JP2006174806A - Method for labeling nucleic acid amplified product - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a method for labeling amplified products, requiring neither temporal labor nor economical load, in a method for amplifying a nucleic acid. <P>SOLUTION: The method for labeling amplified products comprises performing a nucleic acid amplifying reaction by using (a) a primer set comprising at least one primer having a sequence capable of being annealed in a template and a tag sequence incapable of being annealed in the template and (b) a common oligonucleotide containing a sequence capable of hybridizing with the complemental sequence of the tag sequence and including a label. <P>COPYRIGHT: (C)2006,JPO&NCIPI

Description

  The present invention relates to a method for labeling an amplification product in a nucleic acid amplification reaction.

  In a nucleic acid amplification reaction, in order to confirm whether or not a target amplification product is obtained, a labeled primer is generally used and an amplification product is detected based on the label (for example, Non-patent document 1). For this purpose, it is necessary to label each template-specific primer to be used. However, labels (fluorescence and the like) used for such reactions are expensive, and since many kinds of labeled primers are used in ordinary research and development experiments, a large amount of cost is required. In addition, obtaining a labeled primer at a normal laboratory level takes about three times as long as a non-labeled primer.

Therefore, it is desired to develop a labeling method that does not require time and cost.
Suzuko Makino, detection and labeling of amplification products, 6. Labeling of PCR products, “Forefront of PCR method” Protein Nucleic acid Enzyme Vol. 41, No. 5, 494-498, 1996

  Accordingly, an object of the present invention is to provide a method for labeling an amplification product that does not require time and cost in the nucleic acid amplification method.

  As a result of intensive studies to solve the above problems, the present inventor has added a tag sequence to a primer in a nucleic acid amplification reaction, has a sequence capable of hybridizing with a complementary sequence of the tag sequence, and has a label. When the amplification reaction was performed using the attached oligonucleotide, the knowledge that the amplification product was labeled and the amplification product could be detected was obtained, and the present invention was completed.

That is, the present invention
(A) a primer set comprising a sequence that can be annealed to a template and at least one primer having a tag sequence that cannot be annealed to the template; and (b) a sequence that can hybridize to a complementary sequence of the tag sequence. A method for labeling an amplification product, characterized in that a nucleic acid amplification reaction is carried out using a common oligonucleotide containing and containing a label.

The present invention also provides:
(A) a primer set comprising a sequence that can be annealed to a template and at least one primer having a tag sequence that cannot be annealed to the template;
A primer set comprising (b) at least one primer having the tag sequence but capable of annealing to the same or different template as (a) and comprising a sequence different from (a), and (c) the tag sequence A method for labeling an amplification product, characterized in that a nucleic acid amplification reaction is carried out using a common oligonucleotide having a sequence capable of hybridizing with a complementary sequence and comprising a label.

The present invention also relates to a method for detecting an amplification product, for example, the following steps:
(I) performing a nucleic acid amplification reaction from the template using a primer set comprising a sequence that can be annealed to the template and at least one primer having a tag sequence that cannot be annealed to the template;
(Ii) binding a common oligonucleotide having a sequence capable of hybridizing to the complementary sequence of the tag sequence and containing a label to the nucleic acid amplification product generated in step (i);
(Iii) detecting the label;
It is a method including.

  Here, as the label, for example, a fluorescent label can be used. A preferred example of the tag sequence is the one having the base sequence shown in SEQ ID NO: 1.

  Further, at least one primer having a sequence that can be annealed to a template and a tag sequence can be a reverse primer.

  Further, the present invention is an oligonucleotide having a sequence capable of hybridizing with a complementary sequence of a tag sequence and labeling for labeling a nucleic acid amplification product obtained using a primer to which the tag sequence is linked. Here, the oligonucleotide may have a base sequence represented by SEQ ID NO: 1, for example.

  Furthermore, the present invention is for labeling a nucleic acid amplification product comprising an oligonucleotide having a tag sequence for linking to a primer, and a common oligonucleotide having a sequence hybridizable with a complementary sequence of the tag sequence and including a label. It is a kit.

