JP2007068402A - Immune response regulatory protein - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To obtain a new human immune response regulatory protein, its gene and antibody and a pharmaceutical composition using them. <P>SOLUTION: The human immune response regulatory protein has a specific amino acid sequence or a sequence in which one or a plurality of amino acid residues are deleted, added or substituted with other amino acid residues in the amino acid sequence. The specific base sequence encodes the protein. The antibody specifically recognizes the protein. The pharmaceutical composition for immune-related diseases including cancer, allergy, autoimmune disease and inflammatory disease is obtained by using them. <P>COPYRIGHT: (C)2007,JPO&INPIT

Description

  The invention of this application relates to a novel human immune response regulatory gene and a human immune response regulatory protein that regulate the immune response.

  The immune system plays an essential role in biological defense. The activation of the immune system is regulated by various trace protein substances secreted between cells, inside or outside the cells. Immune cells work to protect the body through these molecules while maintaining homeostasis. On the other hand, the failure of the immune system not only causes serious infections, but also causes various diseases such as autoimmune diseases, allergies, immune deficiencies, and cancer. Therefore, elucidation of trace protein substances that regulate immunity is important for accurately grasping various pathological conditions involved in the immune system and making effective treatment policies. It is thought that this can be overcome.

  Examples of proteins involved in the regulation of immune response include interleukin (IL) 1-29, lipid A, phospholipase A2, endotoxin, staphylococcal enterotoxin B and other toxins, type I interferon, type II interferon, tumor necrosis Factor, transforming growth factor-β (“TGF-β”), lymphotoxin, migration inhibitory factor, granulocyte macrophage colony stimulating factor (CSF), monocyte macrophage CSF, granulocyte CSF, vascular epidermal growth factor, angiotensin, trans Forming growth factors, heat shock proteins, blood sugar groups, Rh factors, fibroblast growth factors, chemokines, etc. are known, but these known trace proteins alone explain the pathology of various immune abnormalities It is predicted that there will be more unknown immune response modulators. It is conceived.

On the other hand, effective methods of using these immune response modulators have also greatly advanced. For example, a labeled delivery system combined with a metal colloid, an immune response modulator using the same, and a monoclonal antibody production method Etc. have been proposed (Patent Document 1).
Special Table 2002-503639

  A trace protein that promotes or regulates the immune response can not only be a drug that prevents or corrects various diseases related to immune abnormalities such as carcinogenesis and allergies, autoimmune diseases, chronic infections, etc. It is also useful as a diagnostic marker for grasping, and has the potential as a target protein for developing antibody drugs and small molecule drugs. Those having an immunostimulatory effect are also useful as vaccine additives. Therefore, it is desired to obtain as many immune-related proteins as possible. The invention of this application has been made in view of the above circumstances, and an object thereof is to provide a novel human immune response-regulating protein, its gene, antibody, and an invention using them.

  This application provides the following invention to solve the above-mentioned problems.

  That is, the first invention is an isolated human gene, wherein the amino acid sequence of SEQ ID NO: 2, or one or more amino acid residues in SEQ ID NO: 2 is deleted, added or substituted with another amino acid residue An immune response regulatory gene encoding an immune response regulatory protein having the sequence described above.

  One embodiment of the immune response regulatory gene of the first invention is a gene in which the cDNA synthesized from the transcript mRNA has the base sequence of SEQ ID NO: 1.

  The second invention is a polynucleotide purified from the genomic DNA, mRNA, cDNA or their complementary sequence of the immune response regulatory gene of the first invention.

  The third invention is an oligonucleotide that hybridizes under stringent conditions with the immune response regulatory gene of the first invention or the purified polynucleotide of the second invention.

  The fourth invention is a primer set for PCR amplification of the immune response regulatory gene of the first invention or the purified polynucleotide of the second invention.

  The fifth invention is a recombinant vector carrying the purified polynucleotide of the second invention or the oligonucleotide of the third invention.

  The sixth invention is a transformed cell by the recombinant vector of the fifth invention.

  The seventh invention is a purified human protein having the amino acid sequence of SEQ ID NO: 2 or a sequence in which one or more amino acid residues in SEQ ID NO: 2 are deleted, added or substituted with other amino acid residues It is an immune response regulatory protein.

  One aspect of the immune response regulating protein of the seventh invention is a protein that is an expression product of the immune response regulating gene of the first invention or the polynucleotide of the second invention.

  The eighth invention is a purified or synthesized peptide comprising a part of the immune response regulating protein of the seventh invention.

  One embodiment of the peptide of the eighth invention is a peptide consisting of 8 or more consecutive amino acid sequences of amino acid residues 1-164 in SEQ ID NO: 2.

  A ninth invention is a monoclonal antibody or a polyclonal antibody that specifically recognizes the immune response-regulating protein of the seventh invention. The tenth invention is a hybridoma cell that produces the monoclonal antibody.

The eleventh invention is a pharmaceutical composition for the purpose of regulating immune response,
(a) the polynucleotide of the second invention;
(b) the recombinant vector of the fifth invention;
(c) the immune response-regulating protein of the seventh invention;
(d) the peptide of the eighth invention; and
(e) the monoclonal or polyclonal antibody of the ninth invention,
A pharmaceutical composition comprising at least one selected from the group consisting of: This pharmaceutical composition includes, for example, anti-inflammatory agents, anti-allergic agents, immune response modifiers, anti-infective agents, anti-cancer agents, immunostimulants, and vaccine preparations.

  A twelfth aspect of the invention is a method for measuring the expression level of the immune response regulatory gene of the first aspect of the invention, wherein the expression level of the gene in a biological sample isolated from a subject is measured. This is a level measurement method. In the method of the twelfth invention, a specific embodiment is that the gene expression product is mRNA or the immune response regulating protein of the seventh invention.

    A thirteenth invention is a cell or animal in which the immune response protein of the seventh invention is overexpressed.

  A fourteenth invention is a method for producing an antibody against an arbitrary protein in an animal body, comprising the steps of administering an antigenic substance to the animal of the thirteenth invention and isolating the antibody from the animal. It is a characteristic method.

  In the present invention, “polynucleotide” means a nucleoside phosphate ester (ATP, GTP, CTP, UTP; or dATP, dGTP, dCTP, dTTP) in which purine or pyrimidine is β-N-glycoside-linked to a sugar. A molecule in which 100 or more molecules are bound is referred to, and an “oligonucleotide” is a molecule in which 2-99 molecules are linked. “Protein” and “peptide” mean a molecule composed of a plurality of amino acid residues joined together by amide bonds (peptide bonds) or non-natural residue linkages.

