present invention, it is understood that compounds obtained by screening having a desired activity are also encompassed within the scope of the present invention. The present invention also contemplates providing a computer modeling drug based on the disclosure of the present invention.

  Such screening or identification methods are well known in the art, and for example, such screening or identification can be performed using a biomolecule array or chip such as a microtiter plate, DNA or protein. Examples of the subject containing the screening test factor include, but are not limited to, a gene library and a compound library synthesized with a combinatorial library.

  Thus, in a preferred embodiment, the present invention provides a method of identifying a modulator of a disease or disorder. Such a regulator can be used as a drug for each disease or a lead compound thereof. Such modulators as well as medicaments containing the modulators and therapies utilizing them are also intended to be within the scope of the present invention.

  Therefore, in the present invention, it is also intended that a drug by computer modeling is provided based on the disclosure of the present invention.

  The present invention, in other embodiments, is obtained using computational quantitative structure activity relationship (QSAR) modeling techniques as a tool for screening efficacy for modulatory activity for compounds of the present invention. The compound is included. Here, the computer technology includes creation of a substrate template, a pharmacophore, and a homology model of the active site of the present invention created by several computers. In general, from data obtained in vitro, methods for modeling the normal characteristic groups of an interactant for a substance have recently been described by the CATALYST ™ pharmacophore method (Ekins et al., Pharmacogenetics, 9: 477-489, Ekins et al., J. Pharmacol. & Exp. Ther., 288: 21-29, 1999; Ekins et al., J. Pharmacol. & Exp. Ther., 290: 429-438, 1999; al., J. Pharmacol. & Exp.Ther., 291: 424-433, 1999) and comparative molecular field analysis; A) (Jones et al, Drug Metabolism & Disposition, 24:. 1~6,1996) are shown using, for example. In the present invention, computer modeling can be performed using molecular modeling software such as CATALYSTTM version 4 (Molecular Simulations, Inc., San Diego, CA).

  Fitting a compound to the active site can be done using any of a variety of computer modeling techniques known in the art. Visual inspection and manual manipulation of compounds to the active site are described in QUANTA (Molecular Simulations, Burlington, Mass., 1992), SYBYL (Molecular Modeling Software, Tripos Associates, Inc., St. AM, St. Louis, MO, 1992). et al., J. Am. Chem. Soc., 106: 765-784, 1984), CHARMM (Brooks et al., J. Comp. Chem., 4: 187-217, 1983), etc. Can be done using. In addition, energy can be minimized using standard force fields such as CHARMM, AMBER, and the like. Other more specialized computer modeling are GRID (Goodford et al., J. Med. Chem., 28: 849-857, 1985), MCSS (Miranker and Karplus, Function and Genetics, 11: 29-34, 1991), AUTODOCK (Goodsell and Olsen, Proteins: Structure, Function and Genetics, 8: 195-202, 1990), DOCK (Kuntz et al., J. Mol. Biol., 161: 269-288, (1982). ) Etc. Further structural compounds include LUDI (Bohm, J. Comp. Aid. Molec. Design, 6: 61-78, 1992), LEGEND (Nishibata and Itai), such as blank active sites, active sites in known low molecular weight compounds, and the like. , Tetrahedron, 47: 8985, 1991), LeapFrog (Tripos Associates, St. Louis, Mo.), etc. Such modeling is well known and commonly used in the art, and a person skilled in the art will appropriately design a compound that falls within the scope of the present invention (for example, a compound that imparts a desired calibration function) according to the disclosure of the present specification. be able to.

  Factors used by the screening methods of the present invention can be used to regulate, identify, enrich or proliferate platelet differentiation.

(Gene expression suppression)
In this specification, the dominant negative method means that, when expressed, it becomes a mutant phenotype (particularly, a suppression type of the original gene). For example, when a transcription factor whose function is converted to a repressing factor is used instead of a transcription factor, the expression of the target gene is suppressed in preference to the transcription factor having a function overlap, resulting in a dominant negative phenotype. By using a repression domain (for example, the amino acid sequence LDLELRLGFA) in the dominant negative technique, transcription of the target nucleic acid molecule can be suppressed. As the dominant negative method, a method as described in Examples can be used.

  In this specification, “RNAi (RNA interference)” means that mRNA is sequence-specifically degraded by double-stranded RNA (dsRNA), thereby inhibiting protein translation and suppressing gene expression. The phenomenon that is done. One advantage of RNAi is that various levels of expression suppression, from weak to strong, can be obtained by individual genes. Currently, RNAi is used as a simple and effective method for suppressing gene expression. In a preferred embodiment, “RNAi” suppresses synthesis of a gene product by specifically degrading homologous mRNA by introducing a factor that causes RNAi such as double-stranded RNA (also referred to as dsRNA) into a cell. Phenomenon and the technology used for it. As used herein, RNAi can also be used interchangeably with an agent that causes RNAi in some cases.

  As used herein, “factor that causes RNAi” refers to any factor that can cause RNAi. In the present specification, the “factor causing RNAi” with respect to “gene” means that RNAi related to the gene is caused and an effect brought about by RNAi (for example, suppression of expression of the gene) is achieved. Factors that cause such RNAi include, for example, at least 10 nucleotides, including sequences having at least about 70% homology to a portion of the nucleic acid sequence of the target gene or sequences that hybridize under stringent conditions Examples include, but are not limited to, RNAs containing long double-stranded portions or variants thereof. Here, the factor preferably comprises a 3 'overhang, more preferably the 3' overhang can be 2 or more nucleotides long DNA (eg 2 to 4 nucleotides long DNA).

  Without being bound by theory, one of the possible mechanisms for RNAi to work is that when a molecule that causes RNAi, such as dsRNA, is introduced into a cell, a relatively long (eg, 40 base pairs or more) RNA, helicase In the presence of ATP, an RNaseIII-like nuclease called Dicer having a domain excises the molecule from the 3 ′ end by about 20 base pairs to produce a short dsRNA (also called siRNA). As used herein, “siRNA” is an abbreviation for short interfering RNA, which is artificially chemically synthesized, biochemically synthesized, synthesized in an organism, or about 40 This refers to short double-stranded RNA of 10 base pairs or more formed by decomposing double-stranded RNA of bases or more in the body, and usually has a 5′-phosphate, 3′-OH structure. 'The end protrudes about 2 bases. A protein specific to the siRNA binds to form RISC (RNA-induced-silencing-complex). This complex recognizes and binds to mRNA having the same sequence as siRNA, and cleaves mRNA at the center of siRNA by RNaseIII-like enzyme activity. The relationship between the siRNA sequence and the mRNA sequence cleaved as a target is preferably 100% identical. However, with respect to the base mutation at a position off the center of siRNA, the cleavage activity by RNAi is not completely lost, but a partial activity remains. On the other hand, the mutation of the base at the center of siRNA has a large effect, and the cleavage activity of mRNA by RNAi is extremely reduced. Utilizing such properties, for mRNA having a mutation, only siRNA having the mutation can be specifically decomposed by synthesizing siRNA having the mutation in the center and introducing it into the cell. Therefore, in the present invention, siRNA itself can be used as a factor that causes RNAi, and a factor that generates siRNA (for example, a dsRNA typically having about 40 bases or more) can be used as such a factor. .

  Moreover, although not wishing to be bound by theory, siRNA is synthesized separately from the above pathway, and the antisense strand of siRNA binds to mRNA and acts as a primer for RNA-dependent RNA polymerase (RdRP). It is also contemplated that this dsRNA becomes Dicer's substrate again, generating new siRNA and amplifying the action. Thus, in the present invention, siRNA itself and factors that produce siRNA are also useful. In fact, in insects and the like, for example, 35 dsRNA molecules almost completely degrade the mRNA in a cell having 1,000 copies or more, so it is understood that siRNA itself and factors that generate siRNA are useful. Is done.

  In the present invention, double-stranded RNA having a length of about 20 bases (for example, typically about 21 to 23 bases in length) or less than that called siRNA can be used. Such siRNA suppresses gene expression by expressing in a cell and suppresses expression of a pathogenic gene targeted by the siRNA, so that diseases (for example, all bleeding disorders associated with thrombocytopenia (eg, anti-cancer) It can be used for the treatment, prevention, prognosis, etc. of thrombocytopenia during drug treatment, essential thrombocytopenia, etc.)).

  The siRNA used in the present invention may take any form as long as it can cause RNAi.

  In another embodiment, the factor causing RNAi of the present invention may be a short hairpin structure (shRNA; short hairpin RNA) having an overhang at the 3 'end. As used herein, “shRNA” is a single-stranded RNA that includes a partially palindromic base sequence, and thus has a double-stranded structure within the molecule, resulting in a hairpin-like structure. The above molecules. Such shRNA is artificially chemically synthesized. Alternatively, such shRNA can be generated by synthesizing RNA in vitro using T7 RNA polymerase with hairpin structure DNA in which the DNA sequences of the sense strand and antisense strand are ligated in the opposite direction. Although not wishing to be bound by theory, such shRNAs are approximately 20 bases in length (typically 21 bases, 22 bases, 23 bases, etc.) in length after being introduced into the cell. It should be understood that it is degraded to cause RNAi as well as siRNA and has the therapeutic effect of the present invention. It should be understood that such effects are exerted in a wide range of organisms such as insects, plants, animals (including mammals). Thus, since shRNA causes RNAi similarly to siRNA, it can be used as an active ingredient of the present invention. The shRNA can also preferably have a 3 'overhang. The length of the double-stranded part is not particularly limited, but may preferably be about 10 nucleotides or more, more preferably about 20 nucleotides or more. Here, the 3 'protruding end may be preferably DNA, more preferably DNA having a length of at least 2 nucleotides, and further preferably DNA having a length of 2 to 4 nucleotides.

  The factor causing RNAi used in the present invention can be either artificially synthesized (for example, chemical or biochemical) or naturally occurring, and the effect of the present invention can be achieved between the two. There is no essential difference. Those chemically synthesized are preferably purified by liquid chromatography or the like.

  The factor that causes RNAi used in the present invention can also be synthesized in vitro. In this synthesis system, antisense and sense RNAs are synthesized from template DNA using T7 RNA polymerase and T7 promoter. When these are annealed in vitro and then introduced into cells, RNAi is caused through the mechanism described above, and the effects of the present invention are achieved. Here, for example, such RNA can be introduced into cells by the calcium phosphate method.

