JP2003294734A - Analysis method of intermolecular interaction - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a method of simply and visually detecting an interaction between a target protein mode expressed within an eucaryotic cell and a sub stance to be measured. <P>SOLUTION: The method for analyzing the interaction between a protein and a molecule measures a fluorescent light resulting from a fluorescence resonance energy transfer occurring between two types of fluorescent proteins by making a protein labelled with a first fluorescent protein and a molecule labelled with a second fluorescent protein interact within an eucaryotic cell. <P>COPYRIGHT: (C)2004,JPO

Description

Detailed Description of the Invention

[0001]

TECHNICAL FIELD The present invention relates to a method for analyzing an interaction between a protein and a molecule using fluorescence resonance energy transfer. More specifically, the present invention relates to a protein and a molecule characterized by measuring the fluorescence generated by fluorescence resonance energy transfer by allowing a protein and a molecule each labeled with different fluorescent fluorescent proteins to interact in a eukaryotic cell. The method of analyzing the interactions of

[0002]

2. Description of the Related Art The production of heterologous proteins using gene recombination technology is used in various industries, and E. coli, yeast, insect cells, animal cells, etc. are mainly used as hosts. In order to produce a heterologous protein, particularly a protein derived from eukaryote in a form retaining its physiological activity, it is considered preferable to use a eukaryotic microorganism as a host. Among them, a large-scale culture method has been established for yeast, and expression systems using various yeasts as hosts have been developed so far. When yeast is used as a host, post-translational modifications such as acetylation, phosphorylation and sugar chain addition of the produced protein are considered to be similar to those in animal cells. Therefore, it is advantageous to use a heterologous protein production method using yeast as a host for expressing a protein derived from animal cells. On the other hand, the method using prokaryotes such as Escherichia coli is not always effective for all proteins, and complicated post-translational modification of proteins derived from eukaryote or reproduction of the same three-dimensional structure as natural body is not possible. It's not always easy.

When screening a substance that interacts with a certain target protein, the target protein is expressed in a form that retains its physiological activity, and a substance that interacts with the target protein even if contacted with a test substance is selected. It is necessary to choose. As described above, in order to produce a protein derived from a eukaryote in a form retaining its physiological activity, it is generally expressed in a eukaryotic microbial host.
To screen substances that interact with the target protein, we established a method to easily analyze the interaction that occurs when the test substance is contacted with the target protein expressed in eukaryotic cells as described above. It is necessary to.

[0004]

DISCLOSURE OF THE INVENTION It is an object of the present invention to provide a method for simply and visually detecting the interaction between a test substance and a target protein expressed in eukaryotic cells. . In particular, the present invention has an object to provide a method for easily detecting the interaction between a test substance and a membrane protein expressed in eukaryotic cells. The present invention further provides a method for searching for a molecule that interacts with a target protein by establishing a method for detecting the interaction between a target protein expressed in eukaryotic cells and a test substance. It should be an issue.

[0005]

[Means for Solving the Problems] As a result of intensive studies for solving the above problems, the present inventors have found that a target protein labeled with a first fluorescent protein is secondarily fluorescent in a eukaryotic cell expressing intracellularly. The target protein is introduced by introducing a molecule labeled with a protein, allowing the target protein to interact with the molecule in the cell, and measuring fluorescence generated by fluorescence resonance energy transfer between the two types of fluorescent proteins. It was found that the interaction between the molecule and the molecule could be detected. The present invention has been completed based on this finding.

That is, according to the present invention, in a method for analyzing the interaction between a protein and a molecule, a protein labeled with a first fluorescent protein and a molecule labeled with a second fluorescent protein are introduced in a eukaryotic cell. Provided is a method as described above, which comprises interacting and measuring fluorescence generated by fluorescence resonance energy transfer occurring between the two types of fluorescent proteins.

Preferably, the protein labeled with the first fluorescent protein is immobilized on the cell membrane. Preferably, the protein labeled with the first fluorescent protein is immobilized on the cytoplasmic side of the cell membrane. Preferably, the protein labeled with the first fluorescent protein is immobilized on the cell membrane via an anchor for anchoring the cell membrane. Preferably, the eukaryotic cell is yeast. Preferably, the SNC is used as an anchor for cell membrane fixation.
Single carboxyl-terminal transmembrane domain (CTM) from two gene products or carboxyl-terminal prenylation and palmitoylation motifs (Cp) from RAS2 gene product
r) is used.

[0008] Preferably, the protein labeled with the first fluorescent protein is protein A. Preferably, the molecule labeled with the second fluorescent protein is a protein, an antibody, a low molecular weight compound or a library thereof. Preferably, the molecule labeled with the second fluorescent protein is the expression product of a gene or gene library.