  In the present invention, “one or a plurality of amino acid residues are deleted, added or substituted with other amino acid residues” means that the function of the immune response regulatory protein of the present invention is not substantially changed. It means that 30% or less, preferably 20% or less, more preferably 10% or less of amino acid residues in the total amino acid sequence are added, deleted or substituted.

  Other terms and concepts in each invention of this application are defined in detail in the description of the embodiments and examples of the invention. Various techniques used for carrying out the present invention can be easily and surely implemented by those skilled in the art based on known documents and the like, except for a technique that clearly indicates the source. For example, the preparation of the pharmaceutical composition of the present invention is described in Remington's Pharmaceutical Sciences, 18th Edition, ed.A. Gennaro, Mack Publishing Co., Easton, PA, 1990, and genetic engineering and molecular biological techniques are described in Sambrook and Maniatis, in Molecular Cloning-A Laboratory Manual, Cold Spring Harbor Laboratory Press, New York, 1989; Ausubel, FM et al., Current Protocols in Molecular Biology, John Wiley & Sons, New York, NY, 1995, etc. Furthermore, the terms in the present invention are basically based on the IUPAC-IUB Commission on Biochemical Nomenclature, or based on the meanings of terms conventionally used in the field.

  The immune response regulatory gene of the present invention is a human gene encoding an immune response regulatory protein (hereinafter sometimes referred to as “UKC1”), specifically, an immune response regulatory protein having the amino acid sequence of SEQ ID NO: 2. It is a human gene that encodes. The UKC1 gene has the cDNA sequence of SEQ ID NO: 1.

The UKC1 gene can be isolated by screening with a human genomic library using the oligonucleotide probe provided by this invention. As the probe, for example, a partial sequence (15 bp or more) of a purified polynucleotide (for example, cDNA) provided by the present invention or a complementary sequence thereof can be used. Screening with a probe can be performed under stringent conditions that allow specific hybridization between genomic DNA and the probe. Stringent conditions are defined by the salt concentration, organic solvent (formaldehyde, etc.) concentration, temperature conditions, etc. in the hybridization and washing steps. For example, the conditions disclosed in US Pat. No. 6,100,037 and the like can be employed. The labeling of the probe can be performed by a radioisotope (RI) method or a non-RI method, but it is preferable to use a non-RI method. Examples of the non-RI method include a fluorescence labeling method, a biotin labeling method, a chemiluminescence method, and the like, but it is preferable to use a fluorescence labeling method. As the fluorescent substance, those capable of binding to the base moiety of the oligonucleotide can be appropriately selected and used. However, cyanine dyes (eg, Cy Dye ^TM series Cy3, Cy5 etc.), rhodamine 6G reagent, N-acetoxy- N ² -acetylaminofluorene (AAF), AAIF (iodine derivative of AAF) and the like can be used.

  The UKC1 gene can also be amplified by PCR (Polymerase Chain Reaction) using a suitable primer set and human genomic DNA or cDNA prepared from cells expressing this gene as a template. The primer set can be prepared by combining two or more partial sequences (15 bp or more) selected from the purified polynucleotide (cDNA) provided by the present invention. It is also possible to amplify the upstream of the gene by 5 ′ RACE method using one primer on the 5 ′ side of cDNA and the downstream part of the gene by 3 ′ RACE method using one primer on the 3 ′ side of cDNA. . In addition, the following can also be pointed out as points to keep in mind when designing primers. The size (number of bases) of the primer is 15-40 bases, preferably 15-30 bases in consideration of satisfying specific annealing with the template DNA. However, when LA (long and accurate) PCR is performed, at least 30 bases are efficient. The complementary sequence between both primers should be avoided so that one or a pair (two) of the primer consisting of the sense strand (5 ′ end side) and the antisense strand (3 ′ end side) does not anneal to each other. Further, in order to ensure stable binding to the template DNA, the GC content is set to about 50% so that GC-rich or AT-rich is not unevenly distributed in the primer. Since the annealing temperature depends on Tm (melting temperature), in order to obtain a highly specific PCR product, primers having Tm values of 55 to 65 ° C. that are close to each other are selected. In addition, it is necessary to pay attention to adjusting the final concentration of primers used in PCR to be about 0.1 to about 1 μM. Also, commercially available software for primer design such as Oligo ™ [manufactured by National Bioscience Inc. (USA)], GENETYX (manufactured by Software Development Co., Ltd. (Japan)) and the like can be used.

  The full-length genomic gene thus obtained is, for example, a gene amplification that is usually performed, such as PCR, NASBN (Nucleic acid sequence based amplification), TMA (Transcription-mediated amplification), and SDA (Strand Displacement Amplification). It can also be amplified by the method.

  The UKC1 genomic gene can be used to prepare a purified polynucleotide (DNA fragment or RNA fragment) from mRNA transcribed by this gene or cDNA synthesized from mRNA. For example, cDNA can be synthesized using poly (A) + RNA extracted from human cells as a template. The human cell may be either one isolated from a living body or a cultured cell as long as UKC1 is expressed. cDNA can be synthesized using a known method (Mol. Cell. Biol. 2, 167-170, 1982; J. Gene 25, 263-269, 1983; Gene, 150, 243-250, 1994). Alternatively, the target cDNA can also be synthesized by RT-PCR method using mRNA isolated from human cells as a template, using a primer set designed based on the information provided by the present invention. Alternatively, the target cDNA can also be synthesized by synthesizing partial sequences with a DNA oligo synthesizer and connecting them using an enzymatic method and a subcloning method. Specifically, the cDNA thus prepared has the base sequence of SEQ ID NO: 1. These polynucleotides can be used for genetic engineering production of UKC1 protein. These polynucleotides can also be used as genetic material (transgene) for overexpressing the UKC1 protein in the living body. When the UKC1 protein is to be genetically engineered or used as a transgene, it may not be the full length of SEQ ID NO: 1, for example, a polynucleotide sequence constituting at least each protein coding region (CDS) It's okay. In addition, when a gene is introduced in order to improve animal antigen recognition for a target antigen, for example, an oligonucleotide or a polynucleotide containing 60 or more consecutive bases in the base sequence of SEQ ID NO: 1 can be used. . Such oligonucleotides or polynucleotides can be prepared, for example, by cleaving cDNA with an appropriate restriction enzyme, or in the literature (for example, Carruthers (1982) Cold Spring Harbor Symp. Quant. Biol. 47: 411-418; Adams (1983) J. Am. Chem. Soc. 105: 661; Belousov (1997) Nucleic Acid Res. 25: 3440-3444; Frenkel (1995) Free Radic. Biol. Med. 19: 373-380; Blommers (1994) ) Biochemistry 33: 7886-7896; Narang (1979) Meth. Enzymol. 68:90; Brown (1979) Meth. Enzymol. 68: 109; Beaucage (1981) Tetra. Lett. 22: 1859; US Pat. No. 4,458,066) Can be synthesized in vitro by well-known chemical synthesis techniques such as those described in.