  Factors causing RNAi of the present invention also include factors such as single strands that can hybridize to mRNA, or all similar nucleic acid analogs thereof. Such factors are also useful in the treatment methods and compositions of the invention.

  As used herein, “antisense (activity)” refers to an activity capable of specifically suppressing or reducing the expression of a target gene. Antisense activity is usually achieved by a nucleic acid sequence of at least 8 contiguous nucleotides that is complementary to the nucleic acid sequence of the gene of interest. Such a nucleic acid sequence is preferably at least 9 contiguous nucleotides long, more preferably 10 contiguous nucleotides long, even more preferably 11 contiguous nucleotides long, 12 contiguous nucleotides long, 13 Contiguous nucleotide length, 14 contiguous nucleotide lengths, 15 contiguous nucleotide lengths, 20 contiguous nucleotide lengths, 25 contiguous nucleotide lengths, 30 contiguous nucleotide lengths, 40 contiguous lengths It can be a nucleic acid sequence that is 50 contiguous nucleotides in length. Molecules having such nucleic acid sequences are referred to herein as “antisense molecules”, “antisense nucleic acid molecules” or “antisense nucleic acids” and are used interchangeably. Such nucleic acid sequences include nucleic acid sequences that are at least 70% homologous, more preferably at least 80% homologous, more preferably 90% homologous, most preferably 95% homologous to the sequences described above. included. Such antisense activity is preferably complementary to the 5 'terminal sequence of the nucleic acid sequence of the gene of interest. Such antisense nucleic acid sequences also include those having one, several or one or more nucleotide substitutions, additions and / or deletions relative to the sequences described above. Given the nucleic acid sequences disclosed herein (eg, SEQ ID NO: 1 or 3), antisense nucleic acids of the invention are designed according to the rules of Watson and Crick base pairing or Hoogsteen base pairing. obtain. The antisense nucleic acid molecule can be complementary to the entire coding region of the signaling factor mRNA, but more preferably is an oligonucleotide that is antisense to only a portion of the coding or non-coding region of the mRNA. . For example, the antisense oligonucleotide can be complementary to the region surrounding the translation start site of mRNA. Antisense oligonucleotides can be, for example, about 5, about 10, about 15, about 20, about 25, about 30, about 35, about 40, about 45, or about 50 nucleotides in length. The antisense nucleic acids of the invention can be constructed using chemical synthesis or enzymatic ligation reactions using procedures known in the art. For example, antisense nucleic acids (eg, antisense oligonucleotides) are naturally occurring nucleotides, or two that are formed between an antisense nucleic acid and a sense nucleic acid that increase the biological stability of the molecule. It can be chemically synthesized (eg, phosphorothioate derivatives and acridine substituted nucleotides can be used) using various modified nucleotides designed to increase the physical stability of the strand. Examples of modified nucleotides that can be used to generate antisense nucleic acids include 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5- (carboxyl Hydroxymethyl) uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, β-D-galactosyl queuosine, inosine, N6-isopentenyladenine, 1-methylguanine 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5-methylaminomethyluracil 5-methoxyaminomethyl-2-thiouracil, β-D-mannosylcuocin, 5′-methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-N6-isopentenyladenine, uracil-5-oxyacetic acid (v) , Butytoxine, pseudouracil, cuocin, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5-oxyacetic acid methyl ester, uracil-5-oxyacetic acid (V), 5-methyl-2-thiouracil, 3- (3-amino-3-N-2-carboxypropyl) uracil, (acp3) w, 2,6-diaminopurine, and the like. Not.

  As used herein, the term “promoter” refers to a region on DNA that determines the transcription start site of a gene and directly regulates its frequency, and is a base sequence that initiates transcription upon binding of RNA polymerase. The putative promoter region varies for each structural gene, but is usually upstream of the structural gene, but is not limited thereto, and may be downstream of the structural gene.

  The promoter may be inducible, constitutive, site specific, or time specific. Any promoter can be used as long as it can be expressed in host cells such as mammalian cells, E. coli, and yeast.

(Administration / Infusion / Medicine)
The cells (eg, stem cells, differentiated cells (eg, platelets)) or cell compositions prepared by the factors of the present invention can be provided in any form of formulation that is suitable for transfer to an organism. . Examples of such a pharmaceutical form include a liquid, an injection, and a sustained release agent. Examples of administration routes include oral administration, parenteral administration, and direct administration to the affected area.

  Injections can be prepared by methods well known in the art. For example, after dissolving in an appropriate solvent (buffer solution such as physiological saline, PBS, sterilized water, etc.), sterilized by filtration with a filter, and then filled into a sterile container (eg, ampoule) Can be prepared. This injection may contain a conventional pharmaceutical carrier, if necessary. Methods of administration using non-invasive catheters can also be used.

  In one embodiment, an agent of the invention (eg, an Lnk inhibitor, etc.) can be provided in a sustained release form. The sustained-release form can be any form known in the art as long as it can be used in the present invention. As such a form, for example, it may be a preparation such as a rod form (pellet form, cylinder form, needle form, etc.), a tablet form, a disc form, a spherical form, or a sheet form. Methods for preparing sustained release forms are known in the art and are described, for example, in the Japanese Pharmacopeia, the US Pharmacopeia and pharmacopoeia in other countries. Examples of the method for producing a sustained-release agent (sustained administration agent) include a method utilizing dissociation of a drug from a complex, a method of making an aqueous suspension injection, a method of making an oily injection or an oily suspension injection. And an emulsion injection solution (o / w type, w / o type emulsion injection solution, etc.).

  The composition or kit of the present invention may also further comprise a biocompatible material. Examples of the biocompatible material include silicone, collagen, gelatin, glycolic acid / lactic acid copolymer, ethylene vinyl acetate copolymer, polyurethane, polyethylene, polytetrafluoroethylene, polypropylene, polyacrylate, and polymethacrylate. It may include at least one more selected. Silicone is preferred because it is easy to mold. Examples of biodegradable polymers include collagen, gelatin, α-hydroxycarboxylic acids (eg, glycolic acid, lactic acid, hydroxybutyric acid, etc.), hydroxydicarboxylic acids (eg, malic acid), and hydroxytricarboxylic acids (eg, , Citric acid, etc.) from one or more selected from the group consisting of polymers, copolymers or mixtures thereof, poly-α-cyanoacrylates, polyamino acids (for example, Poly-γ-benzyl-L-glutamic acid and the like) and maleic anhydride-based copolymers (for example, styrene-maleic acid copolymer and the like). The type of polymerization may be random, block, or graft. When α-hydroxycarboxylic acids, hydroxydicarboxylic acids, hydroxytricarboxylic acids have an optically active center in the molecule, D-form, L-form, DL-form Any of these can be used. Preferably, a copolymer of glycolic acid / lactic acid can be used.

  When administering a composition of the invention comprising a nucleic acid molecule, the nucleic acid molecule can be administered, such as by administration in a non-viral vector form or viral vector form, or by direct administration with naked DNA. Such administration forms are well known in the art, and include, for example, separate experimental medicine “Basic Technology of Gene Therapy” Yodosha, 1996; It is explained in detail.

  In certain embodiments, a nucleic acid comprising a normal gene nucleic acid sequence of the invention, a sequence encoding an antibody or a functional derivative thereof, is a disease or disorder associated with abnormal expression and / or activity of a polypeptide of the invention. Is administered for the purpose of gene therapy. Gene therapy refers to treatment performed by administering to a subject a nucleic acid that is expressed or expressible. In this embodiment of the invention, the nucleic acids produce their encoded protein, which mediates a therapeutic effect.

  Any method for gene therapy available in the art can be used in accordance with the present invention. An exemplary method is as follows.

  For a general review of methods of gene therapy, see Goldspiel et al., Clinical Pharmacy 12: 488-505 (1993); Wu and Wu, Biotherapy 3: 87-95 (1991); Tolstoshev, Ann. Rev. Pharmacol. Toxicol. 32: 573-596 (1993); Mulligan, Science 260: 926-932 (1993); and Morgan and Anderson, Ann. Rev. Biochem. 62: 191-217 (1993); May, TIBTECH 11 (5): 155-215 (1993). Commonly known recombinant DNA techniques used in gene therapy are described in Ausubel et al. (Eds.), Current Protocols in Molecular Biology, John Wiley & Sons, NY (1993); and Kriegler, Gene TransferMand Transfer and ExplorMorL. , Stockton Press, NY (1990).

  In the case of a non-viral vector form, a method of introducing a nucleic acid molecule using a liposome (liposome method, HVJ-liposome method, cationic liposome method, lipofectin method, lipofectamine method, etc.), microinjection method, gene gun (Gene Gun) ) And a method of transferring nucleic acid molecules into cells together with carriers (metal particles). Examples of expression vectors include pCAGGS (Gene 108: 193-9, Niwa H, Yamamura K, Miyazaki J (1991)), pBJ-CMV, pcDNA3.1, pZeoSV (available from Invitrogen, Stratagene, etc.) Is mentioned.

  The HVJ-liposome method involves encapsulating a nucleic acid molecule in a liposome made of a lipid bilayer and fusing the liposome with an inactivated Sendai virus (Hemagglutinating virus of Japan, HVJ). This HVJ-liposome method is characterized in that it has a much higher fusion activity with the cell membrane than the conventional liposome method. The HVJ-liposome preparation method is described in detail in a separate volume of experimental medicine “Basic technology of gene therapy” Yodosha, 1996; a separate volume of experimental medicine “Gene transfer & expression analysis experimental method” Yodosha, 1997. As HVJ, any strain can be used (for example, ATCC VR-907, ATCC VR-105, etc.), and Z strain is preferable.

  When the composition of the present invention is provided in the form of a nucleic acid of a viral vector, a viral vector such as a recombinant adenovirus or retrovirus is used. DNA viruses or RNA viruses such as detoxified retrovirus, adenovirus, adeno-associated virus, herpes virus, vaccinia virus, pox virus, poliovirus, Sindbis virus, Sendai virus, SV40, human immunodeficiency virus (HIV), A gene can be introduced into a cell or tissue by introducing a nucleic acid encoding the Lnk variant or a nucleic acid encoding the Lnk variant and infecting the cell or tissue with the recombinant virus. In these viral vectors, the adenoviral vector system is preferably used because the infection efficiency of adenovirus is much higher than that of other viral vectors.

