JP2003527860A - BRCA-1 regulatory factors and methods of use - Google Patents

Abstract

  (57) [Summary] The present invention provides ribozymes and nucleic acids encoding the same. The encoding nucleic acid includes a target recognition sequence that allows the ribozyme to target and cleave a BRCA-1 regulator, resulting in up-regulation of BRCA-1 in cells. Furthermore, there is provided a nucleic acid encoding a BRCA-1 regulator comprising a target sequence recognized by the ribozyme of the present invention. Also provided are fragments of these nucleic acid and protein sequences. Furthermore, methods for identifying genes whose expression levels are affected by BRCA-1 regulators, and some genes that are affected are revealed. Also provided is a method of identifying a compound that modulates the activity of a BRCA-1 regulator. Further, there is provided a method for treating cancer, comprising introducing a ribozyme selectively reacting with RNA encoding a BRCA-1 regulatory factor into cancer cells. Further, the invention includes a method for detecting tumor cells in a sample.

Description

Detailed Description of the Invention

FIELD OF THE INVENTION The present invention relates generally to proliferative disorders, such as cancer, and more specifically to the regulation of the tumor suppressor BRAC A-1 which can be used in the diagnosis and treatment of proliferative disorders.

BACKGROUND OF THE INVENTION Cancer is one of the leading causes of death in the United States. Each year, more than 500,000 Americans die from cancer and more than one million are newly diagnosed with cancer. Cancerous tumors develop when cells exit normal growth regulatory mechanisms and grow in an uncontrolled manner. Tumor cells can metastasize to a secondary site if the treatment of the primary tumor is not complete or if treatment of the primary tumor is not initiated prior to substantial progression of said tumor. Therefore, early diagnosis and effective treatment of tumors are essential for survival.

Cancer involves clonal expansion of cell populations that have gained the advantage of being more competitive than normal cells due to changes in regulatory genes. Regulatory genes can be roughly classified into "oncogenes" and "tumor suppressor genes." The former promotes unregulated cell growth when activated or overexpressed and the latter fails to prevent abnormal cell growth when inactivated or underexpressed. Reduced function or inactivation of tumor suppressor genes is thought to play a central role in the initiation and progression of cancer in a large number of humans. Mutations in one of the known tumor suppressor genes, BRCA-1, are responsible for the genetic susceptibility of ovarian and breast cancer in almost all cases. Furthermore, BRCA-1 expression levels are reduced or undetectable in sporadic breast cancer tumor cells.

Cancer therapies that regulate the function of tumor suppressor genes, either by pharmaceutical compounds or gene therapy, have yielded promising results in animal models and human clinical trials.
Methods have also been developed for diagnosing and prognosing cancer by identifying mutations in known tumor suppressor genes or in genes that regulate the expression of tumor suppressor genes. For example, identification of individuals with germline mutations in known tumor suppressor genes allows identification of individuals at high risk of developing cancer. Such individuals are then closely monitored or treated prophylactically to increase their chances of survival. Identifying patterns of alterations of known tumor suppressor genes in biopsy samples has also been used to determine the presence or stage of tumors. The ability to determine whether a cancer is benign or malignant at an early or late stage of progression provides patients and physicians with a more accurate prognosis, which can be used to determine the most effective treatment for the patient.

Given the importance of tumor suppressor molecules in the detection and treatment of cancer and the known correlation between the tumor suppressor BRCA-1 and breast and ovarian cancer, nucleic acids and polys that influence the level or activity of BRCA-1 There is a need to identify peptides. The present invention fulfills this need and also provides related advantages.

SUMMARY OF THE INVENTION The present invention relates to methods of identifying genes that are responsible for cancer formation, as well as identified genes and gene products as targets for cancer therapy. The present method is aimed at identifying genes encoding proteins that regulate the tumor suppressor, BRCA-1, and thus increase cancer propensity. Accordingly, the present invention encodes a ribozyme having a target recognition sequence capable of binding to and cleaving a BRCA-1 regulatory factor, thereby up-regulating or down-regulating BRCA-1 in cells and a ribozyme encoding the same. Provide a nucleic acid. Furthermore, BRCA-1 containing a target sequence recognized by the ribozyme of the invention
Nucleic acids encoding regulatory elements are provided. Fragments of these nucleic acid and protein sequences are also provided.

Furthermore, a method of identifying a gene whose expression level is affected by a BRCA-1 regulator is provided. The method comprises the steps of: a) hybridizing a first mRNA and a second mRNA with at least one candidate gene, wherein the first mRNA encodes a BRCA-1 regulatory element. Is obtained from cells expressing a ribozyme that targets and cleaves the messenger RNA, which is Comparing the relative amounts of the first and second mRNAs that hybridize to the gene, with respect to the above steps, which in that respect were obtained from control cells similar to cells expressing the ribozyme, and b) The process of doing. mRNA before hybridization
It may be reverse transcribed into DNA. In addition, the gene or mRNA (or cDNA copy) may be labeled with a detectable moiety, such as a fluorescent dye. In yet another embodiment, hybridization with multiple genes is performed by arraying the genes on a solid support.

Also provided are methods of identifying compounds that modulate the activity of a BRCA-1 regulator. The method comprises contacting the BRCA-1 regulator with a test compound and a target molecule responsive to the activity of the BRCA-1 regulator. In this case, an increase or decrease in BRCA-1 regulator activity against the target molecule in the presence of the test compound compared to the absence of the test compound identifies compounds that modulate the activity of the BRCA-1 regulator. It The activity of the BRCA-1 regulator may be DNA binding activity, protein kinase activity, GTP binding activity, protease activity, or protein binding activity.

Further provided is a method of treating cancer comprising the steps of: contacting the cancer cell with an expression vector encoding a ribozyme that selectively reacts with RNA encoding BRCA-1, or With the ribozyme. Also provided is a method of detecting neoplastic cells in a sample, wherein said neoplastic cells have an altered expression of a BRCA-1 regulatory factor or a relative to normal cells.
Accompanied by structural changes in BRCA-1 regulators. The method comprises the following steps: (a) BRCA
-1 contacting the sample with a detection agent specific for the regulatory factor nucleic acid or the encoded BRCA-1 regulatory factor polypeptide; and (b) detecting the nucleic acid and the polypeptide in the sample, In this case, the altered expression or altered structure of the polypeptide is indicative of the presence of neoplastic cells in the sample.

DETAILED DESCRIPTION OF THE INVENTION The present invention relates to methods for identifying genes responsible for cancer formation and the above identified genes and gene products as therapeutic targets for the treatment of cancer. The present method relates to the identification of genes encoding proteins that regulate the tumor suppressor BRCA-1 and increase the propensity to develop cancer. Genes encoding BRCA-1 regulators have been sought as identification and therapeutic targets because they are associated with certain types of cancer (eg breast cancer) with decreased BRCA-1 expression levels or decreased BRCA-1 activity. There is.

In one embodiment, BRCA-1 regulators are identified. BRCA-1 is a tumor suppressor that prevents cells from undergoing uncontrolled growth, such as occurs in cancer cells.
BRCA-1 can function as a transcription factor, so BRCA-1 tumor suppressor activity results, at least in part, from the regulation of gene expression. The decrease in BRCA-1 activity is
It is associated with cancer (eg, breast cancer, ovarian cancer, endometrial cancer, prostate cancer, etc.). In some cancers, decreased BRCA-1 activity is due to mutations in the BRCA-1 gene, while in others, BR
The decrease in CA-1 activity is due to the decrease in BRCA-1 expression level. To date, BRCA-1
The nature of expression regulation has not been fully elucidated. In the present invention, a number of nucleic acid sequences corresponding to the BRCA-1 regulatory factor have been identified. These nucleic acid sequences have been shown to regulate BRCA-1 gene expression or BRCA-1 activity. Many of these nucleic acid sequences (BBC1, BR1
, Including ID4, BR2, and BR3), can increase BRCA-1 expression or BRCA-1 activity.

As used herein, the term “substantially pure” when used in reference to a nucleic acid or polypeptide of the invention is associated with a cellular component (eg, lipid, polypeptide, nucleic acid or naturally occurring). Other cellular components) that are relatively free of forms of the molecule. As used herein, the term “nucleic acid” refers to single or double stranded DNA or RNA molecules. For example, a nucleotide represented by "T" in the listed sequences is equivalent to a "U" nucleotide. The nucleic acid molecules of the invention may be linear, circular or branched in structure and may represent either the sense strand or the antisense strand of the naturally occurring nucleic acid molecule, or both. Unless otherwise specified, the nucleotide sequence of a nucleic acid molecule includes single-stranded and double-stranded sequences. The term is also intended to include nucleic acid molecules of both synthetic and natural origin. A naturally occurring nucleic acid molecule can be any animal (eg, human, non-human primate, mouse, rat, rabbit, cow, pig, dog, cat or amphibian), or lower eukaryote (
For example Drosophila, C. elegans or yeast). Synthetic nucleic acids include, for example, nucleic acids prepared by chemical and enzymatic synthesis. Similarly, the term "nucleic acid" is meant to include naturally occurring nucleotides and analogs of naturally occurring nucleotides that have similar binding properties to the referenced nucleic acids and that are also available in a manner similar to nucleosides. Intent.

As used herein, the term “fragment” when used in reference to a nucleic acid refers to a portion or fragment of a nucleic acid molecule that has the ability to selectively hybridize or bind to the subject nucleic acid or its complement. Point to. As used herein,
The term "selectively hybridize" refers to the ability of a nucleic acid or fragment to bind to a subject nucleic acid molecule without substantial cross-reactivity with molecules that are not the subject nucleic acid molecule.

A fragment of a nucleic acid molecule of the present invention comprises at least about 8-12 of the subject nucleic acid molecule.
Contains nucleotides. For example, the hairpin ribozyme ribozyme sequence tag (RST) and its complementary target sequence tag (TST) described herein generally range from about 14-1.
It contains 6 nucleotides, of which 6-8 nucleotides are in helix 1 and approximately 4 nucleotides are in helix 2, the two helices being separated by four base pair non-forming nucleotides. All of the RST nucleotides present in helix 1 are targeted to the TST-containing RNA by the ribozyme, so that the
It does not have to be complementary to. Generally, depending on the nucleotide position in the sequence, 1-2 bases of RST helix 1 may be non-complementary to TST, which does not result in reduced ribozyme function. However, in some cases up to 4 bases may be non-complementary. Thus, a fragment that has the ability to selectively hybridize is about 8, 9, 10, 11 or 12 of the subject nucleic acids.
It can include nucleotides. Fragments can also include a larger number of nucleotides corresponding to the subject nucleic acid or its complement. For example, about 13
, 14 or 15 nucleotides, and at least 16, 17, 18, as long as the fragment retains the ability to selectively hybridize with the subject nucleic acid.
It can contain 19 or 20 nucleotides. Furthermore, the fragments may be longer (at least about 25, 30, 40, 50, 100, 300,
Or 500 or more nucleotides), and up to 1 nucleotide less than the full length of the reference nucleic acid molecule. Fragments of the above lengths can selectively hybridize to the subject nucleic acid molecules in the various detection modalities described herein and those known to those of skill in the art.

Thus, a fragment of a nucleic acid molecule of the present invention may be used, for example, as a RST for targeting ribozymes to the nucleic acid molecule of the present invention, or to cells that have aberrant BRCA-1 activity or BRCA-1 expression levels. It can be used as a factor that selectively suppresses the unregulated growth of Escherichia coli. TST can be used as a PCR primer to selectively amplify a nucleic acid molecule of the invention; 5'or 3'of a nucleic acid identified by the method of the invention can be used as a selective primer for RACE. Alternatively, the 3'sequence can be determined or identified; used as a selective probe to identify or isolate nucleic acid molecules of the invention on RNA or DNA blots or from cDNA libraries.

The term “unique” when used in reference to a particular nucleic acid sequence is characteristic or distinguishable when comparing another or related nucleotide sequences at the same or similar positions. , Or at least one nucleotide that is novel at a particular position. Speaking of specific sequences, for example, the nucleotide sequence encoding BRCA-1 regulatory factor 1 or BR1 (SEQ ID NO: 1) is different from the sequence encoding elongation factor G (EFG) at codon about position 285 or It differs at about nucleotide 694 within the coding region. Therefore, for each of these codon positions, there is at least one nucleotide that differs from the EFG sequence at said position and is therefore characteristic of the BR1 nucleotide sequence. The BR1 nucleic acid fragment containing one characteristic nucleotide as described above is a unique fragment.

As used herein, the term “substantially the same” when used in reference to a nucleotide sequence refers to a nucleic acid molecule that retains its ability to selectively hybridize with a reference sequence. Thus, a nucleic acid molecule having substantially the same sequence as compared to a reference nucleic acid, as long as it has the ability to selectively bind the reference sequence,
It may include, for example, one or more additions, deletions or substitutions with respect to said reference sequence. Included within this definition are those that have a degenerate codon sequence at one or more positions, and thus differ in nucleotide sequence when compared to a reference nucleic acid, but which substantially degenerate the encoded reference amino acid sequence. It is a nucleic acid that is substantially maintained.

As used herein, the term “substantially the same” when used in reference to a polypeptide of the present invention refers to one or two of the functional activities exhibited by said polypeptide as a whole. As far as the amino acid sequence shows above, it refers to amino acids containing small changes to the reference amino acid sequence. Examples of the polypeptide having an amino acid sequence substantially the same as the human reference amino acid sequence include, for example, homologous polypeptides derived from vertebrate species, such as non-human primates, mouse, rat, rabbit, cow, pig, sheep, It may be from a dog, cat or amphibian, or from a lower eukaryote such as Drosophila, C. elegans or yeast.

A polypeptide having substantially the same amino acid sequence as a reference sequence may also have one or more intentionally induced changes, eg, additions or deletions of natural or unnatural amino acids to the reference sequence. , Or can include substitutions. Those skilled in the art
Determine appropriate modifications that can help increase, eg, increase stability, bioavailability, bioactivity, or immunogenicity of the polypeptide, or facilitate its purification, without altering the desired functional activity. be able to. For example, introduction of D-amino acids or amino acid analogs or deletion of lysine residues can stabilize the polypeptide and reduce degradation. Similarly, the addition of tag sequences (eg, epitope or histidine tags) or sorting sequences can facilitate the purification of recombinant polypeptides. Modifications may be introduced into the polypeptide or into the encoding nucleic acid depending on the modification and origin of the polypeptide.

Computer programs known in the art, such as DNASTAR software, can be used to determine which amino acid residues can be modified as indicated above without stopping the desired functional activity. Furthermore, guidance for altering amino acid sequences while retaining functional activity is provided by alignment of homologous BRCA-1 regulator polypeptides from various species. Those skilled in the art will appreciate that evolutionarily conserved amino acid residues and domains play a greater role in biological activity than less conserved residues and domains.

Generally, an amino acid sequence that is substantially the same as a reference amino acid sequence is about 25% of the reference sequence.
Will have the same above. However, amino acid sequences that are substantially the same as the reference sequence have about 30% or more identity, about 40% or more identity, about 50% or more identity, about 60%.
It may have the same identity, about 70% or more identity, preferably about 80% or more identity, more preferably about 90% or more identity, particularly preferably about 98% or more identity. The amino acid sequences that are aligned between the two sequences, as well as the gaps and heterologous regions present in the alignment, are for example BLAST2 or Clasta.
It will be determined by one of ordinary skill in the art based on IV or similar computer alignment software. If desired, computer alignment
It may be visually optimized by a person skilled in the art. The percent identity of two sequences is determined as the percentage of total amino acids that are identical among those aligned in such an alignment. Two amino acid molecules with a certain percentage of identity over the complete sequence, or a substantial portion thereof, show more similar functional activity than two molecules with the same percentage of identity in the shorter part of the sequence. It will be appreciated by those skilled in the art that this is more likely. Sequence identity is preferably determined by the National Center for Biotechnology Information (National Cancer Biolog).
using the default settings provided on the ical Institute (NCBI) website
Determined by BLAST search.

As used herein, the term “functional fragment”, when used in reference to a polypeptide of the invention, has at least one of the activities of the full-length polypeptide.
Refers to a portion, segment or fragment of a polypeptide that retains one. For example, a functional fragment of any BRCA-1 regulator of the invention would be the portion of the polypeptide that retains its ability to regulate BRCA-1 expression or activity. ID4
In a particular example of, the functional fragment of ID4 retains its ability to bind one or more helix-loop-helix transcription factors.
Regulate differentiation in part 4 or in adipocytes or neuronal cells I
It can be part D4.

As used herein, the term “ribozyme sequence tag” or “RST” refers to the target recognition domain of a ribozyme. Accordingly, the structure of the RST hairpin ribozyme may be a _{5 '-N 8 -AGAA-N 4} -3', wherein N ₈ and N ₄ is complementary to the sequence of the target RNA. Base AGAA forms a non-binding loop with the NGUC sequence of the target sequence. Thus, as used herein, a "target sequence tag" nucleic acid or "
TST "is a nucleic acid having a nucleotide sequence that selectively hybridizes with RST of ribozyme and can be cleaved by the ribozyme. For example, the TST region capable of selectively hybridizing with RST includes helix 1 and helix 1. 2R
It will be the substantial complement of the ST region sequence. These selectively hybridizing region, for example, are separated by a GUC that can be cleaved by a hairpin ribozyme, thus 5 structure (formula with a _{'-N 5 -GUC-N 8 -3} ', N The first four nucleotides of ₅ represent the TST complementary sequence of ribozyme helix 2 and N ₈ represents the TST complementary sequence of ribozyme helix 1.)

As used herein, the term “ribozyme” or “ribozyme RNA molecule” refers to catalytic RNA that cleaves RNA. Ribozymes include both hairpin and hammerhead types, which differ in the mechanism for hybridization. The term “hairpin ribozyme” has the general nucleic acid sequence described above and the two-dimensional molecular structure shown in FIG. Refers to RNA molecules that have both the ability to cleave. The term also includes hairpin ribozyme RNA molecules as well as single and double stranded DNA molecules that, when expressed, form hairpin ribozyme RNA molecules.

Hairpin ribozymes generally have about 50 to 54 nucleotides, which are 2
Three helices (helix 3 and helix 4) and three loops (loop 2)
3 and 4) will be formed. Two additional helices, helix 1 and helix 2, are formed between the ribozyme and its RNA target or substrate (Figure 1). Hairpin ribozymes bind to target RNA by forming Watson-Crick base pairs between the substrate and the sequences of helix 1 and helix 2 (see dots in Figure 1: "N" is any nucleotide). ). The length of helix 2 is usually about 4 nucleotides, and the length of helix 1 is variable, about 6 nucleotides.
To 10 nucleotides or more. Hairpin ribozymes have catalytic activity and are therefore capable of cleaving target RNA, for example at the cleavage site shown in FIG. The catalytic activity of the hairpin ribozyme can also be abolished, for example by changing the AAA sequence in loop 2 to the CGU sequence. Those skilled in the art will appreciate what modifications can be made to the overall ribozyme structure while maintaining target binding of the hairpin ribozyme of the invention, or maintaining both target binding and catalytic activity. Let's decide what is possible.

As used herein, “library” or “ribozyme library”
The term refers to a collection or population of various ribozyme RNA molecular species. Within this population, there may be only one or overlapping ribozyme species. Therefore, when used for ribozyme libraries,
The term "randomized" or "random" refers to a population of ribozymes that have diverse nucleotide sequences in their target recognition sequence. The diverse nucleotide sequences can be intentionally introduced by, for example, degenerate oligonucleotides, partially degenerate oligonucleotides or diversified oligonucleotide synthesis, or other methods known to those of skill in the art. Alternatively, the diverse nucleotide sequences may be introduced by a variety of mutagenesis methods including, for example, chemical and enzymatic methods well known in the art. Random ribozyme libraries may also be made, for example, by bringing together a collection of different ribozyme species into a single population. For details on synthesis and construction of random ribozyme libraries, see Examples and WO00 / 0.
5415 (Barber et al).