According to another aspect of the present invention, a gene capable of expressing the protein labeled with the second fluorescent protein is introduced into cells having the target protein labeled with the first fluorescent protein, and the above-mentioned 2 Provided is a method of searching for a gene encoding a protein that interacts with a target protein, which comprises identifying a gene that causes fluorescence resonance energy transfer to occur between different types of fluorescent proteins.

According to still another aspect of the present invention, a molecule labeled with a second fluorescent protein is introduced into a cell having a target protein labeled with a first fluorescent protein, and the molecule between the two types of fluorescent proteins is introduced. A method of searching for a molecule that interacts with a target protein is provided that includes identifying a molecule that causes fluorescence resonance energy transfer to occur in S.

In the present invention, as a cell having a target protein labeled with the first fluorescent protein, a cell library in which each cell has a different target protein can be used. Preferably, the fluorescent protein is cyan fluorescent protein, yellow fluorescent protein, green protein, red fluorescent protein, blue fluorescent protein, or variants thereof.

[0012]

BEST MODE FOR CARRYING OUT THE INVENTION Embodiments of the present invention will be described in detail below. The present invention relates to a method for analyzing an interaction between a protein and a molecule, wherein a protein labeled with a first fluorescent protein and a molecule labeled with a second fluorescent protein are allowed to interact in a eukaryotic cell, In the method, fluorescence generated by fluorescence resonance energy transfer occurring between the two types of fluorescent proteins is measured.

In the present invention, fluorescent proteins having two different fluorescent wavelengths are used, and the fluorescence generated by the fluorescence resonance energy transfer occurring between these fluorescent proteins is measured. The type of fluorescent protein used in the present invention is not particularly limited, but examples thereof include cyan fluorescent protein (CFP), yellow fluorescent protein (YEP), green protein (GFP), red fluorescent protein (REP), and blue fluorescent protein. (BFP) or variants thereof and the like.

As used herein, cyan fluorescent protein, yellow fluorescent protein, green protein, red fluorescent protein, blue fluorescent protein or mutants thereof are not only known fluorescent proteins but also mutants thereof (for example, ECFP, EYFP, EGFP, which enhances the fluorescence intensity of the above-mentioned fluorescent protein,
(ERFP, EBFP, etc.). For example, the green fluorescent protein gene has been isolated and sequenced (Prasher, DC. Et al. (1992), "Primary stru.
cture of the Aequorea victoria green fluorescent p
rotein ", Gene 111: 229-233). Many amino acid sequences of other fluorescent proteins or mutants thereof have been reported, for example, Roger Y. Tsin, Annu. Rev. Biochem. 1998. 67: 509-.
44, as well as references cited therein. Examples of green fluorescent protein (GFP), yellow fluorescent protein (YFP) or their variants include, for example, Aequorea jellyfish (eg,
Those derived from Aequorea victoria can be used.

Examples of GFP, YFP and variants thereof are shown below, but the invention is not limited thereto. Note that the expression F99S indicates that the 99th amino acid residue has been replaced with F to S, and other amino acid substitutions are also shown according to the similar display. Wild type GFP; GFP having amino acid mutation of F99S, M153T, V163A; GFP having amino acid mutation of S65T; GFP having amino acid mutation of F64L, S65T; S65T, S72A, N149K, M15
GFP having amino acid mutations of 3T and I167T; S2
02F, GFP having T203I amino acid mutation; T
203I, S72A, GFP having amino acid mutations of Y145F; S65G, S72A, GFP (YFP) having amino acid mutations of T203F; S65G, S72A,
GFP (YFP) having an amino acid mutation of T203H;
S65G, V68L, Q69K, S72A, T203Y
Of GFP (EYFP-V68L,
Q69K); S65G, S72A, GFP having an amino acid mutation of T203Y (EYFP); S65G, S72
A, K79R, GF having amino acid mutations of T203Y
P (YFP);

The nucleotide sequence of the gene encoding the fluorescent protein used in the present invention is known. A commercially available gene may be used as the gene encoding the fluorescent protein. For example, EGFP vector, EYFP vector, ECFP vector, EBFP, which are commercially available from Clontech.
Vectors and the like can be used.

In the present invention, first, a protein labeled with a first fluorescent protein and a molecule labeled with a second fluorescent protein are introduced into a eukaryotic cell. The method of introducing the protein or molecule into the cell is not particularly limited, and it may be directly taken up into the cell, or in the case of a protein, the gene encoding it may be introduced into the cell and the gene may be introduced into the cell. The target protein may be produced intracellularly by being expressed.