  The recombinant vector of the present invention is a cloning vector or an expression vector, and an appropriate one is used according to the type of polynucleotide as an insert, the purpose of use, and the like. For example, when producing UKC1 protein using cDNA or its ORF region as an insert, expression vectors for in vitro transcription, prokaryotic cells such as E. coli and Bacillus subtilis, yeast, insect cells, and eukaryotic cells such as mammalian cells are used. Expression vectors suitable for each can also be used. Moreover, when using genomic DNA of UKC1 gene as an insert, a BAC (Bacterial Artificial Chromosome) vector, a cosmid vector, or the like can also be used.

  For example, when the UKC1 protein is produced in large quantities, the transformed cells of the present invention can use prokaryotic cells such as Escherichia coli and Bacillus subtilis and eukaryotic cells such as yeast, insect cells and mammalian cells. . These transformed cells can be prepared by introducing a recombinant vector into cells by a known method such as electroporation, calcium phosphate method, liposome method, DEAE dextran method.

  The UKC1 protein of the present invention is provided by a method of isolating a human organ or cell line using a specific antibody or the like, a method of preparing a peptide by chemical synthesis based on the amino acid sequence of SEQ ID NO: 2, or the present invention The purified polynucleotide (cDNA or its translation region) can be used for production by a recombinant DNA technique, but a method for obtaining by a recombinant DNA technique is preferably used. For example, a protein can be expressed in vitro by preparing RNA from a vector having the above-mentioned polynucleotide by in vitro transcription and performing in vitro translation using this as a template. If the polynucleotide is recombined into an appropriate expression vector by a known method, the protein encoded by the polynucleotide in prokaryotic cells such as Escherichia coli and Bacillus subtilis, and eukaryotic cells such as yeast, insect cells and mammalian cells. Can be expressed in large quantities.

  When UKC1 protein is produced by expressing DNA in vitro, a recombinant vector is prepared by inserting the above-described polynucleotide into a vector having an RNA polymerase promoter, and this vector is converted into an RNA polymerase corresponding to the promoter. UKC1 protein can be produced in vitro by adding it to an in vitro translation system such as a rabbit reticulocyte lysate or wheat germ extract. Examples of the RNA polymerase promoter include T3, T7, SP6 and the like. Examples of vectors containing these RNA polymerase promoters include pKA1, pCDM8, pT3 / T718, pT7 / 319, and pBluescriptII.

  When the UKC1 protein is produced by expressing DNA in a microorganism such as Escherichia coli, the polynucleotide is added to an expression vector having an origin, promoter, ribosome binding site, DNA cloning site, terminator sequence, etc. that can replicate in the microorganism. If a recombinant expression vector is prepared and a host cell is transformed with this expression vector and then the obtained transformant is cultured, the protein encoded by the polynucleotide can be mass-produced in a microorganism. it can. At this time, if a start codon and a stop codon are added before and after an arbitrary translation region and expressed, a protein fragment containing the arbitrary region can be obtained. Alternatively, it can be expressed as a fusion protein with another protein. It is also possible to obtain only the protein portion encoded by this polynucleotide by cleaving this fusion protein with an appropriate protease. Examples of the expression vector for E. coli include pUC system, pBluescriptII, pET expression system, pGEX expression system and the like.

  When the UKC1 protein is produced by expressing DNA in eukaryotic cells, the polynucleotide is inserted into an expression vector for eukaryotic cells having a promoter, a splicing region, a poly (A) addition site, etc. UKC1 protein can be produced in eukaryotic cells by creating a replacement vector and introducing it into eukaryotic cells. Examples of expression vectors include pKA1, pCDM8, pSVK3, pSVL, pBK-CMV, pBK-RSV, EBV vector, pRS, pYE82 and the like. Moreover, if pIND / V5-His, pFLAG-CMV-2, pEGFP-N1, pEGFP-C1, etc. are used as an expression vector, it can be expressed as a fusion protein to which various tags such as His tag, FLAG tag, and GFP are added. . As eukaryotic cells, mammalian cultured cells such as monkey kidney cell COS-7, Chinese hamster ovary cell CHO, budding yeast, fission yeast, silkworm cell, Xenopus egg cell, etc. are generally used, but can express UKC1 protein. Any eukaryotic cell can be used. In order to introduce the expression vector into eukaryotic cells, a known method such as electroporation, calcium phosphate method, liposome method, DEAE dextran method can be used.

  In order to isolate and purify the target protein from the culture after expressing the UKC1 protein in prokaryotic cells or eukaryotic cells, known separation operations can be combined. For example, treatment with denaturing agents and surfactants such as urea, ultrasonic treatment, enzyme digestion, salting out and solvent precipitation, dialysis, centrifugation, ultrafiltration, gel filtration, SDS-PAGE, isoelectric focusing, Ion exchange chromatography, hydrophobic chromatography, reverse phase chromatography, affinity chromatography (including methods using tag sequences and methods using polyclonal antibodies and monoclonal antibodies specific to UKC1), and the like.

  The recombinant UKC1 protein obtained by the above method includes a fusion protein with any other protein. Examples thereof include a fusion protein with glutathione-S-transferase (GST) and green fluorescent protein (GFP). Furthermore, the protein of the invention may be subjected to various modifications in the cell after being translated. Therefore, modified proteins are also included in the scope of the protein of the invention. Examples of such post-translational modifications include elimination of N-terminal methionine, N-terminal acetylation, glycosylation, limited degradation by intracellular protease, mistrailization, isoprenylation, phosphorylation and the like.

  The peptide of the present invention is a peptide fragment consisting of a part of UKC1 protein. That is, it is a peptide having a continuous 8-amino acid sequence, 9-30 amino acid sequence, 31-60 amino acid sequence, 61-110 amino acid sequence, 111-160 amino acid sequence in SEQ ID NO: 2. More specifically, it is a peptide consisting of 8 or more consecutive amino acid sequences of the 1-164 amino acid residues in SEQ ID NO: 2. That is, as shown in Examples below, UKC1 protein has an immune cell activating effect. Therefore, the UKC1 partial peptide can be used as a raw material for improving antigen recognition in animals by, for example, fusing antigens, and can also be used for causing immune tolerance in animals by overdose or the like.