  In the case of the Naked DNA method, the above-described non-viral vector expression plasmid is dissolved in physiological saline and administered as it is. For example, Tsurumi Y, Kearney M, Chen D, Silver M, Takeshita S, Yang J, Symes JF, Isner JM. , Circulation 98 (Suppl. II), 382-388 (1997), can be directly injected into tissues of organs of living organisms.

The amount of cells contained in the composition comprising cells prepared in the present invention is, for example, from about 1 × 10 ³ cells to about 1 × 10 ¹¹ cells, preferably from about 1 × 10 ⁴ cells to about 1 × 10 ¹⁰ cells. More preferably about 1 × 10 ⁵ cells to about 1 × 10 ⁹ cells. These cells may be present as solutions such as, for example, about 0.1 ml, 0.2 ml, 0.5 ml, 1 ml saline. As the upper limit of the range of the amount of cells, for example, about 1 × 10 ¹¹ cells, about 5 × 10 ¹⁰ cells, about 2 × 10 ¹⁰ cells, about 1 × 10 ¹⁰ cells, about 5 × 10 ⁹ cells, about 2 × 10 ⁹ cells, about 1 × 10 ⁹ cells, about 5 × 10 ⁸ cells, about 2 × 10 ⁸ cells, about 1 × 10 ⁸ cells, about 5 × 10 ⁷ cells, about 2 × 10 ⁷ cells, about 1 × 10 ⁷ cells and the like. As the lower limit of the amount of cells, for example, about 1 × 10 ³ cells, about 2 × 10 ³ cells, about 5 × 10 ³ cells, about 1 × 10 ⁴ cells, about 2 × 10 ⁴ cells, about 5 × 10 ⁴ cells. Examples include cells, about 1 × 10 ⁵ cells, about 2 × 10 ⁵ cells, about 5 × 10 ⁵ cells, and about 1 × 10 ⁶ cells.

  In the present specification, “instruction” describes the method for administering the pharmaceutical of the present invention to doctors, patients and other persons who administer it. This instruction describes a word indicating a method of administering a medicine such as platelets of the present invention. This instruction is prepared in accordance with the format prescribed by the national supervisory authority (for example, the Ministry of Health, Labor and Welfare in Japan and the Food and Drug Administration (FDA) in the United States, etc. in the United States) where the present invention is implemented, and is approved by the supervisory authority. It is clearly stated that it has been received. The instruction sheet is a so-called package insert, and is usually provided as a paper medium, but is not limited thereto. But it can be provided.

(disease)
The “disease” targeted by the present invention may be any as long as it requires a certain amount of platelets. The disease or disorder that can be treated according to the present invention can be a disease or disorder associated with the platelet disorder of the present invention. In the present specification, “blood with high viscosity” refers to blood with high viscosity in general, and such blood usually tends to cause thrombus. For example, it is said to easily cause arteriosclerosis. As a method for measuring such viscosity, for example, by using a blood fluidity measuring device (for example, Chiyoda Paramedical Care Center Co., Ltd .; Microchannel Flow Analyzer (MC-FAN)), a flow path (width 7 μm) in the chip is used. ) And the blood fluidity (viscosity) can be measured.

  In the present specification, examples of the “disease derived from viscous blood” include, for example, hyperlipidemia, systemic arteriosclerosis, obstructive arteriosclerosis, diabetes, cerebral infarction, acute coronary syndrome (myocardial infarction, Angina) and the like.

  The present invention can also treat any disease associated with abnormalities in platelets, such as general bleeding disorders associated with thrombocytopenia (eg; thrombocytopenia during anti-cancer drug treatment, essential thrombocytopenia, etc.) ) And the like.

  In one embodiment, the disease or disorder includes, for example, but is not limited to: anemia (eg, aplastic anemia (particularly severe aplastic anemia), renal anemia, cancerous anemia), Secondary anemia, refractory anemia, post-traumatic hemorrhage, etc.), cancer or tumor (eg, leukemia) and hematopoietic failure after chemotherapeutic treatment, thrombocytopenia, acute myeloid leukemia (especially the first remission phase (High) -Risk group), remission period after the second remission period, acute lymphocytic leukemia (especially the first remission period, remission period after the second remission period), chronic myelogenous leukemia (particularly the chronic phase, transitional phase) Malignant lymphoma (especially in the first remission period (High-risk group), remission period after the second remission period), multiple myeloma (especially early after onset), and the like.

(General technology)
Molecular biological techniques, biochemical techniques, and microbiological techniques used in this specification are well known and commonly used in the art, and are described in, for example, Sambrook J. et al. et al. (1989). Molecular Cloning: A Laboratory Manual, Cold Spring Harbor and its 3rd Ed. (2001); Ausubel, F .; M.M. (1987). Current Protocols in Molecular Biology, Greene Pub. Associates and Wiley-Interscience; Ausubel, F .; M.M. (1989). Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology, Greene Pub. Associate ES and Wiley-Interscience; A. (1990). PCR Protocols: A Guide to Methods and Applications, Academic Press; Ausubel, F .; M.M. (1992). Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology, Greene Pub. Associates; Ausubel, F .; M.M. (1995). Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology, Greene Pub. Associates; Innis, M .; A. et al. (1995). PCR Strategies, Academic Press; Ausubel, F .; M.M. (1999). Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology, Wiley, and annual updates; J. et al. et al. (1999). PCR Applications: Protocols for Functional Genomics, Academic Press, “Experimental Methods for Gene Transfer and Expression Analysis”, Yodosha, 1997, etc., which are related parts in this specification (may be all) Is incorporated by reference.

  For DNA synthesis technology and nucleic acid chemistry for producing artificially synthesized genes, see, for example, Gait, M. et al. J. et al. (1985). Oligonucleotide Synthesis: A Practical Approach, IRLPpress; Gait, M .; J. et al. (1990). Oligonucleotide Synthesis: A Practical Approach, IRL Press; Eckstein, F .; (1991). Oligonucleotides and Analogues: A Practical Approach, IRL Press; Adams, R .; L. etal. (1992). The Biochemistry of the Nucleic Acids, Chapman &Hall; Shabarova, Z. et al. et al. (1994). Advanced Organic Chemistry of Nucleic Acids, Weinheim; Blackburn, G .; M.M. et al. (1996). Nucleic Acids in Chemistry and Biology, Oxford University Press; Hermanson, G .; T. T. et al. (I996). Bioconjugate Technologies, Academic Press, etc., which are incorporated herein by reference in the relevant part.

(Preferred form for carrying out the invention)
The description of the preferred embodiment is described below, but it should be understood that this embodiment is an illustration of the present invention and that the scope of the present invention is not limited to such a preferred embodiment.

  In one aspect, the present invention provides a method for producing platelets. This method includes: A) Lnk or equivalent thereof in platelet progenitor cells (eg, having the nucleotide sequence set forth in SEQ ID NO: 1 or encoding the amino acid sequence set forth in SEQ ID NO: 2, or variants thereof or The step of inhibiting the function of the fragment); and B) the step of differentiating the platelet progenitor cells. Inhibition of the function of Lnk or its equivalent can be achieved, for example, at the nucleic acid level (replication or transcription level; this can be achieved by inhibition of Lnk antisense or RNAi), protein level (translation level, post-translational modification level; , Sugar chain cleavage, inhibition by antibodies, etc.) and can be performed directly or indirectly. It will be appreciated that typically it can be achieved, for example, by using dominant negative inhibition of Lnk or its equivalent, by introducing a mutant Lnk that has lost Lnk activity by a retrovirus, etc. . It is understood that the platelet progenitor cells may be directly used (primary culture) taken from a living body, or cells obtained by differentiating or amplifying stem cells to some extent can be used.

  In one embodiment, the platelet precursor cells used in the present invention include embryonic stem cells and megakaryocytes. It can be appreciated that such embryonic stem cells can be prepared using any technique known in the art.

  In one embodiment, the platelet precursor cell differentiation step (step B above) may include contacting the platelet precursor cells with stem cell factor (SCF).

  In one embodiment, the platelet progenitor cells can include megakaryocytes derived from embryonic stem cells. Induction of megakaryocytes can be achieved by, for example, but not limited to, culture on OP9 stromal cells and co-culture with bipolar hemangioblasts. In differentiation into megakaryocytes, A) differentiation and maturation from hemangioblasts (VEGF type 2 receptor; Flk-1, KDR) and c-kit positive cells; B) physical contact with OP9 stromal cells It should be noted that it is essential for differentiation and maturation into megakaryocytes; and C) platelet production is possible on OP9 stromal cells, but is promoted by conditions excluding contact with OP9. is there.

  In another aspect, the present invention also provides platelets produced by the above method of the present invention (including inhibiting the function of Lnk or an equivalent thereof in platelet progenitor cells; and differentiating the platelet progenitor cells). provide.

  In another aspect, the present invention also provides a method of screening for substances that modulate the rate of platelet production. In this method, A) selecting a substance that interacts with Lnk or the Lnk promoter; and B) determining whether or not to differentiate the selected substance by contacting with the platelet progenitor cell, and having the differentiation-regulating action The process of selecting is included. Whether or not it has a differentiation regulating action can be determined by confirming that the differentiation rate is regulated with respect to a positive control that is brought into contact with a differentiation factor as a control.

  In another aspect, the present invention provides a composition comprising platelets whose Lnk or its equivalent is damaged or whose function is damaged. Such platelets are expected to be low in viscosity and suitable for treating diseases caused by viscous blood.

  Thus, in a preferred embodiment, the compositions of the present invention can be used for the treatment of patients with viscous blood. Such patients can be those suffering from symptoms or diseases such as diabetes, arteriosclerosis, myocardial infarction, hyperlipidemia, cerebral infarction, for example.

  In another aspect, the present invention provides an agent that inhibits Lnk or its gene product. This factor can be used for the production or promotion of platelet production. Such factors can be dominant negative factors, promoter binding factors, RNAi, antibodies, small molecules, and the like.