According to a preferred embodiment of the present invention, the protein labeled with the first fluorescent protein is immobilized on the cell membrane, more preferably on the cytoplasmic side of the cell membrane, particularly preferably. , Is immobilized on the cell membrane via a cell membrane anchor. In order to immobilize the protein on the cell membrane in such a state, it is preferable to express the protein intracellularly in a form of being fused with a fluorescent protein using a suitable expression vector selected according to the type of host. . For example, when yeast is used in the present invention, the protein labeled with the first fluorescent protein is used as an anchor for cell membrane anchoring, as a single carboxyl terminal transmembrane domain (CTM) derived from the SNC2 gene product or a carboxyl derived from the RAS2 gene product. Terminal prenylation and palmitoylation motifs (Cpr) can be used to immobilize on yeast cell membranes.

According to a preferred embodiment of the present invention, the protein labeled with the first fluorescent protein is protein A.
Protein A is a gram-positive bacterium Staphylococcus aureu
s (Staphylococcus aureus) is a protein having a molecular weight of about 42,000 that occupies 5% of cell wall components and specifically binds to the Fc fragment of immunoglobulin G (IgG) of human, mouse, rabbit and the like. By presenting this protein A in cells, it becomes possible to screen a novel functional molecule using a combinatorial antibody library or the like.

In the present invention, not only the case where the full-length gene of protein A is used, but a gene encoding a fragment of protein A may be used. The protein A fragment preferably contains a portion having an affinity for the Fc portion of IgG.

The type of expression vector used in the present invention is not particularly limited as long as it can express the target gene in the eukaryotic cell used. When yeast is used as a eukaryotic cell, an expression vector for yeast can be used.
Preferable examples of the expression vector for yeast include pI
CAS1 (Murai et al., Appl.Environ. Microbiol.,
64, 4857-4861 (1998)), pCAS1 (Murai et al.,
Appl. Environ. Microbiol., 64, 4857-4861 (1998)) and the like.

The expression vector used in the present invention usually contains a promoter. The promoter is not particularly limited as long as it is a promoter usually used for expression in yeast, but a preferable example thereof is a promoter (Sawani-) of glyceraldehyde triphosphate dehydrogenase (GAPDH) of Saccharomyces cerevisiae. Hatanaka, H., T. et al., Biosci. Biotec
hnol. Biochem., 59,1221-1228 (1995)), promoter of isocitrate lyase (ICL) of Candida tropicalis (UPR-ICL).
(Kanai et al., Appl. Microbiol. Biotechnology, 44,
759-765 (1996)) and the like.

Further, as described above, the expression vector used in the present invention has an SNC as an anchor sequence for cell membrane fixation.
Single carboxyl-terminal transmembrane domain (CTM) from two gene products or carboxyl-terminal prenylation and palmitoylation motifs (Cp) from RAS2 gene product
It is preferred to include r).

In a preferred embodiment of the expression vector used in the present invention, a promoter and DN encoding protein A are used.
It has A, a DNA encoding a fluorescent protein, and an anchor sequence for anchoring the cell membrane in this order. In another preferred embodiment of the expression vector used in the present invention, a promoter,
It has a fluorescent protein-encoding DNA, a protein A-encoding DNA, and a cell membrane anchoring sequence in this order. In addition, a linker sequence may be present between each sequence. Further, the expression vector used in the present invention may contain a selection marker gene such as an antibiotic resistance gene. Construction of such a recombinant expression vector can be carried out according to a usual recombinant gene technique including amplification of a gene fragment by the PCR method, restriction treatment and ligation.

The assay of the present invention is performed in eukaryotic cells. As the eukaryotic cell, any cell such as yeast, animal cell, plant cell or insect cell can be used. Specific examples of the animal cell include HEK293 cell, HeLa cell and COS.
Examples thereof include cells, BHK cells, CHL cells and CHO cells. Among the above, yeast is preferably used in the present invention. Examples of yeast cells include cells belonging to Saccharomyces or Schizosaccharomyces,
For example, Saccharomyces
cerevis1ae) or Saccharomyces kluyveri (Sa
ccharomyces kluyveri) and the like.

A method for transforming a eukaryotic cell with a recombinant vector and expressing the DNA introduced into the cell is known. For example, when transforming animal cells, electroporation, calcium phosphate method, lipofection method and the like can be used. When transforming yeast, the electroporation method, the spheroblast method, the lithium acetate method, etc. can be mentioned.

The molecule labeled with the second fluorescent protein may be a protein, an antibody, a low molecular compound or a library thereof. When the molecule labeled with the second fluorescent protein is a protein or antibody, the gene encoding the protein is incorporated into a suitable expression vector in the same manner as the protein labeled with the first fluorescent protein, and the resulting recombinant expression is obtained. By introducing the vector into a eukaryotic cell and expressing it, a molecule labeled with the second fluorescent protein can be present in the eukaryotic cell. When the molecule labeled with the second fluorescent protein is a low molecular weight compound, it can be directly incorporated into cells. When searching for a substance that interacts with the target protein, it is preferable to use a library composed of a plurality of molecules as the molecule labeled with the second fluorescent protein.