These peptides can be prepared by cleaving the UKC1 protein with an arbitrary proteolytic enzyme. Further, based on the amino acid sequence of SEQ ID NO: 2, a known peptide synthesis method (Merrifield, RBJ Solid phase peptide synthesis I. The synthesis of tetrapeptide. J. Amer. Chem. Soc. 85, 2149-2154, 1963; Fmoc Solid Phase Peptide Synthesis. A Practical Approach. Chan, WC and White, PD, Oxford University Press, 2000). Moreover, these peptides may consist of residue linkages other than natural amide bonds. Residue linkages other than natural amide bonds may be chemistry such as glutaraldehyde, N-hydroxysuccinimide ester, bifunctional maleimide, N, N'-dicyclohexylcarbodiimide (DCC), or N, N'-diisopropylcarbodiimide (DIC). A coupling or coupling means can be illustrated. Linking groups that can substitute for peptide bonds include, for example, ketomethylene (eg, —C (═O) —NH— for —C (═O) —CH ₂ —), aminomethylene (CH ₂ —NH), ethylene, olefin (CH = CH), ether (CH2-O), thioether (CH ₂ -S), tetrazole (CN ₄ -), thiazole, retro amide, including thioamide, or ester (e.g., Spatola (1983) in Chemistry and Biochemistry of Amino Acids, Peptides and Proteins, Vol. 7, pp 267-357, "Peptide Backbone Modifications," Marcell Dekker, NY).

The antibody of this invention is a polyclonal antibody or a monoclonal antibody specific for animal-derived UKC1. Specifically, it is an antibody prepared using a purified UKC1 protein or a partial peptide thereof as an antigen. The antibody of the present invention includes all molecules capable of binding to the epitope of UKC1 protein, Fab, F (ab ′) ₂ , Fv fragments, and the like.

  For example, a polyclonal antibody can be obtained from serum after immunizing an animal using the UKC1 protein or peptide as an antigen. As the animal, mouse, rat, hamster, rabbit, goat, sheep, cow, horse, pig, dog, cat, monkey, chicken and the like are used. In addition, when it is desired to obtain human-type antibodies for the purpose of human therapy, recombinant animals carrying human immunoglobulin genes are also used. Immunization of animals with immunizing antigen peptides is a known method (for example, Shigeru Muramatsu, et al., Laboratory Biology Course 14, Immunobiology, Maruzen Co., Ltd., 1985, Japan Biochemical Society, Secondary Biochemistry Experiment Course 5, Immune Biochemistry Research Method, Tokyo Chemical Doujin, 1986, edited by the Japanese Biochemical Society, New Chemistry Experiment Course 12, Molecular Immunology III, Antigen / Antibody / Complement, Tokyo Chemical Doujin, 1992, etc.) It can be done according to this. For example, as a general method, immunization can be performed by injecting an antigen peptide intraperitoneally or subcutaneously into a mammal. The antigenic peptide may also be administered with an adjuvant. Examples of the adjuvant include Freund's complete (or incomplete) adjuvant, Ribi adjuvant, pertussis vaccine, BCG, lipid A, liposome, aluminum hydroxide, silica and the like.

  The antiserum containing the polyclonal antibody can be prepared from blood collected from an immunized animal after breeding for a predetermined period.

  Monoclonal antibodies are known monoclonal antibody production methods ("monoclonal antibodies", Nagamune Kamei, Terada Hiroko, Yodogawa Shoten, 1990; "Monoclonal Antibody" James W. Goding, third edition, Academic Press, 1996; Monoclonal Antibody Production Techniques and Applications, pp. 79-97, Marcel Dekker, Inc., New York, 1987, etc.).

  The antibodies of the present invention include those bound with various labels (enzymes, radioisotopes, fluorescent dyes, low molecules such as biotin, toxins, etc.).

  These antibodies are used for diagnostic purposes, for example, to detect the UKC1 protein in clinical specimens such as blood, urine, tissue fragments, etc. and in cultured cells to ascertain the pathological condition. In that case, Western blotting, immunoprecipitation method, immunohistochemical method, flow cytometry, RIA, ELISA method and the like can be used according to the purpose. Moreover, these antibodies are useful for purifying UKC1 from materials containing natural UKC1 or recombinant UKC1, as shown in the Examples below. The specific antibody can also be used for the purpose of neutralizing endogenous UKC1 and regulating immune response by administering it to experimental animals or the like. In addition, humanized monoclonal antibodies produced from animals or human monoclonal antibodies prepared from animals carrying human immunoglobulin genes are administered to humans and used for the purpose of diagnosis, treatment and prevention of diseases.

  The eleventh invention comprises one or more components selected from the group consisting of the aforementioned polynucleotides, recombinant vectors, immune response regulating proteins, peptides and antibodies, and a pharmaceutical composition for the purpose of immune response regulation It is a thing. Each of the above components is formulated as a form that can be introduced into a living body or cells by known methods and means. As a drug form, the polypeptide expression vector may be incorporated into, for example, a hollow nanoparticle displaying a biorecognition molecule or a known virus vector (retrovirus, adenovirus, adeno-associated virus, etc.). By introducing such a drug into a living body by a gene therapy technique, an immune response regulatory protein can be expressed in a living cell. In order to make the immune response regulatory protein or peptide into a form that can be introduced into the living body, for example, the protein or peptide in a pharmacologically acceptable carrier solution without changing the structure or function of the protein or peptide. Alternatively, it can be formulated by mixing peptides. There is also a method in which a living tissue or cell is once taken out of the body, treated with these UKC1 proteins or peptides in vitro to induce a desired character, and then returned to the living body. In addition, it is possible as one form of treatment to introduce a UKC1 gene expression vector into tissues or cells taken out from a living body and then return it to the living body. In such a case, it can be introduced into cells by, for example, a microinjection method. Alternatively, intracellular introduction methods using lipids (BioPORTER (Gene Therapy Systems, USA), Chariot (Active Motif, USA), etc.) can also be employed. The pharmaceutical composition thus formulated is, for example, an anti-inflammatory agent, an antiallergic agent, an immune response modifier, an anti-infective agent, an anticancer agent, an immunostimulant, a vaccine formulation or the like.

  A twelfth aspect of the invention is a method for measuring the expression level of the immune response regulatory gene of the first aspect of the invention, wherein the expression level of the gene in a biological sample isolated from a subject is measured. This is a level measurement method.

  When mRNA is used as an expression product, for example, quantitative probe hybridization or microarray can be used. Specifically, as a hybridization method using a labeled DNA probe, for example, a known method such as the Allele-specific Oligonucleotide Probe method, Oligonucleotide Ligation Assay method, Invader method or the like can be employed. Moreover, the measurement in a microarray can be performed as follows, for example. That is, cDNA is synthesized and amplified by PCR using mRNA isolated from a biological sample (eg, blood) of a subject as a template. At that time, labeled dNTP is incorporated into labeled cDNA. The labeled cDNA is brought into contact with the macroarray, and the cDNA hybridized with the capture probe (oligonucleotide) of the microarray is quantitatively detected. Hybridization can be performed by dispensing a 96- or 384-well plastic plate and spotting a labeled cDNA aqueous solution on the microarray. The amount of spotting can be about 1 to 100 nl. Hybridization is preferably performed in the temperature range of room temperature to 70 ° C. for 6 to 20 hours. After completion of hybridization, washing is performed using a mixed solution of a surfactant and a buffer to remove unreacted labeled cDNA. As the surfactant, sodium dodecyl sulfate (SDS) is preferably used. As the buffer solution, a citrate buffer solution, a phosphate buffer solution, a borate buffer solution, a Tris buffer solution, a Good buffer solution, or the like can be used, and a citrate buffer solution is preferably used.