As used herein, the term “target recognition sequence” when used in reference to a ribozyme refers to the substrate binding site of the ribozyme, which either matches the RST RNA nucleotide sequence or is complementary to the TST nucleic acid nucleotide sequence. Matches the thing. In a specific example of a hairpin ribozyme, the target recognition sequence matches the nucleotide sequence of the helix 1 or helix 2 domain or both (see Figure 1).
The target recognition sequences for helices 1 and 2 are separated by catalytic nucleotides,
In the particular example of the hairpin ribozyme, this corresponds to AGAA.

As used herein, the term “BRCA-1 regulator” refers to a gene product or nucleic acid that regulates BRCA-1 expression or activity, such as structural RNA or functional RNA. BRCA-1 regulators regulate BRCA-1 expression, eg, by directly binding to a nucleic acid component that affects BRCA-1 expression (eg, the 5'regulatory region of BRCA-1) (In this case, the BRCA-1 regulatory factor bound to the nucleic acid component results in increased or decreased expression of BRCA-1). Yet another embodiment in which a BRCA-1 regulator can regulate BRCA-1 expression is a separate molecule that regulates BRCA-1 expression (
(Eg, a transcription factor) by binding in a manner that results in increased or decreased BRCA-1 expression. BRCA-1 expression can also be regulated by BRCA-1 regulators that increase or decrease translation of the mRNA encoding BRCA-1. Furthermore,
BRCA-1 regulators can bind BRCA-1 and thereby regulate BRCA-1 activity. For example, a BRCA-1 regulator can bind to BRCA-1, thereby increasing or decreasing the transcriptional activation activity of BRCA-1. Similarly, the BRCA-1 regulator is BR
Binds to a distinct molecule that regulates the expression of CA-1 (eg, a transcription factor such as TFIIH),
Thereby, BRCA-1 activity can be regulated by increasing or decreasing BRCA-1 activity. BRCA-1 regulators are not necessarily essential for the regulation of BRCA-1 expression or activity. All that is required is that the BRCA-1 regulator is functionally involved in the regulation of BRCA-1 expression or activity. BRCA-1 regulators are encoded by genes that include, for example, genes from the infected cell type as well as heterologous genes that have been incorporated into the genome of the cell. Furthermore, according to the present invention,
Regulators of BRCA-1 can be involved in the regulation of BRCA-2 or other factors required for DNA repair reactions.

As used herein, the term “modulate” when used in reference to BRCA-1 expression or activity refers to the ability of the BRCA-1 regulator to alter BRCA-1 expression or activity. . Changes in expression or activity include, for example, increased or decreased expression or activity of BRCA-1. As used herein, the term "BRCA-1" means a member of the BRCA-1 tumor suppressor family. Human is a typical member of the tumor suppressor family
BRCA-1 and BRCA-1 analogues of each species

As used herein, the term “selectable marker” refers to an activity that affects or is associated with or is associated with the vital activity of cells or proliferation of cells, such as vital activity,
Refers to natural or modified gene products that can be used as measurable indicators of proliferation, gene expression, etc. Specific examples include enhanced green fluorescent protein (EGFP
), The hygromycin resistance gene and the tumor suppressor BRCA-1. For example, in the presence of hygromycin, expression of the hygromycin resistance gene allows cell survival. In contrast, BRCA-1 expression suppresses anchorage-independent cell growth, thus reducing its ability to grow in, for example, soft agar. EGFP is another selectable marker that can be used as a measurable indicator of gene expression. The use of EGFP allows specific user-defined expression levels to be selected for fluorescence activated cell sorting (FACS) and other cell analysis methods. Iterative FACS-based sorting can enrich for cells expressing EGFP at user-defined expression levels.

As used herein, the term “treat” when used in reference to cancer refers to a reduction in severity or prevention of neoplastic disease. Thus, as used herein, the phrase "treating a cancerous disease" means reducing the severity, regression or prevention of the cancerous disease. Reduction in severity includes, for example, progression or reduction in clinical symptoms, physiological indicators or biochemical markers.
Prevention of cancer includes, for example, elimination of cancer development (eg, prophylactic use in individuals known or suspected to develop cancer), or cancer in each individual in a non-pathological healthy state. It includes returning to. As used herein, the terms "cancer,""tumor," and "neoplasia" refer to abnormal growth within a tissue or organ. Typically, such growth is characterized by unregulated cell growth and can be malignant or benign.

As used herein, the term “neoplastic cell” refers to a cell that has altered expression or activity of a BRCA-1 regulatory factor as compared to normal cells from the same or another individual. . In general, neoplastic cells will also exhibit histological or proliferative properties of malignant or premalignant cells. For example, using histological methods, infiltration of surrounding normal tissue, increased mitotic index, increased nuclear to cytoplasmic ratio, altered extracellular matrix deposition, or less differentiated cell phenotype. Can be shown. Neoplastic cells can also exhibit uncontrolled growth, eg, anchorage-independent cell growth, growth in low serum cultures, reduced contact inhibition, or rapid growth relative to normal cells.

As used herein, the term “altered expression” of a BRCA-1 regulator nucleic acid detected by the method of the invention refers to BRCA in a test sample as compared to a known level in a normal sample. -1 Regulatory factor An increase or decrease in the amount of nucleic acid. For example, changes in the abundance of nucleic acid molecules may result from changes in transcription rate, changes in transcriptional capacity, or changes in the copy number of the corresponding gene. As used herein, the term “structural change” of a nucleic acid molecule refers to the difference between the structure of a BRCA-1 regulator nucleic acid molecule in a test sample and the structure of a BRCA-1 regulator nucleic acid molecule in a normal sample. , Point mutations, deletions, translocations, splice mutations and other rearrangements. It will be appreciated by those skilled in the art that the expression can also be altered by mutations that alter the structure of the nucleic acid molecule.

As used herein, the term “altered expression” of a BRCA-1 regulatory factor polypeptide refers to an increase or decrease in the amount in a test sample as compared to a known level, or as compared to a normal sample. Refers to changes in intracellular distribution. Changes in polypeptide abundance may be brought about, for example, by changes in transcription rate or the copy number of the corresponding message, or by changes in protein stability. Altered subcellular distribution may result, for example, from truncation or inactivation of sorting sequences, fusion with another polypeptide sequence, or altered interaction with other cellular polypeptides.

The term “structural change” of a polypeptide, as used herein, refers to a difference in the amino acid sequence, post-translational modification, or structure of the polypeptide in a test sample as compared to a normal sample, Refers to something that causes a change in the expression or activity of a BRCA-1 regulator polypeptide. Post-translational modifications include, for example, phosphorylation, glycation and acylation. Such differences can be detected, for example, using a binding agent capable of structure-specific detection.

As used herein, the term “sample” refers to any biological fluid, tissue, organ or portion thereof that contains the nucleic acids and polypeptides of the invention, or
Or refers to what may be included. The term includes samples obtained or derived from an individual, as well as samples present in the individual. For example, the sample may be a histological section of a specimen obtained by biopsy, or cells in tissue culture or tissue culture-adapted cells. Further, the sample may be an intracellular fraction or extract, or an impure or substantially pure nucleic acid or protein preparation. The sample can be prepared by methods known in the art suitable for the mode specific to the detection method.

As used herein, the term “detection agent” refers to a molecule that allows a BRCA-1 regulator nucleic acid or polypeptide to be detected by analytical methods. Appropriate detection agents will depend on the particular mode of detection and can be determined by one of skill in the art as to the particular application. For example, a detecting agent specific for a BRCA-1 regulator nucleic acid molecule would be a complementary nucleic acid, such as a hybridization probe or a non-catalytic ribozyme that selectively hybridizes to said nucleic acid molecule. The hybridization probe or ribozyme can be labeled with a detectable moiety, such as a radioisotope, a fluorophore, a chemiluminescent marker, biotin, or other detectable moiety known in the art that can be detected by analytical methods.

Detecting agents specific for BRCA-1 regulator nucleic acid molecules also include, for example, PCR or RT-
These can be used with PCR primers to selectively amplify all or desired molecules, which can then be detected by methods known in the art. Furthermore, detecting agents specific for BRCA-1 regulator nucleic acid molecules are identified with selective binding agents, such as peptides, nucleic acid analogs, or small organic molecules, eg, by affinity screening of compound libraries. . A detection agent specific for a BRCA-1 regulator polypeptide would be, for example, an agent that selectively binds to said polypeptide. For example, such agents are those that selectively bind with high affinity or avidity to a polypeptide that is not a BRCA-1 regulator polypeptide without substantially cross-reacting with other polypeptides. is there. The binding affinity of a detecting agent that selectively binds to a polypeptide is generally greater than about 10 ⁻⁵ M, and more preferably greater than about 10 ⁻⁶ M for that polypeptide. Interactions with strong affinity are preferred, and will generally be higher than about 10 ^-8 M to 10 ^-9 M.

A BRCA-1 regulatory factor polypeptide-specific detection agent is, for example, a polyclonal or monoclonal antibody specific for said polypeptide, or by screening a compound library for binding to said regulatory factor polypeptide. There may be other selective binding agents identified. For certain applications, detection agents may be used that exclusively recognize a particular structure or post-translational modification state of the polypeptide. The detection agent may be labeled with a detectable moiety if desired, or may be facilitated by specific binding with a detectable secondary binding agent.

The present invention provides a substantially pure nucleic acid comprising a nucleotide sequence that is about 57% or more identical to SEQ ID NO: 1, or unique fragments thereof. Further provided is a substantially pure polypeptide comprising an amino acid sequence that is about 41% or greater identical to SEQ ID NO: 2, or a functional fragment thereof. The nucleic acid shown in SEQ ID NO: 1 was found to encode a BRCA-1 regulator. BR
The CA-1 regulator has a function of reducing the expression of BRCA-1. Thus, BRCA-1 regulators are useful as targets for the treatment of cancer or amelioration of its severity by regulating the growth of cancer through the regulation of BRCA-1 expression. Suppression of BRCA-1 regulator expression or activity will simultaneously increase BRCA-1 expression and thus reduce tumor cell growth.

SEQ ID NO: 1 is consistent with the expression message of the human gene encoding the BRCA-1 regulatory factor designated BRCA-1 regulatory factor 1 (BR1). SEQ ID NO: 1 has a length of about 296
At 7 nucleotides, it has 5'and 3'non-coding regions of 395 and 988 nucleotides, respectively (Figure 9). As a result, the coding region is 1584 nucleotides in length and encodes a polypeptide of 521 amino acids. SEQ ID NO: 1 is human E
It has a nucleotide sequence that is about 57% identical to the FG sequence.

A variant of SEQ ID NO: 1, which does not substantially affect the activity of the encoded BRCA-1 regulator, yet retains about 57% or more nucleotide sequence identity, is a nucleic acid of the invention. Included as. These nucleic acids with minor modifications can likewise be used in the development of therapeutic agents that suppress BR1 expression or activity. Such modifications include, for example, changes in the nucleotide sequence that do not change the encoded amino acid sequence, as well as conservative amino acid substitutions or slight changes that do not substantially affect the BRCA-1 regulatory activity of BR1. What changes can be made within about 57% identity to SEQ ID NO: 1 without substantially affecting the activity of BR1 as a regulator of BRCA-1 expression or activity? , Will be apparent or determinable to those of skill in the art.

Unique fragments of SEQ ID NO: 1 are also provided. The fragments are useful in a variety of procedures, eg as probes to measure the efficacy of therapeutic agents targeting BR1 expression as a regulator of BRCA-1 expression or activity. Unique fragments can also be used in the screening methods of the invention to encode functional fragments of BR1 as therapeutic targets for anti-cancer compounds. The unique fragment of SEQ ID NO: 1 can be applied to a variety of other methods and procedures known to those of skill in the art.

The unique fragment of SEQ ID NO: 1 is of sufficient length to distinguish said fragment as a BR1-encoding nucleic acid and further comprises at least one nucleotide characteristic of SEQ ID NO: 1: Matches 1 fragment or portion. Such characteristic single nucleotide or nucleotides within the unique fragment of SEQ ID NO: 1 distinguishes the fragment from other related nucleotide sequences. For example, a fragment of the non-coding region of SEQ ID NO: 1 is generally unique because there is little evolutionary pressure to conserve the non-coding domain when compared to a nucleotide sequence such as EFG. A short nucleic acid sequence of about 12-15 nucleotides is a statistically unique sequence within the human genome. However, nucleic acids as small as about 8-12 nucleotides can be unique. Thus, the non-coding region of SEQ ID NO: 1 of about 8-9, preferably about 10-11, more preferably about 12 or 15 nucleotides in length corresponds to a unique fragment of SEQ ID NO: 1 of the invention. It can be a nucleotide sequence.

Furthermore, the unique nucleotide sequence occurs in the coding region of SEQ ID NO: 1 as well. The non-coding region fragment or coding region fragment of which nucleotide position is SEQ ID NO: 1 according to the disclosure herein or by alignment of SEQ ID NO: 2 with other sequences that can be distinguished using methods well known to those skilled in the art. One of ordinary skill in the art would understand or be able to determine which one is unique. By nucleic acid sequence alignment of SEQ ID NO: 1 with the nucleic acid sequence of EFG, BR1
There is a difference of about 285 codons between the EFG sequence and the EFG sequence, suggesting the presence of at least about 694 or more unique nucleotides in SEQ ID NO: 1 as compared to the coding nucleotide sequence of EFG. (Figure 2). The inclusion of any or all of these discriminating nucleotide differences within the fragment of SEQ ID NO: 1 confers uniqueness to the fragment.

A substantially pure nucleic acid molecule comprising a nucleotide sequence that is about 57% or more identical to SEQ ID NO: 1, or a unique fragment thereof, is at least under moderately stringent hybridization conditions and is designated SEQ ID NO: 1. It will have sufficient length and identity with SEQ ID NO: 1 to selectively hybridize. For example,
Hybridization conditions equivalent to those in parentheses below (50% formamide, 5x
Hybridize with Denhardt's solution, 5xSSPE, 0.2% SDS (42 ° C), then 0
.2 x SSPE, washed in 0.2% SDS (65 ° C)) to hybridize with a molecule having the sequence of SEQ ID NO: 1 in a filter hybridization assay, but not with other unrelated nucleic acids A substantially pure nucleic acid molecule can be determined to contain about 57% or more of the nucleotide sequence of SEQ ID NO: 1 or unique fragments thereof. Suitable alternative buffers and hybridization conditions that provide moderately stringent hybridization conditions in a particular assay format are known to those of skill in the art or can be determined (eg, the following references: See: Sambrook et al., Molecular
Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, 1989
).

The nucleic acid set forth as SEQ ID NO: 1 encodes a polypeptide having the amino acid sequence set forth in SEQ ID NO: 2. For the nucleotide sequences above, see BRCA-1
Modifications of SEQ ID NO: 2 that do not substantially affect the activity of the regulator and that still maintain 41% or more amino acid sequence identity are included as polypeptides of the invention. These polypeptides with minor modifications can likewise be used in the development of therapeutic compounds that suppress the BRCA-1 modulating activity of BR1. Such modifications include, for example, conservative substitutions that do not substantially affect the activity of BR1, as well as changes in the amino acid sequence that do not substantially change the structure or function of the domains within the polypeptide. Changes within the amino acid sequence that result in subtle changes are included. Those skilled in the art are familiar with what changes can be made within the identity of about 41% or more compared to SEQ ID NO: 2 without substantially affecting the BRCA-1 regulatory activity of BR1. And you can decide again.

A functional fragment of SEQ ID NO: 2 is also provided. The BRCA-1 regulator BR1 can regulate BRCA-1 by suppressing translation of BRCA-1 mRNA.
Thus, examples of functional fragments of BR1 include translation of mRNA into a polypeptide,
For example, it is within the scope of the present invention that it is a domain that suppresses translation of BRCA-1 mRNA into a polypeptide.

The present invention also provides a substantially pure TST nucleic acid comprising a fragment having the nucleotide sequence of SEQ ID NO: 1. TST is substantially the following nucleotide _{sequence: 5 '-N 5 -GUC-N} 8 -3' or _{5 '-N 5 -GUA-N 8} -3' ( SEQ ID NO: 3 and 4). TST nucleic acid portion of the fragment is about 8-12 N ₅ and N ₈
It has nucleotides, preferably about 9-10 nucleotides, and these are SEQ ID NO:
Matches the fragment of 1. Thus, depending on the length of the TST nucleic acid portion, the fragment of SEQ ID NO: 1 above will be about 11-15 nucleotides or more in length.

The hairpin ribozyme has a sequence of 5'-N ₅ -GUC-N ₈ -3 'or 5'-N ₅ -GUA-N ₈ -3' (
The RNA substrate of any of SEQ ID NOs: 3 and 4) is cleaved 5'to the G nucleotides, respectively. Thus, the fragment of SEQ ID NO: 1, which has the corresponding RNA form recognized by the target recognition site of the hairpin ribozyme, is 5'-N ₅ -GUC-N ₈ -3 'or 5'-N ₅ -GUA-N ₈ A nucleic acid having a -3 'sequence. N ₅ and N ₈ are SEQ ID NOs:
The sequence is substantially the same as the corresponding sequence of 1. Such a fragment corresponds to the ribozyme target recognition site or the complementary sequence of RST and is referred to herein as a TST nucleic acid.

The TST nucleic acid can be of any desired length and has a TST of 5'-N ₅ -GUC-N ₈ -3 'or 5'.
-N ₅ -GUA-N ₈ -3 '(SEQ ID NOS: 3 and 4, respectively),
Additional sequences and other components other than the sequence corresponding to SEQ ID NO: 1 may be included, so long as N ₅ and N ₈ substantially match the nucleotide sequence of SEQ ID NO: 1.
Furthermore, all nucleotide residues of N ₅ and N ₈ in the region, SEQ ID NO: corresponding sequences need not be the same in one. Instead, all that is required is that such TST nucleic acids selectively hybridize to the complementary RST. Thus, N ₅ and N ₈ sites all 13 nucleotides fewer nucleotides SEQ ID NO: may be the same as the first nucleotide sequence or fragments. Generally, about 8-12 or about 9-10 nucleotides are sufficient for the selective hybridization of RST with TST nucleic acids. Specific examples of RST present in ribozymes that selectively hybridize with SEQ ID NO: 1 are further described in the Examples below.

Similarly, TST nucleic acids can be used to design ribozymes that selectively hybridize to and cleave RNAs that match SEQ ID NO: 1. Specific examples of such ribozymes, SEQ ID NO: have complementary target recognition sequence and 1 in TST nucleic acid hairpin ribozymes having a nucleotide sequence of _{5 '-N 8 -AGAA-N 4} -3' is there. Regarding the TST nucleic acid described above, as long as the target recognition sequence selectively hybridizes with the RNA form of the TST nucleic acid and cleaves this as a substrate, all sequences at the N ₈ and N ₄ sites are represented by SEQ ID NO: 1. It need not be the same as the complement. Those of skill in the art, given the disclosure and description provided herein, are familiar with what RST sequences are sufficient to selectively hybridize to and cleave a target RNA substrate. I will be able to decide again.

A typical ribozyme selective for SEQ ID NO: 1 was constructed as described in the Examples. These ribozymes have the following RST sequences: 5'-UUGAUGUGAGAAGCUU-
3 ', 5'-ACUUUUCUAGAAGGAA-3', 5'-UAUUCCAUAGAAACUG-3 ', 5'-AGGACUGGAGAAAG
CC-3 ', 5'-AACAACAUUAGAAUCAA-3' (SEQ ID NO: 17-21). Therefore, the present invention provides a ribozyme having a target recognition sequence capable of selectively hybridizing with the RNA corresponding to SEQ ID NO: 1 and cleaving the RNA. Target recognition sequence of the ribozyme, SEQ ID NO: 1 fragment complementary to, substantially 5 nucleotide sequence of the _{'-N 8 -AGAA-N 4 -3} ' ( SEQ ID NO: 99) consisting of RST with. Furthermore, SEQ ID NO: in N ₈ and N ₄ site is complementary to the first fragment, the target recognition sequence, about 8-12 nucleotides, will preferably be about 9-10 nucleotides.

