JP2006111591A - Preparation for target-specifically delivering nucleic acid medicine inside cell - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a preparation for the target-specific delivery of a nucleic acid medicine inside a cell, especially a stable nano-particle preparation containing a nucleic acid medicine. <P>SOLUTION: The stabilized preparation for the target-specific delivery of the nucleic acid medicine inside the cell contains the nucleic acid medicine such as a gene or its analog contained in a composition composed of [3β-N-(N',N'-dimethylaminoethane)carbamoyl]cholesterol (DC-Chol), a polyoxyethylene sorbitan mono-oleate 80 (commercial name; Tween 80) and a folic acid-polyethylene glycol-distearoylphosphatidyl ethanolamine (folate-PEG-DSPE). The medicine is not a liposome containing water therein by a lipid double membrane but a nano-particle free from water therein. <P>COPYRIGHT: (C)2006,JPO&NCIPI

Description

  The present invention relates to a preparation for intracellular delivery of a nucleic acid drug in a target-specific manner, particularly to a stable nanoparticle preparation including a nucleic acid drug.

Gene therapy has started as a method for treating genetic diseases by repairing abnormal gene defects or compensating for defects.
Recently, however, not only genetic diseases but also normal functioning proteins are not sufficiently expressed, or rather, normal genes are introduced from the outside in order to actively express the target protein and aim at early healing of the disease. By supplying the necessary proteins, it has a wide range of products that aim for therapeutic effects.
Therefore, when gene therapy is performed, it is necessary to efficiently introduce the gene into the target cell, and many methods have been studied as gene transfer methods so far, but a method using a viral vector and a virus are not used. Broadly divided into methods.

  Since a viral vector uses the infectivity of a virus, the introduction efficiency is higher than that of other methods, but there is a safety problem due to the pathogenicity of the original virus.

On the other hand, many methods that do not use viruses have been reported at the laboratory level, but methods that can be applied to human treatment are limited.
For example, electroporation method, manipulator method, PEG method, calcium phosphate method, liposome method, method using a synthetic reagent such as cationic lipid as a carrier, gene gun (particle gun) or method of physically delivering by pressure Has been.
Since these methods do not use viruses, they are excellent in that there is no concern about pathogenicity. However, the efficiency of gene transfer is low, and they often show cytotoxicity / tissue damage.

  Low efficiency is due to the fact that many of the genes introduced into cells are degraded by lysosomes, and there is no mechanism for active migration into the nucleus, so only a part of the genes that enter the cells are used. Etc. are considered.

On the other hand, not only gene drugs but also small molecule drugs (compounds), in order to further improve the therapeutic effect and safety, it is hoped that the drug will be selectively delivered only to the lesion site and the effect will be manifested only where it is needed. It has been rare (Drug Delivery System; DDS).
If this is realized, it will be possible to reduce the dose, and it will be possible to safely use drugs that have side effects if they are in the usual dosage regimen, and it will be satisfactory because the drugs will not reach the affected area sufficiently if the usual administration method is used. It is also possible to use a drug for which a possible effect has not been obtained.

  Particularly in the field of anticancer / anticancer agents, when administered systemically such as intravenously, the drug will be distributed in addition to the target organ, and serious side effects will occur frequently in non-target organs. There was a need for an excellent DDS.

  Drugs and genes are used to recognize and selectively deliver target cells and tissues such as cancer, and to deliver locally to skin and joints, so that antibodies are used and cells that express specific receptors are used. A method for selective introduction via a receptor has also been proposed.

For example, transferrin-DNA complex is introduced into cancer cells expressing transferrin receptor, or asialoglycoprotein-DNA complex is sent to hepatocytes specifically expressing asialoglycoprotein receptor. It is reported that it is possible.
Proc. Natl. Acad. Sci. USA, 1992 Aug 1; 89 (15): 7031-5. J. Biol. Chem., 1991 Aug 5; 266 (22): 14338-42.

Folate receptors are also expressed on the surface of many cells, and it is disclosed that they are involved in endocytosis of exogenous molecules.
Japanese Patent No. 3232347 Special Table 2002-543110

  However, the invention described in Patent Document 1 specifically binds folic acid and oligonucleotides such as antisense, as described in Example 19, and provides stability and target cell specificity. It was not enough in gender. The DDS effect was not presented as specific experimental data.

  The invention described in Patent Document 2 also only disclosed a chemical bond having a short chain length such as N- (4-azidophenylthio) phthalimide, although a crosslinking agent is used.

In addition to these, the invention of a vector consisting of a targeting moiety-linker moiety- / delivery vehicle part instead of direct binding is also disclosed.
Special table 2003-532368 gazette

  However, in the invention described in Patent Document 3, specifically, the delivery vehicle is a virus component, which is completely different from the configuration of the present invention.

Furthermore, using (1) distearoylphosphatidylcholine (DSPC) / (2) cholesterol (Chol) / (3) folate-PEG-DSPE (folic acid-polyethylene glycol-distearoylphosphatidylethanolamine) It has been reported that liposomes encapsulating doxorubicin (doxorubicin) were prepared and incorporated into human Hela / W138 cancer cells.
Biochim. Biophys. Acta, 1995 Feb 15; 1233 (2): 134-44.

  The invention disclosed in Non-Patent Document 3 relates to a liposome (Liposome) in which an aqueous solution component is taken into a vesicle by a lipid bilayer membrane, and the nanoparticle consisting of a single membrane according to the present invention is essentially completely different. Different.

In addition, using (1) egg phosphatidylcholine / (2) cholesterol (Chol) / (3) folate-PEG-DSPE, a liposome encapsulating an antisense consisting of 15 bases was prepared, which is a human epithelial cancer cell. Incorporation into KB cancer cells has also been reported.
Proc. Natl. Acad. Sci. USA, 1995 Apr 11; 92 (8): 3318-22.

  However, the invention disclosed in Non-Patent Document 4 relates to liposomes as in Non-Patent Document 3, and is completely different in configuration and form from the single-layered nanoparticles according to the present invention.

The problem to be solved by the present invention is to provide a preparation for intracellular delivery of a nucleic acid drug in a target-specific manner, particularly a stable nanoparticle preparation including the nucleic acid drug.
More specifically, in order to further improve the therapeutic effect and safety, we will provide a DDS preparation with excellent clinical effect that selectively delivers the drug only to the lesion site and expresses the effect only in the required local area. is there.

  The present invention is a stable nanoparticle formulation of a nucleic acid drug having any of the following characteristics.

(1) A preparation for target-specific delivery of a nucleic acid drug in a cell, wherein the nucleic acid drug is [3β-N- (N ′, N′-dimethylaminoethane) carbamoyl] cholesterol (DC-Chol), poly Stabilization characterized by being included in a composition comprising oxyethylene sorbitan monooleate 80 (trade name; Twin 80) and folic acid-polyethylene glycol-distearoyl phosphatidylethanolamine (folate-PEG-DSPE) Formulation.
(2) DC-Chol composition ratio in the preparation is in the range of 80 to 98 mol%, twin 80 is in the range of 1 to 10 mol%, and folate-PEG-DSPE is in the range of 0.1 to 10 mol%. ) The stabilized preparation described.
(3) DC-Chol composition ratio in the preparation is in the range of 88 to 96 mol%, twin 80 is 3 to 7 mol%, folate-PEG-DSPE is in the range of 0.5 to 5 mol%, (1 ) Or (2).
(4) The composition according to (1) to (3), wherein the composition ratio of DC-Chol in the preparation is 93 to 94 mol%, twin 80 is 4 to 6 mol%, and folate-PEG-DSPE is 1 to 2 mol%. Preparation.
(5) The stabilized preparation according to (1) to (4), wherein the polyethylene glycol (PEG) has an average molecular weight of 1,000 to 5,000.
(6) The stabilized preparation according to (1) to (5), wherein PEG has an average molecular weight of 2,000.
(7) The stabilized preparation according to any one of (1) to (6), wherein the preparation is not a liposome in which water is encapsulated by a lipid bilayer, but nanoparticles containing no water inside. .
(8) The stabilized preparation according to (7), wherein the preparation is nanoparticles having a particle diameter of 50 to 1000 nm.
(9) The stabilized preparation according to (7) or (8), wherein the preparation is nanoparticles having a particle size of 60 to 800 nm.
(10) The stabilized preparation according to (1) to (9), comprising 0.01 to 10% by weight of a nucleic acid drug.
(11) The stabilized preparation according to (1) to (10), comprising 0.1 to 5% by weight of a nucleic acid drug.
(12) The stabilized preparation according to (1) to (11), wherein the nucleic acid drug is a gene or an analog thereof.
(13) The stabilized preparation according to (1) to (12), wherein the nucleic acid drug is a gene.
(14) The stabilized preparation according to (1) to (13), wherein the nucleic acid drug is a tumor suppressor gene.
(15) The stabilized preparation according to (1) to (12), wherein the gene analog is a polynucleotide or an oligonucleotide.
(16) The stabilized preparation according to (1) to (15), wherein the oligonucleotide is a decoy (decoy molecule), antisense, ribozyme, aptamer or siRNA.
(17) The stabilized preparation according to (1) to (16), wherein the decoy has an action of inhibiting the binding of a transcriptional regulatory factor to the binding site.
(18) Decoy is a decoy oligonucleotide of NF-κB, STAT-1, STAT-2, STAT-3, STAT-4, STAT-5, STAT-6, GATA-3, AP-1, E2F, Ets or CRE The stabilized preparation according to any one of (1) to (17).
(19) The stabilized preparation according to (1) to (18), wherein the decoy is an NF-κB decoy oligonucleotide.
(20) The stabilized preparation according to (1) to (19), wherein the decoy is an NF-κB decoy oligonucleotide represented by SEQ ID NO: 1.
(21) The stabilized preparation for transdermal delivery according to (1) to (20), wherein the cells are skin cells.
(22) The stabilized preparation for intra-knee joint administration according to (1) to (20), wherein the cells are synovial cells or macrophages.
(23) The stabilized preparation for intravenous injection according to any one of (1) to (20), wherein the cell is a cancer cell, macrophage, hepatocyte or kidney cell.
(24) The stabilized preparation for intra-cancer administration according to (1) to (20), wherein the cell is a cancer cell.
(25) Cancer cells are squamous cell carcinoma, prostate cancer, cervical cancer, endometrial cancer, ovarian cancer, brain tumor, liver cancer, lung cancer, breast cancer, kidney cancer, stomach cancer, esophageal cancer, colon cancer, pancreatic cancer, skin cancer The stabilized preparation according to (23) or (24), which is a kind selected from pharyngeal cancer and nasopharyngeal cancer.
(26) Transdermal preparation for intradermal delivery of NF-κB decoy oligonucleotide, wherein NF-κB decoy oligonucleotide is included in nanoparticles composed of DC-Chol, twin 80 and folate-PEG-DSPE A stabilized preparation characterized by that.
(27) Use of the stabilized preparation according to (26) for treating inflammatory skin diseases.
(28) Inflammatory skin diseases are atopic dermatitis, contact dermatitis, photosensitivity dermatitis, chronic dermatitis of hands and feet, seborrheic dermatitis, monetary dermatitis, generalized exfoliative dermatitis, Use of the stabilized preparation according to (27), which is congestive dermatitis, topical abrasion dermatitis, drug dermatitis or psoriasis.