  Alternatively, the amount of mRNA can also be measured by quantitative RT-PCR using mRNA isolated from a subject as a template and the primer set of the fourth invention.

Furthermore, when targeting the immune response regulatory protein of this invention as an expression product, the method using the antibody of the ninth invention is preferred. In particular, by using a labeled antibody, simple and highly accurate detection becomes possible. The label can be an enzyme, a radioisotope or a fluorescent dye. The enzyme is not particularly limited as long as it satisfies the conditions such as a large turnover number, stability even when bound to an antibody, and specific coloring of a substrate, and is used for normal EIA. Enzymes such as peroxidase, β-galactosidase, alkaline phosphatase, glucose oxidase, acetylcholinesterase, glucose-6-phosphate dehydrogenase, malate dehydrogenase and the like can also be used. Moreover, an enzyme inhibitor, a coenzyme, etc. can also be used. These enzymes and antibodies can be bound by a known method using a crosslinking agent such as a maleimide compound. As the substrate, a known substance can be used according to the type of enzyme used. For example, when peroxidase is used as an enzyme, 3,3 ′, 5,5′-tetramethylbenzidine can be used, and when alkaline phosphatase is used as an enzyme, paranitrophenol or the like can be used. As the radioisotope, those used in usual RIA such as ¹²⁵ I and ³ H can be used. As the fluorescent dye, those used in usual fluorescent antibody methods such as fluorescein isothiocyanate (FITC) and tetramethylrhodamine isothiocyanate (TRITC) can be used. When using an enzyme, add a substrate that decomposes due to enzymatic action and develops color, optically measures the amount of degradation of the substrate, obtains the enzyme activity, converts this to the amount of bound antibody, and compares it with the standard value. From this, the antibody amount is calculated. When using a radioactive isotope, the radiation dose emitted by the radioactive isotope is measured with a scintillation counter or the like. In addition, when a fluorescent dye is used, the amount of fluorescence may be measured by a measuring device combined with a fluorescence microscope. Moreover, it can also measure using a flow cytometer. Furthermore, a sandwich method using a primary antibody and a labeled secondary antibody (“ELISA method” when an enzyme is used as a label) can be preferably used.

  Next, the cell or animal of the thirteenth invention in which the UKC1 protein is excessively expressed will be described. This animal or cell is prepared by, for example, a method of injecting a UKC1 protein solution into an animal; a method of administering a metal colloid and UKC1 protein as described in Patent Document 1 and administering to the animal; a retrovirus vector or an adenovirus vector A method of introducing an active UKC1 gene (ie, a purified polynucleotide linked with a high expression promoter) into an animal according to a gene therapy method using a calcium; a method using a calcium phosphate method, a liposome or an erythrocyte ghost, electroporation Or a method of introducing the UKC1 gene into cells by a microinjection method using a glass pipette or the like.

  Furthermore, these animals and cells can be produced according to a known transgenic animal production method (for example, Proc. Natl. Acad. Scl. USA 77; 7380-7384, 1980). That is, an active UKC1 gene is introduced into a totipotent cell of a non-human animal (preferably mouse or rat), this cell is generated into an individual, and an individual in which the UKC1 gene is integrated into the somatic cell genome is selected. By doing so, a target transgenic animal can be prepared. As a method for gene transfer into totipotent cells, the physical injection (microinjection) of foreign gene DNA is optimal when considering the high yield of transgenic animals and the efficiency of transgene transfer to the next generation. . The fertilized egg into which the gene has been injected is then transplanted into the oviduct of the foster parent, and after raising and born animals to foster parents, DNA is extracted from a part of the body (such as the tip of the tail) and then Southern By confirming the presence of the foreign gene introduced by blot analysis or PCR assay, a primary heterozygous animal having the foreign gene introduced into one of the diploid chromosomes is obtained, and the heterozygotes are mated. Homozygous animals are obtained. The transgenic animals of the present invention include primary heterozygous animals, homozygous animals obtained by mating heterozygotes, their progeny animals, or their fetuses.

  A fourteenth invention is a method for producing an antibody against an arbitrary protein in an animal body, comprising the steps of administering an antigen to the animal of the thirteenth invention and isolating the antibody from the animal. It is a method. Specifically, the same means as the animal preparation of the thirteenth invention (for example, a method of administering UKC1 protein to an animal, a method of introducing a UKC1 gene into an animal according to a gene therapy method, etc.) In addition to increasing the activity of the UKC1 protein, any antigenic substance is administered to the animal. Since the immune response of animals is activated by the administration and high expression of UKC1 protein, it is possible to efficiently produce antibodies. Another embodiment of the fourteenth invention is a method for producing an antibody using a transgenic animal having an activated UKC1 gene in somatic cells. Since this animal overexpresses the UKC1 protein due to high expression of the introduced UKC1 gene and has a high immune response ability, it efficiently produces antibodies. The antibody is a polyclonal antibody or a monoclonal antibody, and can be prepared by the same procedure as the antibody of the ninth invention.

  EXAMPLES Next, the present invention will be described in more detail and specifically with reference to examples, but the present invention is not limited to these examples. The basic procedures and enzyme reactions related to DNA recombination were in accordance with the literature ("Molecular Cloning, Laboratory Manual" Cold Spring Harbor Laboratory, 1989). Unless otherwise specified, restriction enzymes and various modifying enzymes were used from Invitrogen. The buffer composition of each enzyme reaction and the reaction conditions were in accordance with the attached instructions.