The present invention further provides RST having one of the following nucleotide sequences: 5'-CCGGAUGCAGAACAAU-3 ', 5'-AGUACAUUAGAAUACU-3', 5'-CUAGUGAGAGAAGGGA-3.
', 5'-UGAGAUCCAGAAAAGC-3', 5'-UGUUACUAGAAUGUU-3 ', and 5'-CCCUAUUUAG
AAUUGU-3 '(SEQ ID NOS: 5-10, respectively), or its complementary sequences further described below. The complementary sequence at positions 9-12 (5'-AGAA-3 ') can be replaced with the non-complementary ribozyme cleavage sequence 5'-NGUC-3'.

Ribozyme libraries containing various RST sequences were expressed in cells and cells expressing high levels of BRCA-1 marker were selected. SEQ ID NOs: 5-10 represent the RST sequence of the ribozyme binding site, which is BRCA-1 when the ribozyme is expressed.
This leads to an increase in the expression level of the marker. BRCA-1 marker expression was determined by increased expression of EGFP, increased hygromycin resistance, or decreased ability to grow in soft agar. These assays for BRCA-1 marker expression are based on BRCA-1 itself BR
Being able to regulate CA-1 promoter activity is influenced by both BRCA-1 promoter activity and BRCA-1 activity. Therefore, ribozymes containing RST sequences selective for BRCA-1 regulators (eg, RST of SEQ ID NOs: 5-10) are
BRCA-1 marker expression can be increased by selectively cleaving RNA that regulates CA-1 promoter activity, BRCA-1 expression, BRCA-1 activity, or any combination thereof.

Each of the RST sequences, SEQ ID NOs: 5-10, corresponds to a nucleic acid encoding a BRCA-1 regulatory element. As described above with respect to the TST nucleic acid fragment of the BRCA-1 regulatory element set forth as SEQ ID NO: 1, the 5 ′ terminal N ₈ site and the 3 ′ terminal N ₅ site are the BRCA-1 regulatory element.
Separated by the intervening 3 nucleotide sequence 5'-GUC-3 'in RNA,
Matches the complement of the RST sequence or the TST sequence. Furthermore, as mentioned above, TST
At least about 8-12 nucleotides of N ₈ and N ₅ sites of the ribozyme and its
Sufficient for selective binding between the BRCA-1 regulator's target RNA. Accordingly, the BRCA-1 regulatory nucleic acid molecule of the present invention comprises at least 8-12 nucleotides corresponding to the RST sequence set forth as SEQ ID NOs: 5-10, or its TST sequence complement corresponding to SEQ ID NOs: 11-16. Including the intervening 3 nucleotides 5'-GUC-3 '.

Accordingly, the present invention also provides a TST nucleic acid having one of the following nucleotide sequences: 5'-AUUGNGUCGCAUCCGG-3 ', 5'-AGUANGUCAAUGUACU-3', 5'-UCCCNGUCCUCACUAG-.
3 ', 5'-GCUUNGUCGGAUCUCA-3', 5'-AACANGUCAGUAACA-3 ', 5'-ACAANGUCAAAUAGG
G-3 ′ (respectively SEQ ID NO: 11-16), or its complementary sequence.

For the sake of brevity, the BRCA-1 regulatory element nucleic acid of the invention has at least 8 with respect to its TST nucleic acid sequence, in particular the TST nucleic acid sequences of SEQ ID NOs: 11-16.
Described with respect to a BRCA-1 nucleic acid containing -12 regulatory nucleotides. However, it goes without saying that the complementary sequence of the RST nucleic acid molecule is also included, especially when referring to the TST nucleotide sequence of the BRCA-1 regulatory element. Therefore, SEQ ID NOs: 11-16
When referring to the BRCA-1 regulator comprising at least about 8-12 nucleotides matching the TST sequence also SEQ ID NO: 11-16 (SEQ ID NO: 11-16 5 'end N ₈ site and 3' ends intervening 3 nucleotides between the N ₅ sites, 5 '-GUC-3'
At least about 11-corresponding to the TST sequences described above for the BRCA-1 regulatory element and its TST fragment set forth as SEQ ID NO: 1.
It will be appreciated that a BRCA-1 regulator nucleic acid containing 15 nucleotides is also included. Accordingly, the present invention also provides substantially pure TST nucleic acid having a structure of _{5 '-N 5 -GUC-N 8} -3' or _{5 '-N 5 -GUA-N 8} -3', and SEQ ID NO: Provides a substantially pure nucleotide sequence shown as 11-16.

At least about 8-which corresponds to the TST nucleic acid sequence set forth as SEQ ID NOs: 11-16
12 nucleotides, or about 11-15 nucleotides corresponding to the TST nucleic acid sequence set forth as SEQ ID NOs: 11-16, with intervening 3 nucleotides 5'-GU
BRCA-1 regulatory nucleic acid molecules containing C-3 'or functional fragments thereof do not have the correct nucleotide sequence endpoints deposited and available in public databases. Such databases include, for example, the non-redundant GenBank database and NCB.
I dbest Contains the EST database.

A BRCA-1 regulatory element nucleic acid molecule of the present invention comprising at least 8-12 nucleotides corresponding to the TST sequence set forth as SEQ ID NOs: 11-16 may be used as a therapeutic target, eg for the treatment of cancer, with or without cancer. It can be advantageously used as a diagnostic target to determine propensity, or for the identification and isolation of additional sequences that correspond to other regions of the BRCA-1 regulator nucleic acid molecules of the invention. When used for the latter purpose, the nucleic acid molecule should contain no nucleotides or one or many nucleotides at the 5'- or 3'-ends or both ends of the TST sequences listed in SEQ ID NO: 11-16. You can These additional nucleotides may correspond to the native sequence of the BRCA-1 regulatory nucleic acid molecule, and may be non-native sequences or both. When the nucleic acid molecule is used as a probe or primer for the identification or isolation of a longer BRCA-1 regulatory nucleic acid molecule, it may be, for example, a non-natural flanking sequence corresponding to a restriction endonuclease site or tag, or Non-natural flanking sequences which stabilize nucleic acids containing at least about 8-12 nucleotides corresponding to the TST nucleic acid sequence set forth in SEQ ID NO: 11-16 in a hybridization assay can be advantageously used.

At least about 8-12 corresponding to the TST sequence shown as SEQ ID NO: 11-16
The naturally-occurring BRCA-1 regulatory element nucleotide sequence in contact with nucleotides can be prepared by methods known in the art, such as RT-PCR, 5 ′ or 3 ′ RACE, screening of cDNA or genomic library, or the like of SEQ ID NO: 11-16. Oligonucleotides having at least about 8-12 nucleotides that match the TST sequence can be used as primers or probes to probe and determine the sequence of the resulting product. Template RNA or D for amplification, extension or hybridization screening
One of ordinary skill in the art would be able to determine the appropriate source of NA.

A specific example of a substantially pure BRCA-1 regulatory nucleic acid molecule comprising a TST and flanking coding sequence of at least about 8-12 nucleotides corresponding to SEQ ID NO: 13 is set forth as SEQ ID NO: 1. BRCA-1 regulatory factor nucleic acid molecule having a different nucleotide sequence. Sequence number: 1 based on the information of the corresponding RST sequence of sequence number: 7
Is further described in the examples below. Accordingly, such products can be used to identify and further substantially purify longer nucleic acid molecules comprising at least about 8-12 nucleotides corresponding to the TST of SEQ ID NOs: 11-16. Such molecules and functional fragments thereof are used to generate BRCA-1 regulatory factor polypeptides and specific antibodies, eg, using methods known in the art or described herein, and disclosed herein. It can be used in the diagnostic and therapeutic methods as well as the diagnostic and therapeutic methods known in the art.

In this regard, SEQ ID NOs: 5, 6, 8 and 9 were similarly used to identify the flanking nucleic acid sequences of the corresponding encoded BRCA-1 regulators. Especially SEQ ID NO: 5
Breast basic conserved protein 1 (breast basic conserved protein 1)
BRCA-1 found to match (BBC1, GenBank accession number X64707)
The regulator was identified. BBC1, previously identified from a human breast cancer cDNA library, is downregulated in hormone refractory prostate cancer. BBC1 contains a 25 amino acid region having a strong similarity to the plant basic protein P14. SEQ ID NO: 5 is further used to further analyze the human CHL1-related protein, CHLR2 (
A protein whose partial sequence corresponds to that reported in GenBank under accession number U33834) was identified. A portion of CHLR2 was reported to act as a helicase. CHLR2 is nuclearly distributed and is apparently expressed at high levels in proliferating human cell lines.

Using SEQ ID NO: 8, the inhibitor dominant negative 4 (ID4, GenBank
An additional BRCA-1 regulator was identified that was found to be consistent with the polypeptide designated accession number NM_001546). ID4 is a basic helix-loop-
A transcriptional repressor of the helix transcription factor that inhibits transcriptional activity by forming a dimer with the transcription factor, thereby blocking the DNA binding ability of the transcription factor. I
It is within the present invention that D4 can bind transcription factors that increase BRCA-1 expression, including BRCA-1. SEQ ID NO: 8 was further used to identify the ALL-1 fusion partner AF6 (GenBank Accession No. AB011399), a protein consistent with the translation breakpoint sequence found in acute myelogenous leukemia. AF6 is also considered to be a Ras-binding protein and a regulator of intercellular bond formation.

SEQ ID NOs: 6 and 9 are used herein to represent BR2 and BR3 (GenBank respectively).
Matches a polypeptide designated by accession numbers AL045940 and AI273697)
A BRCA-1 regulator was identified. BR2 and BR3 were only reported as EST sequences, and their properties have not been determined. Further using SEQ ID NO: 6, EST with GenBank accession number AI668913
(Designated BR4) was identified.

As mentioned above, a BRCA-1 regulator nucleic acid molecule, when functionally inactivated in a cell, results in increased BRCA-1 expression or activity, or both. Such an increase simultaneously reduces the proliferative or unlimited proliferative capacity of the cells. Similar results can be observed by inactivating the BRCA-1 regulator polypeptide (eg, by suppressing its activity). Of a nucleic acid molecule comprising at least about 8-12 nucleotides corresponding to the TST of SEQ ID NOs: 11-16 and a natural additional nucleic acid sequence
BRCA-1 regulator activity can be further elucidated using various methods known in the art and those described herein. For example, nucleic acid sequences flanking the sequences of SEQ ID NOs: 11-16 can be targeted to ribozymes intracellularly by the methods described herein. The effect on cell proliferation of reduced BRCA-1 expression and / or activity can be determined by the assays described below. If inactivation of a second sequence within the isolated nucleic acid molecule by ribozyme cleavage results in increased expression or activity of BRCA-1, the nucleic acid molecule can be identified as a BRCA-1 regulatory nucleic acid molecule. For example, ribozymes targeting a second sequence within the nucleic acid molecule of BBC1, ID4 and BR1 increase expression of BRCA-1 or a reporter gene and / or reduce cell growth in soft agar, reducing these It was confirmed that the gene encodes a BRCA-1 regulator. Thus, knowledge of the nucleic acid sequences of BRCA-1 regulators provides information that can be used to target additional ribozymes to BRCA-1 regulators, as demonstrated in the Examples. For example, one part of the above-mentioned BRCA-1 regulatory elements having the sequence 5'-N ₅ -GUC-N ₈ -3 'or 5'-N ₅ -GUA-N ₈ -3' is TST. Conceivable. Such TST
Using as a template, in (SEQ able to design novel ribozyme having RST sequence of _{5 '-N 8 -AGAA-N 4} -3', N 8 and N ₄ are, 5 '-N ₅ - GUC-N ₈ -3 'or 5'-N ₅ -GUA-N ₈ -3' having a nucleotide sequence that is substantially complementary to the corresponding residue in the TST sequence). The RST array has the corresponding 5'-N ₅ -GUC-N ₈ -3 'or 5'-N ₅ -GUA-
N ₈ -3 'TST sequence complementary to 8-12 nucleotides, and preferably have from 9-10 nucleotides in N ₈ and N ₄ sites.

As described in the Examples below, further new ribozymes were constructed directed to the diverse TST sequences present in each of the BRCA-1 regulators described above. The following ribozymes were specifically constructed: The BBC1-selective ribozyme has the following RST sequence: 5'-GGCUUCAAAGAAAUGC-3 ', 5'-UGGGACCCAGAACGGG-3', 5'-CCGGAUGGAGAACGAC-3.
', 5'-ACGUUCCGAGAAGGCA-3', 5'-CCCAGCAUAGAAGCCC-3 '(SEQ ID NO: 22-2
6); The CHLR2-selective ribozyme has the following RST sequence: 5'-CCGAGAGAAGAAAGCC-3 ', 5'-UGGUUGGAAGAACCGA-3', 5'-GAGGAUGCAGAACCAC-3.
', 5'-AAGAAACAAGAAACCC-3', 5'-UUGGCCAGAGAAGGGG-3 '(SEQ ID NO: 27-3
1); The ribozyme selective for ID4 has the following RST sequence: 5'-CAGUGGGCAGAACUCA-3 ', 5'-CCAACAAUUAGAAGGAG-3', 5'-CACACCUGAGAAGCGC-.
3 ', 5'-CGCGGCUGAGAAGGUC-3' (SEQ ID NOs: 32-35);

Ribozymes selective for AF6 have the following RST sequences: 5'-GUACUAGAAGAACGAA-3 ', 5'-UGUGAUCCAGAAAAGG-3', 5'-GGUGGCCAAGAAGUGG-3.
'(SEQ ID NOs: 36-38); BR2 selective ribozymes have the following RST sequences: 5'-AAAAAUUAAGAAGUCA-3', 5'-GCUGUCCUAGAAUCAA-3 ', 5'-UGUCAAAGAGAACACC-3.
', 5'-UGCAAUGAAGAAACUG-3', 5'-UUACAAUAAGAAACUU-3 '(SEQ ID NO: 39-4
3); and BR3 selective ribozymes have the following RST sequences: 5'-CUAUUUAAAGAAAAUU-3 ', 5'-UAUUUCUUAGAAGUUC-3', 5'-AUUUCACUAGAAUCAC-3.
'(SEQ ID NO: 44-46).

Similarly, other types of methods can be used to confirm the activity of BRCA-1 regulatory nucleic acids that include at least about 8-12 nucleotides of TST corresponding to SEQ ID NOs: 11-16. For example, an antibody or other selective agent that binds to the polypeptide encoded by said nucleic acid molecule is introduced into the cell to affect the effect of the antibody on BRCA-1 expression or activity, for example the ability of the cell to grow in soft agar. It can be determined by measuring. Similarly, an antisense nucleic acid that suppresses transcription or translation of a BRCA-1 regulatory factor nucleic acid can be introduced into a cell to determine the effect of said antisense nucleic acid on BRCA-1 expression or activity. Similarly, variants of BRCA-1 regulatory nucleic acid molecules, such as dominant negative mutants, are expressed intracellularly and the encoding polypeptide competes with the endogenous BRCA-1 regulatory molecule or said regulatory molecule. And thus increase BRCA-1 expression or activity. A substantially pure nucleic acid molecule comprising at least about 8-12 nucleotides of any of SEQ ID NOs: 11-16 is
One of ordinary skill in the art would be able to determine other suitable assays that have BRCA-1 regulator activity.

The TST sequences shown as SEQ ID NOs: 11-16 were identified from a random hairpin ribozyme library by assessing their ability to increase BRCA-1 expression of RST (SEQ ID NOs: 5-10). Therefore, the present invention provides a ribozyme containing the RST sequence shown in SEQ ID NOs: 5-10 as a ribozyme target recognition sequence. The hairpin ribozymes of the invention have BRCs that are partially complementary to these RST sequences.
A-1 regulator Selectively binds to mRNA molecules.

The substantially pure hairpin ribozyme of the present invention comprises a BRCA-1 regulator nucleic acid.
It may have catalytic activity to bind and cleave mRNA. Thus, the catalytic hairpin ribozymes of the invention can be used to selectively regulate the activity of the BRCA-1 regulator nucleic acid molecules of the invention. Substantially pure hairpin ribozymes of the invention may also be prepared, for example, by substituting the UGC sequence for the AAA sequence of loop 2 shown in Figure 1 so as to bind but not cleave the BRCA-1 regulator nucleic acid molecule of the invention. Can be disabled catalytically. The non-catalytic hairpin ribozyme can be used, for example, as a control for the inhibitory activity of the non-immobilized ribozyme. Accordingly, the invention also provides a ribozyme comprising a target recognition sequence having any one of the following nucleotide sequences: 5'-CCGGAUGCAGAACAAU-3 ', 5'-AGU.
ACAUUAGAAUACU-3 ', 5'-CUAGUGAGAGAAGGGA-3', 5'-UGAGAUCCAGAAAAGC-3 ', 5'-
UGUUACUAGAAUGUU-3 ', 5'-CCCUAUUUAGAAUUGU-3' (SEQ ID NO: 5-10, respectively)
).

Further provided herein are methods of using ribozyme sequence specificity to identify ribozyme cleavage targets from a nucleic acid sample and isolating ribozyme cleavage product nucleic acids. This method can be used to clone the flanking sequences of any target nucleic acid where ribozyme cleavage sites are present. The nucleic acid molecule is subject to cleavage by a sequence-specific test ribozyme. Sequence-specific recognition and cleavage by ribozymes yields at least one cleavage product nucleic acid, which has a specific sequence at either the 5'or 3'end that matches the sequence recognized by the ribozyme.
Two primers can be constructed when the other end of the cleavage product nucleic acid contains a universal sequence, such as the 3'polyA tail. The first primer is complementary to the sequence recognized by the ribozyme and the second primer is complementary to the universal sequence. The cleavage product nucleic acid can then be amplified using these two primers and further identified using known sequencing methods. In this way, nucleic acid samples can be specifically amplified for the nucleic acid that is cleaved by the ribozyme and subsequently identified.

The target nucleic acid can be RNA or DNA and can be cleaved by any ribozyme, including hairpin ribozymes, hammerhead ribozymes and Tetrahymena group I ribozymes. Prior to sequencing, amplification products can be separated by gel electrophoresis and further compared to nucleic acid samples that have been cleaved by control ribozymes with different sequence specificities other than the ribosomes used in the test nucleic acid samples. . Amplification products specific to the test ribozyme cleaved sample can be recovered and sequenced.

In one embodiment of the invention four primers are used. The first primer hybridizes to the first universal sequence at the 3'end of the cleavage product nucleic acid and strand synthesis occurs. The enzyme used in the above synthesis places a second universal sequence at the 3'end of the newly synthesized strand, which is also adjacent to the specific flanking sequence of the ribozyme cleavage product. One such exemplary enzyme is MMLV reverse transcriptase, which places 3-5 deoxycytidine at the 3'end of the nascent DNA strand. Then, a second primer containing a sequence complementary to the second universal sequence is added to further extend the nascent nucleic acid. Subsequently, the template strand is removed by, for example, ribonuclease digestion (when the template strand is RNA). Subsequently, the remaining nucleic acid was removed using a third primer complementary to the sequence of the first primer and a fourth primer complementary to the sequence of the second primer and further containing a flanking sequence for ribozyme cleavage. Amplify. The amplification products are then identified using sequencing methods known in the art.