  The nucleic acid drug in the present invention is not limited as long as it is a natural type, natural modified type, or synthetic type nucleotide, and may be DNA, RNA, or a chimera thereof. More specifically, the gene is, for example, a tumor suppressor gene, and the gene analog is more specifically a polynucleotide or an oligonucleotide. Further, the nucleotide used in the present invention includes an oligonucleotide (S-oligo) having a thiophosphate diester bond in which the oxygen atom of the phosphodiester bond is substituted with a sulfur atom, or a methyl phosphate having no phosphodiester bond. Also included are oligonucleotides modified to make the oligonucleotide less susceptible to degradation in vivo, such as oligonucleotides substituted with groups.

  More specific examples of the oligonucleotide include decoy (decoy molecule), antisense, ribozyme, aptamer, and siRNA.

  More specifically, the decoy can include an oligonucleotide having an action of inhibiting the binding of a transcriptional regulatory factor to the binding site. Examples of the transcriptional regulatory factor include NF-κB, STAT-1, STAT-2, STAT-3, STAT-4, STAT-5, STAT-6, GATA-3, AP-1, E2F, Ets, CRE and the like can be mentioned, and NF-κB is more suitable.

  More specifically, as a decoy, NF-κB decoy oligonucleotide represented by SEQ ID NO: 1, STAT-1 decoy oligonucleotide represented by SEQ ID NO: 2, GATA-3 decoy oligonucleotide represented by SEQ ID NO: 3, SEQ ID NO: 4 STAT-6 decoy oligonucleotide represented by SEQ ID NO: 5, AP-1 decoy oligonucleotide represented by SEQ ID NO: 5, Ets decoy oligonucleotide represented by SEQ ID NO: 6, E2F decoy oligonucleotide represented by SEQ ID NO: 7, etc. .

  Next, [3β-N- (N ′, N′-dimethylaminoethane) carbamoyl] cholesterol (DC-Chol) used in the present invention is a chemical name represented by the following structural formula: (3β- [N- (N ', N'-dimethylaminoethane) carbamoyl] cholesterol [CAS registration number: 166023-21-8], which can be obtained, for example, as a reagent (product number: C2832) manufactured by Aldrich.

Next, the folic acid-polyethylene glycol-distearoyl phosphatidylethanolamine (folate-PEG-DSPE) used in the present invention may be prepared by, for example, linking folic acid to Amino-PEG-DSPE. 3 (Biochim. Biophys. Acta, 1995 Feb 15; 1233 (2): 134-44.), N-Succinyl DSPE and Folate-PEG-NH ₂ may be reacted. Amino-PEG-DSPE can be obtained as a reagent (Sunbright DSPE-020PA, DSPE-050PA manufactured by NOF Corporation, DSPE-PEG (2000) Amine manufactured by Avanti, etc.).

Sunbright DSPE-020PA made by Nippon Oil & Fat Co., Ltd.

Avanti DSPE-PEG (2000) Amine

  Here, the average molecular weight of polyethylene glycol (PEG) is not limited, but is usually preferably 1,000 to 5,000, more preferably 2,000 or 5,000, and still more preferably 2,000.

  Subsequently, the composition ratio of DC-Chol: twin 80: folate-PEG-DSPE is not limited, but is usually in the range of 80 to 98 mol%: 1 to 10 mol%: 0.1 to 10 mol%, preferably 88 -96 mol%: 3-7 mol%: Within the range of 0.5-5 mol%, more preferably 93-94 mol%: 4-6 mol%: 1-2 mol%.

  Twin 80 is commercially available from various companies as reagents, industrial raw materials, and the like, but in the present invention, it is preferable to use a higher-purity product, and specific examples thereof include Japanese fat products.

  The feature of the nanoparticle according to the present invention is a nanoparticle that does not contain water inside, and is not a liposome in which water is encapsulated inside by a conventionally known lipid bilayer, so it is based on the strain of the bilayer. Instability is improved, and stable nanoparticles with excellent storage stability can be obtained.

  The particle diameter of the nanoparticle of the present invention is usually 50 to 1000 nm, but it is optimized and prepared within a particle diameter range of 60 to 800 nm depending on the kind of the gene to be included or its analog, the target cell / organ or administration route, etc. You can also

  The amount of the nucleic acid drug to be included is not limited, but is usually 0.01 to 10% by weight, preferably 0.1 to 5% by weight.

  In the present invention, in addition to the above structural requirements, a pH adjuster, isotonic agent, surfactant, antioxidant, fragrance, pigment, antiseptic / antifungal agent, oil base, humectant, absorption promotion as necessary An agent or the like can also be added.

The nanoparticle according to the present invention can be used as a therapeutic / amelioration / prevention agent for various diseases, and is not limited as long as it is a cell expressing a folate receptor. Specifically, for example, the following cells are targeted. The administration formulation can be mentioned.
1) Transdermal delivery formulation for skin cells
2) Intra knee preparation for synovial cells or macrophages
3) Intravenous preparation for cancer cells, macrophages, hepatocytes or kidney cells
4) Intracancer preparation for cancer cells

  Here, indications of the transdermal delivery preparation for skin cells are not limited, but specific examples include inflammatory skin diseases, and more specifically, atopic dermatitis, contact dermatitis , Photosensitivity dermatitis, chronic dermatitis of hands and feet, seborrheic dermatitis, monetary dermatitis, generalized exfoliative dermatitis, congestive dermatitis, topical abrasion dermatitis, drug dermatitis or psoriasis Can be mentioned.

  Indications of transdermal delivery preparations intended for intra-knee joint preparations for synovial cells or macrophages are not limited, but specific examples include rheumatoid arthritis (RA), osteoarthritis (OA), etc. Can be mentioned.

  Further, the cancer cells are not limited, but specifically, for example, squamous cell carcinoma, prostate cancer, cervical cancer, endometrial cancer, ovarian cancer, brain tumor, liver cancer, lung cancer, breast cancer, kidney cancer, stomach cancer, esophageal cancer, colon Examples include cancer, pancreatic cancer, skin cancer, pharyngeal cancer, and nasopharyngeal cancer.

  In order to specifically show the effects of the present invention, production examples and examples are given below, but it goes without saying that the present invention is not limited thereto.

Production Example 1 Synthesis of folate-PEG2000-DSPE and folate-PEG5000-DSPE
Folate-PEG2000-DSPE was synthesized according to the method described in Bioconjug. Chem., 10 (1999), 289-298. Folic acid (manufactured by Wako Pure Chemical Industries) was dissolved in dimethyl sulfoxide (DMSO, 1 ml). Amino-PEG2000-DSPE (manufactured by NOF Corporation, 100 mg, 0.035 mmol) and pyridine (0.5 ml) were added thereto, followed by dicyclohexylcarbodiimide (32.5 mg). The reaction was allowed to proceed for 4 hours at room temperature. Formation of a new spot (Rf = 0.57) was observed on silica gel 60F254 thin layer chromatography (75: 36: 6 chloroform / methanol / water). On the other hand, disappearance of Amino-PEG2000-DSPE (Rf = 0.76) was confirmed by ninhydrin color reaction. After distillation under reduced pressure to remove pyridine, water (12.5 ml) was added. The solution was centrifuged to remove a trace amount of insoluble matter. The supernatant was placed in a Spectra / Por CE tube (Spectrum) and dialyzed into 50 mM saline (2000 ml, 2 times) and water (2000 ml, 3 times). The dialysate was lyophilized and analyzed with an ESI-TOFMS mass spectrometer.
Similarly, folate-PEG5000-DSPE was synthesized from Amino-PEG5000-DSPE.

Production Example 2 Preparation of plasmid DNA
The pAAV-CMV-LUC plasmid (see J. Virol. Methods, 1997, Jan; 63 (1-2): 129-36. etc.) was purified by an alkaline dissolution method using a maxiprep column (manufactured by Qiagen). FITC-labeled plasmid was prepared by IT fluorescein label kit (manufactured by Mirus).

Production Example 3 Preparation of Nanoparticles (NP) Lipid (DC-Chol, Twin 80, PEG2000-DSPE, folate-PEG2000-DSPE and / or folate-PEG5000 in water (10 ml) with the formulation shown in the table below. -DSPE), each NP was produced by a modified ethanol injection method.