In the present invention, the analysis is carried out by utilizing FRET (fluorescence resonance energy transfer). For example, a protein labeled with cyan fluorescent protein (CFP) as the first fluorescent protein is expressed in cells, and at the same time, a molecule labeled with yellow fluorescent protein (YFP) as the second fluorescent protein is introduced into the cells. . In this case, the yellow fluorescent protein (YFP) acts as an acceptor molecule, and the cyan fluorescent protein (CF)
P) acts as a donor molecule, causing FRET between the two.
By (fluorescence resonance energy transfer), the interaction between the protein and the molecule introduced into the cell can be visualized. For example, by using protein A as the protein labeled with the first fluorescent protein, any substance that interacts with protein A (eg, IgG Fc
Parts) can be screened.

The type of microscope can be appropriately selected according to the purpose. An ordinary epi-illumination fluorescence microscope is preferable when frequent observation is required such as tracking changes over time. The confocal laser microscope is preferable when the resolution is important, such as when the detailed localization in the cell is desired. As the microscope system, an inverted microscope is preferable from the viewpoint of maintaining the physiological state of cells and preventing contamination.
When using an upright microscope, a water immersion lens can be used when using a high magnification lens.

A suitable filter set can be selected according to the fluorescence wavelength of the fluorescent protein. For example, ECFP
Excitation light 430-450 nm, fluorescence 470-4
It is preferable to use a filter of about 90 nm.
For observation of EYFP, it is preferable to use a filter having excitation light of 480 to 510 nm and fluorescence of 520 to 550 nm.

When observing live cells over time using a fluorescence microscope, the image should be taken in a short time.
A high sensitivity cooled CCD camera is used. The cooled CCD camera can reduce thermal noise by cooling the CCD and can clearly capture a weak fluorescent image by short-time exposure. The present invention will be specifically described by the following examples, but the present invention is not limited to the examples.

[0032]

Examples Example 1: Cells and culture conditions E. coli DH5α [F, φ80lacZΔM15, recAl, endAl, hsdRI7
_{^{(r k -, m k +}} ), phoA, supE44, λ -, thi-1, gyrA96, rel
Al] is Luria containing 100 mg / ml ampicillin when needed.
-Bertani (LB) medium [l% tryptone (Difco, Mich., US
A), 0.5% yeast extract (Difco) and 1% sodium chloride]
Cultured in and used as a host for plasmid amplification. S. cerevisiae MT8-1 (MATa ade his3 leu2 trp1 u
For ra3), amino acids were added when necessary. YPD medium (1% yeast extract, 2% polypeptone (Difco), and 2% glucose) or 0.67% without amino acids containing 2% glucose
Grow on either yeast nitrogen base (YNB) (Difco). H
EPES was added to SD medium at a concentration of 50 mM to buffer the medium in culture.

Example 2 Construction of Plasmids Two types of plasmids were constructed. The first type of plasmid has a gene encoding enhanced cyan fluorescent protein (ECFP) and a Z gene encoding protein A and C-terminal targeting signals. The term "CZ" refers to EC
We have shown that the FP gene is located at the 5'end of the Z gene, and the term "ZC" indicates that the ECFP gene is located at the 3'end of the Z gene. The second type of plasmid has a gene encoding enhanced yellow fluorescent protein (EYFP) and a gene encoding Fc.