  Accordingly, the present invention provides, in a preferred embodiment, a composition for modulating the rate of platelet production comprising a factor that inhibits Lnk or its gene product. Such factors can be dominant negative factors, promoter binding factors, RNAi, antibodies, small molecules, and the like. Alternatively, in another embodiment, the factor is a functional variant of Lnk or its gene product. Such an agent may in certain embodiments be a variant nucleic acid having the nucleotide sequence set forth in SEQ ID NO: 3.

  In one aspect, the present invention provides the use of an agent that inhibits Lnk or its gene product for modulating the rate of platelet production. As used herein, it can be understood that any factor embodiment used herein may be used.

  In another aspect, the present invention provides the use of an agent that inhibits Lnk or its gene product for the manufacture of a composition for modulating the rate of platelet production. As used herein, it can be understood that any factor embodiment used herein may be used.

  References such as scientific literature, patents and patent applications cited herein are hereby incorporated by reference in their entirety to the same extent as if each was specifically described.

  The present invention has been described with reference to the preferred embodiments for easy understanding. In the following, the present invention will be described based on examples, but the above description and the following examples are provided only for the purpose of illustration, not for the purpose of limiting the present invention. Accordingly, the scope of the present invention is not limited to the embodiments or examples specifically described in the present specification, but is limited only by the scope of the claims.

  The present invention will be described in more detail with reference to the following examples, but the present invention is not limited to the following examples. With the exception of exceptions, the reagents and supports used in the following examples were those commercially available from Sigma (St. Louis, USA, Wako Pure Chemical (Osaka, Japan), etc. The animals used in the following were used. The animals were reared and tested in compliance with the rearing standards prescribed by Japanese universities.

(Example 1: Screening of Lnk DN mutant gene)
(Cells, reagents and mice)
MC9 cells were cultured in RPMI 1640 medium (supplemented with 8% calf serum (FBS), antibiotics and 10 units / ml IL-3). Plat-E cells were maintained as previously described ((Morita, S., Kojima, T., and Kitamura, T. 2000. Plat-E: an effective and stable system for transgenic packaging. Ther.7: 1063-1066.) COS7 cells were maintained in RPMI 1640 medium (supplemented with 8% FBS and antibiotics) Purified mouse IL-3, SCF and TPO were purchased from Peprotech (NJ, USA). C57BL / 6 mice (Ly5.2 ⁺ ) and CB-17 scid mice were purchased from Clea Japan (Kanagawa, Japan) Congenic about the Ly5 locus (Ly5, 1 ⁺ ). Mice and lnk ^{− / −} mice (Takaki, S., Sauer, K., Iritani, B.M., Chien, S., Ebihara, Y., Tsuji, K., Takatsu, K., and Perlmutter, , 2000. Control of B cell production by the adapter protein, NK, Definition of a conferred family of signals, a.T. , And Takatsu, K. 2002. Enhanced hematopoiesis by hematopoietic program. itor cells lacking intracellular adaptor protein, Lnk.J.Exp.Med.195:. 151-160) were maintained mated with special conditions of the pathogen-free at the Institute of Medical Science, University of Tokyo animal experiment facility.

(Lnk variants and expression constructs)
The sequences of the R364E, ΔPH, ΔN and Y536F Lnk variants used are as follows:

R364E
Nucleotide sequence
(SEQ ID NO: 7)
Amino acid sequence
(SEQ ID NO: 8).

ΔPH
Nucleotide sequence
(SEQ ID NO: 9)
Amino acid sequence
MNEPTVQPSRTSSAPASPASPRGWSDFCEQHAAAAARELARQYWLFARAHPQPPRADLVSLQFAELFQRHFCREVRESLAGPPGHDYRATAPPRPALPKARSSEDLGPRPACALQHLRRGLRQLFRRRSAGELPGATSDTNDIDTTAASRPGPARKLLPWGLREPPTEALKEVVWLAELRASTGLGLEHPDTELPLSLAAEPGPARSPRGSTDSLDQGASPGVLLDPACQKTDHFLSCYPWFHGPISRVRAAQLVQLQGPDAHGVFLVRQSESRRGEYVLTFNLQGRAKHLRLVLTERGQCRVQHLHFPSVVDMLRHFQRSPIPLECGAACDVRLSGYVVVLSQAPGSSNTVLFPFSLPHWDSELGHPHLSSVGCPPSHGAEALPGQVTPPEQIFHLVPSPEELANSLRQLELESVSSARDSDYDMDSSSRGHLRAIDNQYTPLSQLCREADV (SEQ ID NO: 10).

ΔN
Nucleotide sequence
(SEQ ID NO: 11)
Amino acid sequence
MNACALQHLRRGLRQLFRRRSAGELPGATSDTNDIDTTAASRPGPARKLLPWGLREPPTEALKEVVLRYSLADEAAMDSGARWQRGRLVLRSPGPGHSHFLQLFDPPKSSKPKLQEACSSIREVRPCTRLEMPDNLYTFVLKVQDQTDIIFEVGDEQQLNSWLAELRASTGLGLEHPDTELPLSLAAEPGPARSPRGSTDSLDQGASPGVLLDPACQKTDHFLSCYPWFHGPISRVRAAQLVQLQGPDAHGVFLVRQSESRRGEYVLTFNLQGRAKHLRLVLTERGQCRVQHLHFPSVVDMLRHFQRSPIPLECGAACDVRLSGYVVVLSQAPGSSNTVLFPFSLPHWDSELGHPHLSSVGCPPSHGAEALPGQVTPPEQIFHLVPSPEELANSLRQLELESVSSARDSDYDMDSSSRGHLRAIDNQYTPLSQLCREADV (SEQ ID NO: 12).

Y536F
Nucleotide sequence
(SEQ ID NO: 13)
Amino acid sequence
(SEQ ID NO: 14).

A DNA fragment encoding the mutant was generated by PCR-based site-directed mutagenesis using the following primers and confirmed by DNA sequencing.
[Primers used to prepare R364E]
5'tggtggagcagagtgagtcccgga3 '(SEQ ID NO: 15)
5'tctgctccaccaggaacacgccgt3 '(SEQ ID NO: 16)
[Primers used to produce ΔPH]
5'tggctggcagagctcagggca3 '(SEQ ID NO: 17)
5'ctgccagccatacgacctccttgagcgcct3 '(SEQ ID NO: 18)
[Primers used to produce ΔN]
5'gcctgtgccctgcagcacctg3 '(SEQ ID NO: 19)
5'gggcacaggcgttcatggtggagagcgagg3 '(SEQ ID NO: 20)
[Primers used to produce Y536F]
5'caaccagttcacccctctctca3 '(SEQ ID NO: 21)
5'aggggtgaactggttgtcaatgg3 '(SEQ ID NO: 22).

  Mutant cDNA encoding dC was constructed by digesting lnk cDNA with BglII, blunting with a Klenow fragment and then self-ligating. Other lnk cDNAs containing mutations in various combinations were constructed by replacing the appropriate cDNA fragment with the mutant fragment using restriction enzyme digestion and ligation. The resulting cDNA fragment is subcloned into a pcDNA3 mammalian expression vector (Invitrogen) or MSCV retroviral vector (including an internal ribosome entry site (IRES) between the multicloning site and the eGFP-encoded cDNA (available from Clontech)) did.

(Retroviral transduction and bone marrow transplantation)
The pMY vector was transfected into Plat-E cells by lipofection using FuGene (Roche). The supernatant containing the packaged retroviral particles was collected and centrifuged at 4 ° C. for 16 hours in a microcentrifuge tube. For transduction, MC9 cells were incubated for 3 hours in fresh medium containing 8 mg / ml polybrene (Sigma) and retroviral supernatant concentrate. Cells were washed and further cultured in fresh medium containing 10 ng / ml SCF. For HSC / HPC transduction, bone marrow (BM) cells negative for Lineage markers (B220, CD3, Mac-1, Gr-1 and TER-119) were purified using the MACS system (Miltenyi Biotec). . Lin ^- cells (4 × 10 ⁵ ) were incubated with retroviral supernatant for 3 hours and RMPI 1640 medium (8% FBS, 50 mM 2-mercaptoethanol, 1 × non-essential) on Retrotronin-coated dishes (TaKaRa) Plated with amino acids (Gibco), 10 ng / ml SCF, 100 ng / ml TPO and 5 ng / ml IL-3). The next day, transduction was repeated with fresh retroviral supernatant and the cells were cultured for an additional 24 hours. Transformed Lin ⁻ cells (2.0 × 10 ⁵ ) were washed and intravenously injected into lethal doses of irradiated mice (9.5 Gy).

(Flow cytometry)
MC9 cells expressing eGFP after retroviral transduction were analyzed using a FACS Calibur ^™ instrument (BD Biosciences). Peripheral blood enucleated cells were obtained from recipient mice, which were stained with a predetermined optimal concentration of each antibody, and then analyzed by FACS Calbiur ^™ . The following were used as monoclonal antibodies. FITC-conjugated, anti-B220 (anti-CD-45R, RA3-6B2), anti-Mac-1 (anti-CD11b, M1 / 70), and anti-Sca-1 (E13-161.7); PE conjugated Anti-CD3e (145-2C11), anti-Gr-1 (RB6-8C5), anti-TER119, anti-Sca-1 and anti-c-Kit (anti-CD117, 2B8); biotin-conjugated anti-Ky5.1 ( Anti-CD45.1, A20) and anti-Ly5.2 (anti-CD45.2, 104); APC-conjugated, anti-B220 and anti-c-Kit (all purchased from BD Biosciences or eBiosciences). Biotin conjugated antibody binding was visualized using APC conjugated or PerCP conjugated streptavidin (BD Biosciences). Dead cells were gated out by 7 amino acid actinomycin D (Sigma) staining.

(Chemical crosslinking, immunoprecipitation and immunoblotting)
COS7 cells were transfected with pcDNA3 encoding wild-type or mutant Lnk protein using Superfect (Qiagen) and harvested 48 hours after transfection. Cell lysis buffer (Takaki, S., Morita, H., Tetsuka, Y., and Takatsu, K. 2002. Enhanced hematopoietics by hematopoietic progenitor cells. -160.) And chemically crosslinked using BS ³ (Pierce) at various concentrations. This was then immunoblotted with anti-Lnk antibody. For stimulation experiments, transfectants were serum starved for 12 hours and stimulated with 100 ng / ml SCF for 5 minutes. The cells were then lysed and the lysate immunoprecipitated and immunoblotted as previously described (Takaki, S., Morita, H., Tetsuka, Y., and Takatsu, K. 2002. Enhanced hematopoiesis by hematopoietic progenitor cells racking intracellular adapter protein, Lnk. J. Exp. Med. 195: 151-160.).