-------------------------------------------------- --------
Formulation Mol%
-------------------------------------------------- --------
DC-twin PEG2000- f-PEG2000- f-PEG5000-
Chol 80 (T) DSPE (P) DSPE (F) DSPE (FL)
-------------------------------------------------- --------
NP-T 95 5 ― ― ―
NP-0.3PT 94.7 5 0.3 ― ―
NP-1PT 94 5 1 ― ―
NP-0.3FT 94.7 5 ― 0.3 ―
NP-1FT 94 5 ― 1 ―
NP-1FLT 94 5 ― ― 1
-------------------------------------------------- --------

  Nanoparticles are lipids (for example, in the case of NP-1FT, DC-Chol / Twin 80 / folate-PEG2000-DSP = 94/5/1 molar ratio = 10: 1.3: 0.65 weight [mg] ratio) in an appropriate amount of ethanol. And prepared by a modified ethanol injection method. DiI-labeled nanoparticles were produced by adding DiI to 0.04 mol% with respect to the total lipid. First, a lipid solution dissolved in ethanol was removed to a suitable amount (about 1 ml) using a vacuum concentrator to finally obtain a semi-solid solution. An appropriate amount (10 ml) of water was added thereto, and ethanol was removed again using a vacuum concentrator. In order to obtain a uniform particle size, the mixture was treated with an ultrasonic bath (W220R type, manufactured by Honda Electronics Co., Ltd.) for 5 minutes, and then sterilized by filtration once with a sterilizing filter (pore diameter: 450 nm).

  In this way, six different cationic nanoparticle compositions that were potential non-viral vectors were prepared. The components and composition of the nanoparticles are shown in the table above. All compositions contain 1 mg / ml DC-Chol as the cationic lipid. NP-T contains 5mol% twin 80. NP-0.3PT and NP-1PT contain 5 mol% twin 80 and 0.3 or 1 mol% PEG2000-DSPE, respectively. In the NP-0.3FT and NP-1FT compositions, which are folate receptor (receptor) targeting vectors, 0.3 or 1 mol% folate-PEG2000-DSPE was used instead of PEG2000-DSPE in NP-0.3PT and NP-1PT, respectively. Using. For NP-1FLT, 1 mol% folate-PEG5000-DSPE was used instead of folate-PEG2000-DSPE in NP-1FT.

Example 1 Particle size and surface potential of nanoparticles and Nanoplex The particle size distribution of nanoparticles and Nanoplex was determined by dynamic light scattering, and the surface potential was determined by electrophoretic light scattering (ELS-800 manufactured by Otsuka Electronics) at 25 ° C. Then, after dispersion and dilution in an appropriate amount of water, each was measured. The stability of the nanoparticles was evaluated by the change in particle diameter after 60 days. Nanoplex and nanoparticles containing plasmid DNA with charge ratios (+/−) 1/1, 3/1, 5/1 were used for particle size and surface potential measurements. Nanoplex stability was assessed by changes in particle size upon dilution in 10% and 50% serum.

  The charge ratio of cationic nanoparticles to DNA was fixed at 3, and the physical properties of Nanoplex were investigated. Nanoparticles were mixed with DNA and the particle size and surface potential were measured. The results are shown in the table below.

-------------------------------------------------- -------------
Formulation Nanoparticle Nanoplex
+ 10% + 50%
Serum Serum
-------------------------------------------------- -------------
Particle size Surface potential Particle size Surface potential Particle size Particle size
(nm) (mV) (nm) (mV) (nm) (nm)
0 days 60 days 0 days 0 days 1 days 0 days
-------------------------------------------------- -------------
NP-T 146.4 165.8 49.0 221.2 285.4 40.7 ― ―
NP-0.3PT 114.7 114.7 52.9 200.6 235.8 32.8 ― ―
NP-1PT 139.3 127.6 53.5 191.6 214.5 40.0--
NP-0.3FT 122.0 122.0 51.3 215.6 230.3 37.2 482.9 937.9
NP-1FT 207.4 188.3 46.8 309.1 342.9 33.3 473.0 513.0
NP-1FLT 104.3 126.3 42.3 240.5 248.2 29.6 253.4 303.5
-------------------------------------------------- --------------

1. Stability of nanoparticles The average particle size and surface potential of each nanoparticle were about 100-200 nm and about +50 mV, respectively. The stability of each nanoparticle was evaluated by the change with time of the particle diameter, but no change in the particle diameter after 60 days was observed in any of the nanoparticles. All compositions are believed to maintain particle size due to electrostatic repulsion and / or the presence of PEG on the particle surface. From these findings, the stability of the nanoparticles according to the present invention in water was shown.

2. Characteristics of Nanoplex The particle size of each Nanoplex increased slightly from 200nm to 300nm. The surface potential decreased slightly from +30 mV to +40 mV. After standing for 24 hours, the particle size of Nanoplex in water increased slightly from 200 nm to 350 nm and did not change after 72 hours.

3. Stability of Nanoplex in the presence of serum Numerous anionic substances are present in serum, which compete with or substitute for DNA in the complex. Such substitution is believed to be one of the main mechanisms destabilizing the complex. Therefore, we examined the stability of Nanoplex (NP-0.3FT, NP-1FT, NP-1FLT) in the presence of 10% or 50% serum. In the presence of 10% serum, there was no significant change in the particle size of NP-1FLT, whereas the particle size of Nanoplex NP-0.3FT and NP-1FT increased to 500 nm. In the presence of 50% serum, the particle size of NP-1FT and NP-1FLT increased slightly compared to the result in the presence of 10% serum, whereas Nanoplex NP-0.3FT increased to 900 nm. Therefore, it was considered that the stability of NP-1FT and NP-1FLT was almost equivalent in maintaining the physical properties in the presence of an anionic competitor.

4. Optimization of charge ratio in Nanoplex Gene transfer experiments were mainly focused on NP-1FT. In order to optimize the charge ratio (+/-) of nanoparticles to DNA, pAAV-CMV-LUC plasmid-containing NP-1FT nanoplex with various charge ratios (+/-) was used in medium supplemented with 10% serum. Then, the gene was introduced, and the luciferase activity in LNCaP cells was measured. The highest gene transfer efficiency was observed when the charge ratio (+/−) 3/1. Luciferase activity (cps / μg protein) reached about 1 × 10 ³ at the optimal ratio (see table below and FIG. 1).

The relationship between the charge ratio and the expressed luciferase activity (mean ± standard deviation) is shown below.
----------------------------
P: N ratio Luciferase activity
(cps / μg protein)
----------------------------
1: 1 193.73 ± 10.78
2: 1 265.43 ± 11.99
3: 1 932.81 ± 26.35
4: 1 618.48 ± 88.73
5: 1 333.65 ± 91.99
----------------------------
P; f-PEG2000-DSPE, N; DNA

  No difference was observed in the particle size of NP-1FT Nanoplex at charge ratio (+/-) 3/1 in water compared to 1/1 or 5/1. In the presence of 10% serum, the particle size of NP-1FT Nanoplex (surface potential; -37.85mV) at charge ratio (+/-) 1/1 increased to 600 nm, but positively charged ratio (+/-) That of 3/1 or 5/1 only increased slightly to about 470 nm. Therefore, the subsequent examination was performed at a charge ratio (+/−) 3/1 between the nanoparticles and DNA.

Example 2 Cell Culture
KB cells were provided by Tohoku University Medical Cell Resource Center. LNCaP cells were obtained from the Department of Urology, Keio University Hospital. KB and LNCaP cells were cultured at 37 ° C. and 5% CO _{2 in} folate-free medium RPMI-1640 supplemented with 10% non-immobilized fetal bovine serum and kanamycin (100 μg / ml).

Example 3 Nanoplex Uptake by KB Cells Cultured KB cells were transferred to a 35 mm culture dish 24 hours before the experiment. DiI labeled nanoparticles (20 μl) were mixed with the respective DNA (4 μg) and then diluted in folate-free medium RPMI (1 ml) supplemented with 10% serum. The mixture was added to KB cells. To confirm selective uptake of nanoparticles and KB cells, KB cells were cultured in the presence or absence of 1 mM folic acid. After 1, 2, and 3 hours of culture, KB cells were washed twice with PBS (1 ml, pH 7.4) to remove unbound Nanoplex, and the cells were detached with 0.25% trypsin. The cells were centrifuged at 1,500 × g, and the pellet was lysed with a cell lysis buffer [PBS containing 0.5% Triton X-100 (trade name)]. DiI fluorescence intensity in an arbitrary unit (Arbitary Unit) was measured using a fluorometer (Hitachi, f-4010) at excitation / emission wavelengths of 550 and 570 nm. Protein concentration was measured by BCA protein assay. The results were expressed as fluorescence (au) per protein concentration (mg / ml).

  The uptake of folate-modified nanoparticles by KB cells was compared to that of non-folate-modified nanoparticles. In examining uptake efficiency, we used NP-T, NP-1FT and NP-1PT. Nanoplex labeled with DiI, a lipidic fluorescent dye, was synthesized from DiI-labeled nanoparticles, and KB cells were cultured in the presence of 10% serum. Nanoplexes that did not bind were carefully removed, and the bound Nanoplexes were measured using DiI fluorescence as an index. The uptake of NP-1PT Nanoplex is lower than that of NP-T Nanoplex, probably due to the addition of PEG-DSPE (see FIG. 2). However, 1.5-fold higher cellular uptake was observed in NP-1FT Nanoplex compared to that of NP-1PT Nanoplex after standing for 3 hours. In 1 mM folic acid-containing medium, cellular uptake with NP-1FT Nanoplex was reduced, but that of NP-1PT Nanoplex was not changed (see FIG. 3). At the time of standing for 3 hours, NP-1FT Nanoplex had incorporated about 8% of the amount used for gene transfer.