  According to the present invention, labeling of an amplification product in a nucleic acid amplification reaction can be performed without time labor and economical burden. Therefore, the method of the present invention is useful for all methods for performing nucleic acid amplification.

Hereinafter, the present invention will be described in detail.
1. The present invention relates to a method for labeling an amplification product in a nucleic acid amplification method, a primer set comprising a sequence that can be annealed to a template, and at least one primer having a tag sequence that cannot be annealed to the template, and A common oligonucleotide containing a sequence capable of hybridizing with a complementary sequence of a tag sequence and containing a label is used.

  The nucleic acid amplification method generally uses the principle of the polymerase chain reaction (PCR) method. The principle of the PCR method is that a DNA double strand as a template is first denatured by heating to a single strand (denaturation), and then complementary to both strands of the DNA strand of the target region to be amplified. The temperature is lowered with an excessive amount of oligonucleotide primers added to the reaction system so that the primer and the complementary portion of the DNA strand form a double strand (annealing), and in this state the DNA synthesis substrate When deoxynucleoside triphosphate and DNA polymerase are reacted, the DNA synthesis reaction consisting of three steps is repeated by the polymerase synthesizing a DNA complementary strand from the primer site (extension). According to the PCR method, nucleic acid fragments can be amplified exponentially by repeating a cycle consisting of denaturation, annealing and synthesis.

  In the present invention, in the nucleic acid amplification reaction, a primer that can be annealed to the template to be amplified, generally a forward primer (F) and a reverse primer (R) is used (FIG. 1A). Here, a tag sequence is added to at least one of the forward primer and the reverse primer (in FIG. 1, a tag sequence is added to the reverse primer). In the amplification reaction, a common oligonucleotide (uni) having a sequence capable of hybridizing with a complementary sequence of the tag sequence is used. This common oligonucleotide contains an optional label (indicated by an asterisk as an example). When an amplification reaction is performed using these primers and a common oligonucleotide, first, as shown in FIG. 1B, the primer anneals to the template, and an extension reaction by the polymerase occurs from the primer (in FIG. 1B). (Shown with a dashed line). Subsequently, the product (amplification product) generated by such extension serves as a template, the primer anneals, and an extension reaction occurs (FIG. 1C, the amplification product generated by the reverse primer is shown as a template). By repeating such a cycle, the base sequence of the template is amplified. However, in the labeling method of the present invention, the tag sequence is added to the reverse primer, so that the reverse primer is extended and generated. When an extension reaction occurs using the product as a template, a sequence complementary to the tag sequence is also amplified, as shown in FIG. 1C. Since the common oligonucleotide (uni) has a sequence that can hybridize with a complementary sequence of the tag sequence, an amplification product having a sequence complementary to the tag sequence can hybridize with the common oligonucleotide (uni). Nucleotides (uni) bind to the amplification product. As a result, since the amplification product has a common oligonucleotide (uni) label, it is possible to detect the amplification product based on the label. In addition, this common oligonucleotide (uni) functions as a primer, and an extension reaction using the amplification product as a template may occur to generate a further amplification product (FIG. 1D).

  The common oligonucleotide (uni) can be used regardless of the sequence and type of the primer set and the sequence and type of the template to be amplified as long as the primer to which the tag sequence is linked is used. Therefore, since a common oligonucleotide with an expensive label can be used in various amplification reactions, it is less wasteful and less economical than when a label is added for each primer. In addition, primer preparation can be performed simply by synthesizing an oligonucleotide without adding a label, thereby saving time.

2. Design of Primer Set and Common Oligonucleotide In the present invention, a primer set for performing a nucleic acid amplification reaction is designed. As described above, in the nucleic acid amplification reaction, since the primer needs to specifically anneal to the target region to be amplified, the primer is designed based on the base sequence of the target region. Here, the template to be amplified may be DNA or RNA as long as it is a nucleic acid, and its origin is not particularly limited.

  The primer includes a forward primer and a reverse primer. In the present invention, at least one of the forward primer and the reverse primer has a tag sequence described later. Any primer having any base sequence can be used as long as it is designed based on the sequence of the target region to be amplified or a sequence complementary to the sequence. Here, the primer may be homologous or complementary to the sequence used as a template at the time of design. Generally, the forward primer is a homologous sequence to the template sequence, and the reverse primer is complementary to the template sequence. It is necessary to design the primer in consideration of the sequence. The design of such primers is well known to those skilled in the art.