The first type of plasmid was constructed as follows. 5'-primer 5'-TCTGCCGAATTCATGGTGAGCA that creates an EcoRI site using the plasmid pECFP (Clontech, Calif., USA) as a template, using the region encoding ECFP as a template.
3'primer 5'-GGCCCCA that creates AGGGCGAGGAGC-3 '(SEQ ID NO: 1) and NcoI site and eliminates stop codon
It was amplified by PCR using TGGCTTGTACAGCTCGTCCATGCCGAGAGT-3 '(SEQ ID NO: 2). The EcoRI / Ncol restriction product was cloned into pCAS1 (Murai et al., Appl. En.
viron. Microbiol, 64 , 4857-4
861 (1998)). The resulting plasmid was named pCASCFP. The region encoding the Z of protein A is used as a template for plasmid pEZZ (Amersham P
harmacia Biotech) to create NcoI site 5'-
Primer 5'-GCTGCGCAACACGATGAACCATGGGACAACA-3 '
3'-primer 5'-ATCTCATAGAACGCGCTCGAGCCAGAACCACCACCAGAAGAACCT (SEQ ID NO: 3) and a sequence encoding GS linker (GSSGGGS) are added to form an XhoI site.
It was amplified by PCR using ACTTTCGGCGCCT-3 '(SEQ ID NO: 4). The NcoI / XhoI restriction product was cloned into pCASCFP. The resulting plasmid was named pCASCZA. To construct the plasmid pYECZI, the ECFP-Z gene was
5'-primer 5'-TCTGCCGAATTCATGGTGAGCAAGGGCGAGGAGC-3 'to create EcoRI site using CASCZA as template
(SEQ ID NO: 5) and 3'-primer 5'-GCTTTTGGATCCTTAAGAACCACCAC that creates a stop codon and BamHI site
P using CACCAGAAGAACCTACTTTCGG-3 '(SEQ ID NO: 6)
Amplified by CR. The EcoRI / BamHI restriction product is then
It was cloned into CAS1. To construct the plasmid pYECZ2, the ECFP-Z gene is used as a template with pCASCZA to create an EcoRI site 5'primer 5'-TCTGCCGAATT
CATGGTGAGCAAGGGCGAGGAGC-3 '(SEQ ID NO: 7), and
Ras2p C-terminal 9 amino acids with stop codon (-GSG
GCCIIS) -encoding oligonucleotide and add Kpn
Create an I site 3'-primer 5'-GCTCGGTACCTTAACTTAT
AATACAACAGCCACCCGATCCAGAACCACCACC-3 '(SEQ ID NO: 8)
Was used to amplify by PCR. The EcoRI / KpnI restriction product was finally cloned into pCAS1.

To construct the plasmid pCASCZB, ECF
5'-primer 5'-TCTGCCGAATTCATGGTGAGCAAG that creates an EcoRI site by using the PZ gene as a template with pCASCZA
GGCGAGGAGC-3 '(SEQ ID NO: 9) and 3'-primer 5'-GCTCAGTGGATCCAGAACCACCACCAGAAG that creates a BamHI site
AACCCTTGTACAGCTCGTCCATGC-3 '(SEQ ID NO: 10) was used for amplification by PCR. PC EcoRI / BamHI restriction product
It was cloned into AS1. The obtained plasmid was designated as pCASCZB
I named it. To construct the plasmid pYECZ3, Ras2
A fragment encoding the C-terminal 21 amino acids of p (-APGGNTSEASKSGSGGCCIIS) was used as a template for BamH using the yeast genome as a template.
Create an I site 5'-primer 5'-GGAAGCAGGGATCCGCACC
CGGCGGTAACACCAGTGAAGCC-3 '(SEQ ID NO: 11), and Bam
Create HI site 3'- Primer 5'-TCTACAAGCGGCCGCGG
ATCCTTAACTTATAATACAACAGCCACC-3 '(SEQ ID NO: 12) was used for amplification by PCR. BamHI restricted product pCASCZ
Cloned into B. To construct the plasmid pYECZ4, the C-terminal 31 amino acids of SNC2 (-WWKDLKMRMCLFLVVI
5'-primer 5'-AGAAAGGGATCCTGGTGGAAAGATCTAAAAATGAGAATGTG-3 'that creates a BamHI site using the yeast genome as a template and the fragment encoding (ILLVVIIVPIVVHFS)
(SEQ ID NO: 13), and 3′-primer 5′-CCGCGGATCCTTAGCTGAAATGGACGACGATAGGAACG-3 ′ that creates a BamHI site.
(SEQ ID NO: 14) was used for amplification by PCR. BamH
The I restriction product was cloned into pCASCZB.

Plasmids pYEZC1, pYEZC2, pYEZC3 and
To construct pYEZC4, pYECZ1, pYECZ2, pYE respectively
The same procedure was used as for the construction of CZ3 and pYECZ4. The structures of the created plasmids pYEZC1-4 and pYECZ1-4 are shown in FIG.

The second type of plasmid was constructed as follows. PWI3 (Knai et al., Appl. Mic
robiol. Biotechnol, 44 , 759-.
2μ restricted with EcoRI from 765 (1996))
PRS406 (Sikorski et al., Genet.
ics, 122 , 19-27 (1989)) to obtain the pR2 plasmid. GAPDH (Glyceraldehyde 3 Phosphate Dehydrogenase) Promoter (Murai et al., Appl. Envi
ron. Microbiol, 63 , 1362-136.
6 (1997)) using pCAS1 as a template and KpnI
Create the site 5'-primer 5'-GGATCCGGTACCGAGCTCA
TCGAGTTTATCATTATCAATACTCGCCATTTCAAAGAATACG-3 (SEQ ID NO: 15), and 3'-primer 5'- that creates the XhoI site
CCCGGGCCGCGGCTCGAGTATTTATGTGTGTTTATTCGAAACTAAGTTCT
It was amplified by PCR using TGG-3 '(SEQ ID NO: 16). Kp
The nI / XhoI restriction product was cloned into pR2 to obtain pR2G.