The change with time of fluorescence per protein concentration is shown below. [Fluorescence (au) / protein concentration (mg / ml), mean ± standard deviation] (see FIG. 2)
-------------------------------------------------- ----
Time (min) NP-T NP-1PT NP-1FT
-------------------------------------------------- ----
0 0.000 ± 0 0.000 ± 0.000 0.000 ± 0.000
60 6.422 ± 0.241 5.290 ± 0.813 6.630 ± 0.663
120 12.140 ± 0.755 8.175 ± 0.268 9.596 ± 0.160
180 16.900 ± 0.530 10.320 ± 1.41 13.100 ± 0.62
-------------------------------------------------- ----

Subsequently, the results of uptake of NP-1FT Nanoplex and NP-1PT Nanoplex by KB cells in the presence and absence of 1 mM folic acid are shown by fluorescence per protein concentration. [Fluorescence (au) / protein concentration (mg / ml), mean ± standard deviation] (see FIG. 3)
--------------------------------------
Fluorescence per sample protein concentration
--------------------------------------
NP-1PT 10.32 ± 1.41
NP-1PT + folic acid 9.74 ± 1.58
NP-1FT 13.10 ± 0.62
NP-1FT + folic acid 10.02 ± 0.01
--------------------------------------

Example 4 Confocal laser microscope observation
KB cells were seeded in 35 mm culture dishes. 10 μl of nanoparticles and 2 μg of DNA were mixed and diluted in complete medium (1 ml). KB cells were cultured with this mixture for 24 hours in the presence or absence of 1 mM folic acid. After removing the medium, the cells were washed with PBS, fixed with a PBS buffered 4% formaldehyde solution at room temperature for 1 hour, and then washed 3 times with PBS. A cover glass was then placed on the cells coated with Aqua Poly / Mount (Poly-science) to prevent fading. The fluorescence observation was performed using a Radiance 2100 confocal laser microscope (manufactured by BioRad). DiI fluorescence was observed using a helium-neon laser with an excitation wavelength of 543 nm and a long-pass barrier filter 560DCLP.
The fluorescence of FITC-ODN was observed using an argon laser with an excitation wavelength of 488 nm and an HQ515 / 30 filter.

Intracellular localization of Nanoplex, visualized by confocal laser microscopy
KB cells were cultured with DiI-labeled NP-1FT for 24 hours, fixed with 4% paraformaldehyde, and visualized by confocal laser microscopy. When the red fluorescence distribution of DiI on NP-1FT was observed for the whole cell, most of the fluorescence was concentrated on the cell surface (see FIGS. 4A and B).
In contrast, in the 1 mM folic acid-containing medium, the fluorescence on the cell surface was attenuated (see FIGS. 4C and D).
As shown in FIGS. 4E and F, Nanoplex composed of DiI-labeled NP-1FT and FITC-labeled plasmid DNA was cultured with LNCaP cells for 24 hours. The fluorescence of FITC was strongly detected on the cell surface and was small in the cytoplasm (see FIGS. 4E and 4F). The fact that both DiI and FITC fluorescence were detected to be localized on the cell surface suggests that plasmid DNA is still bound to some places in NP-1FT. These findings were also observed in KB cells as shown in FIGS. 4E and 4F.

Example 5 Luciferase Assay Cationic Lipid / DNA Charge Ratio (+/-) 1/1, 2/1, 3/1, 4/1, 5/1 Nanoplex -CMV-LUC plasmid, 2 μg) was added, and the mixture was gently shaken and then allowed to stand at room temperature for 10-15 minutes. For transfection, each nanoparticle was diluted in serum-containing medium (1 ml) and cultured for 24 hours. Luciferase expression was measured by a luciferase assay system. First, the cultured cells into which the gene was introduced were washed three times with cold PBS, and then cell lysis solution (Pica gene) was added to lyse the cells. Thereafter, it was frozen (-70 ° C.) and thawed (37 ° C.) once, and centrifuged at 15,000 × g for 5 minutes. The supernatant was stored at -70 ° C until used for measurement. The supernatant (20 μl) is collected, mixed with the luciferase assay system (pica gene, 100 μl), and then used with a chemiluminescence spectrometer (Perkin Elmer Life Sciences, Wallac ARVO SX1420 multi label counter) The number of proton particles per second (counts) was measured. Using bovine serum albumin as a standard, the protein concentration of the supernatant was determined with the BCA reagent, and cps / μg protein was calculated.

Expression of luciferase in KB and LNCaP cells We evaluated the gene transfer efficiency of 6 kinds of nanoparticles in the presence of 10% serum by luciferase activity. A plasmid encoding luciferase (pAAV-CMV-luc) was introduced into nanoparticles using KB and LNCaP cells using nanoparticles and cultured for 24 hours. As a result, NP-1FT showed the highest luciferase activity in KB cells, while the other nanoparticles showed low activity (see FIG. 5A). NP-0.3FT and NP-1FT showed high luciferase activity in LNCaP cells (see FIG. 5B). Tfx20, a commercially available gene transfection reagent, has 5 times higher luciferase activity in KB cells than NP-1FT (1 × 10 ³ cps / μg protein; equivalent to 1.9 × 10 ³ RLU / μg protein). The cells showed 50 times higher luciferase activity (5 × 10 ⁴ cps / μg protein; equivalent to 1 × 10 ⁵ RLU / μg protein). NP-1FLT decreased luciferase activity. NP-0.3FT showed different transfection activities in both cultured cell lines.

The luciferase activity in KB cells is shown below. [Luciferase activity (cps / μg protein), mean ± standard deviation] (see FIG. 5A)
----------------------------
Sample luciferase activity
----------------------------
NP-T 29.64 ± 22.82
NP-0.3PT 17.55 ± 10.14
NP-0.3FT 33.12 ± 20.18
NP-1PT 11.50 ± 7.61
NP-1FT 184.82 ± 11.99
NP-1FLT 21.00 ± 5.61
----------------------------

Subsequently, luciferase activity in LNCaP cells is shown. [Luciferase activity (cps / μg protein), mean ± standard deviation] (see FIG. 5B)
----------------------------
Sample luciferase activity
----------------------------
NP-T 259.82 ± 37.92
NP-0.3PT 73.69 ± 26.18
NP-0.3FT 410.37 ± 113.78
NP-1PT 71.47 ± 17.07
NP-1FT 1046.49 ± 123.14
NP-1FLT 31.40 ± 12.64
----------------------------

Example 6 RNA isolation and RT-PCR
Using NusleoSpin RNA II (Macherey-Nagel), LNCaP and KB cells
Total RNA was isolated. RNA yield and purity were confirmed by spectroscopic analysis at 260 and 280 nm and RNA electrophoresis, respectively. cDNA was synthesized by denaturing total RNA (5 μg) at 65 ° C. for 5 minutes, and then adding 50 pmol random primer, 0.5 mM dNTP and 5 U AMV reverse transcriptase XL (Takara Shuzo). The reaction was performed at 41 ° C. for 1 hour in a volume of 20 μl. Gene amplification by RT-PCR consists of synthesized cDNA (1 μl), specific primer (10 pmol), PCR reaction buffer containing 1.5 mM MgCl ₂ and 0.25 U Ex Taq DNA polymerase (Takara Shuzo), and 0.2 mM dNTP. Performed in 25 μl reaction. The temperature conditions for PCR amplification consisted of 30 repetitions of denaturation 94 ° C., 0.5 min, primer annealing 55 ° C., 0.5 min, extension reaction 72 ° C., 1 min.

  PCR was performed for the housekeeping genes β-actin, folate receptor (Folate Receptor; FR) -α, -β, -γ, and prostate specific membrane antigen (Prostate Specific Membrane Antigen; PSMA), all with the same number of cycles. These PCR products were analyzed by 8% acrylamide electrophoresis in tris-borate-EDTA (TBE) buffer, ethidium bromide staining. (See Figure 6)

Expression of folate receptor and PSMA mRNA Finally, in order to investigate the cellular uptake mechanism of folate-modified nanoparticles, the expression of folate receptor in KB and LNCaP cells was evaluated by RT-PCR. In KB cells, folate receptor α mRNA was expressed strongly and receptor β mRNA was expressed weakly, but not in LNCaP cells. Folate receptor γ mRNA was not expressed in any cell. This suggested that folate receptor α and receptor β are involved in the cellular uptake of folate-modified nanoparticles in KB cells. Next, we examined whether PSMA, one of the folate-modified proteins, was expressed in LNCaP cells. PSMA mRNA was strongly expressed in LNCaP cells, but not expressed in KB cells (see FIG. 6). This suggests that PSMA may be involved in intracellular uptake of folic acid-modified nanoparticles in LNCaP cells.

Example 7 Examination of Folic Acid Modified Nanoparticles in Folic Acid Modified Nanoparticles In order to examine gene delivery ability of folic acid modified nanoparticles according to folic acid concentration, folic acid modified nanoparticles were prepared in the same manner as in the above example with the formulation shown in the following table did.
-----------------------------------
Formulation Mol%
-------------------------
DC-twin f-PEG2000-
Chol 80 DSPE (F)
-----------------------------------
NP 95 5 ―
NP-1F 94 5 1
NP-2F 93 5 2
NP-3F 92 5 3
-----------------------------------

(1) Nanoparticle size and surface potential
--------------------------------------
Formulation Particle size (nm) Surface potential (mV)
--------------------------------------
NP 117.2 ± 2.0 53.1 ± 2.5
NP-1F 146.1 ± 12.4 43.9 ± 1.7
NP-2F 165.3 ± 22.1 38.6 ± 1.5
NP-3F 118.4 ± 4.3 54.8 ± 6.3
--------------------------------------

  The average particle size and surface potential of each nanoparticle were about 110 to 170 nm and about +40 to +50 mV, respectively.