  Human Th1 and Th2 cells were prepared from peripheral blood lymphocytes of healthy individuals according to a previous report [Nagata et al .. J Immunol: 1999; 162 (3): 1278-8630]. The probe for detecting UKC1 gene expression uses a 22-mer sense primer (CAGCCCAGCCATCCGGGCATAT: SEQ ID NO: 3) and a 22-mer antisense primer (CCGAGGGCTCCCCCAGGGAG: SEQ ID NO: 4), using human Th2 cell poly (A) + RNA as a template As a result of amplification by RT-PCR. The obtained PCR product (590 bp) is labeled with a commercially available 32P labeling kit (Takara Shuzo) using a random priming method, and this is used as a radioactive probe to detect various human tissues and cells by Northern blotting. The expression of UKC1 mRNA in the strain was examined. When a commercially available multi-tissue blot membrane (manufactured by Clonetech) containing various human tissue-derived mRNAs was examined, no clear mRNA expression was confirmed in any tissue. Next, the expression of UKC1 mRNA in Th1 and Th2 cells was examined. Th1 and Th2 cells were cultured for 6 hours at 37 ° C in the presence and absence of PMA (20 ng / ml) and ionomycin (1 μg / ml), then total RNA was extracted from the cells, and UKC1 mRNA was extracted by Northern blotting. As a result, about 1.1 kb of UKC1 mRNA was remarkably expressed in the stimulated Th2 cells, and hardly expressed in the unstimulated Th1, Th2 cells and the stimulated Th1 cells (FIG. 1). Thus, the expression of UKC1 gene was extremely limited in human tissues, and as an example, it was found that it was selectively expressed in stimulated Th2 cells.

To clone the full length of the desired cDNA, a λ phage cDNA library was prepared from cells with high UKC1 mRNA expression. Specifically, total RNA was extracted from human Th2 cells after 6 hours of culture at 37 ° C. in the presence of PMA (20 ng / ml) and ionomycin (1 μg / ml), and oligo (dT) beads (Promega) were used. Then, poly (A) + RNA was purified. Next, using a commercially available cDNA cloning kit (Invitrogen), double-stranded cDNA was synthesized, EcoRI (NotI) adapters were added to both ends, and then cloned into the EcoRI site of ZAP Express (Stratagene). did. Following this, packaging in the λ phage was completed in vitro using a commercially available kit (Stratagene). This packaging product was infected with Escherichia coli XL1-Bleu MRF ′ (Stratagene) to obtain about 1.7 × 10 ⁵ recombinant λ phages. Next, the 590 bp PCR product prepared in Example 1 above was labeled using a commercially available 32P labeling kit (manufactured by Takara Shuzo) using the random priming method, and this was used as a radioactive probe to obtain λ by plaque hybridization. A phage library was screened to obtain a plurality of cDNA clones. The longest cDNA clone consists of 913 bp in length, excluding the poly (A) part, and has a structure consisting of a 492 bp open reading frame (ORF), a 37 bp 5 'untranslated region and a 384 bp 3' untranslated region. (SEQ ID NO: 1). ORF encoded a protein consisting of 164 amino acid residues, and a characteristic signal sequence of the secreted protein was present (SEQ ID NO: 2).

The full length (including adapter sequence) of the UKC1 cDNA clone cloned in Example 2 above was subcloned into the BamHI / HindIII site of pcDNA3.1 (-) (manufactured by Invitrogen) to prepare an expression vector for mammalian cells (hereinafter pcD). -Call it UKC1). On the other hand, an expression vector for Escherichia coli expressing the fusion protein in which the translation region of the UKC1 cDNA clone cloned in Example 2 above is subcloned into the pQE30 vector (Qiagen) and the full length of the UKC1 protein is fused to the C terminus of the His tag. (Hereinafter referred to as pQE-H-ss-UKC1). Furthermore, a fragment containing only the region corresponding to the secreted protein portion excluding the signal peptide sequence in the translation region of the UKC1 cDNA clone cloned in Example 2 above, and added with a restriction enzyme site for subcloning was amplified by PCR. . The PCR primer is a 30-mer sense primer with an NdeI site (AAACATATGTCCCACACGTTGCCCGTCCGT:
SEQ ID NO: 5) and a 30-mer antisense primer (TTTCTCGAGAGTGGTGGCCTGTTGGGCTCC: SEQ ID NO: 6) to which an XhoI site was added were used.

  The PCR product was smoothed with KOD polymerase (Toyobo Co., Ltd.), inserted into the EcoRV site of pZero-2.0, and transformed into host E. coli DH-5αFT (Invitorgen). The base sequence of the obtained clone was determined, and a clone having an objective structure without an amplification error during the PCR reaction was selected. From this plasmid, an NdeI to XhoI fragment was inserted between NdeI and XhoI of pET30-A (Novagen) and transformed into host E. coli DH-5αFT (Invitorgen). The base sequence was confirmed, and a clone expressed as a protein fused with the His tag of the ORF of the cDNA was selected. This clone was cultured in LB medium at 37 ° C. for 16 hours to purify the expression plasmid DNA (pET-UKC-H).

  Plasmids PQE-H-ss-UKC and pET-UKC-H were transformed into host E. coli JM-109 (Toyobo) and BL21-Codon Plus (Stratagene), respectively. Next, protein was induced by IPTG to induce expression of UKC1 protein in the host. E. coli was recovered by centrifugation, suspended in a PBS buffer containing 8M urea, freeze-thawed, and then disrupted by ultrasonic waves. The supernatant was separated from the crushed liquid by centrifugation and purified with nickel NTA-resin (Qiagen). The purified solution containing urea was separated by gel filtration, and fractions containing UKC1 protein were collected, dialyzed against PBS, and insoluble matters were removed by centrifugation. The obtained recombinant proteins were referred to as His-ss-UKC1 and UKC1-His, respectively, and used in the following experiments (FIG. 2).

  It is also possible to produce a secreted UKC1 protein with baculovirus. First, using baculovirus expression plasmid pAC-GP67-B (manufactured by Invitrogen) as a template, PCR was performed using a sense primer (AATCCATgggAATgCTACTAgTAAATCAgT: SEQ ID NO: 7) and an antisense primer (CAACGTGTGGGACGCCGCAAAGGCAGAATG: SEQ ID NO: 8) containing the UKC1 sequence. The baculovirus signal sequence was amplified. Using a plasmid DNA (pcD-UKC1) as a template, a primer (TTTGCGGCGTCCCACACGTTGCCCGTCCGT: SEQ ID NO: 9) which contains a partial signal sequence of baculovirus and a complementary strand of SEQ ID NO: 8 and downstream of the cleavage point of the UKC1 signal sequence ) And an antisense primer (TTTGAATTCTTAAGTGGTGGCCTGTTGGG: SEQ ID NO: 10) was used to amplify a partial cDNA of UKC1. Using this cDNA and the above DNA mixture of baculovirus signal sequence as a template, PCR was performed using the sense primer (SEQ ID NO: 7) and antisense primer (SEQ ID NO: 10), and the baculovirus signal sequence and UKC1 signal DNA (SEQ ID NO: 11) fused with the sequence downstream of the sequence breakpoint is amplified, smoothed with KOD polymerase (Toyobo), inserted into the EcoRV site of pZero-2.0, and host E. coli DH-5αFT (Invitorgen) Made). A clone having the desired structure was selected and the plasmid was purified. This plasmid was digested with SpeI and EcoRI, and the resulting fragment was inserted between SpeI and EcoRI of baculovirus expression plasmid pAC-GP67-B, and transformed into host E. coli DH-5αFT (Invitorgen). . A clone having the desired structure was selected and the plasmid was purified. A recombinant baculovirus expressing the UKC1 protein was prepared from the obtained plasmid according to the Pharmingen protocol, and the UKC protein was released into a protein-free medium and insect cells were collected. Proteins were dissolved from the supernatant and cells by SDS, and Western blotting was performed to confirm that UKC protein was expressed and released, and that the sugar chain was modified electrophoretically.