(Effect of dominant negative mutation of Lnk gene on the production of platelets from ES cells)
(Proliferation and differentiation of ES cells)
The mouse E14tg2a cell line was passaged on mouse feeder cells irradiated in complete GMEM medium (GIBCO / Invitrogen, Carlsbad, Calif.) Supplemented with 1000 U / ml murine leukemia inhibitory factor (LIF) (Chemicon, Temecula, Calif.). Maintained until. A co-culture system with stromal cell line OP9 cells (Nakano T, Kodama H, Honjo T. Science, 265; 1098-1101, 1994) is described for differentiation into megakaryoblasts (Eto K, Murphy). R, Kerrigan SW, Bertoni A, Stuhlmann H, Nakano T, Leavitt AD, Shattil SJ (2002) Megakaryocytes derived from embryonic stem cells implicate CalDAG-GEFI in integrin signaling.Proc.Natl.Acad.Sci.U S A.99: 12819-12824.). Briefly, ES cells were detached with 0.25% trypsin / EDTA and allowed to stand for 75 minutes to deplete adherent feeder cells. Subsequently, 1.5 × 10 ⁴ cells were seeded in each well of a 6-well plate containing confluent OP9 stromal cells. OP9 cells are derived from the calvaria of neonatal M-SCF deficient B6C3F1-op / op mice. The cells in each well were then cultured in αMEM medium (GIBCO / Invitrogen) supplemented with 10-12% fetal calf serum and 50 mM 2-ME (Sigma). In αMEM containing 20 ng / ml bifunctional hemangioblasts expressing both Flk-1 and PECAM-1 on day 5 of the differentiation protocol to obtain megakaryocytes expressing proteins transduced with retrovirus The suspension was suspended at 8 × 10 ⁵ / ml. After adding an equal volume of virus stock and 4 mg / ml protamine sulfate (Sigma), the cells were cultured at 37 ° C. for 17 hours, washed and seeded on fresh OP9 layers with 4 × 10 ⁵ cells, and Cultures were performed up to day 15 as described above (Eto K. et al., PNAS, 2002).

(Retroviral infection of megakaryocytes)
Multiple cloning sites of MSCV retroviral vector (MIG vector: purchased from BD bio / clontech) isolated and purified by digestion with LNK cDNA and dominant negative mutant cDNA from retroviral vector containing IRES-GFP cassette The PGK-neo gene was replaced with ires-EGFP. Relevant sequences were confirmed by automated DNA sequencing. Virus was produced by calcium phosphate transfection into 293T cells (available from Promega). In this experiment, 15 μg of MIG expression vector and 12 μg of envelope plasmid pcDNA-VSVG were used. Viral titers were determined 48-60 hours later by measuring GFP expression in infected NIH 3T3 cells, which ranged from 0.4 to 1.0 × 10 ⁶ IU / ml. .

  The sequence of the dominant negative mutant is as follows.

Dominant negative mouse Lnk
Nucleotide sequence
(SEQ ID NO: 3)
Amino acid sequence
MNEPTVQPSRTSSAPASPASPRGWSDFCEQHAAAAARELARQYWLFARAHPQPPRADLVSLQFAELFQRHFCREVRESLAGPPGHDYRATAPPRPALPKARSSEDLGPRPACALQHLRRGLRQLFRRRSAGELPGATSDTNDIDTTAASRPGPARKLLPWGLREPPTEALKEVVWLAELRASTGLGLEHPDTELPLSLAAEPGPARSPRGSTDSLDQGASPGVLLDPACQKTDHFLSCYPWFHGPISRVRAAQLVQLQGPDAHGVFLVEQSESRRGEYVLTFNLQGRAKHLRLVLTERGQCRVQHLHFPSVVDMLRHFQRSPIPLECGAACDVRLSGYVVVLSQAPGSSNTVLFPFSLPHWDSELGHPHLSSVGCPPSHGAEALPGQVTPPEQI (SEQ ID NO: 4).

(IIb, characterization of megakaryocytes for expression of GPIb, and proplatelet production)
After 9 and 12 days of ES cell differentiation, non-adherent cells were gravity sedimented at 37 ° C. for 60 minutes. To optimize megakaryocyte yield, hematopoietic cells that still adhere to the OP9 layer were resuspended and the cell mass removed through the mesh. Expression of αIIbβ3 or GPIbα was measured using rat anti-mouse αIIB (CD41) conjugated with FITC.
The formation of pre-platelets expressing GFP was monitored and counted with a phase-contrast epi-fluorescent microscope (Leica DM IRBE microscope system). Briefly, the real number of cells for proplatelet was counted in 100 GFP positive megakaryocytes per culture dish on days 9 and 12 of culture. From day 12 to day 14 of the culture, the number of platelet particles derived from ES cells was counted by flow cytometry. As a result, the total number of GFP positive GPIbα positive for the entire 3 days collected from one 6-well culture dish: control (GFP only) expression 682 ± 418, R364E1 amino acid substitution gene expression 896 ± 51 Lnk dominant negative gene expression 3028 It was ± 446. Positive particles of GFP and GPIbα were finally counted by using control beads (BD / Invitrogen).

(Example 2: Lnk knockout platelet experiment)
(material)
All reagents were purchased from Sigma-Aldrich unless otherwise noted. All animal and recombinant DNA experiments were approved by the Institute of Medical Sciences, University of Tokyo, Tokai University and Hokkaido University Animal Experiment Facility Council.

  Horseradish peroxidase (HRP) conjugated secondary antibody was purchased from Bio-Rad Laboratories. Argatroban was purchased from Mitsubishi Chemical (Tokyo, Japan). Rhodamine-phalloidin, alexa488-conjugated fibrinogen and alexa488-conjugated anti-mouse IgG antibody were purchased from Molecular Probes.

  Purified human fibrinogen was obtained from American Diagnostica Inc. (CT, USA). FITC-conjugated anti-mouse integrin αIIb (CD41) and PE-conjugated anti-mouse GPIbα were obtained from Amfret (Germany). Human thrombopoietin, IL-6 and IL-11 were obtained from Peprotech.

(Bleeding time)
The tail bleeding assay was performed using 8-week-old Lnk-deficient mice (Takaki, S., Morita, H., Tetsuka, Y., and Takatsu, K. 2002. Exp. Med. 195: 151-160) or control mice. Mice were anesthetized with 50 μg / ml pentobarbital. The 2 mm distal tip of the tail was excised and the tail immediately bathed in 37 ° C PBS. Tail bleeding time was defined as the time required for bleeding to stop.

(Preparation of blood sample)
Blood samples per experiment were obtained by cardiac theft from over 8 Lnk null mice and their controls each. The collected blood samples were immediately transferred to plastic tubes containing 1/6 of that volume of acidic citrate dextrose (ACD) and used for specific fibrinogen binding or platelet diffusion experiments for integrin αIIβb3. Another sample was transferred to a tube containing 1/6 of its volume containing 3.8% citric acid to a final concentration of 0.38% and used for platelet aggregation experiments. Platelet-enriched plasma (PRP) was obtained by centrifuging whole blood at 150 × g for 15 minutes. To obtain washed platelets, add 10 mM Plastaglandin E1 (PGE ₁ ) and 5 U / mL apyrase and centrifuge at 750 × g for 10 min, once with ₁ mM PGE ₁ and 1 U / mL apyrase Washed with citrate buffer. Platelet pellets were placed in appropriate volumes of modified Tyrode-Hepes buffer pH 7.4 without Ca ²⁺ (10 mM HEPES, 12 mM NaHCO ₃ , 138 mM NaCl, 5.5 mM glucose, 2.9 mM KCl and 1 resuspended in mM MgCl ₂ ).

(Ex vivo flow chamber experiment)
For ex vivo perfusion experiments, the collected blood sample is immediately transferred to a plastic tube containing 1/10 of its volume of the specific thrombin inhibitor argatroban at a final concentration of 100 μM to maintain blood sample fluidity during the experiment. (Argatroban is more commonly used as an anticoagulant than citric acid or heparin, which avoids the pleiotropic effects through reduced cation concentration or the interaction of modified von Willebrand factor Iβa. did.).

  The platelets in the whole blood sample were then added to mepacrine (Sigma, Co. Ltd., St. Louis, USA) at a final concentration of 10 μmol / L and the procedure previously described (Eto K, Goto S, Shimazaki T). , Sakakibara M, Yoshida M, Isshiki T, Handa S (2001) Two distinct mechanisms are invented in thrombus underflows conditions. In some experiments, a whole blood sample is divided into PRP and the remaining sample by centrifugation to reconstitute control PRP or Lnk null PRP and the remaining sample from control blood, including control red blood cells and plasma. Constructed whole blood was prepared. To further adjust the platelet count, control PRP or Lnk-PRP was diluted in HEPES-Tyrode buffer and mixed with control blood containing control erythrocytes and plasma.

A rectangular flow chamber with immobilized collagen type I (Sigma, USA) was prepared as previously described (Eto K, Goto S, Shimazaki T, Sakuraki M, Yoshishima M, Isshiki T, Handa S (2001) Two. distinct mechanisms are involved in thrombosis under flow conditions. Platelets 12: 228-235.). A blood sample was aspirated through a chamber equipped with a syringe pump at a rate of 116.1 ml / hr to achieve a maximum wall shear rate of 1,500 s ⁻¹ (Holliston, MA 01746, Harvard Apparatus, Co. Ltd., USA). Platelets that interact with collagen on the surface to form thrombus were visualized using an inverted stage epi fluorescent video microscope system equipped with a 480 nm excitation light source (DMIRB, 1RB-FLUO, Leica, Germany). Microscopic images were digitized online using a photosensitive color CCD camera (L-600, Leica, Germany). To quantify platelet thrombus growth in two dimensions, the surface area coverage by platelets was calculated as previously reported (Goto S, Tamura N, Ishida H (2004) Ability of anti-glycoprotein IIb / IIIa agents to dissolve platelet thrombo formed on a collagen surface under flow conditions, Journal of the American College of Cardio. Platelet thrombus lysis was shown in video images. In this video image, the time sensation was reduced by a factor of 3 (ie, 3 minutes of real time is represented in 1 second in the video). The three-dimensional structure of platelet thrombus is analyzed with ultrafast laser confocal microscope, the position of the objective lens is raised, and controlled by a dielectric motor control unit, the constant speed is reduced to 20 μm / 50 seconds, and the scanned image of thrombus Can be obtained (FIG. 8). By using a rapidly rotating disc confocal unit (CSU10, Yokogawa Medical, Co., Japan) with 20,000 pinholes covered by microlenses, a piece of confocal image can be obtained within 10 milliseconds. Could get to. The confocal image was magnified using an image magnifier (SRUB GEN III +, Solamer, International Co., Japan), and the magnified image was recorded on a digital video recorder (Handycam, Sony Co., Japan). The recorded image was transferred to a personal computer (PowerMachinosh G4, Apple Inc., USA), a 3D projection image was obtained using shareware NIH images / Image J 1.32, and 60 ° C obliquely upward and laterally from the top surface Recorded as a QuickTime animation and a projection.