Nucleic acid molecules of the present invention, including BRCA-1 regulator nucleic acid molecules and fragments, and hairpin ribozyme nucleic acid molecules can be produced or isolated by methods known in the art. The method selected will depend, for example, on the type of nucleic acid molecule to be isolated. One of ordinary skill in the art will know, according to the nucleotide sequence information disclosed herein, the BRCA-1 regulatory element nucleic acid molecule as genomic DNA or the desired intron, exon or regulatory sequence by methods known in the art;
It could be readily isolated as full-length cDNA or desired fragment thereof; or full-length mRNA or desired fragment thereof. Similarly, one skilled in the art will be able to produce or isolate hairpin ribozymes selective for these sequences.

A useful method of isolating the BRCA-1 regulator nucleic acid molecule of the present invention involves amplification of the nucleic acid molecule using the polymerase chain reaction (PCR) and purification of the resulting product by gel electrophoresis. To do. For example, PCR or reverse transcription PCR (RT-PCR) can be used to produce a BRCA-1 regulator nucleic acid molecule with any desired nucleotide boundaries. The desired modification (s) to the nucleic acid molecule can also be introduced by selecting the appropriate primer (s) containing one or more additions, deletions or substitutions. Such nucleic acid molecules can be exponentially amplified starting from only one gene or mRNA copy from any cell, tissue or species of interest. An example of isolation of a BRCA-1 regulatory factor nucleic acid molecule using PCR is provided in the Examples below.

Yet another method of producing or isolating the BRCA-1 regulator nucleic acid molecule of the present invention is by screening a library, eg, a genomic library, a cDNA library or an expression library, with a detecting agent. It is a thing. Such libraries are commercially available or can be prepared from any desired tissue, cell or species of interest using methods known in the art. For example, a cDNA or genomic library can be screened by hybridizing with a detectably labeled nucleic acid molecule having a nucleotide sequence disclosed herein. Furthermore, expression libraries can be screened with antibodies raised against the polypeptides corresponding to the coding sequences of the BRCA-1 regulatory factor nucleic acids disclosed herein. Library clones containing a BRCA-1 regulatory factor nucleic acid molecule of the invention can be purified from other clones by methods known in the art.

Furthermore, the nucleic acid molecule of the present invention can be produced synthetically. For example, a single strand of a nucleic acid molecule can be chemically synthesized as a stretch or as several fragments by automated synthetic methods known in the art. Similarly, a complementary strand can be synthesized as a series or as two or more fragments, and a double-stranded molecule can be prepared by annealing the complementary strand. Direct synthesis is particularly advantageous when producing hybridization probes and primers in addition to relatively short molecules such as RST or hairpin ribozyme nucleic acid molecules. Alternatively, the nucleic acid molecule of the present invention can be isolated using RNA polymerase
It can be produced by in vitro enzymatic synthesis. For example, template DNA can be mixed with RNA polymerase and ribonucleotide triphosphates. The RNA polymerase synthesizes RNA nucleic acid complementary to the sequence of the DNA template.

If subcloning, amplification or expression of a substantially pure nucleic acid molecule of the invention is desired, the isolated nucleic acid molecule can be inserted into a commercially available cloning or expression vector using methods known in the art. If desired, appropriate regulatory elements may be selected for constitutive, inducible or cellular expression in selected host cells (eg, bacterial, yeast, amphibian, insect or mammalian cells, including human cells). Type-specific expression can be provided. Those skilled in the art will appreciate the cloning of the nucleic acid molecules of the invention,
Alternatively, a host and vector system suitable for expression and purification of the encoded polypeptide could be determined.

Methods for introducing cloning or expression vectors into host cells are well known in the art and include, for example, various transfection methods (eg calcium phosphate, DEAE-dextran and lipofectin methods, viral transduction,
Electroporation and microinjection). For example, using host cells expressing a BRCA-1 regulatory factor nucleic acid molecule as a source, isolation of a BRCA-1 regulatory factor polypeptide expressed by genetic recombination, as described below, BRCA-1 Identification and isolation of molecules that regulate or interact with regulator nucleic acids and polypeptides, or screening for compounds that enhance or suppress the activity of the BRCA-1 regulator molecules of the invention can be performed. Methods of isolating, cloning, and expressing the nucleic acid molecules of the invention disclosed herein are routine in the art and are described in detail in, for example:
Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Har
bor Laboratory, New York (1992); Ansubel et al., Current Protocols in Mo
lecular Biology, John Wiley and Sons, Baltimore, MD (1989).

The BRCA-1 regulator polypeptides and functional fragments of the present invention can be isolated or prepared by methods known in the art including biochemical, recombinant and synthetic methods. For example, a BRCA-1 regulator polypeptide can be purified by routine biochemical methods from cells or tissues that express corresponding abundant amounts of transcripts or polypeptides. Biochemical purification includes steps such as, for example, solubilization of appropriate tissues or cells, isolation of desired non-cellular fractions, size or affinity chromatography, electrophoresis, and immunoaffinity chromatography. One of ordinary skill in the art would be able to select biochemical purification methods and conditions for the polypeptides of the present invention. Purification is monitored, for example, by an ELISA assay or a functional assay.

Fragments containing the desired boundaries and modifications to the BRCA-1 regulatory element mino acid sequence can also be produced by recombinant methods. Recombinant methods include expression of nucleic acid molecules encoding the desired polypeptide or fragment in host cells or cell extracts, and routine biochemical purification methods for recombinant polypeptides or fragments, such as those described above. Isolation by. Nucleic acid sequences encoding epitope tags, polyhistidine tags, glutathione-S-transferase (GST) domains and similar affinity binding sequences, or polypeptides into the cytoplasm to facilitate identification and purification of recombinant polypeptides It may be desirable to insert, in frame, with or add to the coding sequence, a sequence that directs the expression or secretion of E. Methods of producing and expressing recombinant polypeptides in vitro in prokaryotic and eukaryotic host cells are well known in the art.

Functional fragments of BRCA-1 regulatory factor polypeptides can also be produced, for example, by enzymatic or chemical cleavage of full-length polypeptides. Methods for enzymatic and chemical cleavage of the resulting peptide fragments, as well as purification methods are well known in the art (see for example: Deutscher, Methods in Enzymology, Vo.
l.182, "Guide to Protein Purifications", San Diego: Academic Press, Inc.
1990), which is hereby incorporated by reference). Furthermore, functional fragments of BRCA-1 regulator polypeptides can be produced by chemical synthesis. Modifying the molecule to include D-stereoisomers, unnatural amino acids and amino acid analogs and mimetics, for example, if it is desired to optimize its functional activity, stability, or bioavailability. You can Examples of modified amino acids and their use are described in: Sawyer,
Peptide Based Drug Design, ACS, Washington (1995) and Gross and Meienhof
er, The Peptides: Analysis, Synthesis, Biology, Academic Press, Inc., Ne
w York (1983), both documents are incorporated herein by reference.

A functional activity of a BRCA-1 regulator polypeptide or fragment of the invention alters BRCA-1 expression or activity when it is expressed in or introduced into a cell (eg, The ability to increase unrestricted cell growth).
To determine whether a polypeptide or fragment has the ability to alter BRCA-1 expression or activity, the polypeptide or fragment is expressed intracellularly by recombinant methods known in the art, -1 Effects on regulatory factors can be determined in vitro. Alternatively, BRCA-1 regulator expression can be suppressed in vivo (including cell culture or animal models) to determine BRCA-1 expression or activity. Similarly, expression of BRCA-1 regulators can be suppressed in vivo (including cell culture or animal models) and expression of BRCA-1 promoter linked reporter markers can be determined. Increased cell proliferation in soft agar or reduced expression of the BRCA-1 promoter linked reporter marker suggests that the polypeptide or fragment is a BRCA-1 regulator of the invention.

The present invention provides methods for identifying compounds that modulate the activity of BRCA-1 regulators. The method comprises contacting a BRCA-1 regulator with a target molecule and a test compound that responds to the activity of the BRCA-1 regulator. In this method, an increase or decrease in the activity of the BRCA-1 regulator on the target molecule as compared to the absence of the test compound indicates that the compound modulates the activity of the BRCA-1 regulator. As used herein, a “target molecule that responds to the activity of a BRCA-1 regulator” refers to a BRCA-1 regulator that
It means to bind to or chemically modify a target molecule present in a cell. For example, when a BRCA-1 regulator has DNA binding activity, eg, when used in the regulation of transcribed genes, the target molecule responsive to said activity is a nucleotide sequence that is recognized and bound by a particular BRCA-1 regulator. Is a nucleic acid containing. BRCA-1
When the regulator has protein kinase activity, eg, has a serine / threonine kinase domain, the target molecule that responds to said activity is a protein with the appropriate serine or threonine kinase recognition site. Similarly, in the case of protease activity, the responding target molecule is a protein that is cleaved by the BRCA-1 regulator.

When the BRCA-1 regulator activity to be measured for drug screening is DNA binding, such binding is accomplished by assaying for expression of a reporter gene operably linked to the nucleic acid element. I can decide. In this case, an increase in the expression level or activity of the reporter gene in the presence of the test compound as compared with the absence of the test compound indicates that the compound has an activity of suppressing the DNA binding of the BRCA-1 regulatory factor. . The degree of increase in expression activity correlates with the BRCA-1 regulator inhibitory activity of the test compound. Typical reporter genes include BRCA-1, EGFP and hygromycin resistance genes.

As used herein, the term “nucleic acid element”, when used in reference to the regulation of BRCA-1 expression, refers to a nucleic acid region that regulates BRCA-1 expression. Typical nucleic acid elements are the 5'promoter and regulatory regions of BRCA-1, or other transcriptional regulatory regions, and the translational regulatory region of transcribed mRNA. Generally, this nucleic acid element will be the 5'promoter and regulatory region.

Similarly, compounds that increase or enhance the activity of BRCA-1 regulators can also be identified. When added to a sample containing a BRCA-1 regulator and a nucleic acid element regulated by the BRCA-1 regulator, compared to the absence of the test compound,
A test compound that decreases the expression level or expression rate of a BRCA-1 activity or a reporter gene operably linked to BRCA-1 or the nucleic acid element shows that the compound increases the activity of a BRCA-1 regulatory factor. . Therefore, the present invention provides BRCA
-1 provides a method of identifying a compound that modulates the activity of a regulator.

The reaction system for identifying compounds that suppress or increase BRCA-1 regulator activity is BRCA
-1 can be prepared with essentially any sample, material, or component thereof, including regulators. BRCA-1 regulatory factor-containing samples used in such methods are, for example, in
It is an in vitro transcription or translation system. The system described above may be used, for example, for normal or tumor cells.
This is a system using a hybrid construct in which a nucleic acid derived from the BRCA-1 gene or a nucleic acid element regulated by a BRCA-1 regulatory factor is linked to a reporter gene.
Alternatively, BRCA-1 regulators can also function in normal cells, so nucleic acids and proteins obtained from normal cells can also be used. Furthermore, BRCA
The -1 regulatory factor-containing sample may be derived from a cell extract, cell fraction, or in vivo system, such as a cell culture or animal model, containing nucleic acid elements regulated by the BRCA-1 regulatory factor. The expression level or activity of BRCA-1 or reporter gene can be measured in a reaction system to determine the modulatory effect of the test compound on the BRCA-1 regulator. Such measurements can be performed using methods known to those of skill in the art in addition to the methods described herein.

Briefly, a BRCA-1 regulator source is mixed with a nucleic acid element or protein regulated by the BRCA-1 regulator as described above, in the presence of a test compound,
Incubate in the absence. The expression level or activity of BRCA-1 or reporter gene in the presence of the test compound is compared to that in the absence of the test compound. A test compound that results in an increase in the expression level or activity of BRCA-1 or a reporter gene by at least about 50% is considered a BRCA-1 regulator inhibitor or antagonist, and has potential for the treatment of neoplastic diseases such as cancer. It is considered to be a therapeutic compound. Similarly, a compound that decreases the expression level or activity of BRCA-1 or a reporter gene by 2-fold or more is considered to be a compound that increases the activity of BRCA-1 regulatory factor, or an agonist of BRCA-1 regulatory factor. Such agones can be used, for example, as therapeutic agents to promote cell proliferation or cell survival of transplanted cells or explanted cells that are subsequently transplanted. BRCA-1
Compounds that have been shown to regulate regulator activity further confirm that they affect the activity of BRCA-1 regulators that enhance BRCA-1 expression or activity, if desired. For in vitro or in vivo experiments.

Test compounds suitable for the above assays are believed to be capable of inhibiting any substance, molecule, compound, mixture of molecules or compounds, or BRCA-1 modulator activity in vivo or in vitro. It may be any other composition, eg a compound with cytostatic activity. Test compounds are macromolecules, such as biological polymers (
(Including proteins, polysaccharides and nucleic acids). Sources of test compounds that can be screened for BRCA-1 regulator inhibitory activity include, for example, libraries of small organic molecules, peptides, polypeptides, DNA and RNA. Furthermore,
Test compounds may be prescreened according to a variety of criteria. For example, a suitable test compound can be selected as a compound known to have suppressive or enhancing activity on cell proliferation. Alternatively, test compounds can be randomly selected and further tested by the screening methods of the invention. The test compound can be added to the reaction system in only one concentration, or
Additions over a range of concentrations can determine the optimal regulatory activity, eg against a BRCA-1 regulator.

The activity of the BRCA-1 regulator for which drug screening is desired may be protein kinase activity. For example, a BRCA-1 regulator with a serine / threonine kinase domain can be used for drug screening where the regulated activity is protein kinase activity. Protein kinase assays are well known to those of skill in the art (see, eg, US Pat. Nos. 5,538,858 and 5,757,787; Anal. Biochem. 209: 348-353 (1993)). The activity of the BRCA-1 regulator for which drug screening is desired may also be GTP binding activity. For example, a BRCA-1 regulator with a GTP binding site can be used for drug screening where the regulated activity is GTP binding. BRCA-1 regulators with GTP-binding activity can regulate cell proliferation, for example through BRCA-1 expression, and can influence cell cycle regulation, protein secretion and intracellular vesicle interaction. it can. GTP binding assays are well known to those of skill in the art (
See, for example: US Pat. No. 5,840,969 (Hillman et al.)).

The activity of the BRCA-1 regulator for which drug screening is desired may also be hormone binding activity. For example, a BRCA-1 regulator with a hormone binding site can be used for drug screening where the regulated activity is hormone binding. BR
Hormones that bind to CA-1 regulators may be steroid hormones, such as estrogen or protein-based hormones. Receptor hormone binding assays, including receptor estrogen binding assays, are well known to those of skill in the art (see below: US Pat. No. 6,204,067 (Simon et al.)).

The present invention provides methods for identifying ribozymes that react with BRCA-1 regulators.
The method comprises: (a) introducing the randomized ribozyme library into a cell population expressing a selectable marker gene operably linked to a nucleic acid element regulated by a BRCA-1 regulator; b) subjecting the cell population to sorting; and (c) recovering one or more ribozymes from viable cells after sorting. Also provided are methods of identifying BRCA-1 regulators. The method comprises: (a) introducing the randomized ribozyme library into a cell population expressing a selectable marker gene operably linked to a nucleic acid element regulated by a BRCA-1 regulator; b) subjecting the cell population to sorting; (c) recovering one or more ribozymes from viable cells after sorting; and (d)
To sequence the target recognition sequence of the recovered ribozyme and identify the nucleic acid encoding the BRCA-1 regulatory factor.

Tumor suppressor regulators for sustained growth by reference to cancer, particularly breast cancer or ovarian cancer, as a typical neoplastic disease suitable for the method of identifying ribozymes or BRCA-1 regulators of the present invention. It will be readily apparent to one of ordinary skill in the art in view of the disclosure and description herein that the method is applicable to essentially any neoplastic disease requiring Thus, the method of identifying a BRCA-1 regulator or the method of identifying a ribozyme with BRCA-1 regulator selectivity is similar to the method of treating a neoplastic disease,
Once such regulators are identified, they can be applied to methods of identifying any tumor suppressor regulators and methods of treating neoplastic diseases.

Methods of identifying tumor suppressor regulators can be performed using the methods disclosed herein. Briefly, tumor suppressor gene nucleic acid elements that regulate the expression of tumor suppressor genes (eg, the 5'promoter and regulatory regions for individual tumor suppressors) can be operably linked to a reporter gene. A sample containing a tumor suppressor regulator and a nucleic acid element regulated by a tumor suppressor regulator linked to a reporter gene can be contacted with a test compound to measure the expression or activity of the reporter gene. Test compounds found to increase reporter gene expression or activity indicate that the test compound suppresses the activity of tumor suppressor regulators. Test compounds found to reduce reporter gene expression or activity indicate that the test compound increases or potentiates tumor suppressor regulator activity.

In order for the application of the above method to be achieved, only identification of nucleic acid (eg BRCA-1 promoter or p53 promoter) regulated by tumor suppressor regulators derived from normal cells or tumor cells is completed Is enough. Once identified, the methods of the invention can be used to functionally link nucleic acids from those cells to a reporter gene (eg, a selectable marker gene) for selection.

Furthermore, it is not necessary that the nucleic acid derived from normal cells or tumor cells be indigenous to the expression or activity of a particular tumor suppressor within said cells. In fact, normal or tumor cell-derived tumor suppressor regulator nucleic acids overlap and have redundancy with regulators of the expression or activity of other tumor suppressors. The expression level or activity level of the tumor suppressor is between the levels of one or more tumor suppressor found in normal cells as compared to the level of one or more tumor suppressor of tumor cells. It depends on the balance. Therefore, utilizing tumor suppressor regulators for normal cell function that reduces unrestricted cell proliferation by reducing the level or activity of tumor suppressor regulators that have effects on common components or structures. The balance can be shifted in the direction. Examples of nucleic acids that are regulated by tumor suppressor regulators include nucleic acids that are expressed in normal cells and whose expression is increased in tumor cells. Another example of nucleic acids that are regulated by tumor suppressor regulators include nucleic acids that are not expressed in normal cells but are expressed in tumor cells.

A method of identifying a ribozyme that reacts with a BRCA-1 regulator expresses a selectable marker gene under the control of or operably linked to a nucleic acid regulated by the BRCA-1 regulator. Requires population of cell populations. Specific examples of such cell populations and their uses are further described in the Examples below. Briefly, the nucleic acid element regulated by the BRCA-1 regulator is BR
Essentially any nucleic acid sequence that affects the expression or activity of CA-1 can be used. Specific examples of such elements include the BRCA-1 promoter and 5'regulatory element regions. The method using the BRCA-1 regulatory factor identified for the BRCA-1 promoter and a therapeutic compound therefor is applicable to all neoplastic diseases associated with decreased expression or activity of BRCA-1. Other elements include, for example, transcription enhancers and BRCA-1 mRNA.

The cell population contains nucleic acid elements regulated by the BRCA-1 regulatory element operably linked to a selectable marker gene. Functional links are dependent on the type of element used and are intended to place the nucleic acid element in the proper state and position in the reporter construct, as found in the native genome. In a specific example of the BRCA-1 promoter, the functional linkage positions the element 5'to the transcription start site of the marker gene. Functional linkage of promoter elements is sufficient to effect translation, eg, in a CAP-dependent manner, 5 ′.
It will be well upstream of the translation initiation codon so that untranslated region sequences are included. Reporter constructs are well known in the art and can be introduced into cell populations using the methods described further above.

A selectable marker is a gene product that is or can be produced to affect the vital activity of a cell or cell proliferation, or a gene product that can be used as a measurable indicator. Specific examples include enhanced green fluorescent protein (EGFP), hygromycin resistance gene, tumor suppressor BRCA-1, herpes simplex virus thymidine kinase (HSV-tk), cytosine deaminase (CD) and diphtheria toxin (DT). included. For example, expression of a negative selection marker in cells is toxic alone or in the presence of a negative selection compound (which is metabolized by the marker gene product into a cytotoxic or cytostatic substance). . In contrast, intracellular expression of the positive selection marker protects cells from growth arrest or cell death. Alternatively, the gene product may be a measurable indicator that can be used to sort cells that exhibit a measurable, constant level of expression of the gene product.