  The recombinant UKC1 protein His-ss-UKC1 derived from Escherichia coli obtained in Example 3 was immunized to the peritoneal cavity of BALB / c mice together with Freund's complete adjuvant. From the second time on, the same protein was boosted several times with an incomplete Freund's adjuvant at intervals of about 2 weeks. Two weeks after the final immunization, blood was collected and the polyclonal antibody was purified, and a monoclonal antibody was prepared from the spleen cells. Monoclonal antibodies were screened based on reactivity to UKC1 protein expressed in COS-7 cells. That is, COS-7 cells after 24 hours of transfection with pcD-UKC1 and control pcDNA3.1 (-) plasmid were collected by trypsin / EDTA treatment, and further cultured on a slide glass for 6 hours. Formalin fixation and NP-40 treatment were used as antigen positive and antigen negative slides, respectively, and a UKC1-specific monoclonal antibody by FITC-labeled goat anti-mouse immunoglobulin antibody (manufactured by Biosource International) with an indirect fluorescent antibody method Were selected. Twenty-four UKC1-specific monoclonal antibodies were obtained by one cell fusion. Of these, two monoclonal antibodies (CX-2 and CX-10, both of which are mouse IgG1 antibodies) that can be used for Western blotting and have different epitopes were selected.

  The UKC1 protein can be detected immunohistochemically using a specific antibody as described in Example 4, and can also be detected by Western blotting for molecular property analysis or qualitative purposes. For example, FIG. 3 shows the results of Western blotting. Here, the culture supernatant of COS-7 introduced with pcD-UKC1 and control plasmid pcDNA3.1 (-), and in the presence or absence of PMA (20 ng / ml) and ionomycin (1 μg / ml) The culture supernatant of human Th2 cells cultured for 6 hours was immunoprecipitated with anti-UKC1 monoclonal antibody CX-2. Next, each immunoprecipitate is divided into two equal parts, one is left as it is, the other is treated with EndoF to remove all sugar chains, and then subjected to SDS-PAGE. Western blotting using biotin-labeled CX-2 antibody as a probe The result of the analysis is shown. From the results shown in FIG. 3, it was confirmed that UKC1 is a secreted protein, a sugar chain was added, and the molecular weight when the sugar chain was removed was about 16 K Dalton, as predicted from the amino acid sequence. It was also confirmed that the UKC1 protein derived from pcD-UKC1 has a molecular structure similar to that of natural UKC1 derived from Th2 cells. Furthermore, as predicted from the results of gene expression analysis as shown in FIG. 1, it was confirmed at the protein level that UKC1 was produced and secreted in response to stimulation.

  UKC1 protein can be easily quantified using existing immunological methods such as ELISA. When quantifying UKC1, it is necessary to adjust UKC1 standard products that are as close to natural as possible. For this purpose, the culture supernatant of COS-7 cells into which pcD-UKC1 has been introduced is applied to a column of Affi-Gel 10 (Biorad) coupled with CX-2 antibody, and contains PBS and 2M NaCl. After thoroughly washing with PBS and eluting with pH 2.5 glycine hydrochloride buffer, a highly pure UKC1 standard product was obtained (FIG. 4). The main protein in this standard is UKC1, because when EndoF removes the sugar chain, it becomes a single molecular weight band of about 16K Dalton (Fig. 4) and reacts specifically with monoclonal antibodies by Western blotting. confirmed. Next, a sandwich ELISA was constructed using CX-10 antibody as a solid phase antibody and biotinylated CX-2 antibody as a detection antibody. A standard curve using the above UKC1 standard is shown in FIG. FIG. 6 shows the results of actual measurement of stimulated and non-stimulated culture supernatants of human Th1 cells and Th2 cells.

Mononuclear cells (hereinafter abbreviated as PBMC) are isolated from healthy adult peripheral blood, and His-ss-UKC1 and a control His-tagged recombinant protein derived from Escherichia coli (here, hematopoietic prostaglandin D2 synthase (hPGDS)) Used] was measured for 23 hours, and the cytokine in the culture supernatant was measured with a Human Cytokine LINCOplex kit (manufactured by Linco Research). When UKC1 was added, production of IL-6, IL-10, IL-13, and IFN-γ was induced, confirming that UKC1 strongly activates immune cells, particularly monocyte cells (Table). 1 top). Next, the same experiment was performed under a low concentration of PHA stimulation. As a result, UKC1 significantly promoted the production of IL-12 and IFN-γ, which are Th1-related cytokines, while suppressing the production of IL-4, IL-5, and IL-13, which are Th2-related cytokines (Table). 1 bottom). This result indicates that UKC1 acts suppressively on allergic immune responses. To confirm this, a system that measures the proliferative response to PBMC cedar pollen allergen, PPD (typical Th1-related antigen, Mycobacterium tuberculosis) and low concentrations of PHA by measuring ³ H-thymidine (1 mCi) uptake. The effect was examined by adding UKC1 (1 mg / ml) derived from COS-7. As a result, UKC1 did not affect the proliferation response to PPD or PHA, but selectively suppressed the proliferation response to cedar pollen allergen (FIG. 7).

B cells were isolated from spleen cells of lipopolysaccharide (LPS) non-responsive mouse C3H / HeJ using a magnetic bead-attached antibody against B220 (BD). ⁶ × 10 ⁵ B cells were cultured in a 96-well plate for 40 hours in the presence or absence of UKC1 protein. ³ H-thymidine (1 mCi) was pulsed for 24 to 40 hours in culture, and the uptake was measured with a liquid scintillation counter (BD). Each UKC protein was expressed in E. coli and purified using a monoclonal antibody (CX-2) affinity column. As a result, as shown in FIG. 8, His-ss-UKC1 protein and UKC-His protein showed proliferation activity against C3H / HeJ mouse B cells. The control His-hPGDS protein showed no growth activity. Thus, it was confirmed that UKC1 is a protein that acts on B cells and exhibits proliferative activity.