The EYFP gene was constructed using pEYFP as a template (Clontech, Calif., USA) to create an XhoI site 5'-primer 5'-GGATCCCTCGAGCTTAAGATGGTGAGCAAGGGCGAGGA
GCTGTTCACCGGGGTGG-3 '(SEQ ID NO: 17), and 3'primer 3'-AAGCTTATCGATTTAGTCGACCTTGTACAGCTCGTCCATGCCG that creates SalI site, stop codon and BanIII site
It was amplified by PCR using AGAGTGATCCCG-5 '(SEQ ID NO: 18). The XhoI / BanIII restriction product was cloned into pR2G to obtain pR2GY. The cDNA encoding the Fc region is pUC19F
c (provided by Mitsubishi Co.) was used as a template and SalI
Creating the site 5'-primer 5'-TCTAGAGTCGACCTTAAGGA
GTCCAAATCTTGTGACAAAACTCACACATGCCC-3 '(SEQ ID NO: 1
9), and 3'-primer 5'-TG that creates the BanIII site
AATTCATCGATTCATTTACCCGGAGACAGGGAGAGGCTCTTCTGCGTGTA
It was amplified by PCR using GTGGTTGTGC-3 '(SEQ ID NO: 20). The SalI / BanIII restriction product was cloned into pR2GY to give pR2GYF. Constructed plasmids pR2G and pR
The structure of 2GYF is shown in FIG.

Example 3 Fluorescence Microscopy and Image Processing Fluorescence microscopy was used to observe the active ECFP and EYFP presented in the cytoplasm and plasma membrane of S. cerevisiae. The MT8-1 strain was transformed with each plasmid.
Each transformed yeast was grown overnight at 30 ° C. with shaking in 10 ml of SD medium containing 0.002% adenine to suppress red vesicle pigmentation due to the ade2 mutation. Cells were concentrated by low speed centrifugation for microscopy. A portion of the culture was mounted on a fluorescence free microscope slide. Fluorescence was detected using a filter set. C
The FP filter was suitable for observing the localization of ECFP and protein A: Excitation filter 440 ± 21 n
m, and emission filter, 480 ± 30 nm. YFP filter set for EYFP-Fc, excitation filter 495 nm, and emission filter 535 nm (Omega optical). Fluorescence microscope
Observation and photography were performed using (Olympus).

The results are shown in FIGS. 2, 4 and 5. Figure 2
From the results, it was confirmed that a fusion protein of protein A and a fluorescent protein can be expressed intracellularly by using the expression vector constructed in this Example, and the fusion protein was immobilized on the cell membrane via a cell membrane anchor. It was confirmed that it can be converted.

From the results of FIG. 4, it was confirmed that a fusion protein of Fc and a fluorescent protein can be expressed intracellularly by using the expression vector constructed in this Example. From the results of FIG. 5, it was confirmed that Protein A and Fc interact in vivo on the cytoplasmic side of the cell membrane.

4. Isolation of Plasma Membrane After culturing the transformed yeast cells in liquid SD medium, the cells were collected by centrifugation and the disruption buffer solution (10 mM Tris-HCI, 1 mM EDTA, 1
mM Phenylmethylsulfonyl fluoride (PMSF), pH 7.
5) Washed in at 4 ° C. The collected cells were resuspended in the same buffer containing glass beads (0.45 mm diameter). 50
Glass beads (2.5 ml) and 5 ml of disruption buffer were used per 0 OD ₆₀₀ units of cells. The cells were then homogenized by vortexing on ice 5 times at 2 minute intervals (1 minute each time). The cells were confirmed to have been discarded using a phase contrast microscope. After removing the glass beads by precipitation, the supernatant was centrifuged at 700 g for 10 minutes to remove cell debris. Supernatant at 20,000g 2
Centrifuge for 0 minutes. Supernatants were stored at 4 ° C or -70 ° C. The resulting pellet, which contains a high percentage of plasma membranes, was resuspended in disruption buffer and recentrifuged at 20,000 g for 20 minutes. The pellet was resuspended in disruption buffer or disruption buffer containing 20% (v / v) glycerol and stored at 4 ° C or -70 ° C.

5. Fluorescence analysis Fluorometer with Ascent Software Version 2.4 (Fl
uoroskan Ascent FL 2.2, type 347, Labsystems) was used to measure fluorescence intensity in cytoplasmic or plasma membrane samples (above) with tissue culture plates (24 well FALCON 3047). Using a combination of filters using a 440 nm excitation filter and a 480 nm emission filter,
The fluorescence intensity of ECFP was detected. Another combination of filters using a 500 nm excitation filter and a 538 nm emission filter was used to detect the fluorescence intensity of EYFP. The fluorescence measurement was performed at room temperature.