Expression of a readily detectable gene product such as EGFP can be used as a measurable indicator of gene expression. EGFP is, for example, fluorescence activated cell sorting (
Methods such as FACS) are used to allow selection of specific user-specified expression levels. For example, 10% of the cells expressing the highest level of EGFP can be harvested using the FACS method. The sorted subpopulations are expanded and subjected to a second round of high level EGFP expression sorting by FACS. This iterative FACS sorting can enrich high level of EGFP expressing cells and is thus a typical positive sorting method by FACS.

Positive selection can also be performed using eg hygromycin. Expression of the hygromycin resistance gene allows cells to survive in the presence of hygromycin. Hygromycin is an aminoglycoside antibiotic that kills bacteria, fungi and higher eukaryotic cells by inhibiting protein synthesis. Expression of the hygromycin resistance gene allows cells to survive in the presence of hygromycin. The concentration of hygromycin used for selection ranges from approximately 50 μg / mL to 1000 μg.
g / mL, preferably about 250 μg / mL. Phenotypic selection can also be performed. Expression of the BRCA-1 gene suppresses cell proliferation, especially anchorage-dependent proliferation, resulting in a reduced ability to grow in, for example, soft agar. Cell growth in soft agar can therefore be used to measure the anchorage-independent growth tendency of cells and thus to display BRCA-1 gene expression levels.

Once selection is complete, the selected cells are those that express a ribozyme reactive with a BRCA-1 regulatory factor that suppresses or reduces BRCA-1 promoter-dependent expression of the reporter gene. These cells are isolated and the ribozyme recovered by, for example, PCR or other methods well known in the art. Ribozyme RST is BRCA-
It is a sequence tag corresponding to one control factor. Sequencing of this tag identifies the nucleic acid encoding the BRCA-1 regulator. A specific example of RST corresponding to the BRCA-1 regulatory element is shown as SEQ ID NO: 5-10, and their corresponding TSTs are SEQ ID NO: 1
Shown as 1-16. Five RST sequences were determined. Specifically, SEQ ID NO: 7 corresponds to RST for BR1, the full length nucleotide and amino acid sequences of which are shown as SEQ ID NOs: 1 and 2. SEQ ID NO: 5 is BBC1 (GenB
Ank accession number X64707) also corresponds to RST of CHLR2 (GenBank accession number U33834), SEQ ID NO: 8 is RST of ID4 (GenBank accession number NM_001546) and also AF6 (GenBank accession number A).
B011399) RST. SEQ ID NO: 6 is BR2 (GenBank accession number AL
045940) corresponding to RST, SEQ ID NO: 9 is BR3 (GenBank accession number AI276
397).

The present invention also provides a method of treating breast cancer or ovarian cancer. This method uses BBC1, BR1
, ID4, BR2 or BR3, and a ribozyme that selectively reacts with RNA encoding the ribozyme, which is preferably BBC1.
Reacts selectively with RNA encoding ID4, BR1 or BR1. Further provided is breast or ovarian cancer by introducing a ribozyme that selectively reacts with RNA encoding a BRCA-1 regulatory factor, which corresponds to RST selected from the group consisting of SEQ ID NOs: 5-10. Is a method of treating. Treatment of breast cancer or ovarian cancer by replacing the ribozyme of the present invention, which selectively reacts with BRCA-1 regulatory RNA, with an antisense nucleic acid corresponding to the RST sequence selected from the group consisting of SEQ ID NOs: 5-10. Methods are also provided. Like the catalytic ribozyme, the antisense nucleic acid hybridizes with the BRCA-1 regulatory factor nucleic acid and suppresses the RNA transcription process or translation without causing subsequent cleavage. Such methods are described below with reference to the ribozymes of the invention, but those of skill in the art will similarly replace antisense nucleic acids with ribozymes to prevent or reduce the severity of breast or ovarian cancer. It will be appreciated that it is possible.

Ribozymes encoding any of the RST sequences set forth as SEQ ID NOs: 5-10, or combinations thereof, may be delivered to tumor cells or cells that allow uncontrolled growth in various ways to interfere with tumor growth or Can be prevented. Ribozyme is RNA
Or may be expressed from an expression vector. Ribozyme
The ribozyme may be administered ex vivo, for example by administration to cells removed from an infected individual, followed by returning to said individual, or the ribozyme may be administered in vivo. Delivery can be carried out using any suitable delivery carrier known to those of skill in the art. Such carriers include, for example, liposomes, controlled release carriers, electroporation or covalent moieties, and other pharmaceutically acceptable delivery methods. The carrier may provide specificity for tissue or organ accumulation of the ribozyme at the tissue or organ that is the primary site of tumor growth, eg breast or ovarian accumulation. Ribozyme delivery vehicles can be designed to act as sustained release reservoirs or to deliver their contents directly to target cells. Examples of ribozyme delivery carriers include liposomes, hydrogels, cyclodextrins, biodegradable nanocapsules, and bioadhesive microspheres. Liposomes can easily target the liver to deliver RNA to infected tumor cells.

The routes of administration of ribozymes include intramuscular, aerosol, intravenous, parenteral, intraperitoneal routes. However, in general, the route of administration is via the blood vessels, which represents a direct route to the organ or tissue to be treated. The dosage of the ribozyme will also depend on a variety of factors, such as the form of the ribozyme, the route of administration, the severity of the cancer or condition, the general condition of the patient being treated and, therefore, will vary widely. Generally, the dose of ribozyme is about 10 μg -200 mg / kg body weight per day, which will result in therapeutic or prophylactic levels in target cells sufficient to suppress or eradicate tumor cells. The duration of treatment can be extended to the entire duration of the neoplastic disease or condition, usually at least about 7-30 days, with longer durations required for more severe diseases. The frequency and timing of administration will also vary, eg according to the extent of the disease.

Viral vectors containing ribozymes corresponding to the BRCA-1 regulator RST of the present invention can be prepared by any of a wide variety of methods known to those of skill in the art. Representative retroviral vectors that can be used in the methods of the invention are described, for example, in US Pat. Nos. 4,861,719, 5,124,263 and 5,219,740. Other vectors, such as DNA
Vectors, pseudotyped retrovirus vectors, adenoviruses, and adeno-associated virus vectors can also be used, especially in ex vivo methods.

Viral vectors intended for use in the methods of the invention include infectious but replication defective viral particles. The particle comprises at least one DNA sequence encoding a ribozyme that selectively reacts with a BRCA-1 regulator, which is administered in a subject in an amount effective to inhibit the formation or progression of cancer. . Vector particles can be administered in an amount of 1 plaque forming unit to about 10 ¹⁴ plaque forming units, more preferably about 1 × 10 ⁶ plaque forming units to about 1 × 10 ¹³ plaque forming units. A sufficient number of vector particles containing a ribozyme that selectively reacts with the BRCA-1 regulatory factor of the present invention is administered to a cancer tissue or organ, and at least about 50% of the cancer cells in the individual, usually about 80%, preferably Can infect about 90% or more of the cancer cells. Subsequent administration, if necessary, can be effected to effectively treat or reduce the severity of the cancer.

Typical ribozymes of the invention include, for example, the RS shown as SEQ ID NO: 5-10.
Those having a T sequence are included. One of these RST sequences, SEQ ID NO: 1, corresponds to proteins BBC1 and CHRL2. Another RST sequence, SEQ ID NO: 8, corresponds to proteins ID4 and AF6. Three of the RST sequences correspond to sequences whose role has not been previously known. Briefly, SEQ ID NO: 7 corresponds to BR1 (SEQ ID NO: 1), SEQ ID NO: 6 corresponds to BR2, and SEQ ID NO: 9 corresponds to BR3. Methods of treating cancer are also provided by the present invention. More specifically, in one aspect of the invention, cancer conditions can be treated by administering to a warm-blooded animal (eg, human) a therapeutically effective amount of a ribozyme.

The invention provides for treatment of cancer by contacting the desired cells with an effective amount of a ribozyme of the invention. A suitable "therapeutically effective amount" will depend on the nature and extent of the diseased tissue being treated. Such a "therapeutically effective amount" is well known in the art and appropriate animal model (eg, rat, rabbit, or pig model).
Can be readily determined by one of skill in the art using or by clinical trials. As used herein, a patient is considered "treated" if the cancer symptoms recover or are suppressed in a quantifiable manner in the patient. A therapeutically effective amount or method should provide: (1) a reduction in the frequency, severity, or duration of clinical symptoms (eg, pain); (2) an extension of duration in remission; 3) Altered pathological signs (eg decreased tumor volume or tumor markers); or (4) Any combination of the above. When delivering the ribozyme exogenously, the RNA molecule can be embedded within a stable RNA molecule or another protective environmental form (eg, liposome). As another option, the RNA can be embedded within a ribonuclease resistant DNA replica. The intracellular uptake of exogenous ribozymes can be enhanced by attaching chemical groups (eg cholesteryl moieties) to the DNA termini (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989).

Hammerhead ribozymes suitable for use in the present invention preferably recognize the sequence NUH, where N is either G, U, C or A and H is C, U or A. . The hairpin recognition site GUC is a subset of the hammerhead recognition site NUH. Therefore,
All hairpin sites are also clearly hammerhead sites, but not vice versa. Chimeric hammerhead ribozymes (ie RNA / DNA hybrids) are designed to have the appropriate NUH sequences for ribozyme cleavage.
A ribozyme having the general structure shown in the schematic diagram 1 below is chemically synthesized. The base and stem loop of the binding arm contains DNA and the catalytic domain is RNA and / or 2 '.
Contains O-methyl RNA base. The stem loop can be replaced with a propanediol linker. DNA bases are shown in upper case, RNA bases are shown in lower case, 2'O methyl RNA is shown in lower case with underline, and the propanediol linker is shown as pr pr pr pr.

Schematic diagram 1 SEQ ID NO: 47 Length: 38 5 ′ NNNNN nn cuga u g agg CCGTAAGG cc ga a a cc NNNNNN3 ′ SEQ ID NO: 48 Length: 28 5 ′ NNNNN nn cuga u g ag pr pr pr pr pr pr c ga a a cc NNNNNN3 '

In addition to the methods of treating breast or ovarian cancer using the ribozymes of the present invention, the inhibitory compounds identified in the screening methods described above may also be used to reduce the severity of breast or ovarian cancer. be able to. Small organic compounds are particularly advantageous because they can be easily formulated and administered using methods well known in the pharmaceutical art. The present invention provides methods for identifying target genes that are downregulated by ribozyme activity. Another potential application of this technology is to identify other genes in the pathway that contribute to the phenotypic changes seen after ribozyme knockdown. Expression profiles can be determined with hybridization arrays of cDNA targets obtained from sequence databases of known genes or expressed sequence tags (ESTs).

In one embodiment, the mRNA differentially expressed in cells transduced with control and effector ribozymes reverse transcribes the cellular mRNA into cDNA, which is green (control ribozyme) and red (effector ribozyme). It can be detected by labeling with a fluorescent dye. Individual EST clones are lined up on a solid support (eg polylysine coated glass (eg 24x24 panel)).
The above microarray is hybridized with a mixture of two labeled cDNAs, followed by scanning for fluorescence color. The G3pDH DNA fragment is spotted in each corner of a 24x24 panel and used as an internal control to check the equality of the amount of cDNA applied from the two cell lines. The concentration of color at each position in the array is proportional to the expression level of the corresponding gene in the sample. The EST fragment with a marked red color indicates that the EST is expressed primarily in effector ribozyme cells or is upregulated by effector ribozyme treatment, while the predominant green color indicates that the EST is primarily in control. Is expressed in ribozyme cells,
Or, it is shown to be down-regulated by effector ribozyme treatment.

In the approaches described above, an array of clones can be formed on any of a variety of solid supports such as membranes or silicon-based chips such as those made of nylon. Furthermore, the cDNA prepared from the two types of transduced cells may be differentially labeled with a fluorescent chromophore, an enzyme, a radioisotope, or the like. If radiolabeled cDNA is used, each pool of labeled cDNA is hybridized to a separate membrane and these membranes are scanned for radioactivity using a phosphoimager. The radioactivity of each array element is proportional to the number of bound cDNAs, so the concentration of effector ribozyme cDNA can be directly compared to the control ribozyme cDNA in a manner similar to the fluorescent elements described above.

Criteria (eg, at least 2-fold difference in expression levels) can be set to outline potential targets for genes involved in pathways that result in phenotypic changes. This method can be used to identify alternative drug targets that are indirectly regulated by ribozymes. Regulators of BRCA-1 expression were identified using the expression analysis approach described above and described in great detail in Example X. These genes (GenBank accession number AA419
229, GenBank accession number H18950, GenBank accession number H07920, G
enBank accession number H70047, GenBank accession number H84815, GenBank
Accession number AA757764, GenBank accession number H19111, GenBank accession number AA629897, GenBank accession number AA663439, GenBank accession number R15740, GenBank accession number AA454570, GenBank accession number AA485748, GenBank accession number AA464601, GenBank accession Number AA102107, and GenBank accession number Z49826) is BRCA-1.
Are representative of therapeutic agents or ribozyme effector targets that increase the expression of A.

The present invention also provides high throughput drug discovery methods using ribozyme-transduced cells and chip array technology. By combining array technology with ribozyme knockdown, drugs can be rapidly screened for effects on a pathway. Once the expression profile resulting in a phenotype has been determined, the relevant regulatory EST sequences can be used to generate additional arrays. These can be screened with the mRNA of drug-treated cells. A profile that matches the ribozyme treatment profile can be identified. Treatment with the agents thus identified can be expected to confer the desired phenotype.

This method allows these target genes to have the desired phenotype (ie, increased expression of BRCA-1).
It is possible to connect to. One of skill in the art would be able to identify small molecule drugs, ribozyme drugs or antibody drugs that suppress the activity of these gene targets resulting in increased expression of BRCA-1, for example. These gene targets can be used to develop high throughput assays to screen existing small molecule libraries. Furthermore, genes expressing surface or secreted proteins can be targeted for antibody development. Preferably, a human antibody can be prepared by preparing an antibody specific to the gene product in a transgenic mouse system. Furthermore, chimeric ribozymes targeting these BRCA-1 regulators can be designed as described above (see, eg, Scheme 1 above and Scheme 2 below).

The invention also provides a method of detecting tumor cells in a sample. In one embodiment, the method comprises contacting the sample with a detection agent specific for a BRCA-1 regulator nucleic acid molecule and detecting the nucleic acid molecule in the sample. Altered expression or altered structure of the nucleic acid molecule is indicative of the presence of tumor cells in the sample. In another embodiment, the method comprises contacting the sample with a detection agent specific for a BRCA-1 regulator polypeptide of the present invention and further detecting the polypeptide in the sample. Altered expression or altered structure of said polypeptide is indicative of the presence of tumor cells in the sample.

The diagnostic methods disclosed herein include solid tumors (carcinomas and sarcomas), such as breast cancer,
It can be used to identify tumor cells present in ovarian and prostate cancer. BRCA-1 regulator molecules that can be detected using this method include BR1, BR2, BR3, BBC1 or ID4 or the corresponding polypeptide. Various qualitative and quantitative assays for detecting altered expression or altered structure of nucleic acid molecules in a sample are well known in the art. Generally, hybridization of a nucleic acid molecule with a detecting agent, such as a complementary primer or probe, is required. Such assays include, for example, in situ hybridization, which is used to detect changes in the chromosomal location of the nucleic acid molecule, changes in gene copy number, or changes in RNA quantity, depending on the mode used. Can be used. Other assays include, for example: RNA blots and ribonuclease protection assays, which can be used to determine RNA quantity and integrity; DNA blots, which determine DNA copy number and integrity. Can be used to determine); SSCP analysis (which can detect only one point mutation in DNA, eg PCR or RT-PCR products); and coupled PCR, transcription translation assays, eg protein truncation test. (Protein Truncation Test) (In this case, DNA
The mutations in are determined by gel electrophoresis of the altered protein product).
Yet another assay includes methods for genotyping the BRCA-1 regulator gene known in the art. The method may be, for example, by RFLP analysis, or
By determining the specific SNP in the BRCA-1 regulator gene. Suitable assay formats and detecting agents for detecting changes in expression and structure of BRCA-1 regulator nucleic acid molecules will be determined by those of skill in the art depending on the changes to be identified.

Various assays for detecting altered expression or altered conformation of a BRCA-1 polypeptide are also well known in the art, and generally, a detection agent (eg, an antibody or selective binding agent) is added to the polypeptide in the sample. Need to hybridize with. Such assays can be performed in situ by contacting the detectably labeled antibody with the polypeptide in the cell, eg, by immunohistochemical or immunofluorescent methods. Other assays, such as ELISA assays, immunoprecipitation, and immunoblot analysis can be performed with cell or tissue extracts. When a structure-specific binding agent (which can detect a polypeptide with a structural change) is used, an assay in which the polypeptide remains in its native form is particularly useful. BRCA-1
Structural variants of regulator polypeptides can act, for example, in a dominant negative manner to reduce BRCA-1 expression or activity and cause uncontrolled cell proliferation. Appropriate assay formats and detection agents for detecting changes in BRCA-1 regulator polypeptides will be determined by those of skill in the art depending on the changes to be identified.

Also contemplated herein are in vivo methods of detecting BRCA-1 polypeptides or nucleic acids. The method may include detecting agents such as antibodies or complementary R
Administering the NA molecule to the subject. The detection agent is suitably conjugated with an imaging reagent useful for its detection in vivo and is known in the art, eg magnetic resonance imaging, computer assisted tomography, X-ray. Imaging is used. Imaging reagents are well known in the art and include radioactive reagents, electron-dense reagents and magnetic or electronic reagents.

The diagnostic methods described herein can also be used in prognostic assays. By the above-mentioned applications, it occurs at a stage characteristic of proliferative disease or tumor progression.
Changes in expression or structure of the BRCA-1 regulator molecule are identified. Knowing the tumor stage allows the physician to select the most appropriate treatment for the tumor and predict the likelihood of success of that treatment. The diagnostic methods described herein can also be used to monitor the effectiveness of treatment. Successful treatment can be indicated, for example, by a reduction in the number of tumor cells in the individual, which is evidenced by a more normal expression or structure of BRCA-1 regulators in the post-treatment sample.

In the diagnostic and prognostic assays described herein, the expression level or structure of BRCA-1 regulatory factor nucleic acid or polypeptide detected in a test sample is determined by the known level of nucleic acid or polypeptide in a normal sample. The expression level or structure is compared. A normal sample can be obtained from normal tissue of the same histological origin of the same individual or another individual or population of individuals.

The diagnostic methods described herein can also be used in methods of determining a subject's propensity to develop cancer. Such methods include collecting a preneoplastic sample from a subject. The sample can include a sample of a particular tissue or organ suspected of tumor growth. Alternatively, the sample may be any part of the subject, such as a blood, saliva or buccal swab sample. The detected expression level or structure of the BRCA-1 regulatory factor nucleic acid or polypeptide is then compared to corresponding known expression levels or structures for a population of normal and cancer subjects, whereby the expression level or structure is identified. Will correspond to a sub-group of people. The number of normal subjects versus cancer subjects in the particular subpopulation can be determined and a predictive value for cancer development for any subject in the subpopulation can be obtained. A subject's cancer-proneness is determined by assigning the subject's cancer-proneness to the expected value of a subpopulation that matches the subject's expression level or structure. It will be appreciated that modifications which do not substantially affect the activity of the various embodiments of this invention are also included in the disclosure provided herein. Therefore, the following examples are illustrative of the present invention and are not intended to limit it.