(2) Particle size and surface potential of Nanoplex (complex of nanoparticles and plasmid DNA) in the presence or absence of serum
--------------------------------------------------
Formulation Particle size Surface potential When 50% serum is added
(nm) (mV) Particle size (nm)
--------------------------------------------------
NP 354.9 ± 8.8 39.0 ± 1.0 499.6 ± 38.8
NP-1F 515.2 ± 32.3 34.2 ± 1.6 623.2 ± 114.9
NP-2F 233.7 ± 6.5 30.8 ± 1.9 431.3 ± 16.0
NP-3F 396.0 ± 7.8 35.1 ± 0.9 662.4 ± 7.2
--------------------------------------------------

Compared to nanoparticles, the particle size of each Nanoplex increased to about 200-500 nm and its surface potential decreased slightly.
Subsequently, the particle diameters of Nanoplex NP-1F, NP-2F, and NP-3F in the presence of 50% serum slightly increased compared with those in the absence, but the maximum was about 660 nm.

(3) In vitro and in vivo gene expression effects of 2mol% folate-modified PEG2000-DSPE gene vector on squamous cell carcinoma cells

3-1) in vitro
In the same manner as in Examples 3 and 5, the incorporation of folate-modified nanoparticles including the pAAV-CMV-LUC plasmid into KB cells was examined in vitro. NP, NP-1F, NP-2F and NP-3F were used as nanoparticles and Tfx20 was used as a comparative control, and the uptake efficiency was evaluated by luciferase activity.
The luciferase activity in KB cells is shown below. [Luciferase activity (cps / μg protein), mean ± standard deviation] (see FIG. 7)

------------------------------
Nanoparticles luciferase activity
------------------------------
NP-T 10.85 ± 3.12
NP-1FT 49.49 ± 37.63
NP-2FT 478.38 ± 63.74
NP-3FT 1.19 ± 0.16
Tfx20 1234.66 ± 397.66
------------------------------
In summary of the results so far, the optimum concentration of f-PEG-DSPE was 1-2 mol%, and 2 mol% showed a higher effect.

3-2) in vivo
In the same manner as described in Example 8 (12) below, KB cells were xenografted into mice, and folate-modified nanoparticles containing pAAV-CMV-LUC plasmid or Tfx20 containing pAAV-CMV-LUC plasmid were placed in squamous cell carcinoma. Administration and cellular uptake were compared in vivo.

The luciferase activity in squamous cell carcinoma cells is shown below. [Luciferase activity (cps / g tumor)] (see Fig. 8)
----------------------------
Nanoparticles luciferase activity
----------------------------
NP-2FT 367250
Tfx20 3250
----------------------------

  The folate-modified gene vector supplemented with 2 mol% folate-modified PEG2000-DSPE was incorporated into squamous cell carcinoma cells via folate receptors in vitro and in vivo, and induced high gene expression. Moreover, particularly in vivo, the gene vector according to the present invention showed a very high gene transfer effect as compared with Tfx20, which is a commercially available gene transfection reagent. This result shows the high clinical usefulness of the present invention.

Example 8 Introduction of tumor suppressor gene into prostate cancer cells
(1) Preparation of plasmid DNA and oligonucleotide pCMV-luc encoding luciferase reporter gene controlled by cytomegalovirus (CMV) promoter was provided by Dr. Tanaka of Mount Sinai University. The pCMV-tk plasmid encoding HSV-tk controlled by the CMV promoter was constructed according to a conventional method.
In constructing pSV40-Cx43, first, to isolate the tumor suppressor gene connexin 43 (Cx43) gene, total RNA was isolated from KB cells using NusleoSpin RNA II (Macherey-Nagel). .
After denaturing 5 μg of total RNA at 65 ° C. for 5 minutes, first strand cDNA was prepared using random primers (50 pmol), 0.5 mM dNTP, 5U AMV reverse transcriptase XL (Takara Shuzo).
Using cDNA prepared from KB cells as a template, cDNA encoding Cx43 base pair 1-1149 was amplified by PCR using Cx43 forward primer (5'-ATCAATGGaccATGGGTGACTGGAGCGCCT): Cx43 reverse primer (5'-CATCTAGACTAGATCTCCAGGTCATCAG) .
The forward primer contains an optimal Kozak sequence of 3 base pairs, along with an Nco I restriction enzyme site (underlined). (Indicated in lower case in the sequence.)
The reverse primer encodes Cx43 base pair 1129-1149 and the Xba I restriction enzyme site (underlined).
After amplifying Cx43 cDNA, this cDNA was cleaved with Nco I and Xba I, and then restriction enzyme cleaved at the Nco I / Xba I site downstream of the simian virus (SV40) promoter (Promega). ).
These plasmids were purified by the alkaline method using a maxiprep column.
FITC-labeled random oligonucleotide (FITC-ODN) was constructed according to a conventional method.

(2) Preparation of nanoparticles and Nanoplex Folic acid-polyethylene glycol-distearoyl phosphatidylethanolamine (f-PEG-DSPE) was prepared according to the method described in Bioconjug. Chem., 10 (1999), 289-298. (Average molecular weight of PEG: 2 kDa)
All nanoparticle compositions are composed of 1 mg / ml of DC-Chol (manufactured by Sigma) and 5 mol% of twin 80 (manufactured by NOF Corporation), which are cationic lipids.
NP-1F, NP-2F and NP-3F contain 1, 2 and 3 mol% f-PEG-DSPE as folate-modified targeting vectors, respectively.
In accordance with the method described in the above J. Control Release, 2004; 97: 173-183., Lipid [for example, NP-2F: DC-Chol: Tween 80: f-PEG-DSPE] = 93: 5: 2 (molar ratio) = 10: 1.3: 1.3 (weight ratio)].
Nanoparticles labeled with 1,1'-dioctadecyl-3, 3, 3 ', 3'-tetramethylindocarbocyanine perchlorate (DiI) were 0.04 mol% DiI (Lambda Probes & Diagnostics) Was added to the total lipid.
Nanoplex with charge ratio (+/-) 3/1 and Tfx20 (Promega) lipoplex with cationic lipid / DNA charge ratio (+/-) 2/1 unless otherwise noted, each nanoparticle or Tfx20 DNA (2 μg) was added thereto, and the mixture was prepared with gentle shaking at room temperature for 10 minutes.

(3) Cell culture
LNCaP cells were provided by the Department of Urology, Keio University Hospital.
PC-3 and KB cells were obtained from Tohoku University Medical Cell Resource Center.
Hela 229, a cultured human cervical cancer cell, was provided by the Department of Virology, Toyama Medical and Pharmaceutical University.
HepG2, a human hepatoblastoma cultured cell, was obtained from Riken Cell Bank.
All cells used in this study were 37 ° C, 5% CO ₂ , folate-free medium RPMI-1640 (Life Technologies) supplemented with 10% non-immobilized fetal bovine serum and kanamycin (100 μg / ml) Incubated in.

(4) Luciferase assay For transfection, each Nanoplex was diluted in 1 ml of medium supplemented with 10% serum and incubated for 24 hours.
The expression of luciferase was measured using a luciferase assay system (Pica gene) according to the method described in J. Control Release, 2004; 97: 173-183.

Expression of luciferase in cultured cells To optimize the composition of folate-modified nanoparticles, study the transfection efficiency of four different 0, 1, 2, and 3 mol% folate-modified nanoparticles in the presence of 10% serum using luciferase activity did.
LNCaP and PC-3 cells were cultured for 24 hours after gene transfer using pCMV-luc.
In both cells, NP-2F, a 2 mol% folic acid-modified nanoparticle, showed the highest luciferase activity compared to other nanoparticles. (See Figs. 9A and 9B)
The optimum folic acid concentration in the nanoparticles was also the same in KB cells.
Therefore, in the following experiment, NP-2F was used, which was indicated as NP-F.
In order to examine the gene transfer efficiency of NP-F and Tfx20 (Promega), which is a commercially available gene transfer reagent, luciferase activity was measured in 5 types of cultured cell lines.
Tfx20 is a synthetic cationic lipid, iodinated [N, N, N ′, N′-tetramethyl-N, N′-bis (2-hydroxyethyl) -2,3-di (oleoyloxy) 1,4-butanediammonium] and L-dioleoylphosphatidylethanolamine (DOPE).

In comparison with Tfx20, NP-F showed a 5-fold higher gene transfer efficiency in PC-3 cells, but about 20-fold lower in LNCaP cells. (See Figure 10A)
However, NP-F showed higher gene transfer efficiency in LNCaP, PC-3 and Hela cells than in HepG2 and KB cells.

(5) RNA isolation and RT-PCR
Total RNA was isolated from LNCaP, PC-3, KB, Hela and HepG2 cells using NusleoSpin RNA II (Macherey-Nagel).
The yield and purity of RNA were confirmed by spectrophotometry (260 nm, 280 nm) and RNA electrophoresis, respectively.
Total RNA from human prostate cancer tissue was obtained from Ambion.
5 μg of total RNA was denatured at 65 ° C. for 5 minutes, and first strand cDNA was prepared using random primer (50 pmol), 0.5 mM dNTP, 5U AMV reverse transcriptase XL (Takara Shuzo).
The reaction was performed at 41 ° C. for 1 hour in a 20 μl volume.
In 25 μl of RT-PCR reaction solution, PCR reaction buffer containing 1 μl of prepared cDNA, specific primer (10 pmol) and Ex Taq DNA polymerase (Takara Shuzo, 0.25 U), and 1.5 mM MgCl ₂ , 0.2 mM dNTP Is included.
PCR amplification temperature conditions consisted of 25 repetitions of denaturation 94 ° C., 0.5 min, primer annealing 58 ° C., 0.5 min, extension reaction 72 ° C., 1 min.
PCR was performed with the same number of cycles for the housekeeping genes β-actin, folate receptor (Folate Receptor; FR) -α, -β, -γ, and folate transporter (RFC).
PCR products of each folate receptor, RFC and β-actin were analyzed by 1.5% agarose gel electrophoresis in Tris-Borate-EDTA (TBE) buffer.
Each product was analyzed by ethidium bromide staining.