Presence or absence of UKC1 protein in 2 × 10 ⁴ mouse Th2 cell lines that specifically propagate to the cedar pollen allergen Cry j 1, 6 × 10 ⁵ antigen-presenting cells treated with mitomycin, and Cry j 1 (2.5 mg / ml) as the antigen The cells were cultured under 64 hours. ³ H-thymidine (1 mCi) was pulsed for 48 to 64 hours in culture, and the uptake was measured with a liquid scintillation counter (BD). Each UKC protein was expressed in E. coli and purified using a monoclonal antibody (CX? 2) affinity column. As shown in FIG. 9, this result confirmed that UKC1 is a protein that can suppress the proliferation reaction of Cry j 1 specific to the cedar pollen allergen Cry j 1 -specific Th2 cells. Thus, UKC1 protein is a protein having an activity of suppressing the antigen-specific proliferation reaction of Th2 cells.

  As explained in detail above, the present invention provides an immune response regulatory protein that activates immunity in animals including humans, its gene, and a specific antibody. In addition, the protein can be produced in large quantities by using the polynucleotide of the present invention. This gene, protein or antibody is expected to be effective in the prevention and treatment of immune-related diseases including cancer, allergies, autoimmune diseases, and various inflammatory diseases. It is also useful as a vaccine effect-enhancing substance. In addition, the gene or antibody is useful for understanding the pathology of the immune-related disease and evaluating the therapeutic effect. Also provided are screening systems for antagonists and agonists for the interaction between the immune response-regulating protein of the present invention and its specific receptor. Such antagonists and agonists are also promising as preventive and therapeutic agents for the above immune-related diseases. On the other hand, by using proteins and fusion proteins when immunizing experimental animals, immunization can be efficiently carried out, and various antibodies can be easily obtained as polyclonal and monoclonal antibodies. Efficient immunization in experimental animals can efficiently create model mice for immune abnormalities such as autoimmune diseases.

The result of having analyzed the expression of UKC1 mRNA in Th1 and Th2 cells by the Northern blotting method is shown. The result of SDS-PAGE analysis of UKC1 recombinant protein derived from E. coli is shown. Coomassie brilliant blue staining. COS-7 cells transfected with pcDNA3.1 (-) (Control), COS-7 cells transfected with pcD-UKC1 (UKC1), unstimulated Th2 cells (Control), and ThA cells stimulated with PMA / ionomycin (PMA) The results of Western blot analysis after immunoprecipitation of each culture supernatant of (/ ion) using CX-2 antibody and EndoF treatment (+) or non-treatment (-) are shown. SDS-PAGE analysis image of COS-7 cell-derived UKC1 protein. The middle lane shows the UKC1 protein purified using a CX2 antibody-binding column, and the right lane shows an SDS-PAGE image of a preparation obtained by treating purified UKC1 with Endo F and removing the sugar chain. Standard curve of UKC1 ELISA. The reaction curve of standard UKC1 protein in a sandwich ELISA using two kinds of anti-UKC1 monoclonal antibodies (CX2 and CX10) is shown. The vertical axis represents the OD value at 592 nanometers. UKC1 production in Th1 and Th2 cells. The result of having quantified the density | concentration of UKC1 in the culture supernatant which culture | cultivated Th1 and Th2 cell for 24 hours at 37 degreeC by PMA + ionomycin presence (stimulation) and absence (non-stimulation) is shown. Figure 3 shows the effect of UKC1 on the proliferative response of human peripheral blood mononuclear cells to cedar pollen, PPD and PHA. Human peripheral blood mononuclear cells were stimulated with cedar antigen, PPD and PHA in the presence (UKC1) and absence (Control) of purified UKC1, and DNA synthesis of cells on day 5 was evaluated by 3H-thymidine incorporation. did. 1 shows the ability to stimulate proliferation of mouse B cells by UKC1 protein.

The UKC1 protein stimulates B cell proliferation by pulsing ³ H-thymidine for 24 to 40 hours in culture.
The proliferative response of B cells was evaluated as the ability to synthesize DNA.
It shows the growth inhibitory activity of antigen-specific Th2 cells by UKC1 protein. In the presence of UKC1 protein, can suppress the growth response of cedar pollen allergen Cry j 1 specific mouse Th2 cells to Cry j 1 or pulse ³ H-thymidine for 48 to 64 hours in culture to proliferate T cells Was evaluated as the ability to synthesize DNA.

Claims (19)

  Immune response regulatory protein comprising an isolated human gene, the amino acid sequence of SEQ ID NO: 2, or a sequence in which one or more amino acid residues in SEQ ID NO: 2 are deleted, added, or substituted with other amino acid residues Immune response regulatory gene encoding   The immune response-regulating gene according to claim 1, wherein the cDNA synthesized from the transcript mRNA has the nucleotide sequence of SEQ ID NO: 1.   A polynucleotide purified from the genomic DNA, mRNA, cDNA or their complementary sequence of the immune response regulatory gene of claim 1.   An oligonucleotide that hybridizes under stringent conditions with the immune response-regulating gene of claim 1 or the purified polynucleotide of claim 3.   A primer set for PCR amplification of the immune response regulatory gene of claim 1 or the purified polynucleotide of claim 3.   A recombinant vector carrying the purified polynucleotide of claim 3 or the oligonucleotide of claim 4.   A transformed cell by the recombinant vector of claim 6.   An immune response-regulating protein comprising a purified human protein having the amino acid sequence of SEQ ID NO: 2 or a sequence in which one or more amino acid residues in SEQ ID NO: 2 are deleted, added, or substituted with other amino acid residues.   The immune response-regulating protein of claim 9, which is an expression product of the immune response-regulating gene of claim 1 or the polynucleotide of claim 3.   A purified or synthesized peptide comprising a portion of the immune response-regulating protein of claim 8.   The peptide of claim 10, which consists of an amino acid sequence of 8 or more consecutive amino acid residues 1-164 in SEQ ID NO: 2.   A monoclonal antibody or a polyclonal antibody that specifically recognizes the immune response-regulating protein of claim 8 and the peptide of claim 10.   A hybridoma cell producing the monoclonal antibody of claim 12. A pharmaceutical composition for the purpose of regulating immune response,
(a) the polynucleotide of claim 3;
(b) the recombinant vector of claim 6;
(c) the immune response regulatory protein of claim 8 or 9;
(d) the peptide of claim 10 or 11; and
(e) the monoclonal or polyclonal antibody of claim 12,
A pharmaceutical composition comprising one or more selected from the group consisting of:   A method for measuring the expression level of an immune response-regulating gene according to claim 1, wherein the expression product level of the gene in a biological sample isolated from a subject is measured.   The method of claim 15, wherein the gene expression product is mRNA.   16. The method of claim 15, wherein the gene expression product is the immune response regulatory protein of claim 8.   Cells and animals overexpressing the immune response regulatory protein of claim 8. A method for producing an antibody against an arbitrary protein in an animal body, the method comprising the steps of administering an antigenic substance to the animal of claim 18 and isolating the antibody from the animal.

Images