The results of measuring the fluorescence intensity are shown in Tables 1 and 2. Table 1 shows the fluorescence intensities measured in the cytoplasmic fraction and the yeast plasma membrane fraction when the C-terminal region of the fusion protein was changed. Fluorescence analysis was performed using an excitation filter (440 nm) and an emission filter (480 nm).

[0045]

[Table 1] Sample CZ1 ZC1 CZ2 ZC2 CZ4 ZC4 membrane fraction (M) 0.052 0.046 0.32 0.52 0.38 0.41 Ratio (M / C) 0.038 0.039 0.61 0.78 2.87 1.84 ZC1: pYEZC1, ZC2: pYEZC2, ZC4: pYEZ1p, CZ4 , CZ2: pYECZ2, CZ4: pYECZ4 M: ECFP intensity of plasma membrane fraction C: Cytoplasmic ECFP intensity

Table 2 shows the fluorescence intensity measured in the cytoplasmic fraction and the yeast plasma membrane fraction of the co-expressing sample. Excitation filter (500 nm) and emission filter (538 nm)
Was used for fluorescence analysis.

[0047]

[Table 2] Sample CZ1 / YF ZC1 / YF CZ4 / Y ZC4 / Y CZ4 / YF ZC4 / YF Membrane fraction (M) 0.03 0.034 0.051 0.062 0.26 0.28 Ratio (M / C) 0.029 0.037 0.061 0.059 0.94 0.97 CZ1 / YF And ZC1 / YF: ECFP-protein A or protein A-ECFP and EYFP-Fc co-expression; CZ4 / Y and ZC4 / Y: ECFP-protein A-CTM or protein A-ECF P-CTM and EYFP Co-expression; CZ4 / YF and ZC4 / YF: co-expression of ECFP-Protein A-CTM or Protein A-EC FP-CTM with EYFP-Fc;

[0048]

INDUSTRIAL APPLICABILITY The present invention has made it possible to provide a method for simply and visually detecting the interaction between a test substance and a target protein expressed in eukaryotic cells. Moreover, since the analysis method of the present invention is an analysis method performed in vivo in cells, it is possible to analyze the interaction between molecules in the same environment as in the actual living body.

[0049]

[Sequence list] SEQUENCE LISTING <110> GenCom <120> A method for the analysis of interaction among molecules <130> A21218A <160> 20

[0050] <210> 1 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic DNA <400> 1 tctgccgaat tcatggtgag caagggcgag gagc 34

[0051] <210> 2 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic DNA <400> 2 ggccccatgg cttgtacagc tcgtccatgc cgagagt 37

[0052] <210> 3 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic DNA <400> 3 gctgcgcaac acgatgaacc atgggacaac a 31

[0053] <210> 4 <211> 58 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic DNA <400> 4 atctcataga acgcgctcga gccagaacca ccaccagaag aacctacttt cggcgcct 58

[0054] <210> 5 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic DNA <400> 5 tctgccgaat tcatggtgag caagggcgag gagc 34

[0055] <210> 6 <211> 48 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic DNA <400> 6 gcttttggat ccttaagaac caccaccacc agaagaacct actttcgg 48

[0056] <210> 7 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic DNA <400> 7 tctgccgaat tcatggtgag caagggcgag gagc 34

[0057] <210> 8 <211> 52 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic DNA <400> 8 gctcggtacc ttaacttata atacaacagc cacccgatcc agaaccacca cc 52

[0058] <210> 9 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic DNA <400> 9 tctgccgaat tcatggtgag caagggcgag gagc 34

[0059] <210> 10 <211> 54 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic DNA <400> 10 gctcagtgga tccagaacca ccaccagaag aacccttgta cagctcgtcc atgc 54

[0060] <210> 11 <211> 41 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic DNA <400> 11 ggaagcaggg atccgcaccc ggcggtaaca ccagtgaagc c 41

[0061] <210> 12 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic DNA <400> 12 tctacaagcg gccgcggatc cttaacttat aatacaacag ccacc 45

[0062] <210> 13 <211> 41 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic DNA <400> 13 agaaagggat cctggtggaa agatctaaaa atgagaatgt g 41

[0063] <210> 14 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic DNA <400> 14 ccgcggatcc ttagctgaaa tggacgacga taggaacg 38

[0064] <210> 15 <211> 61 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic DNA <400> 15 ggatccggta ccgagctcat cgagtttatc attatcaata ctcgccattt caaagaatac 60 g 61

[0065] <210> 16 <211> 53 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic DNA <400> 16 cccgggccgc ggctcgagta tttatgtgtg tttattcgaa actaagttct tgg 53