  Briefly, a primer contains a sequence that can be annealed to a template. Here, the “annealable sequence” means a sequence that is completely homologous or complementary to the template sequence, and is not completely homologous or complementary to the template sequence, but will be amplified in an amplification reaction. And a sequence that is partially homologous or complementary to the extent that it can be specifically annealed to the target region of the template. In addition, the primer needs to satisfy a condition capable of specific annealing, for example, a length and a base composition (melting temperature) capable of specific annealing. Therefore, the primer needs to contain a sequence that specifically anneals to the nucleic acid (DNA or RNA) to be amplified, and is non-specific because its length is short or its base composition is not appropriate. Annealing occurs frequently to prevent non-specific amplification.

  For example, the length of the primer is preferably 10 bases or more, more preferably 16 to 50 bases, and further preferably 20 to 30 bases. In designing, it is preferable to confirm the melting temperature (Tm) of the primer. Tm means the temperature at which 50% of any nucleic acid strand forms a hybrid with its complementary strand, and the annealing temperature is optimized for the template and primer to form a duplex and anneal. There is a need. On the other hand, if this temperature is lowered too much, a non-specific reaction occurs, so it is desirable that the temperature be as high as possible. Therefore, the Tm of the primer to be designed is an important factor in performing the amplification reaction. For confirmation of Tm, known primer design software can be used.

  In the present invention, the primer may be either DNA or RNA, or a hybrid nucleic acid of DNA and RNA. The primer may also be a nucleic acid analog (eg, a DNA analog).

  In the present invention, at least one of the primer sets has a tag sequence in addition to a sequence that can be annealed. A “tag sequence” is substantially the same as the sequence of a common oligonucleotide so that when an amplification product complementary to the tag sequence is generated, the common oligonucleotide can hybridize to the amplification product. Have the same sequence. Here, “substantially the same” means not only the completely identical sequence but also the identity that allows the common oligonucleotide to specifically hybridize to the generated amplification product (complementary sequence of the tag sequence). Are included. For example, a tag sequence in which one or several bases are deleted, substituted, or added is substantially the same as the sequence of the common oligonucleotide as long as the common oligonucleotide binds to the amplification product generated based on the tag sequence. It can be said that it is the same.

  Such a tag sequence is not particularly limited, but should not be a sequence that directly anneals to the target template. Therefore, the tag sequence is preferably designed to include a sequence that is as short as possible and does not exist in the template to be amplified. For example, the base length of the tag sequence is about 15-30 bp, preferably about 17-25 bp, and is preferably shorter than the sequence that can be annealed. Further, the base composition of the tag sequence preferably has a high GC content from the viewpoint of binding strength. An example of a tag sequence that satisfies the above criteria is cccccccccccccctga (SEQ ID NO: 1). The tag sequence having the base sequence shown in SEQ ID NO: 1 is particularly preferred when performing an amplification reaction using Arabidopsis DNA as a template.

  Further, in the primer, another base that does not anneal to the template may be included between the sequence that can be annealed and the tag sequence.

  Furthermore, a common oligonucleotide is used in the present invention. A common oligonucleotide is one that binds to the amplification product and can be used to label the amplification product. Therefore, the common oligonucleotide has a sequence capable of hybridizing with a complementary sequence of the tag sequence of the primer. Thus, when an amplification product based on the tag sequence of the primer is generated, the common oligonucleotide can bind to the amplification product containing a sequence complementary to the tag sequence. As long as the common oligonucleotide can hybridize with the complementary sequence of the tag sequence, it may be further added with another base or may be shorter than the tag sequence, and the base length is about 15 as a whole. It is designed to be ˜30 bp, preferably about 17 to 25 bp.