(Platelet aggregation research)
Washed platelets were placed at a concentration of 2 × 10 ⁵ / ml in modified Tyrode-Hepes buffer containing 1 mM MgCl ₂ . After adding CaCl ₂ at a final concentration of 1 mM and incubating at 37 ° C. for 1 minute, various concentrations of mouse thrombin and collagen I were added and stirred. Aggregation profiles were generated in a Chrono-Log platelet aggregometer with stirring at 37 ° C.

(Fibrinogen binding by various agonists (activation of integrin αIIβb3) and FACS analysis)
Washed and resting platelets were treated with 300 mg / ml Alexa488-conjugated fibrinogen at room temperature and modified tie with ADP, PAR4 agonist peptide, mouse thrombin or PMA (50 mM final solution 0.2 mM CaCl ₂ each). (Dissolved in load-Hepes buffer) for 30 minutes.

Confocal microscopy: Seeding 1 mM MgCl ₂ and modified Tyrode -Hepes washed platelets in buffer containing 0.2MMCaCl ₂ a ⁽¹⁰ 7 / ^500μl), for 45 min at 37 ° C. to fibrinogen coated coverslips 12-well plates It was. Adherent cells were fixed in 4% formamide, permeabilized with 0.1% Triton X-100, and stained with primary antibody and Alexa 488 conjugated secondary antibody.

(Results and Discussion)
FIG. 1 shows that the functional domain of Lnk is important for cell growth regulation. (A) Representative schematic of an MSCV vector used to co-express eGFP from a single mRNA with Lnk mutant and an internal liposome entry site (IRES). The proline-rich part (stretch; indicated by a white box with a black bar), the SH2 domain (white box), and the N-terminal domain with a tyrosine phosphorylation site (Y) at the C-terminus. Deletion of N-terminal domain (DN), PH domain (DPH) and C-terminal tail (DC) and phenylalanine substitution (Y546F) of Y536 and glutamic acid substitution of R364 (R364E; shown as X in SH2 domain) are shown. (B) MC9 cells transduced with control vector (left column, vector) or MC9 cells transduced with Lnk expression vector (right column, WT) are cultured in the presence of SCF and are alive at a given time The percentage of eGFP ⁺ cells was determined by flow cytometry. (C) The growth rate of MC9 cells expressing the indicated Lnk mutant induced by SCF is determined by dividing the percentage of eGFP ⁺ cells at each given time point at the start of culture (day 0). Comparison was made with cells that had not been introduced. Shown are representative results of multiple independent experiments.

FIG. 2 shows that the Lnk SH2 mutant inhibits the negative regulatory function of Lnk dominantly in cell proliferation. (A) Lnk associates with c-Kit via the SH2 domain. COS7 transfectants co-expressing the indicated Lnk mutants and c-Kit were stimulated with SCF and lysed. Proteins immunoprecipitated with anti-Lnk antibody were isolated and immunoblotted with anti-phosphotyrosine antibody to detect c-Kit (upper panel), and immunoblotted Lnk with anti-Lnk antibody to detect ( Lower panel). The association between c-Kit and Lnk was abolished by the R364E SH2 mutation. (B) Multimer formation of Lnk through the N-terminal region. The whole indicated Lnk cell lysate COS7 transformant cells expressing mutant, was treated with a chemical cross-linking agent BS ³ of various concentrations, and subjected to immunoblotting then with anti Lnk antibody. Lnk formed a multimeric complex. This showed slower mobility (arrowhead). Multimerized complexes were not detectable with the dNLnk mutant. (C and D) Lnk SH2 mutants were transduced into MC9-Lnk cells expressing wild type Lnk with retroviruses. Transduced cells were cultured in the presence of SCF and their growth was compared to that of untransduced MC9-Lnk cells. The comparison was determined by grading eGFP ⁺ cells at a given point in time during culture (Day 0). Shown are representative data from three independent experiments. Finally, in addition to the R364E SH2 mutation, the DPH and DC mutations (ΔPH / R364E / ΔC) were determined as the most potent dominant negative mutants with an inhibitory effect on wt Lnk.

  FIG. 3 shows that ectopic expression of Lnk ΔPH / R364E / ΔC mutant, but not SH2 R364E alone, facilitates the maturation of ES cell-derived megakaryocytopoiesis.

  (A) Differences between Lnk wt, SH2 R364E alone and the ΔPH / R364E / ΔC mutant of cDNA. N-terminal domain with proline-rich region (white box with black bar), PH domain (hatched box), SH2 domain (white box) and C-terminal tyrosine phosphorylation site (Y) are shown. Two mutant genes were tested in megakaryocytes derived from ES cells. (B) On day 5 of the differentiation protocol, hematopoietic progenitor cells are allowed to undergo 18 hours of virus encoding GFP alone, R364E variant and GFP (R364E-GFP) or ΔPH / R364E / ΔC variant encoding virus and GFP. Infected with a virus encoding (ΔPH / R364E / ΔC-GFP). Further differentiation was maintained by co-culture with OP9 in the presence of 20 ng / ml TPO. On day 7, cells were analyzed by expression of CD41 (integrin αIIb) in transduced (GFP positive) and non-transduced cells (GFP negative). The average number of CD41 positive cells in GFP negative cells was defined as 1.0. To study maturity, GPIβa expression was also tested. Shown is the mean ± SD of 3 independent experiments. (Results) The number of CD41-expressing cells was not changed between GFP alone, SH2 R364E, and ΔPH / R364E / ΔC-GFP. On the other hand, the expression of GPIβa, which is characteristic of the maturation process in megakaryocytes, increased in megakaryocytes transduced with Lnk ΔPH / R364E / ΔC, but not in cells transduced with SH2 R364E alone. This indicates that DPH and DC can inhibit endogenous Lnk in addition to the SH2 mutant and promote maturation in this culture system.

  FIG. 4 shows that the Lnk ΔPH / R364E / ΔC mutant increases the number of mature megakaryocytes and proplatelet production.

(A) GFP expression mediated by retroviruses in megakaryocytes derived from ES cells. Day 5 hematopoietic progenitor cells were infected with retrovirus encoding GFP alone or encoding ΔPH / R364E / ΔC-GFP. On days 9 and 12, fluorescence images of GFP positive cells showing multiple extensions were obtained at a given exposure time using an inverted fluorescence microscope / computer system. Then, the number of preplatelets in 100 cells was calculated. The dimension of the bar in (A) is 100 mm. (B left) The number of CD41 ⁺ GFP ⁺ cells on day 9 was calculated by flow cytometry. According to dot plot side scatter and forward scatter in flow cytometry, two arbitrary analysis gates were applied as previously described (Eto K, Murphy R, Kerrigan SW, Bertoni A, Stuhlmann H, Nakano. T. Leavitt AD, Shatil SJ (2002) Megakaryocytes derived from embryonic cells cells implicated CalDAG-GEFI in integrated G. A. S U. 99. Proc. Shown is the mean ± SD of 3 independent experiments. As shown in (B), ΔPH / R364E / ΔC-GFP transduced cells showed mature megakaryocytes and had increased platelet counts 3 days after retroviral infection. After an additional 3 days, the enhanced production of pre-platelets was maintained by co-culture with OP9 cells, as shown in (B right).

FIG. 5 shows that the Lnk ΔPH / R364E / ΔC mutant increases platelet fragmentation from megakaryocytes derived from ES cells. Fragmented particles derived from mature megakaryocytes from day 12 to day 14 were counted by flow cytometry as described in the methods section herein. Shown is the 3 day total of GPIβa ⁺ GFP ⁺ particles. The insertion place of the graph shows an example of dot plot. (Results) The Lnk ΔPH / R364E / ΔC mutant increased the number of ES cell-derived GPIβa ⁺ platelet particles, but the SH2 mutant alone did not.

FIG. 6 is a diagram showing Lnk expression in mouse platelets and prolonged bleeding time in the tail in Lnk null mice. (A) Western blot of protein expression in COS7 cells transfected with mouse lnk cDNA and analysis of platelets of the indicated genotype. 25 mg of each lysate prepared with RIPA buffer containing 2% SDS was evaluated with a polyclonal antibody against mouse Lnk (Takaki, S., Morita, H., Tetsuka, Y., and Takasu, K. 2002.). Enhanced hematopoiesis by hematopoietic progenitor cells racking intracellular adapter protein, Lnk. J. Exp. Med. 195: 151-160). (B) The bleeding time was determined as described in the method column herein. The plotted data were normal mice (n = 5) and Lnk null mice (n = 7).
FIG. 7 shows platelet aggregation by thrombin and collagen.

  Washed and resting platelets were applied to a platelet aggregometer and activated with thrombin (0.1 U / ml) or collagen I (0.5 μg / ml). Arrows indicate agonist addition. Shown are representative results of three independent experiments.