[0066] <210> 17 <211> 55 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic DNA <400> 17 ggatccctcg agcttaagat ggtgagcaag ggcgaggagc tgttcaccgg ggtgg 55

[0067] <210> 18 <211> 55 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic DNA <400> 18 aagcttatcg atttagtcga ccttgtacag ctcgtccatg ccgagagtga tcccg 55

[0068] <210> 19 <211> 53 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic DNA <400> 19 tctagagtcg accttaagga gtccaaatct tgtgacaaaa ctcacacatg ccc 53

[0069] <210> 20 <211> 62 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic DNA <400> 20 tgaattcatc gattcattta cccggagaca gggagaggct cttctgcgtg tagtggttgt 60 gc 62

[Brief description of drawings]

FIG. 1 shows plasmids pYEZC1-4 and pYECZ1-.
The structure of 4 is shown.

FIG. 2 shows E with and without a transmembrane domain (MTD) (anchor for anchoring cell membrane).
The localization of CFP fluorescence is shown.

FIG. 3 shows the structures of plasmids pR2G and pR2GYF.

FIG. 4 shows expression of EYFP and EYFP-Fc. EYFP indicates expression of EYFP in pR2GY plasmid. EYFP-Fc shows the expression of EYFP-Fc in the pR2GYF plasmid.

FIG. 5 shows EYFP or EYFP-Fc and EC
FP-Protein A-CTM or Protein A-ECF
5 shows co-expression of P-CTM.

─────────────────────────────────────────────────── ─── Continuation of front page (51) Int.Cl. ⁷ Identification code FI theme code (reference) G01N 21/64 G01N 21/78 C 21/78 33/483 C 33/483 33/536 D 33/536 33 / 566 33/566 33/58 Z 33/58 C12N 15/00 AF Term (reference) 2G043 AA01 AA04 BA16 CA04 DA02 EA01 FA02 FA06 GA07 GB21 JA03 KA02 LA01 2G045 AA34 AA35 BB10 BB20 BB46 BB51 CB01 CB21 DA13 FA36 FA16 FA16 FA16 FA16 FB02 FB03 FB12 GC15 2G054 AA08 AB10 BB13 CA22 CA23 CE02 EA03 FA19 GA04 4B024 AA11 CA04 DA12 EA04 GA11 HA01 HA14 HA15 4B063 QA18 QQ08 QQ79 QR32 QR55 QS03 QS33 QS34 QX02

Claims (13)

[Claims] 1. A method for analyzing the interaction between a protein and a molecule, wherein the protein labeled with the first fluorescent protein and the molecule labeled with the second fluorescent protein are allowed to interact in a eukaryotic cell, and A method as described above, comprising measuring the fluorescence produced by fluorescence resonance energy transfer occurring between different types of fluorescent proteins. 2. The method according to claim 1, wherein the protein labeled with the first fluorescent protein is immobilized on the cell membrane. 3. The protein labeled with the first fluorescent protein is immobilized on the cytoplasmic side of the cell membrane.
The method described in. 4. The method according to claim 1, wherein the protein labeled with the first fluorescent protein is immobilized on the cell membrane via an anchor for anchoring the cell membrane. 5. The eukaryotic cell is yeast. Claims 1 to 4
The method according to any one of 1. 6. SNC2 as an anchor for cell membrane fixation
Single carboxyl terminal transmembrane domain (CTM) from gene product or carboxyl terminal prenylation and palmitoylation motif (Cpr) from RAS2 gene product
The method according to claim 1, wherein 7. The method according to claim 1, wherein the protein labeled with the first fluorescent protein is protein A. 8. The method according to claim 1, wherein the molecule labeled with the second fluorescent protein is a protein, an antibody, a low molecular compound or a library thereof. 9. The method according to claim 1, wherein the molecule labeled with the second fluorescent protein is a gene or an expression product of a gene library. 10. A gene capable of expressing a protein labeled with a second fluorescent protein is introduced into a cell having a target protein labeled with the first fluorescent protein, which occurs between the two types of fluorescent proteins. A method for searching for a gene encoding a protein that interacts with a target protein, comprising identifying a gene that causes fluorescence resonance energy transfer. 11. A molecule having a target protein labeled with a first fluorescent protein is introduced with a molecule labeled with a second fluorescent protein to cause fluorescence resonance energy transfer between the two types of fluorescent proteins. A method of searching for a molecule that interacts with a target protein, comprising identifying the molecule. 12. The cell library in which each cell has a different target protein is used as the cell having the target protein labeled with the first fluorescent protein.
The method described in. 13. The method according to claim 1, wherein the fluorescent protein is cyan fluorescent protein, yellow fluorescent protein, green protein, red fluorescent protein, blue fluorescent protein, or variants thereof.