The common oligonucleotide also includes a label. The label that can be used in the present invention is not particularly limited, and for example, a fluorescent substance, a radioisotope, a luminescent substance, and the like can be used. Examples of the fluorescent material include, but are not limited to, fluorescein, 5-carboxyfluorescein, 2′7′-dimethoxy-4′5′-dichloro-6-carboxyfluorescein, rhodamine, sulforhodamine, tetramethylrhodamine, 6-carboxy. Rhodamine, N, N, N′-tetramethyl-6-carboxyrhodamine, 6-carboxy-X-rhodamine, 5- (2′-aminoethyl) aminonaphthalene-1-sulfonic acid, anthranilamide, coumarin, terbium chelate derivative , Malachite green, reactive red 4 and the like. As the radioactive isotope, ³² P, ¹²⁵ I, ³⁵ S and the like can be used. As the luminescent substance, luciferin or the like can be used. In the present invention, it is preferable to use a fluorescent substance from the viewpoint of handling and detection simplicity. In addition, amplification products can be distinguished and labeled using two types of fluorescence, and can be detected by visual discrimination.

  There are no particular restrictions on the type of label, the method for introducing the label, etc., and various conventionally known means can be used. For example, as a method for introducing a label, an end labeling method using a radioisotope can be mentioned.

3. Amplification reaction An amplification reaction is performed using the primer set and common oligonucleotide designed as described above.

  The amplification method is not particularly limited, and a known method utilizing the principle of the polymerase chain reaction (PCR) method can be mentioned. For example, PCR method, LAMP (Loop-mediated isothermal AMPlification) method, ICAN (Isothermal and Chimeric primer-initiated Amplification of Nucleic acids) method, RCA (Rolling Circle Amplification) method, LCR (Ligase Chain Reaction) method, SDA (Strand Displacement) Amplification) method.

  For example, the PCR method synthesizes a base sequence between a pair of primers using DNA as a template and DNA polymerase. According to the PCR method, the amplified fragment can be amplified exponentially by repeating a cycle consisting of denaturation, annealing and synthesis. Those skilled in the art can easily determine the optimum conditions for PCR.

  In the RT-PCR method, first, cDNA is prepared by reverse transcriptase reaction using RNA as a template, and then PCR is performed using the prepared cDNA as a template and a pair of primers.

  By adopting a quantitative PCR method such as a competitive PCR method or a real-time PCR method as an amplification method, it is possible to quantitatively detect the amplification product labeled according to the present invention. For example, the competitive PCR method uses the same primers to compare the amount of amplification product obtained from a competitive template as an internal standard for quantification and the amount of amplification product obtained from a target template, thereby determining the amount of target template present. Can be quantified.

  As the template in the amplification reaction, any nucleic acid can be used as long as it is a nucleic acid to be amplified, and its preparation method is well known. For example, when DNA is prepared from natural cells, for example, a phenol / chloroform method can be used. The template may be prepared by chemical synthesis. Furthermore, a polymerase, a substrate (dNTP or the like) used for the amplification reaction can be appropriately selected and used.

  The conditions for the amplification reaction are also not particularly limited, and those skilled in the art can set optimum amplification conditions for the amplification technique employed. Preferably, in the amplification reaction, the addition concentration of the primer and the common oligonucleotide is set so that the addition concentration of the primer having the tag sequence and the common oligonucleotide is the same as the addition concentration of the other primer. More preferably, it is set so that the addition concentration of the primer having the tag sequence: the other primer: the common oligonucleotide primer is about 1 to 100: 100: 100.

  In the present invention, an amplification reaction using not only one kind of primer set but also a plurality of different primer sets is performed, and an amplification product derived from each primer set is used using one kind of common oligonucleotide. Can be labeled. That is, one primer set is designed to include at least one primer having a sequence that can be annealed to the template and a tag sequence that cannot be annealed to the template, and another primer set has the tag sequence. Is designed to include at least one primer that can be annealed to the same or different template as (a) and has a different sequence than (a). When a nucleic acid amplification reaction is simultaneously performed using these primer sets, the product amplified from any primer set includes a sequence complementary to the tag sequence. Therefore, when a common oligonucleotide containing a sequence that can hybridize to the complementary sequence of the tag sequence and containing a label is added in the nucleic acid amplification reaction, the common oligonucleotide binds to the product amplified from both primer sets, and the amplified product Is labeled.