Expression of folate receptor mRNA To investigate the cellular uptake mechanism of folate-modified nanoparticles, the expression of folate receptor and RFC in cultured cells was examined by RT-PCR.
The folate receptor has three isoforms, α, β, and γ that differ in pattern and tissue distribution.
Folate receptor-α mRNA is strongly expressed in KB and Hela cells, but not in LNCaP, PC-3 or HepG2 cells. (See Figure 10B)
Folate receptors -β and -γ mRNA are not expressed in any cultured cell line.
RFC, the carrier through the folate transporter, was weakly expressed in all cultured cell lines. (See Figure 10B)
These results suggest that intracellular uptake of folate-modified nanoparticles in Hela and KB cells is carried out via folate receptor-α, leading to transfection activity.
In HepG2 cells, since folate receptor mRNA was not expressed, the transfection effect was about 100 times lower than that of Tfx20.
Although folate receptor mRNA was not expressed in LNCaP and PC-3 cells, NP-F showed a relatively high transfection effect. This suggests that uptake in LNCaP and PC-3 cells is through a different mechanism than the folate receptor.

(6) Confocal laser microscopy
LNCaP and PC-3 cells were seeded in 35 mm culture dishes.
Mix 10 μl of DiI-labeled NP-2F with 2 μg of FITC-ODN and pEGFP plasmid (Clontech) that encodes green fluorescent protein (GFP) in the presence of CMV promoter, and in 10% serum-supplemented medium (1 ml). Diluted.
These cells were cultured with the mixture for 24 hours.
According to the description of J. Control Release, 2004; 97: 173-183., The inspection was performed using a Radiance 2100 confocal laser microscope (manufactured by BioRad).
DiI fluorescence was observed using a helium-neon laser with an excitation wavelength of 543 nm and a long pass barrier filter 560DCLP.
The fluorescence of FITC-ODN and GFP was observed using an argon laser with an excitation wavelength of 488 nm and an HQ515 / 30 filter.

(7) Incorporation of FITC-labeled folate-bovine serum albumin conjugate
FITC-labeled folate-bovine serum albumin conjugate (FITC-f-BSA) was prepared according to the method described in J. Cell Sci., 1993; 106: 423-430.
Briefly, folic acid was dissolved in anhydrous dimethyl sulfoxide and activated with a 5-fold excess of 1-ethyl-3- (3-dimethylaminopropyl) carbodiimide for 1 hour at room temperature.
The activated folic acid was then reacted with FITC-labeled bovine serum albumin (Sigma) in phosphate buffer (pH 7.4).
Excess folic acid was removed from the protein conjugate using a PD-10 desalting column (Amersham Bioscience).
PC-3 cells were seeded beforehand in a 35 mm cell culture dish 24 hours before the experiment.
FITC-f-BSA was diluted to 30 μM in 10% serum-containing / folic acid-free RPMI medium (1 ml), and then added to the cells and cultured in the presence or absence of 1 mM folic acid.
After culturing for 3 hours, each dish was washed twice with 1 ml of PBS (pH 7.4) in order to remove unbound FITC-f-BSA.
FITC-f-BSA was visualized by the confocal laser scanning microscopy described above.

Import FITC-f-BSA
FITC-f-BSA was visualized with a confocal microscope to examine the selectivity of folate sites for uptake into PC-3 cells.
As shown in FIGS. 11A and 11B, the intracellular uptake of FITC-f-BSA was observed.
In a comparative experiment in the presence of 1 mM folic acid, a significant decrease in cellular uptake of cell-bound FITC-f-BSA was observed. (See FIGS. 11C and 11D)
These results indicate that the folic acid site promotes cellular uptake of FITC-f-BSA.

(8) Immunohistochemical examination Normal and cancerous prostate tissue, unstained formalin-fixed paraffin-embedded tissue slide (Chemicon Select Tissue array: TMA3202, Chemicon International) is deparaffinized and contains 1% twin 20-Tris buffer Rinse in chlorinated saline (TBST, pH 7.4).
Sections were left in TBST supplemented with 1% skim milk for blocking, then washed in TBST, and further diluted at room temperature at 1% skim milk supplemented TBST with mouse anti-human folate receptor-α (FR-α This was reacted with a monoclonal IgG antibody (Mov18 / ZEL, Alexis Biochemicals).
Subsequently, the tissue section was reacted with FITC-labeled goat anti-mouse IgG antibody (manufactured by KPL) for 1 hour at room temperature.
After washing with TBST, the antigen-antibody complex was visualized by confocal laser scanning microscopy as described in the cell culture section.

Immunohistochemical examination To evaluate folate receptor expression in tissue biopsy specimens of human malignant tumors, paraffin-fixed sections of folate receptor-α were immunohistochemically stained.
In tumor samples, folate receptor-alpha protein was clearly expressed in 3/4 of the tissue biopsy specimens evaluated. (Refer to Fig. 11E and F)
Folate receptor-α positive staining was present around the epithelial tissue of the prostate.
Folate receptor-α mRNA was detected by RT-PCR in RNA from prostate cancer tissue.
In contrast, no staining was observed when normal tissue sections were reacted with folate receptor-α antibody.

(9) Flow cytometry analysis
LNCaP cultured cells were seeded in advance in a 35 mm cell culture dish 24 hours before the experiment.
10% serum-added folate-free RPMI medium (1 ml) supplemented with Nanoplex containing FITC-ODN (2 μg) was added to monolayer LNCaP cells.
After culturing for 3 to 24 hours, in order to remove unbound Nanoplex, the culture dish was washed twice with PBS (pH 7.4, 1 ml), and the cells were detached with 0.25% trypsin.
The amount of FITC-ODN in the cells was determined by fluorescence emission intensity measurement using a fax caliber flow cytometer (Becton Dickinson).

Transfection efficiency and localization of Nanoplex visualized by confocal microscopy and flow cytometry
In order to clarify the gene transfer ability of NP-F into LNCaP and PC-3 cells, the gene transfer efficiency of NP-F including pEGFP-C1 plasmid into LNCaP and PC-3 cells was examined.
Confocal microscopy showed that GFP protein expression was strong in 2-3% of cells in both LNCaP cells (FIG. 12A) and PC-3 cells (FIG. 12B) in response to luciferase expression, most of the others. Weak expression was observed in these cells.
Next, after transfection into LNCaP cells, the localization of fluorescent dyes DiI-labeled NP-F and FITC-ODN was examined.
The distribution pattern of the red DiI signal on NP-F was weakly observed on the cell surface 3 hours after transfection (FIG. 12C) and strongly observed after 24 hours (FIG. 12D).
In contrast, the FITC signal was strongly observed throughout the cytoplasm after 3 hours (FIG. 12C) and diffused after 24 hours (FIG. 12D).
Most of the DiI and FITC signals were not colocalized in the cytoplasm.
The flow cytometry results also indicated that the FITC intensity in LNCaP cells was stronger at 3 hours after transfection than at 24 hours (FIG. 12E), suggesting that DNA was released from the Nanoplex and diffused into the cytoplasm.
In PC-3 cells, strong FITC intensity was also observed 3 hours after transfection.

(10) Analysis of GCV metabolites by anion exchange HPLC
In accordance with the method described in Biochem. Biophys. Res. Commun., 2001; 289: 525-530., Using pCMV-tk transgenic cells seeded in a 35 mm cell culture dish, GCV in LNCaP cells and PC-3 cells The accumulation of phosphorous oxide (GCV-MP), diphosphorus oxide (GCV-DP), and triphosphorus oxide (GCV-TP) was examined.
GCV was added to the cells at a concentration of 100 μg / ml.
After culturing for 24 hours, the cells were washed 3 times with PBS.
After trypsinization, the cells were collected by centrifugation at 1,500 × g for 10 minutes.
The cell pellet was extracted with 60% methanol (HPLC quality) and the extract was heated at 95 ° C. for 2 minutes.
After centrifugation, the supernatant fraction was collected and concentrated under reduced pressure, and immediately dissolved in water before analysis.
The aqueous fraction of cell extract was used for HPLC analysis.
GCV and its phosphorylated metabolite were separated using a 616 LC HPLC system (Waters) with an ultraviolet detector.
Metabolites were separated using a Senshu Pak SAX-1253P column (250 × 4.6 mm, manufactured by Senshu Kagaku).
Elution consists of the following processes.
Uniform solvent elution with 100% buffer A (pH unadjusted 0.02M ammonium phosphate), 0-5 minutes
Linear gradient to 25% buffer B (10% methanol added, 0.7M ammonium phosphate), 5-20 minutes
Linear gradient to 100% buffer B, re-equilibration to buffer A at a flow rate of 2 ml / min for 20-30 minutes, retention time for intracellular triphosphorylated ribonucleotides for 40-55 minutes, ribonucleotide standard The elution peak time at 254 nm was determined.
The respective retention times were UTP, 29 minutes; CTP, 30 minutes; ATP, 32 minutes; GTP, 34 minutes.
The retention times of GCV and its phosphorylated were GCV-MP, 9 minutes; GCV-DP, 21 minutes; GCV-TP, 33 minutes.

Analysis of GCV metabolites in cells transfected with pCMV-tk
To confirm the generation of GCV metabolites, GCV phosphorylation was analyzed in LNCaP cells incubated with 100 μg / ml GCV for 24 hours after transfection with pCMV-tk.
GCV-TP produced most as a triphosphorylated substance was strongly detected in the transfected cells (FIG. 13B), whereas phosphorylation of GCV was not detected in the non-transfected cells (FIG. 13B). 13A).
These findings shown in FIG. 13B were also observed in PC-3 cells.