EXAMPLES Example I: Preparation of Random Retrovirus Vector Ribozyme Library: This example shows the construction of a random retrovirus vector ribozyme gene library. The present inventors have introduced a random retrovirus vector ribozyme gene library into a PA1 ovarian cancer cell line, whereby certain ribozymes selectively target mRNA encoding a regulatory factor of the BRCA-1 tumor suppressor gene. And found that this would be inactivated. A ribozyme gene library having a randomized target recognition sequence was introduced into mammalian cells stably expressing a selection marker (green fluorescent protein (EGFP) under the control of BRCA-1 promoter). Cells in which BRCA-1 expression was upregulated by specific ribozymes were sorted by their EGFP expression, which was simultaneously increased. The ribozyme gene was then rescued from cells showing enhanced EGFP expression and their substrate binding site sequenced. The corresponding ribozyme binding sequence, or "target sequence tag" (TST), is a sequence present in the regulatory factor nucleic acid molecule targeted by the ribozyme. Therefore, knowing the TST makes it possible to identify and isolate novel regulator nucleic acids.

A plasmid-based retroviral library was constructed by inserting a random ribozyme gene sequence into the parent vector, pLHPM-2kb. pLHP
M-2 kb is the 5'and 3'long terminal repeat (LTR) of the Moloney retrovirus genome; the neomycin resistance gene driven by said LTR;
SV40 driven puromycin resistance gene; and a transcription cassette containing the tRNAval promoter, and a 2 kb filled insert. The tRNAval promoter can drive transcription of the inserted ribozyme gene when the filled insert is removed and replaced with a random ribozyme insert.

To prepare the pLHPM-2kb vector, plasmid pLHPM was digested with BstB1 overnight at 65 ° C., phenol: chloroform extraction was performed, and ethanol precipitation was performed. The resuspended DNA was then digested with MluI overnight at 37 ° C. This double digestion cuts out the 2 kb fill fragment. The resulting 6 kb plasmid vector DNA fragment was purified by agarose gel electrophoresis. To prepare random ribozyme library inserts, three oligonucleotides were synthesized and combined with annealing buffer (50 mM NaCl, 10 mM Tris pH 7.5).
), 5 mM MgCl ₂ ) in a molar ratio of 1: 3: 3 (Oligo1: Oligo2: Oligo3).
Annealed by heating at 0 ° C. followed by cooling to room temperature. The three oligonucleotides had the following sequences: Oligo 1: 5'-pCGCGTACCAGGTAATATACCACGGACCGAAGTCCGTGTGTTTCTCTGGTNNNNTT
CTNNNNNNNNGGATCCTGTTTCCGCCCGGTTT-3 '(SEQ ID NO: 49) Oligo 2: 5'-pGTCCGTGGTATATTACCTGGTA-3' (SEQ ID NO: 50) Oligo 3: 5'-pCGAAACCGGGCGGAAACAGG-3 '(SEQ ID NO: 51).

In order to randomly and uniformly incorporate A, T, C and G nucleotides at the positions shown as N nucleotides in Oligo 1, the A, T, C and G reagents were premixed and the mixture was oligonucleotide synthesized. For each N position. This ribozyme insert library (SEQ ID NOs: 7-9) formed by annealing three oligonucleotides thus contained eight random nucleotide positions in ribozyme helix 1 and ribozyme helix 2.
Contains 4 random nucleotide positions. To ligate the DNA fragment of the pLHPM-2 kb vector with the random ribozyme insert library, 0.5 pmol of vector and an 8-fold molar excess of annealed oligonucleotides were ligated overnight with 10 units of T4 DNA ligase. Subsequently, together with the ligation mixture, Ultra Competent DH12
Electroporation was performed on S bacteria. A total of 5 × 10 ⁷ colonies containing the retrovirus plasmid ribozyme library were obtained.

Bacterial colonies containing the retroviral plasmid ribozyme library were aliquoted and pooled as a master stock and frozen at -80 ° C. Working stocks were made by culturing 1 mL master stock in 60 mL LB broth at 30 ° C. overnight. A 500 mL bacterial culture was made by incubating 1 mL aliquots of the working stock overnight at 30 ° C. and used to make the retroviral vector as described below.

After cloning the randomized hairpin ribozyme gene in pLHPM, the "randomness" of this plasmid library was evaluated by both statistical and functional analysis. A complete ribozyme library with this design (12 random positions) will contain 4 ¹² or 1.67 x 10 ⁷ different members. For statistical analysis, 40 individual transformed bacteria were removed and sequenced. This allowed assessment of library complexity without the need for manual sequencing of each library member. The statistical “randomness” of this library is the two-sided approximant confidence interval
e binomial confidence interval) was determined using the following formula: E = 1.
96 * (P * (1-P) / N) ^2/1 , where P is the expected proportion of each nucleotide present at a position (this value for DNA bases is equal to 25% or P = 0.25)
); E is the desired confidence interval around P (ie P ± E); N is the required sample size (Callahan Associates, Inc., La Jolla, CA). Within 5% (E
= 0.05), the sample size required to determine the proportion of each base is 289. Since each ribozyme molecule contains 12 distinct positions, the number of ribozyme genes in the library that need to be sequenced is equal to 289 divided by 12, or about 25 molecules.

The frequency of four nucleotides in random positions with a 95% confidence limit is G:
It was calculated as 22.3 + 6.1, A: 31.9 + 7.0, T: 27.3 + 7.8, C: 18.01 + 15.1. The expected frequency of each base is 25%, so each base appears to be represented randomly (except for C, where C is slightly lower than expected). These deviations would reduce library complexity, probably as a result of unbalanced nucleotide incorporation during the chemical synthesis of the oligonucleotide.

For functional assessment of library complexity, in vitro cleavage was used to
It was determined whether ribozymes targeting RNA substrates were present in the library pool. This requires in vitro transcription of the entire ribozyme library in a single reaction, followed by testing whether the pool has the ability to cleave various RNA substrates of cellular and viral origin. Six of the seven known RNA targets were properly and efficiently cleaved by the in vitro transcribed library. The above qualitative analysis suggests that the ribozyme gene library has significant complexity, and the lack of cleavage of one of the seven targets is suggested by the base composition described above. It may reflect a slight non-randomness.

Viral vectors were made from ribozyme library plasmids using triple transfection. CF2 cells were seeded at 3.5 × 10 ⁴ cells / cm ² one day before transfection. Cationic lipid trans IT-LT1 (Pan Ve
cells with a 1: 1: 1 mixture of a ribozyme library plasmid or a control ribozyme plasmid, a plasmid encoding the Moloney mouse virus gag-pol gene, and a plasmid encoding the G gene of follicular stomatitis virus. Transfected. 25 mg of each plasmid complexed with 250 mL of lipid was used to transfect 7.8 × 10 ⁶ cells in a total volume of 20 mL of serum-free medium. After 6 hours, the culture medium was replaced with a growth medium. Cell supernatants containing retroviral particles were collected every 24 hours starting 2 days after the addition of fresh medium. This supernatant was passed through a 0.4 mm filter and titered in a standard assay using HT1080 cells.

Example II: Isolation of Ribozymes Targeting BRCA-1 Regulator Nucleic Acids: This example illustrates the isolation of ribozyme genes that bind to and inactivate BRCA-1 regulator nucleic acid molecules and The identification of the targeted nucleic acid sequence is shown. To facilitate functional selection of cells with changes in BRCA-1 expression, a reporter gene based cell selection system was used. The reporter construct allowed the expression of EGFP under the control of the BRCA-1 promoter contained in a 2.9 kb fragment derived from the BRCA-1 genomic sequence. A 2.9 kb BRCA-1 promoter region having an additional PstI site (5'-ATCTTTCTGCAGCTGCTGGCCCGG-3 '; SEQ ID NO: 52) and an AgeI-containing primer (5'-GTGTAAACCGGTAACGCGAAGAGCAGATA-3'; SEQ ID NO: 53) and PCR A long template system (Boehringer Mannheim) was used to amplify from the pGL2 vector containing the 3.8 kb genomic BRCA-1 fragment. This PCR product was gel-purified and digested with PstI and AgeI, using standard molecular biology techniques.
Cloned with pEGFFFFP-1 (also containing a neomycin resistance marker) (Clontech).

Ovarian cancer cell lines were loaded with the BRCA / EGFP reporter construct, Lipofectamine Plus (Lipof
ectamine Plus, Gibco-BRL) to obtain stable integrants.
Selection was performed using 400-800 mg / mL neomycin for 2 weeks. Reporter cell clones were generated by limiting dilution and characterized for endogenous BRCA-1 and EGFP expression. A reporter clone designated P8EGBR3 that expresses both genes at intermediate levels was selected for library introduction. A retroviral library vector or control vector was introduced into P8EGBR3 reporter cells and screened for stable integration of the vector with a puromycin resistance marker. 1.
9 × 10 ⁷ cells were transduced with retroviral vector (library or control) at MOI 1 based on HT1080 titer. 2 days after transformation, 1 cell
: 2 parts, and recultured for 14 days in a culture medium containing 0.3 mg / mL puromycin to stably select cells into which the retrovirus vector was incorporated.

After stable sorting, the cell populations were subjected to several rounds of fluorescence activated cell sorting (FACS) to enrich for cells with increased EGFP expression (up to 3-10% of each population).
). After three rounds of selection, the transduced population of the ribozyme library showed a subpopulation with increased EGFP expression, whereas the control transduced cells did not show an increased expression subpopulation. After further selection, the library-transduced cells had an average fluorescence intensity of about 4 compared to the control vector-transduced cells (FIG. 4).
The cells shifted to fold increased (Fig. 3). RNA analysis of these populations also revealed an increase in endogenous BRCA-1 message along with EGFP message in the library population. These data clearly demonstrate the ability of selected ribozymes to increase expression of endogenous BRCA-1 and concomitantly expression of the reporter gene, suggesting regulation at the transcriptional level.

Ribozymes were rescued from the shifted cell population by PCR amplification. P
CR recovery is performed by the QIAmp Blood Kit (Qiagen, Valencia, CA).
) Was used on 5 separate aliquots of 1 mg of genomic DNA extracted from cells. PCR is AmpliTaq Gold System (Perkin-Elme)
r, Norwalk, CT), first denaturing at 94 ° C for 10 minutes, then [94 ° C for 20 seconds,
65 ° C. for 30 seconds, and 72 ° C. for 30 seconds] × 35 cycles. The final extension was at 72 ° C for 7 minutes. PCR primer in the vector (5'-GGCGGGACTATGG
TTGCTGACTAAT-3 ', 5'GGTTATCACGTTCGCCTCACACGC-3'; SEQ ID NO: 54, respectively
And 55) amplified a 300 bp fragment containing the ribozyme gene.
The pooled PCR product (containing the ribozyme gene pool) was electrophoretically isolated on 1% agarose and purified using a gel extraction kit (Qiagen), followed by digestion with BamHI and MluI and digestion with the same enzymes. Connected to LHPM. The ligated DNA was used to transform DH12S bacteria by electroporation. The entire bacterial culture was plated on LB agar containing ampicillin and incubated overnight at 37 ° C. The resulting bacterial colonies were pooled and purified DNA was used in a triple transfection protocol to generate a novel retroviral vector. Individual colonies were also labeled with the vector primer (5'-CTGACTCCATCGAGCCAG
TGTAGAG-3 '; SEQ ID NO: 98) was used to sequence by standard dideoxy method. It was found to be rich in some ribozyme sequences. This retrovirus pool was introduced into new reporter cells and subjected to several rounds of FACS sorting. Cells re-transduced with the library showed a shift compared to cells transduced with the control. Rescue of ribozymes from these cells revealed six major ribozymes designated RH1, RH2, RH3, RH4, RH5 and RH6 (Tables 1-6).

The substrate binding sequence of RH1 (SEQ ID NO: 5) was converted to its corresponding target sequence tag (TST1
Is shown in Table 1 below together with SEQ ID NO: 11).

[Table 1] Table 1: RH1 gene sequence TST1 corresponding CCGGATGC AGAA CAAT ATTG NGTC GCATCCGG   (SEQ ID NO: 5) (SEQ ID NO: 11)

The substrate binding sequence of RH2 (SEQ ID NO: 10) was converted to its corresponding target sequence tag (TST
2; together with SEQ ID NO: 16) are shown in Table 2 below.

[Table 2] Table 2: RH2 gene sequence TST2 corresponding CCCTATTT-AGAA TTGT ACAA NGTC AAATAGGG     (SEQ ID NO: 10) (SEQ ID NO: 16)

The substrate binding sequence of RH3 (SEQ ID NO: 6) was converted to its corresponding target sequence tag (TST3
Is shown in Table 3 below together with SEQ ID NO: 12).

[Table 3] Table 3: RH3 gene sequence TST3 corresponding AGTACATT AGAA TATC AGTA NGTC AATGTACT     (SEQ ID NO: 6) (SEQ ID NO: 12)

The substrate binding sequence of RH4 (SEQ ID NO: 7) was converted to its corresponding target sequence tag (TST4
Is shown in Table 4 below together with SEQ ID NO: 13).

[Table 4] Table 4: RH4 gene sequence TST4 corresponding CTAGTGAG AGAA GGGA TCCC NGTC CTCACTAG         (SEQ ID NO: 7) (SEQ ID NO: 13)

The substrate binding sequence of RH5 (SEQ ID NO: 8) was converted to its corresponding target sequence tag (TST2
Are shown in Table 5 below together with SEQ ID NO: 14).

[Table 5] Table 5: RH5 gene sequence Corresponding TST5 TGAGATCC AGAA AAGC GCTT NGTC GGATCTCA         (SEQ ID NO: 8) (SEQ ID NO: 14)

The substrate binding sequence of RH6 (SEQ ID NO: 9) was converted to its corresponding target sequence tag (TST6
Is shown in Table 6 below together with SEQ ID NO: 15).

[Table 6] Table 6: RH6 gene sequence TST6 corresponding TGTTACTT AGAA TGTT AACA NGTC AGTAACA     (SEQ ID NO: 9) (SEQ ID NO: 15)

To demonstrate the function of the major ribozymes, a vector was made from the plasmids encoding the individual ribozymes and a second reporter containing the hygromycin resistance gene driven by the BRCA-1 promoter in the SKBR3 breast cancer cell line. System (SKHYTK
It was introduced into 4) by retrovirus transduction. Using BRCA-1 / EGFP plasmid, 2.
The SapI insert containing the 9 kb BRCA-1 promoter region was excised, the ends were made blunt with Klenow and the insert was digested with BglII. A hygromycin reporter plasmid was constructed using as backbone 30 a plasmid containing the hygromycin resistance gene fused to HSV thymidine kinase. This plasmid also contains a separate neomycin resistance cassette. This plasmid was digested with NheI, the ends were blunt-ended with Klenow, and the plasmid was digested with BglII. The insert was ligated into a plasmid with one blunt end and one BglII site to create the hygromycin gene driven by the BRCA-1 promoter. Breast cancer cell line SKBR3 with Lipofectamine plus (Gibco-BRL)
Was used to transfect the BRCA / HyTK reporter construct, 400-800 m
Stable integrants were selected using g / mL neomycin for 2 weeks. Reporter cell clones were made by limiting dilution and characterized for resistance to hygromycin B. One clone, SKHYTK4, was selected for its sensitivity to hygromycin over the range 400-800 mg / mL. PCR and analysis of genomic DNA determined that the BRCA-1 / hygroTK cassette was present in these cells. S transduced with individual ribozymes RH3, RH4 or RH6
KHYTK4 cells were resistant to hygromycin as determined by the increase in cell number when transduced cells were grown in culture containing hygromycin (3.1, 8.5 and 147 fold, respectively). Showed an increase. RH2 was not confirmed in this assay.

In addition, individual ribozymes were introduced into PA1 cells by retroviral transduction and analyzed for their ability to grow in soft agar. Six-well plates were coated with Iscove's medium (Gibco-BRL) containing 0.6% agar and 10% fetal bovine serum. MOI with 1 × 10 ⁶ PA1 cells by retrovirus vector
1 was transduced on days 1 and 2. PA1 newly transduced on day 3
Cells were overlaid on coated plates at 6 × 10 ⁴ or 9 × 10 ⁴ cells per well in Iscove's medium containing 0.4% agar and 7.7% fetal bovine serum. On day 4, Iscove's medium top layer containing 0.6% agar and 10% fetal bovine serum was applied. Every 3rd day, Iscove's medium containing 10% fetal bovine serum was replaced on the surface of the agar layer. Cells were incubated for 6 weeks at 37.5 ° C., 5% CO ₂ and the number of colonies 100 cells or larger in size was determined. PA1 cells transduced with individual ribozymes RH1, 4 or 5 showed a reduced ability to grow in soft agar (control 3
． 7, 26 and 28%), suggesting up-regulation of endogenous BRCA-1 message leading to suppression of anchorage-independent growth. RH2 was not confirmed in this assay.

Considering its ability to reproducibly cause increased expression from the BRCA-1 tumor suppressor promoter and to alter the ability of PA1 cells to grow in soft agar, SEQ ID NO: 5 The ribozyme containing the −10 substrate-binding sequence is a ribozyme that binds to and inactivates the regulatory factor of the BRCA-1 expressing nucleic acid molecule. Similarly, the targets of these ribozymes, which are nucleic acid molecules containing the nucleic acid sequence referred to as SEQ ID NOs: 11-16, are regulators of BRCA-1 expressing nucleic acid molecules.

Example III: Isolation and Characterization of Breast Basic Conserved Protein 1 (BBC1): This example describes the BRCA-1 nucleic acid molecule referred to as Breast Basic Conserved Protein 1. 3 shows the isolation of the full-length transcriptional regulator cDNA and its encoding polypeptide. Since ribozymes recognize their cognate targets by sequence complementarity, the sequences of ribozymes that give rise to a phenotype through their catalytic activity can predict sequence tags that can be used in cloning target genes. This "target sequence tag" or TST is approximately 16 bases in length and consists of two target regions complementary to ribozyme helices 1 and 2 and an essential GUC (see Figures 1, 2 and 3). Therefore, TST can be used for BLAST searches of gene and EST databases, and can also be used as primers for 3'and 5'RACE. A BLAST search of the database using TST corresponding to RH1 did not give a perfect match, only an incomplete match with the non-human sequence.

Given the absence of clear database candidates, the RH1 target gene was cloned using RKTST as a primer for a novel technique developed to identify ribozyme cleavage targets. This new technique is based on the "switching mechanism of the 5'end of the RNA template in the cleavage-specific amplification of cDNA ends" (Switchin
g Mechanism At 5'end of RNA Template in Cleavage-Specific Amplification
of cDNA Ends), which is called SMARTC-SPACE, utilizes the unique cleavage site of the hairpin ribozyme to create the 5'end of the target nucleic acid consisting of base GUC.

The present method aims to detect in vitro cleavage of cellular mRNA by specific ribozymes (compared to control ribozyme cleavage performed in another aliquot of target cell mRNA) and detection of cleavage products by PCR amplification. Combining with cDNA technology (Clontech). SMART cDNA technology provides high-quality, double-stranded cDNA in high yield and nanogram total RN
This is a PCR-based method prepared from A or poly A + RNA. PolyA + RNA of PA1 cells was first cleaved with an in vitro transcribed RH1 ribozyme (P. Welch et al.
al., 1997), which was subsequently used as a template for SMART cDNA synthesis. The first strand reaction was primed with a modified oligo (dT) oligonucleotide,
Catalyzed by LV reverse transcriptase (Superscript, GIBCO BRL). When the enzyme reaches the 5'end of the cleaved (or uncleaved) mRNA, the terminal transferase activity of the enzyme adds a 3-5 deoxycytidine nucleotide to the 3'end of the first strand cDNA. 3'end of SMART oligonucleotide (
It contains a stretch of G residues) anneals with the C-rich motif to form an extended template. The reverse transcriptase then switches templates and replicates the oligonucleotide.