  In order to detect the amplification product based on the label after performing the amplification reaction, a method known in the art for detecting the label described above can be used. For example, when fluorescence is used as a label, the fluorescence can be detected using a fluorescence microscope, a fluorescence plate reader, or the like. When a radioisotope is used as a label, the radioactivity can be measured by, for example, a liquid scintillation counter or a γ-counter.

  The present invention further includes an oligonucleotide having a tag sequence for ligation to a primer, a sequence capable of hybridizing to a complementary sequence of the tag sequence, and a label, in order to easily label the amplification product described above. A kit for labeling a nucleic acid amplification product comprising a common oligonucleotide is provided. With this kit, an oligonucleotide having a tag sequence included in the kit is linked to at least one primer of an appropriately designed primer set, and used together with a common oligonucleotide in a nucleic acid amplification reaction, whereby an amplification product can be easily and quickly obtained. Can be labeled.

  EXAMPLES Hereinafter, although this invention is demonstrated in detail using an Example, the technical scope of this invention is not limited to these Examples.

  In this example, an attempt was made to create a primer set and a common oligonucleotide.

  In order to analyze an amplification product using the DNA chain length analysis function of a fluorescent DNA sequencer (ABI model 3100), a primer set and a common oligonucleotide that can fluorescently label the amplification product were prepared. In this example, a common oligonucleotide (uni) that can bind to the 5 ′ end of one primer (reverse primer; R) of the primer set so that one of the amplification products is fluorescently labeled. Was designed (FIG. 1).

  Since the sequence of the common oligonucleotide (uni) is preferably as short as possible and a sequence that can be reliably reacted, cccccccccccccctga (SEQ ID NO: 1) was designed as shown in Table 1. A fluorescent label was added to the sequence of the common oligonucleotide (uni) (requested synthesis from ABI).

  Moreover, in order to specifically amplify regions containing polymorphisms different between Col and Ler of Arabidopsis thaliana, a primer set consisting of a forward primer and a reverse primer was designed based on the sequence of these regions ( Table 1). Specifically, as shown in FIG. 2, the SSLP polymorphism in Col and Ler (polymorphism contributing to the difference in the length of the amplified product) is specifically amplified, and for the SSLP polymorphism, Primer sets were designed so that the lengths of the Col-derived amplification product and Ler-derived amplification product were different. The selected SSLP polymorphisms are nga1107 and nga129. Further, a tag sequence (indicated by underline in Table 1) for binding to the common oligonucleotide (uni) was added to the reverse primer.

  In this example, an amplification reaction was performed by the PCR method using the primer set and the common oligonucleotide (uni) prepared in Example 1.

  Specifically, the amplification reaction was performed by changing the mixing ratio of the primer and the common oligonucleotide at the ratio shown in Table 2. PCR reaction temperature conditions were 95 ° C for 5 minutes, 40 cycles of (94 ° C for 15 seconds, 55 ° C for 15 seconds, 72 ° C for 30 seconds), 60 ° C for 45 minutes, 4 ° C for 10 minutes, and 10 ° C. Retained. The composition of the reaction solution was 10 μl by adding 0.5 μl of template, 5 μl of Amplitag gold PCR Master Mix (manufactured by ABI), primers having the concentrations shown in Table 2 and common oligonucleotides. The template was used by extracting genomic DNA from Col and Ler according to a standard method.

  The results are shown in FIGS. As a result, it was found that the amplification product was fluorescently labeled under conditions other than Condition 4, and the amplification product could be detected based on the label. In particular, it was found that three conditions were good for labeling so that the length of the amplified product could be accurately determined (FIGS. 3 to 6).

  In Example 2, in order to confirm the amplification reaction of the designed primer set and common oligonucleotide, it was confirmed whether or not a unique polymorphism was detected when using Arabidopsis Col and Ler as templates. . As a result, polymorphism could be detected (FIGS. 3-6).