FIG. 8 shows ex vivo thrombus formation of collagen bound to the surface. Blood was collected from control mice or Lnk-deficient mice using argatroban as an anticoagulant. Glass cover slips were coated with insoluble fiber type I collagen and placed in parallel plate flow chambers. (A) Whole blood was applied into the flow chamber at a relatively high shear rate (1500 s ⁻¹ ) without adjusting platelet counts from control (10 mice) or Lnk deficient mice (10 mice). The left three frames in the control (Lnk + / +) or Lnk deficiency (Lnk − / −) from serial recordings show the collagen-coated surface at 2 min, 4 min and 7 min after blood perfusion (2 Dimension; XY axis). Thrombus formed from control and Lnk deficiency is shown. On the other hand, a three-dimensional image of Lnk-deficient blood (right frame: Z axis) showed a thrombus that was relatively lower than the height of the control. (B) Reconstituted blood consisting of control PRP or Lnk null PRP along with red blood cells and plasma derived from control blood was applied to the flow chamber at a high shear rate (1500 s ⁻¹ ). A three-dimensional image (Z-axis) in a sample containing Lnk-deficient platelets showed a clot height lower than that of the control even when the platelet count was adjusted to 5 × 10 ⁵ / ml for the control.

  FIG. 9 is a diagram showing the thrombus surface area, thrombus height and thrombus volume after perfusion in Lnk-deficient blood. (A) The surface area ratio was determined from continuous z-axis intercepts. The data shows the average of three independent experiments on a 1-2 μm high thrombus. (B) Data show the average of three independent experiments at maximum height (μm).

  FIG. 10 shows integrin αIIβb3 activation by various agonists in Lnk-deficient platelets. ΑIIβb3 activated after addition of various agonists was analyzed by Alexa488-conjugated fibrinogen binding to integrin αIIβb3 in flow cytometry. Nonspecific binding was determined in the presence of 10 mM EDTA. Data show mean fluorescence intensity (FL-1 channel) from 5-8 independent experiments.

  FIG. 11 shows that a deficiency in lamellipodia formation was observed for fibrinogen in Lnk-deficient platelets. Platelets were obtained from Lnk − / − and control mice and plated on fibrinogen for 45 minutes with no agonist; ADP (50 μM); PAR4 receptor activating peptide (1 mM). The cells were then fixed, permeabilized, and stained for F-actin (red) and phosphotyrosine (green). This was analyzed by a confocal microscope. The arrowhead indicates a filamentous temporary foot. Bar represents 10 μM.

  Thus, it became clear that the dominant negative of Lnk activates the production of platelets and that the produced platelets are expected to be suitable for replenishment of highly viscous blood.

(Example 3: Demonstration in human)
CD34 ⁺ pluripotent stem cell fraction prepared from umbilical cord blood was added in the presence of Stem cell factor (SCF) (50 ng / ml), FLT-3L (50 ng / ml), IL-6 (50 ng / ml) Incubate for 1-2 days. In the meantime, the virus particles prepared from the retroviral vector co-expressing the Lnk inhibitor and GFP and the control vector expressing only GFP are added to introduce the infection. The experimental group and control GFP ⁺ infected cells are sorted and purified by a flow cytometer, and cultured in the presence of various cytokines to examine colony forming ability. For megakaryocyte cell colonies, pay attention to the size per colony as well as the number of colonies. Co-culture with a stromal cell line that supports umbilical cord blood stem cell survival or proliferation, and examine whether the gene-transfected cells have an effect of survival or amplification. In these culture systems, expression of Lnk inhibitors is expected to enhance the proliferation ability of megakaryocyte cells, platelets, and various hematopoietic progenitor cells.

The same number of experimental groups and control GFP ⁺ infected umbilical cord blood progenitor cells were mixed with a fixed amount (about the same number or half of the infected cells) of non-infected cells (or untreated umbilical cord blood) to give a non-lethal dose of radiation (3 Transfer to a NOD / SCID mouse. After 2-3 months, peripheral blood of recipient mice was collected, and the GFP positive rate of CD19 ⁺ B cell fraction, CD3 ⁺ T cell fraction, CD11b ⁺ myelocyte fraction was examined by flow cytometry, and Compare the hematopoietic capacity of uninfected cells under competitive conditions. It is confirmed that by expressing the Lnk inhibitor, the engraftment rate of the transplanted donor umbilical cord blood progenitor cells and the production of megakaryocyte cells and platelets, various hematopoietic cells and lymphocytes produced therefrom are increased. it can.

(Example 4: Inhibitor screening)
Next, screening for platelet production promoting factors is performed by Lnk inhibitor screening. The protocol is shown below.

  Lnk is overexpressed by gene transfer into a cell line that grows in a TPO-dependent manner. It is expressed or acted on a gene-transferred cell line in which TPO-dependent growth is no longer possible due to this overexpression of Lnk, and the action as a Lnk inhibitor is screened using recovery of TPO-dependent growth as an index. Regarding factors that may act as Lnk inhibitors, the effects on differentiation systems that induce differentiation of megakaryocytes and platelets from ES cell lines will be examined, and the effects as platelet production promoting factors will be confirmed.

(Example 5: Automation)
Screening performed in Example 4 can be automated using a robot. In this case, for example, a system using a microplate can be constructed using Beckman Coulter's Biomek series, or a system can be constructed using Zymark's Staccato Mini-System series.

  The lead compound thus obtained can be used for animal experiments. Alternatively, other compounds can be designed based on such lead compounds.

(Example 6: Animal experiment)
Compounds that are found to be Lnk inhibitors, such as in Example 4 or 5, are administered to animals such as mice, rats or monkeys to screen for compounds that modulate platelet production.

  By such screening, substances that actually regulate platelet production can be screened.

  As mentioned above, although this invention has been illustrated using preferable embodiment of this invention, it is understood that the scope of this invention should be construed only by the claims. Patents, patent applications, and documents cited herein should be incorporated by reference in their entirety, as if the contents themselves were specifically described herein. Understood.

  The present invention provides methods, compositions and systems for modulating platelet production. Such adjustment makes it easy to control the production of platelets, and makes it possible to maintain and proliferate them easily and systematically. These utilities are useful in bio-related industries.