After ribonuclease treatment, the result is a single-stranded cDNA with a sequence complementary to the oligo (dT) primer at its 5'end and a sequence complementary to the SMART oligonucleotide at its 3'end. These sequences subsequently serve as priming sites for PCR amplification. In the case of ribozyme cleaved RNA fragments, the 3'binding sequence is CA generated by reverse transcription of mRNA ribozyme recognition triplet GUC.
It is right next to the G sequence. This sequence stretch corresponds to ribozyme helix 1
Together with the contiguous 8 bases of the construct a 14 base stretch specific for the substrate RNA molecule to be cleaved. The cDNA generated using this technique has the SMART sequence,
Amplification was carried out with an oligonucleotide primer that recognizes the binding C residue, the GTC site and the adjacent helix 1 of the ribozyme, and the unique portion of the oligo (dT) primer. Amplification product is RH
A comparison was made between 1-cut mRNA and control ribozyme-cut mRNA. Several bands specific for the RH1 ribozyme cleaved sample were recovered, cloned and sequenced (Figure 6).

One sequence of the SMARTC-SPACE band matched the sequence of breast basic conserved protein 1 (GenBank Accession No. X64707) in a 13/16 match at the target recognition site (scheme 2). This gene was first identified by differential screening of a human breast cancer cDNA library. The gene was found to be more abundant in fibroadenoma than in cancer. It encodes two potential nuclear localization signals. The protein encoded by this gene contains a 25 amino acid region showing strong similarity to the plant basic peptide P14 (P14 is a novel type of transcriptional activator). The gene is located on chromosome 16q24.3. The BBC1 message has been found to be downregulated in hormone refractory prostate cancer.

Schematic diagram 2. RH1 TST sequence (SEQ ID NO: 11) and BBC1 sequence (SEQ ID NO: 1)
Comparative RH1 5′-ATTG NGTC GCATCCGG-3 ′ BBC1 nt208-223 5′-GTCG GGTC CCATCCGG-3 ′ To confirm the involvement of BBC1 in the transcriptional regulation of BRCA-1, another ribozyme target GUC site was added to the BBC1 sequence. Identified and designed a target-validating ribozyme (
TV6-10, Table 7; SEQ ID NOS: 56 to 60, respectively). Retroviral vectors expressing target-validating ribozymes, prepared as above from individual target-validating ribozyme sequences, were tested in the SKHYTK4 hygromycin resistance assay as described above. Some of these target-validating ribozymes showed positive scores for hygromycin resistance, with TV9 showing the most prominent effect (cell number 20).
Doubled). Yet another target-validating ribozyme is shown in Figure 8 (SEQ ID NO: 1).
02 to 221).

[0155]

[Table 7] Table 7 Validated ribozyme gene sequence (SEQ ID NO :)   TV6 GGCTTCAA AGAA ATGC (16)   TV7 TGGGACCC AGAA CGGG (17)   TV8 CCGGATGG AGAA CGAC (18)   TV9 ACGTTCCG AGAA GGCA (19)   TV10 CCCAGCAT AGAA GCCC (20)

To directly measure the increased expression of BRCA-1 that results from repression of the transcription factor BBC1, real-time PCR was performed on RNA of cells in the presence and absence of repressive enzyme.
Real-time quantitative polymerase chain reaction (RT-PCR) is a reaction process that can determine the cellular levels of mRNAs encoding various proteins. To carry out RT-PCR, a special thermal cycler with three oligonucleotides based on the sequence of the mRNA in question and a fluorescence detection device is required. Two of these oligonucleotides function as primers, as in normal PCR. The third oligonucleotide functions as a "probe" and must match the sequence present between the two primers. Two groups are attached to this probe. The reporter dye is attached to the 5'end and the quencher is attached to the 3'end. When these two groups are in close proximity (as when they are attached to the two ends of the oligo)
, The fluorescence of the reporter dye is quenched by the quencher. In such an arrangement, the fluorescence detection device cannot detect any signal. However, during PCR, the probe anneals to the template between the two primers. The taq polymerase enzyme replicates the template from the primer so it travels on the probe. In addition to polymerase activity, taq also has 5'-3 'exonuclease activity. Thus, when the enzyme reaches the location on the template where the probe is annealed, the enzyme will displace the probe and cleave the probe from its 5'end. This releases the reporter dye from the oligonucleotide, thus allowing the reporter dye to diffuse from the quencher. Once the reporter dye is separated from the quencher, the fluorescence detector can detect the signal. This fluorescence reading is taken at the end of each PCR cycle. In this way, the detection device can determine the amount of probe destroyed during each cycle.
The amount of probe destroyed is directly proportional to the amount of template at the start of PCR. as a result,
The amount of mRNA encoding a protein can be determined for each test sample. BRCA-1mR
To determine NA levels, we use the following oligonucleotide sequences:
Forward primer: 5'-CTGCTCAGGGCTATCCTCTCA-3 'Reverse primer: 5'-TGCTGGAGCTTTATCAGGTTATGT-3' Probe: 5'-1TGACATTTTAACCACTCAGCAGAGGGATACCA2-3 'where 1 is a 6-FAM reporter dye and 2 is a TAMRA quencher ( SEQ ID NOs: 61 to 63, respectively). RT-P of mRNA extracted from cells transduced with TV9
CR analysis showed a 150% increase in BRCA-1 message compared to cells transduced with the control vector. This confirms the involvement of BBC1 in the observed phenotype and establishes a novel function of this gene as a transcriptional regulator of BRCA-1.

Yet another SMART C-SPACE product is CHLR2 (GenBank Accession No. U33834)
It was identified using a 12/16 match with (a partial sequence found in the database, said to be a helicase) (scheme 3). Validation of this sequence with a ribozyme targeting five additional GUCs (TV11-15, Table 8; SEQ ID NOs: 65-69) failed to show enhanced hygromycin resistance. This illustrates the requirement of the validation technique mentioned in this application to discriminate between some possible candidate genes. Schematic diagram 3. RH1 TST sequence (SEQ ID NO: 11) and CHLR2 sequence (SEQ ID NO: 64) and comparison of RH1 5 '-ATTG NGTC GCATCCGG-3 ' CHLR2 nt1621-1636 5 '-GGTG GGTC GCATCCTC-3'

[0158]

[Table 8] Table 8   Validated ribozyme gene sequence (SEQ ID NO :) TV11 CCGAGAGA AGAA AGCC (65) TV12 TGGTTGGA AGAA CCGA (66) TV13 GAGGATGC AGAA CCAC (67) TV14 AAGAAACA AGAA ACCC (68) TV15 TT.GGCCAG AGAA GGGG (69)

Example IV: Isolation and Characterization of Candidate BRCA-1 Regulator (BR1): This example describes the full length transcriptional regulator of a BRCA-1 nucleic acid molecule designated candidate BRCA1 regulator (BR1). Shows the isolation of the cDNA and its encoding polypeptide. A BLAST search of the E8T database with RH4 revealed a 15/16 match with an EST (GenBank Accession No. AA886839) that showed no similarity to known genes. RH4 TST and identified EST-derived sequences were 5'and 3
'Used as a primer for RACE and cloned a 2.9 kb cDNA (
(Fig. 7). This novel sequence was called the candidate BRCA-1 regulator (BR1). This array is
It has a 127 amino acid ORF with significant similarity to the elongation factor. However, the C-terminal domain of this ORF is not conserved. This may indicate a function of this gene in the translational regulation of BRCA-1 message. Interestingly,
The PTI-1 oncogene is truncated elongation factor 1a.

In order to confirm that BR1 is involved in the regulation of BRCA-1, another ribozyme target GUC site was identified in the BR1 sequence and a target-validating ribozyme was designed (TV
1-5, Table 9; SEQ ID NOs: 70 to 74, respectively). The retroviral vector prepared above from the individual target-validating ribozyme sequences was tested in the SKHYTK4 hygromycin resistance assay. Some of these target-validating ribozymes scored positive for enhanced hygromycin resistance, and TV3 showed a 17-fold increase in cell number. This supports the involvement of BR1 in the observed phenotype and establishes a novel function of this gene as a BRCA-1 regulator.

[0161]

[Table 9] Table 9     Validated ribozyme gene sequence (SEQ ID NO :)         TV1 TTGATGTG AGAA GCTT (70)         TV2 ACTTTTCT AGAA GGAA (71)         TV3 TATTCCAT AGAA ACTG (72)         TV4 AGGACTGG AGAA AGCC (73)         TV5 AACACATT AGAA TCAA (74)

Example V: Isolation and Characterization of the Repressor, Dominant Negative 4 (ID4): This example demonstrates the full-length transcriptional regulation of the BRCA-1 nucleic acid termed repressor, dominant negative 4 (ID4). The isolation of the factor cDNA and the encoding polypeptide is shown. RH5TST was identified by the BLAST search as the ID4 gene (GenBank accession number N
M_001546) and a 14/16 match was shown. ID4 is on chromosome 6p21.3-p22 / 6p22.3-p23
It is a known transcriptional repressor located at. It belongs to the repressor family of basic helix-loop-helix transcription factors. It interferes with transcriptional activity by forming dimers with transcription factors and preventing them from binding to DNA. They are known to be involved in the differentiation of adipocytes and neurons.

To demonstrate the involvement of ID4 in the regulation of BRCA-1, target-validating ribozymes (TV19-22, Table 10; SEQ ID NOs: 75-7 corresponding to the GUC site of the ID4 sequence).
8) was designed. Retroviral vectors made from individual target-validating ribozymes were introduced into the SKHYTK4 cell line and assayed for hygromycin resistance. The validated ribozyme, like the original RH5 ribozyme, failed to confer enhanced hygromycin resistance. The ID4 message was found to be undetectable in SKBR3 cells. The validated ribozyme was tested in soft agar using PA1 cells (PA1 cells
Expressing ID4). RH5 and some target-validated ribozymes reduced the anchorage-independent growth potential of these cells (58, 10 and 34% reduction for RH5, TV20 and TV21, respectively) and complete integrity of ID4 in PA1 cells. cDNA
Overexpression resulted in an increased anchorage-independent growth capacity of these cells,
Large colonies formed after a day. RT-PC of cells transduced with RH5 vector
The R analysis showed significant variation according to the test population. This may be due to complex feedback regulation.

[0164]

[Table 10] Table 10     Validated ribozyme gene sequence (SEQ ID NO :)         TV19 CAGTGGGC AGAA CTCA (75)         TV20 CAACAATT AGAA GGAG (76)         TV21 CACACCTG AGAA GCGC (77)         TV22 CGCGGCTG AGAA GGTC (78)

Yet another possible candidate sequence was identified using a 13/16 match with AF6 (
AF6 is a translocation breakpoint sequence found in AML (GenBank Accession No. NM005936)). Validation of this sequence with three additional ribozymes targeting the GUC site (TV23, 26, 27, Table 11; SEQ ID NOs: 79 to 81) showed enhanced hygromycin resistance and enhanced growth in soft agar. Was also not shown. This illustrates the requirement of the validation technique disclosed herein to discriminate between some possible candidate genes.

[0166]

[Table 11] Table 11     Validated ribozyme gene sequence (SEQ ID NO :)         TV23 GTACTAGA AGAA CGAA (79)         TV26 TGTGATCC AGAA AAGG (80)         TV27 GGTGGCCA AGAA GTGG (81)

Example VI: Isolation and Characterization of ESTs Corresponding to RH3: This example demonstrates the isolation of ESTs encoding TST-containing nucleic acids corresponding to RH3. The RH3 TST sequence was used as a primer for 5'RACE using standard methods. The resulting PCR product showed a 13/16 match with the database EST (GenBank Accession No. AL045940). Target verification of this EST was performed on 5 other GUC recognition sites (SEQ ID NOs: 82 to 86, respectively).

[0168]

[Table 12] Table 12     Validated ribozyme gene sequence (SEQ ID NO :)       TV28 AAAAATTA AGAA GTCA (82)       TV29 GCTGTCCT AGAA TCAA (83)       TV30 TGTCAAAG AGAA CACC (84)       TV31 TGCAATGA AGAA ACTG (85)       TV32 TTACAATA AGAA ACTT (86)

A second EST with a 14/15 match to RH3 was identified by database search (GenBank Accession No. AI668913). Target verification of this EST was performed on four additional GUC recognition sites (SEQ ID NOs: 87 to 91, respectively).

[0170]

[Table 13] Table 13     Validated ribozyme gene sequence (SEQ ID NO :)       TV33 TCCTTCCAAGAAACGC (87)       TV34 TTGGCCCTAGAATGAG (88)       TV35 TTTTTCTAAGAAGCCC (89)       TV36 TTGTCTCAGAATGCG (90)       TV37 ATCGTCAAAGAAATCA (91)

Example VII: Isolation and Characterization of ESTs Corresponding to RH6: ESTs with a 15/15 match to RH6 were identified by database search (GenBank Accession No. AI276397). Two available GUs in this array
Target-validated ribozymes generated against the C site (SEQ ID NOs: 92 and 9 respectively)
3) could not be confirmed by hygromycin resistance or soft agar assay, suggesting that the as yet unidentified gene is the true target required for the observed phenotype.

[0172]

[Table 14] Table 14     Validated ribozyme gene sequence (SEQ ID NO :)       TV16 CTATTTAA AGAA AATT (92)       TV17 TATTTCTT AGAA GTTC (93)

Example VIII: Expression of BBC1, BR1 and ID4 in human cell lines: Northern analysis of mRNA extracted from human ovarian cancer cell line PA1 and breast cancer cell lines MCF7 and SKBR3 identified as BRCA-1 gene Was determined. Total RNA was extracted from a cell culture grown in an 80% fusion state (confluency) using a ribonuclease kit (Qiagen). 15 μg of total RNA
It was denatured with 50% formamide, 17 mM MOPS, 2.2M formaldehyde for 15 minutes at 70 ° C. 2.2 Separation of the samples by electrophoresis in a 0.8% agarose gel containing 2M formamide and 20mM MOPS, followed by hybridization with a ³² P-labeled probe made from a plasmid encoding either BBC1, BR1 or ID4 Transferred to nylon membrane for. BBC1 and BR2 were found to be expressed in both PA1 and SKBR3 cells (not performed in MCF7 cells). ID
4 was found to be expressed in both PA1 and MCF7 cells and not in SKBR3 cells. To confirm this result, RT-PCR analysis was performed with higher sensitivity, so RT-PCR analysis was performed using total RNA. Again, ID4 is P
It was found to be expressed in both A1 and MCF7 cells, but not in SKBR3 cells. This explains the lack of action of the ribozyme targeting ID4 observed in the hygromycin resistance assay with SKBR3.

Example IX: Impact of ID4 overexpression: To demonstrate the biological relevance of ID4 regulation of BRCA-1 the ID4 sense and antisense expression vectors were transduced with retroviral vectors into P8R3 cells. Introduced. The cDNA sequence of ID4 was amplified using the following primers: ID4-3 (5 '
-TCCGAAGGGAGTGACTAGGACACCC-3 '; SEQ ID NO: 94) and ID4-7 (5'-TT)
CTGCTCTTCCCCCTCCCTCTCTA-3 '; SEQ ID NO: 95). The amplification product was cloned into the T / A-vector (Invitrogen) and confirmed by sequencing from both vector sites. Plasmid DNA was digested with EcoRI to release the complete insert from the cloning vector and the EcoRI linearized retroviral expression vector pLPCX (Clo
ntech). Clones were analyzed by multiple restriction digests for correct insertion and orientation. Vector-based primers 5- and 3-LP
Sequencing of both binding sites from both orientations using CX (Clontech) confirmed correct orientation and binding sequence. After stable integration, the anchorage-independent growth potential was examined by the soft agar assay described above. The biological consequence of BRCA-1 downregulation should be increased proliferation in soft agar and vice versa for BRCA-1 upregulation. Cells expressing sense ID4 showed a dramatic increase in anchorage-independent growth compared to cells expressing antisense ID4.

Example X: Detection of BRCA-1 Regulatory Pathway Genes: This example uses the BRCA-1 regulator ribozyme to detect ribozyme-mediated target RNA.
Required for the phenotypic changes observed after cleavage (ie, target “knockdown”),
Methods for identifying other genes in the BRCA-1 pathway are provided. The expression profile of the gene in the hybridization assay identifies cellular genes that are up- or down-regulated following BRCA-1 regulator knockdown. Such genes constitute potential BRCA-1 regulators.

RNA extracted from cells expressing the ribozymes RH1, RH3, RH4, RH5 and RH6 were successively hybridized to an array filter. Probes, filters and analyzes were according to manufacturer's recommendations (Research Genetics, Hunts
ville AL). Briefly, 10 μg of total RNA obtained from a cell population transduced with each ribozyme or control was primed with oligo dT and further reverse transcriptase (Superscript II Life Technologies) while incorporating ³³ P-labeled dCTP.
, Gaithersburg MD) was used to prepare a detectable cDNA probe by reverse transcription. The denatured probe was hybridized to the filter in the supplied buffer for 18 hours at 42 ° C. The filters were washed twice in 2 × SSC, 1% SDS at 50 ° C. (20 minutes each), followed by 0.5 × SSC, 1% SDS for 15 minutes at room temperature. Expose this filter to a phosphor imaging screen to remove morphic dynamics (Mo
Images were captured using a lecular Dynamics; Sunnyvale, CA) phosphor imaging system. Pathways (registered trademark) analysis software (Research Genetics, Huntsvill
e AL) was used to compare between filters.

The expression profile was compared to the pattern created by hybridizing the filter with RNA extracted from cells expressing the control ribozyme.
Some genes were found to be downregulated in some or all ribozyme expression profiles. From the expression pattern, it is possible to confirm the pathway of genes that are differentially expressed. Many genes were differentially expressed in ribozyme-expressing cells at higher levels than in control cells.