(11) Cytotoxicity test of HSV-tk transgenic cells in vitro
LNCaP and PC-3 cells were seeded in 96-well plates at a density of 1 × 10 ⁴ cells per well and replaced with 10% serum-added folate-free RPMI medium 12 hours before transfection.
Cells were transfected with each of the following NP-F Nanoplexes.
0.2 μg pGL3 enhancer as control DNA
0.1 μg pCMV-tk to which 0.1 μg pGL3 enhancer (Promega) was added,
0.1 μg pGL3 enhancer with 0.1 μg pSV40-Cx43 added,
0.1 μg pCMV-tk added with 0.1 μg pSV40-Cx43 was used.

After 12 hours of incubation, the culture medium was replaced with several GCV 0.1-1,000 μg / ml concentrations.
Four days after exposure to GCV, the number of viable cells was measured using a WST-8 assay kit [manufactured by DOJINDO LABORATORIES].

WST-8 assay
1. Microplate method
1) Dilute Standard BSA solution in half with pure water one by one, and prepare 0-5000μg / ml BSA diluted solution.
2) Add 180 μl Buffer solution to each well.
3) Add 20 μl of the calibration curve BSA dilution solution of each concentration prepared in 1) or sample to each well and mix. The calibration curve is preferably n = 3.
4) Add 20μl of WST-8 solution to each well and mix well.
5) Cover the plate with light-shielding aluminum foil and incubate at 37 ° C for 1 hour.
6) Measure absorbance at 650 nm using a plate reader.
7) Subtract the absorbance of the blank (BSA: 0 μg / ml) from the absorbance of each well.
8) Take the concentration of BSA on the horizontal axis and create a calibration curve from the absorbance of the diluted BSA solution.
9) Calculate the protein concentration of the sample from the calibration curve.

2. Cell method [when using an absorptiometer]
1) As with the microplate method, standard BSA solution is diluted in half sequentially with pure water to prepare a 0-5000 μg / ml BSA diluted solution.
2) Add 2.25ml Buffer solution to the test tube.
3) Add the BSA diluted solution for the calibration curve of each concentration prepared in 1) or 50 μl of the sample and mix.
4) Add 250μl of WST-8 solution and mix well.
5) Incubate the tube at 37 ° C for 1 hour with light shielded aluminum foil.
6) Transfer the reaction solution to a spectrophotometer cell (1 cm × 1 cm) and measure the absorbance at 650 nm.
7) Subtract the absorbance of the blank (BSA: 0 μg / ml) from the measured absorbance.
8) Take the concentration of BSA on the horizontal axis and create a calibration curve from the absorbance of the diluted BSA solution.
9) Calculate the protein concentration of the sample from the calibration curve.

Sensitivity of cells transiently transfected with pCMV-tk and pSV40-Cx43 to GCV
LNCaP and PC-3 cells were each transiently transfected with NP-F Nanoplex of various plasmids (pCMV-tk, pSV40-Cx43 and combinations thereof).
GCV sensitivity was compared with IC ₅₀ values.
In LNCaP cells, cells transfected with pCMV-tk with NP-F showed significantly higher GCV sensitivity (85.6 fold increase) compared to controls, and cells transfected with pSV40-Cx43 increased 12.9 fold. (FIG. 14A)
Cells transfected with both pCMV-tk and pSV40-Cx43 had increased sensitivity to GCV. (101.8 times increase compared to control)
These results show the cytotoxic effect of GCV on cells transfected with pCMV-tk and pSV40-Cx43 with NP-F, respectively, and cells transfected with pCMV-tk and pSV40-Cx43 are It is thought that the action of GCV was enhanced by the effect (bystander effect).
In PC-3 cells, cells transfected with pCMV-tk with NP-F showed significant GCV sensitivity compared to the control (FIG. 14B), but cells transfected with pSV40-Cx43 did not.
Cells transfected with pCMV-tk and pSV40-Cx43 together with NP-F did not increase sensitivity to GCV. This result indicates that pSV40-Cx43 did not show a bystander effect in PC-3 cells.

(12) Evaluation of LNCaP cancer cell growth in vivo Male BALB / c nu / nu mice (8 weeks old, manufactured by CLEA Japan, Inc.) were folic acid-free rodent diet (Oriental Yeast) ).
For tumor xenotransplantation, 1 × 10 ⁷ LNCaP cells suspended in RPMI medium (50 μl) containing 60% reconstituted basement membrane (Matrigel: Collaborative Research) were implanted subcutaneously in the flank of mice. .
In order to maintain the testosterone concentration in serum, male mice were intraperitoneally administered testosterone propionate (0.5 mg, manufactured by Wako Pure Chemical Industries) once every other day dissolved in olive oil.
Tumor volume was calculated according to the following formula. (A and b mean a major axis and a minor axis, respectively.)
Tumor volume = 0.5 x a x b ²
When the average volume of transplanted cancer reached 60 mm ³ (day 0), the mice were divided into the following two groups.
group I, pGL3-enhancer (10 μg) as control DNA
group II, mixed DNA of pCMV-tk (5μg) and SV40-Cx43 (5μg) as treatment group

Six cancers were used in each group.
On days 0, 3, 5 and 7, Nanoplex was prepared using 10 μg plasmid DNA and nanoparticulate NP-F (50 μl) and directly administered intratumorally.
At 24 and 36 hours after administration of Nanoplex, GCV 25 mg / kg was administered intraperitoneally.
Tumor volume was measured at 0, 3, 5, 7, 9 and 11 days after the start of treatment.
The results are shown as mean ± standard error.
The above animal experiments were conducted with the ethical permission of the Institutional Animal Care and Use Committee.

Since the NP-F Nanoplex consisting of pCMV-tk and pSV40-Cx43 was most effective in in vitro experiments using LNCaP cells, the in vivo antitumor effect of direct administration of Nanoplex into the tumor was examined. (See Figure 15)
When the average volume of transplanted cancer reached 70 mm ³ , the mice were divided into two groups and administered intratumorally on days 0, 3, 5, and 7.
GCV (25 mg / kg) was intraperitoneally administered 24 and 36 hours after the administration of Nanoplex.
Tumor growth suppression was observed in mice treated with NP-F Nanoplex consisting of pCMV-tk and pSV40-Cx43, but not in control mice.
The mean survival times of Nanoplex-treated mice as controls and NP-F Nanoplex-treated mice consisting of pCMV-tk and pSV40-Cx43 were 21.5 days and 33 days, respectively.

(13) Statistical significance of statistical analysis data was evaluated by Student's t test.
The case where the P value was 0.05 or less was considered significant.

Example 9 Cytotoxicity test Method Evaluation samples were prepared as follows. Lipofectamine 2000 (manufactured by Invitrogen) was used as a control for cytotoxicity.
(1) Normal (no administration)
(2) NP-2FT
(3) SSD (2.0μmol / l Single Strand Decoy [CCTTGAAGGGATTTCCCTCC] / NP-2FT)
(4) D0.1 (0.1μmol / l Double Strand NF-κB Decoy / NP-2FT)
(5) D1.0 (1.0μmol / l Double Strand NF-κB Decoy / NP-2FT)
(6) Lipofectamine 2000

Mouse macrophage RAW264.7 was seeded in a 24-well plate (4.0 × 10 ⁴ cells / well). After culturing for 24 hours, each oligonucleotide encapsulated in NP-2FT was introduced in 5 hours. Then fetal bovine serum (FBS) was added. 24 hours after oligonucleotide introduction, WST-1 assay was performed to evaluate cytotoxicity.

Oligonucleotide introduction into macrophages ↓ 5 hours
FBS addition ↓ 19 hours
WST-1 assay

  Mouse macrophage RAW264.7 can be obtained through, for example, ATCC (P.O. Box 1549, Manassas, VA 20108, USA) or IST Biotechnology Department (10 I-16132 Genova, Italia).

ATCC Number: TIB-71
http://www.atcc.org/SearchCatalogs/longview.cfm?view=ce,6290175,TIB-71&text=RAW%20%26%20264%2E7&max=20

ECACC 91062702
http://www.biotech.ist.unige.it/cldb/cl4110.html

WST-1 assay
1) Perform cell culture and transfect 1 sample into 3 wells.
2) Add 10% WST-1 cell proliferation measurement reagent to the medium 30-120 minutes before cell lysis.
3) Convert WST-1 conversion directly or aliquot and quantify with ELISA reader.
4) Discard reagent / medium and lyse cells for reporter assay.
5) Standardize the reporter assay results according to the absorbance of the WST-1 assay.
6) The absorbance of WST-1 is equivalent to the cell count result.
7) The average and standard deviation of each group when the absorbance of the (1) Normal (no administration) group was 100% were calculated.

The results are shown in the table below. (Unit:%, see Fig. 16)
---------------------------------------
Group mean standard deviation
---------------------------------------
(1) Normal (no administration) 100.00 0.00
(2) NP-2FT 103.00 5.99
(3) SSD 99.35 5.75
(4) D0.1 90.83 3.30
(5) D1.0 96.98 2.69
(6) Lipofectamine 57.96 0.58
---------------------------------------
Lipofectamine, which is frequently used as a cationic lipid for gene transfer, is known to have cytotoxicity, but it is clear from the above results that the nanoparticle preparation according to the present invention does not have cytotoxicity.