FIG. 1 shows that the functional domain of Lnk is important for cell growth regulation. (A) Representative schematic of a pMY vector used to co-express eGFP from a single mRNA with Lnk mutant and internal liposome entry site (IRES). The proline-rich part (stretch; indicated by a white box with a black bar), the SH2 domain (white box), and the N-terminal domain with a tyrosine phosphorylation site (Y) at the C-terminus. Deletion of N-terminal domain (DN), PH domain (DPH) and C-terminal tail (DC) and phenylalanine substitution (Y546F) of Y536 and glutamic acid substitution of R364 (R364E; shown as X in SH2 domain) are shown. (B) MC9 cells transduced with control vector (left column, vector) or MC9 cells transduced with Lnk expression vector (right column, WT) are cultured in the presence of SCF and are alive at a given time The percentage of eGFP ⁺ cells was determined by flow cytometry. (C) The growth rate of MC9 cells expressing the indicated Lnk mutant induced by SCF is determined by dividing the percentage of eGFP ⁺ cells at each given time point at the start of culture (day 0). Comparison was made with cells that had not been introduced. Shown are representative results of multiple independent experiments. FIG. 2 shows that the Lnk SH2 mutant inhibits the negative regulatory function of Lnk dominantly in cell proliferation. (A) Lnk associates with c-Kit via the SH2 domain. COS7 transfectants co-expressing the indicated Lnk mutants and c-Kit were stimulated with SCF and lysed. Proteins immunoprecipitated with anti-Lnk antibody were isolated and immunoblotted with anti-phosphotyrosine antibody to detect c-Kit (upper panel), and immunoblotted Lnk with anti-Lnk antibody to detect ( Lower panel). The association between c-Kit and Lnk was abolished by the R364E SH2 mutation. (B) Multimer formation of Lnk through the N-terminal region. The whole indicated Lnk cell lysate COS7 transformant cells expressing mutant, was treated with a chemical cross-linking agent BS ³ of various concentrations, and subjected to immunoblotting then with anti Lnk antibody. Lnk formed a multimeric complex. This showed slower mobility (arrowhead). Multimerized complexes were not detectable with the dNLnk mutant. (C and D) Lnk SH2 mutants were transduced into MC9-Lnk cells expressing wild type Lnk with retroviruses. Transduced cells were cultured in the presence of SCF and their growth was compared to that of untransduced MC9-Lnk cells. The comparison was determined by grading eGFP ⁺ cells at a given point in time during culture (Day 0). Shown are representative data from three independent experiments. Finally, in addition to the R364E SH2 mutation, the DPH and DC mutations (ΔPH / R364E / ΔC) were determined as the most potent dominant negative mutants having an inhibitory effect on wt Lnk. FIG. 3 shows that ectopic expression of Lnk ΔPH / R364E / ΔC mutant, but not SH2 R364E alone, facilitates the maturation of ES cell-derived megakaryocytopoiesis. (A) Differences between Lnk wt, SH2 R364E alone and the ΔPH / R364E / ΔC mutant of cDNA. N-terminal domain with proline-rich region (white box with black bar), PH domain (hatched box), SH2 domain (white box) and C-terminal tyrosine phosphorylation site (Y) are shown. Two mutant genes were tested in megakaryocytes derived from ES cells. (B) On day 5 of the differentiation protocol, ES cell-derived hematopoietic progenitor cells are encoded for 18 hours with a virus encoding GFP alone, R364E mutant and GFP (R364E-GFP) or ΔPH / R364E / ΔC mutant. And viruses encoding GFP (ΔPH / R364E / ΔC-GFP). Further differentiation was maintained by co-culture with OP9 in the presence of 20 ng / ml TPO. On day 7, cells were analyzed by expression of CD41 (integrin αIIb) in transduced (GFP positive) and non-transduced cells (GFP negative). The average number of CD41 positive cells in GFP negative cells was defined as 1.0. To study maturity, GPIbα expression was also tested. Shown is the mean ± SD of 3 independent experiments. (Results) The number of CD41-expressing cells was not changed between GFP alone, SH2 R364E, and ΔPH / R364E / ΔC-GFP. On the other hand, GPIbα expression, characteristic of the maturation process in megakaryocytes, increased in megakaryocytes transduced with Lnk ΔPH / R364E / ΔC, but not in cells transduced with SH2 R364E alone. This indicates that ΔPH and ΔC can inhibit endogenous Lnk in addition to the SH2 mutant and promote maturation in this culture system. FIG. 4 shows that the Lnk ΔPH / R364E / ΔC mutant increases the number of mature megakaryocytes and proplatelet production. (A) GFP expression mediated by retroviruses in megakaryocytes derived from ES cells. Day 5 hematopoietic progenitor cells were infected with retrovirus encoding GFP alone or encoding ΔPH / R364E / ΔC-GFP. On days 9 and 12, fluorescence images of GFP positive cells showing multiple extensions were obtained at a given exposure time using an inverted fluorescence microscope / computer system. Then, the number of preplatelets in 100 cells was calculated. The dimension of the bar in (A) is 100 μm. (B left) The number of CD41 ⁺ GFP ⁺ cells on day 9 was calculated by flow cytometry. According to dot plot side scatter and forward scatter in flow cytometry, two arbitrary analysis gates were applied as previously described (Eto K, Murphy R, Kerrigan SW, Bertoni A, Stuhlmann H, Nakano. T. Leavitt AD, Shatil SJ (2002) Megakaryocytes derived from embryonic cells cells implicated CalDAG-GEFI in integrated G. A. S U. 99. Proc. Results shown are the mean ± SD of three independent experiments. As shown in (B), ΔPH / R364E / ΔC-GFP transduced cells showed mature megakaryocytes and had increased platelet counts 3 days after retroviral infection. After an additional 3 days, the enhanced production of pre-platelets was maintained by co-culture with OP9 cells, as shown in (B right). FIG. 5 shows that the Lnk ΔPH / R364E / ΔC mutant increases platelet fragmentation from megakaryocytes derived from ES cells. Fragmented particles derived from mature megakaryocytes from day 12 to day 14 were counted by flow cytometry as described in the methods section herein. Shown is the 3 day total of GPIbα ⁺ GFP ⁺ particles. The insertion place of the graph shows an example of dot plot. (Results) The Lnk ΔPH / R364E / ΔC mutant increased the number of ES cell-derived GPIbα ⁺ platelet particles, but the SH2 mutant alone did not. FIG. 6 is a diagram showing Lnk expression in mouse platelets and prolonged bleeding time in the tail in Lnk-deficient mice. (A) Western blot of protein expression in COS7 cells transfected with mouse lnk cDNA and analysis of platelets of the indicated genotype. 25 μg of each lysate prepared with RIPA buffer containing 2% SDS was evaluated with a polyclonal antibody against mouse Lnk (Takaki, S., Morita, H., Tetsuka, Y., and Takasu, K. 2002.). Enhanced hematopoiesis by hematopoietic progenitor cells racking intracellular adapter protein, Lnk. J. Exp. Med. 195: 151-160.). (B) The bleeding time was determined as described in the method column herein. The plotted data were normal mice (n = 5) and Lnk deficient mice (n = 7). FIG. 7 shows platelet aggregation by thrombin and collagen. Washed and resting platelets were applied to a platelet aggregometer and activated with thrombin (0.1 U / ml) or collagen I (0.5 μg / ml). Arrows indicate agonist addition. Shown are representative results of three independent experiments. FIG. 8 shows ex vivo thrombus formation of collagen bound to the surface. Blood was collected from control or Lnk null mice using argatroban as an anticoagulant. Glass cover slips were coated with insoluble fiber type I collagen and placed in parallel plate flow chambers. (A) Whole blood was applied into the flow chamber at a relatively high shear rate (1500 s ⁻¹ ) without adjusting platelet counts from control (10 mice) or Lnk deficient mice (10 mice). The left three frames in the control (Lnk + / +) or Lnk deficiency (Lnk − / −) from serial recordings show the collagen-coated surface at 2 min, 4 min and 7 min after blood perfusion (2 Dimension; XY axis). Thrombus formed from control and Lnk null is shown. On the other hand, a three-dimensional image of Lnk-deficient blood (right frame: Z axis) showed a thrombus that was relatively lower than the height of the control. (B) Reconstituted blood consisting of control PRP or Lnk null PRP along with red blood cells and plasma derived from control blood was applied to the flow chamber at a high shear rate (1500 s ⁻¹ ). The three-dimensional image (Z-axis) in the sample containing Lnk-deficient platelets showed a lower thrombus height than that of the control even when the platelet count was adjusted to 5 × 10 ⁵ / μl for the control. FIG. 9 is a graph showing the thrombus surface area ratio and thrombus height after perfusion in Lnk-deficient blood. (A) Surface area was determined from continuous z-axis intercepts. The data represents the average of three independent experiments on a 1-2 μm high thrombus. (B) Data show the average of three independent experiments at maximum height (μm). FIG. 10 shows integrin αIIβb3 activation by various agonists in Lnk null platelets. ΑIIβb3 activated after addition of various agonists was analyzed by Alexa488-conjugated fibrinogen binding to integrin αIIβb3 in flow cytometry. Nonspecific binding was determined in the presence of 10 mM EDTA. Data show mean fluorescence intensity (FL-1 channel) from 5-8 independent experiments. FIG. 11 shows that a deficiency of lamellipodia formation was seen for fibrinogen in Lnk null platelets. Platelets were obtained from Lnk − / − and control mice and seeded on fibrinogen for 45 minutes with no agonist; ADP (50 μM) or PAR4 receptor activating peptide (1 mM). The cells were then fixed, permeabilized and stained for F-actin (red) and phosphotyrosine (tyrosine phosphorylation; green). This was analyzed by a confocal microscope. The arrowhead indicates a filamentous temporary foot. Bar indicates 10 μm. FIG. 12 is an explanatory diagram of the function control of hematopoietic stem cells that is possible by blocking the Lnk function.

(Explanation of sequence listing)
SEQ ID NO: 1 is the nucleic acid sequence of Lnk.
SEQ ID NO: 2 is the amino acid sequence of Lnk.
SEQ ID NO: 3 is the nucleic acid sequence of a dominant negative mutant of Lnk.
SEQ ID NO: 4 is the amino acid sequence of a dominant negative mutant of Lnk.
SEQ ID NO: 5 is the nucleic acid sequence of SCF.
SEQ ID NO: 6 is the amino acid sequence of SCF.
SEQ ID NO: 7 is the nucleic acid sequence of Lnk variant R364E.
SEQ ID NO: 8 is the amino acid sequence of Lnk variant R364E.
SEQ ID NO: 9 is the nucleic acid sequence of the Lnk mutant ΔPH.
SEQ ID NO: 10 is the amino acid sequence of the Lnk mutant ΔPH.
SEQ ID NO: 11 is the nucleic acid sequence of Lnk mutant ΔN.
SEQ ID NO: 12 is the amino acid sequence of Lnk variant ΔN.
SEQ ID NO: 13 is the nucleic acid sequence of Lnk variant Y536F.
SEQ ID NO: 14 is the amino acid sequence of Lnk variant Y536F.
SEQ ID NO: 15 is a primer used for the preparation of R364E.
Sequence number 16 is the primer used for preparation of R364E.
SEQ ID NO: 17 is a primer used for the preparation of ΔPH.
SEQ ID NO: 18 is a primer used for the preparation of ΔPH.
SEQ ID NO: 19 is a primer used for the preparation of ΔN.
SEQ ID NO: 20 is a primer used for the preparation of ΔN.
Sequence number 21 is the primer used for preparation of Y536F.
Sequence number 22 is the primer used for preparation of Y536F.

Claims (25)

A method of producing platelets comprising:
A) inhibiting the function of Lnk or its equivalent in platelet precursor cells; and B) differentiating the platelet precursor cells;
Including the method. The method of claim 1, wherein the platelet precursor cells include embryonic stem cells and megakaryocytes. The method according to claim 1, wherein the inhibition comprises inhibition of the Lnk or an equivalent thereof by a dominant negative method. 4. The method according to claim 3, wherein the inhibition is achieved by introducing a mutant Lnk capable of suppressing Lnk activity by a retrovirus. The method according to claim 1, wherein the Lnk has the nucleotide sequence shown in SEQ ID NO: 1, encodes the amino acid sequence shown in SEQ ID NO: 2, or is a variant or fragment thereof. The method according to claim 1, comprising the step of contacting the platelet precursor cells with stem cell factor (SCF) in the step B. 2. The method of claim 1, wherein the inhibition is achieved by inhibition by Lnk nucleic acid levels. 2. The method of claim 1, wherein the inhibition is achieved by inhibition with Lnk antisense or RNAi. 2. The method of claim 1, wherein the inhibition is achieved by inhibition by Lnk product levels. The method of claim 1, wherein the inhibition is achieved by inhibition of Lnk with an antibody. The method of claim 1, wherein the platelet precursor cells comprise megakaryocytes derived from embryonic stem cells. 12. The method of claim 11, wherein the induction is achieved by culture on OP9 stromal cells and co-culture with bipolar hemangioblasts. In differentiation into megakaryocytes, A) differentiation and maturation from hemangioblasts (VEGF type 2 receptor; Flk-1, KDR) and c-kit positive cells; B) physical contact with OP9 stromal cells Is essential for differentiation and maturation into megakaryocytes; and C) platelet production is possible on OP9 stromal cells, but is promoted by using conditions other than contact with OP9. 12. The method of claim 11, having at least one feature selected. Platelets produced by the method of claim 1. A method of screening for substances that modulate the rate of platelet production,
A) a step of selecting a substance that interacts with Lnk or the Lnk promoter; and B) a step of determining whether or not to differentiate by contacting the selected substance with platelet progenitor cells and selecting the substance having a differentiation-regulating action. Including the method. A composition comprising platelets with impaired Lnk or its function. 17. A composition according to claim 16, wherein the composition is used for the treatment of patients having viscous blood. A factor that inhibits Lnk or its gene product. 19. The factor of claim 18, wherein the factor is selected from the group consisting of a dominant negative factor, a promoter binding factor, RNAi, an antibody and a small molecule. A composition for regulating the rate of platelet production, comprising an agent that inhibits Lnk or its gene product. 21. The composition of claim 20, wherein the factor is selected from the group consisting of a dominant negative factor, a promoter binding factor, RNAi, an antibody and a small molecule. 21. The composition of claim 20, wherein the factor is a functional variant of Lnk or its gene product. 21. The composition of claim 20, wherein the factor is a variant nucleic acid having the nucleotide sequence set forth in SEQ ID NO: 3. Use of an agent that inhibits Lnk or its gene product to modulate the rate of platelet formation. Use of an agent that inhibits Lnk or its gene product for the manufacture of a composition for the modulation of the rate of platelet production.