1. AA419229: ESTs that share sequence identity with orphan GPR39. AF034633.1-Homo sapiens orphan G protein-coupled receptor (GPR39) mRNA, complete cds B. 4504096-Homo sapiens G protein-coupled receptor 39 (GPR
39) mRNA and translation products C. Protein: O43194-human hypothetical G protein-coupled receptor 39 D. Protein: 4504097-G protein-coupled receptor 39

2. H18950: EST A. which shares sequence identity with NADC3. AF154121.1-Homosapiens sodium dependent high affinity dicarboxylate transporter (NADC3) mRNA, complete cds

3. H07920: EST A. that shares sequence identity with MKK6. XM_012648.1-Homo sapiens mitogen activated protein kinase kinase 6 (MAP2K6), mRNA B. NM_002758.1-Homo sapiens mitogen activated protein kinase kinase 6 (MAP2K6), mRNA C.I. U39657.1-human MAP kinase kinase 6 (MKK6) mRNA, complete c
ds

4. H70047: EST A. which shares sequence identity with RGS13. AF030107-Regulator of G protein signaling in Homo sapiens (R
GS13) mRNA, complete cds 5. H84815: EST A. which shares sequence identity with Rab9 effector p40. BC000503-Homo sapiens, Rab9 effector p40, MGC: 8
459, mRNA, complete cds B. NM_005833.1-Homo sapiens Rab9 effector p40 (RAB9
P40), mRNA C. Z97074.1-Homo sapiens Rab9 effector p40 mRNA, complete cds

6. AA757764: ESTs that share sequence identity with multi-Zn-finger TF. Homo sapiens mRNA for D49835-DNA-binding protein, complete c
ds 7. H19111: EST sharing sequence identity with sialyltransferase

8. AA629897: EST A. that shares sequence identity with the laminin receptor. M14199.1-human laminin receptor (2H5 epitope) mRNA, 5 '
Terminal B. BC002533-Homo sapiens, laminin receptor 1 (67 kD, ribosomal protein SA), clone MGC: 2208, mRNA, complete cds C. NM_002295.2-Homo Sapiens Laminin Receptor 1 (67kD,
Ribosomal protein SA) (LAMR1), mRNA

9. AA663439: EST A. that shares sequence identity with adenine nucleotide translocator 3 J03592.1-Human ADP / ATP transferase mRNA, 3'end, clone pH
AT8 B. AF076617-Homo sapiens ADP / ATP transferase mRNA, 3'UTR C. L29034.1-Human mitochondria (clone GC6-T5) ADP / AT
P-transposase gene sequence

10. R15740: EST that shares sequence identity with chondroitin-6-sulfotransferase. XM_012024.1-Homo sapiens carbohydrate (chondroitin 6 / keratan) sulfotransferase 1 (CHST1), mRNA B. NM_003654.1-Homo sapiens carbohydrate (chondroitin 6 / keratan) sulfotransferase 1 (CHST1), mRNA C.I. U65637.1-Homosapiens chondroitin-6-sulfotransferase mRNA, complete cds

11. AA454570: EST A. which shares sequence identity with lambda 5 semaphorin. U38276.1-human semaphorin III family homolog mRNA, complete cd
s 12. AA485748: EST A. which shares sequence identity with fibromodurin. XM_001782. 2-Homo sapiens fibromodurin (FMOD), mRNA B. NM_002023.2-Homo sapiens fibromodurin (FMOD), mRNA

13. AA464601: EST A. that shares sequence identity with tspan-5. AF065389-Homo sapiens tetraspan NET-4 mRNA, complete cds B. AF053455-Homo Sapiens Tetraspan TM4SF (TSPAN-5)
Gene, complete cds C. NM_005723.1-Homo sapiens tetraspan 5 (TSPAN-5), mRN
A.D. XM_011178.1-Homo Sapiens Tetraspan 5 (Homo Sapiens) (L
OC65435), mRNA

[0188] 14. AA102107: EST sharing sequence identity with aminopeptidase A     A. L12468.1-Homo sapiens aminopeptidase A mRNA, complete cds   15. Z49826: HSHNF4G hepatocyte nuclear factor 4 gamma

Ribozymes can be designed according to the methods disclosed above to target cleavage sites within the 15 genes described above, demonstrating that the genes are BRCA-1 modulators. Potential cleavage TST target sequences and ribozyme substrate recognition sites for cleaving these TST target sequences are shown in Tables 15-17 below.

[0190]

[Table 15] Table 15: Validated RST and TST sequences for GenBank accession number H07920     Validated ribozyme RST TST Target sequence 3'-AAGG UCAG ACAAAACG-5 '5'-TTCC AGTC TGTTTTGC-3'     (SEQ ID NO :) (SEQ ID NO :) 3'-GUAG CCAG UUCUCUUU-5 '5'-CATC GGTC AAGAGAAA-3'     (SEQ ID NO :) (SEQ ID NO :) 3'-CUUG ACAG AUCUACCU-5 '5'-GAAC TGTC TAGATGGA-3'     (SEQ ID NO :) (SEQ ID NO :)

[0191]

[Table 16] Table 16: Validated RST and TST sequences for GenBank accession number AA419229     Validated ribozyme RST TST Target sequence 5'-AGUG UCAG UACAGGGG-3 '5'-TCAC AGTC ATGTCCCC-3'     (SEQ ID NO :) (SEQ ID NO :) 3'-GGGG UCAG AUUCAGGG-5 '5'-CCCC AGTC TAAGTCCC-3'       (SEQ ID NO :) (SEQ ID NO :) 3'-UAAC UCAG AGCUCAGU-5 '5'-ATTG AGTC TCGAGTCA-3'       (SEQ ID NO :) (SEQ ID NO :)

[0192]

Table 17: Validated RST and TST sequences for GenBank accession number Z49826 Validated ribozyme RST TST target sequence 5'-UCGG UCAG ACUCUAUA-3 '5'-AGCC AGTC TGAGATAT-3' (SEQ ID NO :) ( SEQ ID NO :) 3'-UGCC ACAG UUGACAGA-5 '5'-ACGG TGTC AACTGTCT-3
'(SEQ ID NO :) (SEQ ID NO :) 3'-GGUC CCAG UUCGUGAC-5'5'-CCTG GGTC AAGCACTG-3
'(SEQ ID NO :) (SEQ ID NO :) 3'-ACCG UCAG UAGAGGUA-5'5'-TGGC AGTC ATCTCCAT-3
'(SEQ ID NO :) (SEQ ID NO :) 3'-GUAG UCAG UAAAGUGU-5'5'-CATC AGTC ATTTCACA-3
'(Sequence number :) (Sequence number :)

Throughout this application, various publications are referenced in parentheses. These publications are hereby incorporated by reference in their entirety in order to more fully describe the state of the art to which this invention belongs. Although the present invention has been described with reference to embodiments, those skilled in the art will readily appreciate that the specific experiments described in detail are merely illustrative of the invention. It will be appreciated that various modifications can be made without departing from the scope of the invention. Therefore,
The invention is limited only by the claims.

[Brief description of drawings]

FIG. 1 shows the hairpin ribozyme and substrate RNA (SEQ ID NOs: 3 and 99).
).

FIG. 2 shows an alignment of (a) nucleic acid sequences and (b) amino acid sequences of BR1 (SEQ ID NOs: 1 and 2, respectively) and Thema EFG (SEQ ID NOs: 96 and 97, respectively).

[Figure 3]   FIG. 3 shows several cell sortings for sorting cells with increased EGFP expression.

[Figure 4]   FIG. 4 shows EGFP-expressing cells enriched after several rounds of cell sorting.

[Figure 5]   FIG. 5 shows RNA expression levels after carrying out cell sorting 5 times.

[Figure 6]   FIG. 6 shows a schematic diagram of a method for amplifying DNA corresponding to the TST sequence.

FIG. 7 shows RST for BR1 and several binding sites for RST of BR1 (
SEQ ID NOs: 100 and 101, respectively).

[Figure 8]   FIG. 8 shows the verified ribozyme sequence (SEQ ID NOs: 102 to 221).

FIG. 9 shows the nucleic acid sequence of BR1 (SEQ ID NO: 1) and the predicted translated polypeptide sequence (SEQ ID NOS: 2 and 222-231).

─────────────────────────────────────────────────── ─── Continuation of front page (51) Int.Cl. ⁷ Identification code FI theme code (reference) C12N 9/00 C12Q 1/02 4H045 C12Q 1/02 1/37 1/37 1/48 Z 1/48 1 / 68 A 1/68 C12N 15/00 ZNAA (81) Designated country EP (AT, BE, CH, CY, DE, DK, ES, FI, FR, GB, GR, IE, IT, LU, MC, NL , PT, SE, TR), OA (BF, BJ, CF, CG, CI, CM, GA, GN, GW, ML, MR, NE, SN, TD, TG), AP (GH, GM, KE, LS, MW, MZ, SD, SL, SZ, TZ, UG, ZW), EA (AM, AZ, BY, KG, KZ, MD, RU, TJ, TM), AE, AG, AL, AM, AT, AU, Z, BA, BB, BG, BR, BY, CA, CH, CN, CO, CR, CU, CZ, DE, DK, DM, DZ, EE, ES, FI, GB, GD, GE, GH, GM , HR, HU, ID, IL, IN, IS, JP, KE, KG, KP, KR, KZ, LC, LK, LR, LS, LT, LU, LV, MA, MD, MG, MK, MN, MW, MX, MZ, NO, NZ, PL, PT, RO, RU, SD, SE, SG, SI, SK, SL, TJ, TM, TR, TT, TZ, UA, UG, US, UZ, VN , YU, ZA, ZW (72) Inventor Barber Jack United States California 92129 San Diego Charlottes Treats 11168 (72) Inventor Wong-Star Flossy United States California 92130 San Diego Monterey Ipuresu Way 12737 F-term (reference) 4B024 AA01 AA11 BA07 BA80 CA01 CA09 CA12 DA02 EA02 EA04 FA02 GA11 HA11 HA12 4B050 CC01 CC03 CC04 DD20 LL01 LL03 4B063 QA01 QA18 QA19 QQ08 QQ13 QQ27 QQ36 QQ42 QQ52 QR07 QR08 QR16 QR33 QR42 QR55 QR59 QR62 QR77 QR80 QR82 QS05 QS25 QS26 QS34 QS36 QX02 4C084 AA13 NA14 ZB26 4C086 AA01 AA04 EA16 MA01 MA04 NA14 ZB26 4H045 AA10 BA10 CA40 DA00 EA20 EA50 FA72 FA74

Claims (42)

[Claims] 1. A substantially pure nucleic acid comprising SEQ ID NO: 1 and a nucleotide sequence having 60% or more sequence identity with SEQ ID NO: 1, or a complementary sequence thereof. 2. The substantially pure nucleic acid of claim 1, wherein said nucleotide sequence comprises SEQ ID NO: 1. 3. A substantially pure nucleic acid comprising at least 16 nucleotides in length or its complementary sequence, selected from SEQ ID NO: 1 or a nucleotide sequence having a sequence identity of 60% or more with SEQ ID NO: 1. . 4. The substantially pure nucleic acid of claim 3, wherein said sequence is selected from SEQ ID NO: 1. 5. Substantially comprising at least 18 nucleotides in length, or a complementary sequence thereof, selected from SEQ ID NO: 1 and from nucleotide sequences having a sequence identity of 60% or more with SEQ ID NO: 1. Pure nucleic acid. 6. The substantially pure nucleic acid of claim 5, wherein said sequence is selected from SEQ ID NO: 1. 7. Selected from SEQ ID NO: 1 or SEQ ID NOS: 1 and 60
A substantially pure nucleic acid comprising at least 20 nucleotides in length, or a complementary sequence thereof, selected from nucleotide sequences having% or more sequence identity. 8. The substantially pure nucleic acid of claim 7, wherein said sequence is selected from SEQ ID NO: 1. 9. BR1 (SEQ ID NO: 1), ID4 (GenBank accession number NM
_001547), BBC1 (GenBank accession number X64707), RH3 (GenBank accession number AL045940), and RH6 (GenBank accession number AI27).
6397), GenBank accession number AA419229, GenBank accession number H189.
50, GenBank accession number H07920, GenBank accession number H70047, Ge
nBank accession number H84815, GenBank accession number AA757764, GenBan
k Accession number H19111, GenBank accession number AA629897, GenBank accession number AA663439, GenBank accession number R15740, GenBank accession number AA454570, GenBank accession number AA485748, GenBank accession number AA464601, GenBank accession number AA102107: and GenBank A ribozyme comprising a target recognition sequence that selectively hybridizes to an RNA target selected from the group consisting of accession number Z49826, wherein said hybridization results in the cleavage of said RNA target. Wherein said target recognition sequence is SEQ ribozyme of claim 9 including the N ₈ -AGAA-N _4. 11. segment, ribozyme of claim 10 10 to 12 nucleotides with the N ₈ and N ₈ is complementary to the target RNA. 12. The ribozyme of claim 10, wherein the target recognition sequence is selected from the group consisting of: 5'-CCGGAUGCAGAACAAU-3 ', 5'-AGUACAUUAGAAUACU-3', 5'-CUAGUGAGAGAAGGGA-.
3 ', 5'-UGAGAUCCAGAAAAGC-3', 5'-UGUUACUAGAAUGUU-3 ', and 5'-CCCUAUUUA
GAAUUGU-3 '(SEQ ID NOS: 5-10, respectively). 13. A substantially pure nucleic acid target sequence tag recognized by a ribozyme selected from the group consisting of: 5'-AUUGNGUCGCAUCCGG-3 ', 5'-AGUANGUCAAUGUACU-3', 5'-UCCCNGUCCUCACUAG-.
3 ', 5'-GCUUNGUCGGAUCUCA-3', 5'-AACANGUCAGUAACA-3 ', 5'-ACAANGUCAAAUAGG
G-3 ′ (respectively SEQ ID NO: 11-16), or its complementary sequence. 14. A ribozyme target recognition sequence selected from the group consisting of: 5'-CCGGAUGCAGAACAAU-3 ', 5'-AGUACAUUAGAAUACU-3', 5'-CUAGUGAGAGAAGGGA-.
3 ', 5'-UGAGAUCCAGAAAAGC-3', 5'-UGUUACUAGAAUGUU-3 ', and 5'-CCCUAUUUA
GAAUUGU-3 '(SEQ ID NO: 5-10, respectively), or its complementary sequence. 15. A substantially pure poly that regulates the expression level of BRCA-1 comprising an amino acid sequence represented by SEQ ID NO: 2 or an amino acid sequence having 50% or more sequence identity with SEQ ID NO: 2. peptide. 16. The substantially pure polypeptide of claim 15, wherein the amino acid sequence is the amino acid sequence set forth in SEQ ID NO: 2. 17. A method for identifying a candidate gene whose expression level is affected by a BRCA-1 regulatory factor, comprising the steps of: a) at least one candidate gene for the first mRNA and the second mRNA or its In the step of hybridizing with a portion, the first mRNA is obtained from cells expressing a ribozyme that targets and cleaves the mRNA encoding the BRCA-1 regulatory factor, and further The second mRNA is obtained from a control cell similar to the cell expressing the ribozyme except that the BRCA-1 regulatory factor mRNA is not targeted by the ribozyme; and b). The relative amounts of the first and second mRNAs that hybridize to the gene are compared, and due to the difference in the relative amounts of hybridization, the expression level of BRCA-1 is regulated by the BRCA-1 regulatory factor. The process of identifying genes that are affected. 18. The first and second mRNAs are prior to hybridization
18. The method of claim 17, wherein the method is reverse transcribed into DNA. 19. The method of claim 17, wherein the first and second mRNAs or the gene are labeled with a detectable moiety. 20. The method of claim 19, wherein the detectable moiety is a fluorescent dye. 21. The method of claim 17, wherein two or more genes are hybridized with the first and second mRNAs. 22. The method of claim 21, wherein two or more genes are placed on the solid support prior to hybridization. 23. The BRCA-1 regulator is selected from the group consisting of:
Method 7: BR1 (SEQ ID NO: 1), ID4 (GenBank Accession No. NM_001547
), BBC1 (GenBank accession number X64707), BR2 (GenBank accession number AL045940) and BR3 (GenBank accession number AI276397). 24. The BRCA-1 regulator is selected from the group consisting of:
Method 7: GenBank Accession No. AA419229, GenBank Accession No. H1
8950, GenBank accession number H07920, GenBank accession number H70047,
GenBank accession number H84815, GenBank accession number AA757764, GenB
ank accession number H19111, GenBank accession number AA629897, GenBank
Accession number AA663439, GenBank accession number R15740, GenBank accession number AA454570, GenBank accession number AA485748, GenBank accession number AA464601, GenBank accession number AA102107: and GenBank accession number Z49826. 25. A method of identifying a compound that modulates the activity of a BRCA-1 regulator, comprising contacting the BRCA-1 regulator with a test compound and a target molecule responsive to BRCA-1 regulator activity, the test compound Identifying a compound that modulates the activity of a BRCA-1 regulator by increasing or decreasing the activity of the BRCA-1 regulator against said target molecule in the presence of a test compound as compared to the absence thereof. 26. The method of claim 25, wherein the test compound is a compound that increases the activity of a BRCA-1 regulator. 27. The method of claim 25, wherein the test compound is a compound that reduces the activity of a BRCA-1 regulator. 28. The BRCA-1 regulator is selected from the group consisting of:
Method 5: BR1 (SEQ ID NO: 1), ID4 (GenBank accession number NM_001547
), BBC1 (GenBank accession number X64707), BR2 (GenBank accession number AL045940) and BR3 (GenBank accession number AI276397). 29. The BRCA-1 regulator is selected from the group consisting of:
Method 5: GenBank Accession No. AA419229, GenBank Accession No. H1
8950, GenBank accession number H07920, GenBank accession number H70047,
GenBank accession number H84815, GenBank accession number AA757764, GenB
ank accession number H19111, GenBank accession number AA629897, GenBank
Accession number AA663439, GenBank accession number R15740, GenBank accession number AA454570, GenBank accession number AA485748, GenBank accession number AA464601, GenBank accession number AA102107: and GenBank accession number Z49826. 30. The method of claim 25, wherein the BRCA-1 regulator activity is DNA binding activity. 31. The method of claim 25, wherein the activity measured is the expression of a nucleic acid component or gene via a functional linkage with a reporter gene. 32. The method of claim 25, wherein the BRCA-1 regulator activity is protein kinase activity. 33. The method of claim 25, wherein the BRCA-1 regulator activity is GTP binding activity. 34. The BRCA-1 regulatory factor activity is a protease activity.
the method of. 35. The BRCA-1 regulatory factor activity is a protein binding activity.
Method 5 36. The BRCA-1 regulatory factor activity is hormone binding activity.
the method of. 37. Treating a cancer comprising contacting a cancer cell with an expression vector encoding a ribozyme that selectively reacts with RNA encoding a BRCA-1 regulator, or contacting a cancer cell with the ribozyme. A method of treating the cancer wherein the BRCA-1 regulator is selected from the group consisting of: BR1 (SEQ ID NO:
1), ID4 (GenBank accession number NM_001547), BBC1 (GenBank accession number X64707), BR2 (GenBank accession number AL045940) and BR3 (
GenBank accession number AI276397). 38. The BRCA-1 regulator is selected from the group consisting of:
Method 7: GenBank Accession No. AA419229, GenBank Accession No. H1
8950, GenBank accession number H07920, GenBank accession number H70047,
GenBank accession number H84815, GenBank accession number AA757764, GenB
ank accession number H19111, GenBank accession number AA629897, GenBank
Accession number AA663439, GenBank accession number R15740, GenBank accession number AA454570, GenBank accession number AA485748, GenBank accession number AA464601, GenBank accession number AA102107: and GenBank accession number Z49826. 39. The method of claim 37, wherein the ribozyme comprises a target recognition sequence selected from the group consisting of: 5'-CCGGAUGCAGAACAAU-3 ', 5'-AGUACAUUAGAAUACU-3', 5'-CUAGUGAGAGAAGGGA-3.
', 5'-UGAGAUCCAGAAAAGC-3', 5'-UGUUACUAGAAUGUU-3 ', and 5'-CCCUAUUUAG
AAUUGU-3 '(SEQ ID NOS: 5-10, respectively). 40. A method for detecting neoplastic cells in a sample, comprising the following (a) and (b), wherein the neoplastic cells contain a BRCA-1 regulatory factor compared to normal cells. The method for detecting neoplastic cells accompanied by a change in expression or a change in BRCA-1 structure: (a) a sample as a detection agent specific to a BRCA-1 regulatory factor nucleic acid or an encoded BRCA-1 regulatory factor polypeptide Contacting; and (b) detecting the nucleic acid or polypeptide in the sample, wherein the change in expression or structure of the polypeptide indicates the presence of neoplastic cells in the sample. Process. 41. The BRCA-1 regulator is selected from the group consisting of:
Method 0: BR1 (SEQ ID NO: 1), ID4 (GenBank Accession No. NM_001547
), BBC1 (GenBank accession number X64707), BR2 (GenBank accession number AL045940) and BR3 (GenBank accession number AI276397). 42. The BRCA-1 regulator is selected from the group consisting of:
Method 1: GenBank accession number AA419229, GenBank accession number H1
8950, GenBank accession number H07920, GenBank accession number H70047,
GenBank accession number H84815, GenBank accession number AA757764, GenB
ank accession number H19111, GenBank accession number AA629897, GenBank
Accession number AA663439, GenBank accession number R15740, GenBank accession number AA454570, GenBank accession number AA485748, GenBank accession number AA464601, GenBank accession number AA102107: and GenBank accession number Z49826.