Example 10 NF- [kappa] B nuclear translocation inhibition test Method Evaluation samples were prepared as follows.
(7) Normal (no administration)
(8) SSD (2.0μmol / l Single Strand Decoy [CCTTGAAGGGATTTCCCTCC] / NP-2FT)
(9) D0.01 (0.01μmol / l Double Strand NF-κB Decoy / NP-2FT)
(10) D0.03 (0.03μmol / l Double Strand NF-κB Decoy / NP-2FT)
(11) D0.1 (0.1μmol / l Double Strand NF-κB Decoy / NP-2FT)
(12) D1.0 (1.0μmol / l Double Strand NF-κB Decoy / NP-2FT)

Mouse macrophage RAW264.7 was seeded in a 6-well plate (6.0 × 10 ⁵ cells / well). After culturing for 24 hours, each sample was introduced in 5 hours. Thereafter, LPS (lipopolysaccharide, 100 ng / ml) was added and the mixture was stimulated for 1 hour. A nuclear extract was prepared, and nuclear NF-κB protein was measured by ELISA. The average and standard deviation of each group when the amount of protein in the SSD administration group was 100% were calculated.

Each sample is introduced into macrophages ↓ 5 hours
LPS stimulation ↓ 1 hour Nuclear extract preparation, nuclear NF-κB protein measurement

The results are shown in the table below. (Unit:%, see Fig. 17)
---------------------------------------
Group mean standard deviation
---------------------------------------
(7) Normal (no administration) 30.41 8.38
(8) SSD 100.00 0.00
(9) D0.01 100.87 5.79
(10) D0.03 53.20 2.42
(11) D0.1 39.89 6.60
(12) D1.0 5.49 1.30
---------------------------------------
From the above results, the excellent NF-κB nuclear translocation inhibitory action of the nanoparticle preparation according to the present invention is clear.

  The present invention provides a preparation for target-specific intracellular delivery of a nucleic acid drug, in particular, a stable nanoparticle preparation including the nucleic acid drug.

It is the graph which showed the relationship between the charge ratio and luciferase activity in Nanoplex. It is the graph which showed the change with time of the uptake | capture amount by the KB cell of the folic acid modification nanoparticle by the fluorescence per protein concentration (mg / ml). It is the graph which compared the fluorescence per protein concentration (mg / ml) in a 1 mM folic acid presence culture medium. This is a photograph of DiI-labeled NP-1FT fixed after administration to KB cells and visualized by confocal laser microscopy. It is the graph which compared with the luciferase activity about the gene transfer efficiency of six types of nanoparticles to KB cells in the presence of 10% serum. It is the graph which compared with the luciferase activity about the gene transfer efficiency of six types of nanoparticles to LNCaP cells in the presence of 10% serum. It is the electrophoresis photograph when the expression of a folate receptor and PSMA was evaluated by RT-PCR method. It is the graph which compared the uptake | capture efficiency (in vitro) of the folic acid modification nanoparticle to KB cell by luciferase activity. It is the graph which compared the uptake | capture efficiency (in vivo) of a folate modification nanoparticle and a commercially available gene transfer reagent to KB cell by luciferase activity. It is the graph which compared the gene transfer efficiency of the folic acid modification nanoparticle from which density | concentration differs in LNCaP and PC-3 cell by luciferase activity. (A; LNCaP cell, B; PC-3 cell) A: A graph comparing the gene transfer efficiency of folic acid-modified nanoparticles and a commercially available gene transfer reagent in terms of luciferase activity in five types of cultured cell systems. B: The results of examining the expression of folate receptor, folate transporter (RFC) and β-actin in cultured cells by RT-PCR. A, B: It is the result of having observed the intracellular uptake | capture of FITC-f-BSA with the confocal microscope. C, D: The results of observation of FITC-f-BSA intracellular uptake with a confocal microscope in the presence of 1 mM folic acid. E, F; Folic acid receptor expression in human malignant tumors is a result of observation by immunohistochemical staining. It is the result of having observed with the confocal microscope about the gene transfer effect to the LNCaP and PC-3 cell of a folate modification nanoparticle. (FIG. 12A; LNCaP cell, FIG. 12B; PC-3 cell) FIG. 12 shows the results of examining the localization of fluorescent dyes DiI-labeled NP-F and FITC-ODN after gene introduction into LNCaP cells. (FIG. 12C; 3 hours after gene introduction, FIG. 12D; 24 hours after) The results of time-dependent changes in FITC intensity after gene introduction into LNCaP cells were observed by flow cytometry. (Figure 12E) It is the HPLC chart which analyzed about GCV phosphorylation in the LNCaP cell which was not gene-transferred. FIG. 13A is an HPLC chart analyzing GCV phosphorylation in LNCaP cells transfected with pCMV-tk gene. (Fig. 13B) It is the graph which compared the GCV sensitivity at the time of gene-transferring various plasmids in a LNCaP cell. FIG. 14A is a graph comparing GCV sensitivity when various plasmids are introduced into PC-3 cells. (Fig. 14B) It is the graph which showed the time-dependent change of the average volume of the transplanted cancer when a tumor suppressor gene was directly introduce | transduced into the LNCaP tumor by the folate modification nanoparticle. It is the graph which compared the cytotoxicity of a folic acid modification nanoparticle and Lipofectamine. It is the graph which compared the NF- (kappa) B nuclear transfer inhibitory effect by the folic acid modification nanoparticle containing NF- (kappa) B decoy.

Claims (28)

A preparation for delivering a nucleic acid drug in a target-specific manner, wherein the nucleic acid drug is [3β-N- (N ′, N′-dimethylaminoethane) carbamoyl] cholesterol (DC-Chol), polyoxyethylene sorbitan A stabilized preparation comprising a composition comprising monooleate 80 (twin 80) and folic acid-polyethylene glycol-distearoylphosphatidylethanolamine (folate-PEG-DSPE). The composition of DC-Chol in the preparation is in the range of 80 to 98 mol%, twin 80 is in the range of 1 to 10 mol%, and folate-PEG-DSPE is in the range of 0.1 to 10 mol%. Stabilized formulation. The composition of DC-Chol in the preparation is 88 to 96 mol%, twin 80 is 3 to 7 mol%, and folate-PEG-DSPE is in the range of 0.5 to 5 mol%. The stabilized formulation as described. The stabilized preparation according to claims 1 to 3, wherein the composition ratio of DC-Chol in the preparation is 93 to 94 mol%, twin 80 is 4 to 6 mol%, and folate-PEG-DSPE is 1 to 2 mol%. 5. The stabilized preparation according to claim 1, wherein polyethylene glycol (PEG) has an average molecular weight of 1,000 to 5,000. 6. The stabilized preparation according to claim 1, wherein PEG has an average molecular weight of 2,000. The stabilized preparation according to any one of claims 1 to 6, wherein the preparation is not a liposome in which water is encapsulated by a lipid bilayer, but is a nanoparticle not containing water. The stabilized preparation according to claim 7, wherein the preparation is nanoparticles having a particle diameter of 50 to 1000 nm. The stabilized preparation according to claim 7 or 8, wherein the preparation is nanoparticles having a particle diameter of 60 to 800 nm. 10. The stabilized preparation according to claim 1, comprising 0.01 to 10% by weight of a nucleic acid drug. The stabilized preparation according to claim 1, comprising 0.1 to 5% by weight of a nucleic acid drug. 12. The stabilized preparation according to claim 1, wherein the nucleic acid drug is a gene or an analog thereof. The stabilized preparation according to claim 1, wherein the nucleic acid drug is a gene. 14. The stabilized preparation according to claim 1, wherein the nucleic acid drug is a tumor suppressor gene. The stabilized preparation according to claim 1, wherein the analog of the gene is a polynucleotide or an oligonucleotide. 16. The stabilized preparation according to claim 1, wherein the oligonucleotide is a decoy (decoy molecule), antisense, ribozyme, aptamer or siRNA. The stabilized preparation according to any one of claims 1 to 16, wherein the decoy has an action of inhibiting the binding of a transcriptional regulatory factor to the binding site. The decoy is a decoy oligonucleotide of NF-κB, STAT-1, STAT-2, STAT-3, STAT-4, STAT-5, STAT-6, GATA-3, AP-1, E2F, Ets or CRE Item 18. A stabilized preparation according to Item 1 to 17. The stabilized preparation according to any one of claims 1 to 18, wherein the decoy is an NF-κB decoy oligonucleotide. 20. The stabilized preparation according to claim 1, wherein the decoy is an NF-κB decoy oligonucleotide represented by SEQ ID NO: 1. 21. The stabilized preparation for transdermal delivery according to claim 1, wherein the cells are skin cells. 21. The stabilized preparation for intra-knee joint administration according to claim 1, wherein the cells are synovial cells or macrophages. 21. The stabilized preparation for intravenous injection according to claim 1, wherein the cells are cancer cells, macrophages, hepatocytes or kidney cells. 21. The stabilized preparation for intra-cancer administration according to claim 1, wherein the cell is a cancer cell. Cancer cells are squamous cell carcinoma, prostate cancer, cervical cancer, endometrial cancer, ovarian cancer, brain cancer, liver cancer, lung cancer, breast cancer, kidney cancer, gastric cancer, esophageal cancer, colon cancer, pancreatic cancer, skin cancer, pharyngeal cancer The stabilized preparation according to claim 23 or 24, which is a kind selected from nasopharyngeal cancer. A transdermal preparation for intradermal delivery of NF-κB decoy oligonucleotides, characterized in that NF-κB decoy oligonucleotides are included in nanoparticles composed of DC-Chol, Twin 80 and folate-PEG-DSPE Stabilized preparation. 27. Use of the stabilized formulation of claim 26 for treating inflammatory skin diseases. Inflammatory skin diseases are atopic dermatitis, contact dermatitis, photosensitivity dermatitis, chronic hand and foot dermatitis, seborrheic dermatitis, monetary dermatitis, generalized exfoliative dermatitis, congestive skin 28. Use of the stabilized formulation according to claim 27, which is inflammation, topical abrasion dermatitis, drug dermatitis or psoriasis.

Images