  In this example, 4 individuals of F1 plants obtained by multiplying a mutant having Col as a back brand (name: H32S1007) and Ler, and 96 individuals showing a mutant expression system from F2 plants which are the next generation of F1 plants. Chromosomal DNA isolated by mixing was analyzed. As a primer set, GTGTCTTTTTTTATATGTTTCTCACTCCAAAGTC (SEQ ID NO: 6) was used as a forward primer, and cccccccccccccccctgaCACATATGACCAAATTAATAAGAAAAA (SEQ ID NO: 7) was attached as a reverse primer. The common oligonucleotide designed in Example 1 was used.

  The result is shown in FIG. As shown in FIG. 7A, when the genomic DNA of the F1 plant is used as a template, an amplification product derived from the Col polymorphism (amplification product length 170 bp) and an amplification product derived from the Ler polymorphism (amplification product length 172 bp) These peak ratios were close to 1, as expected. In addition, when the genomic DNA of the F2 plant was used as a template, the peak of the amplification product derived from the Col polymorphism was high (FIG. 7B). From the above, it was found that by using the labeling method of the present invention, the amplification product can be labeled with such an accuracy that even a slight difference such as a difference in length or abundance of the amplification product can be distinguished.

  According to the present invention, labeling of an amplification product in a nucleic acid amplification reaction can be performed without time labor and economical burden. Therefore, the method of the present invention is useful for all methods for performing nucleic acid amplification.

The outline | summary of the labeling method of this invention is shown. The design of a primer set for amplifying fragments containing the Arabidopsis Col and Ler SSLP polymorphisms is described. The result of performing an amplification reaction using Primer Set A and a common oligonucleotide using Arabidopsis thaliana Col-derived genomic DNA as a template is shown. The result of performing an amplification reaction using Primer Set B and a common oligonucleotide, using genomic DNA derived from Arabidopsis Col as a template is shown. The result of performing an amplification reaction using Primer Set A and a common oligonucleotide using Arabidopsis thaliana Ler-derived genomic DNA as a template is shown. The result of performing an amplification reaction using Primer Set B and a common oligonucleotide using Arabidopsis thaliana Ler-derived genomic DNA as a template is shown. The result of having performed amplification reaction using the genomic DNA derived from F1 plant and F2 plant as a template is shown.

  Sequence number 1-7: Synthetic oligonucleotide

Claims (9)

(A) a primer set comprising a sequence that can be annealed to a template and at least one primer having a tag sequence that cannot be annealed to the template; and (b) a sequence that can hybridize to a complementary sequence of the tag sequence. A method for labeling an amplification product, comprising performing a nucleic acid amplification reaction using a common oligonucleotide containing and containing a label. (A) a primer set comprising a sequence that can be annealed to a template and at least one primer having a tag sequence that cannot be annealed to the template;
A primer set comprising (b) at least one primer comprising the tag sequence but capable of annealing to the same or different template as (a) and having a sequence different from (a), and (c) the tag sequence A method for labeling an amplification product, wherein a nucleic acid amplification reaction is performed using a common oligonucleotide having a sequence that can hybridize with a complementary sequence and comprising a label. (I) performing a nucleic acid amplification reaction from the template using a primer set comprising a sequence that can be annealed to the template and at least one primer having a tag sequence that cannot be annealed to the template;
(Ii) binding a common oligonucleotide having a sequence capable of hybridizing to the complementary sequence of the tag sequence and containing a label to the nucleic acid amplification product generated in step (i);
(Iii) detecting the label;
A method for detecting an amplification product, comprising:   The method according to any one of claims 1 to 3, wherein the label is a fluorescent label.   The method according to any one of claims 1 to 4, wherein the tag sequence has a base sequence represented by SEQ ID NO: 1.   The method according to any one of claims 1 to 5, wherein at least one primer having a sequence that can be annealed to a template and a tag sequence is a reverse primer.   An oligonucleotide having a sequence capable of hybridizing with a complementary sequence of a tag sequence and comprising a label, for labeling a nucleic acid amplification product obtained using a primer to which the tag sequence is linked.   The oligonucleotide according to claim 7, which has the base sequence represented by SEQ ID NO: 1. A kit for labeling a nucleic acid amplification product, comprising: an oligonucleotide having a tag sequence for linking to a primer; and a common oligonucleotide having a sequence capable of hybridizing with a complementary sequence of the tag sequence and including a label.

Images