JP2003052389A - New promoter - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a potent expression promoter. SOLUTION: A sequence affecting the expression of a protein is found and a promoter using the same is developed. Since a DNA having an NP3 promoter region has an excellent promoter activity, a target peptide or protein can be mass-produced at a good efficiency by ligating a structural gene encoding the target peptide or protein to the downstream side of the promoter.

Description

Detailed Description of the Invention

[0001]

TECHNICAL FIELD The present invention relates to a promoter capable of strongly expressing a gene linked downstream (3 ′ side) in prokaryotes, particularly in Escherichia coli.

[0002]

Recombinant D using a prokaryotic or eukaryotic cell as a host
In the expression of a protein by the NA technique, the efficiency of protein expression is greatly influenced by the efficiency of transcription of a structural gene encoding the protein into mRNA. The transcription efficiency is the efficiency at which mRNA synthesis is initiated by RNA polymerase, and generally depends on the strength of a promoter existing upstream of a structural gene. In prokaryotes, the promoter strength exists mainly in the vicinity of about 10 base pairs upstream of the transcription start point in the promoter base sequence and the −10 region (so-called Pribnow sequence) and about 35 base pairs upstream of the transcription start point. It is controlled by the -35 region. Gene transcription is the first step in gene expression (ie, protein expression) and allows for more efficient transcription when the desired protein or peptide is to be produced in large quantities by recombinant DNA technology. It is necessary to use a strong promoter that can.

Conventionally, as a promoter used for expression of a protein in Escherichia coli, an E. coli-derived tryptophan promoter (trp, called Emtage,
JS et al., Nature, 283, p.171, 1983), lactose promoter (called lac, Itakura, K., Scienc)
e, 198, 1056, 1977) or coliphage λ
PL promoter (Bernard, H., Gene, Volume 5, page 59, 1
979) was known, but it had a problem that the protein expressivity was relatively weak. On the other hand, JP-A-57-1
There is provided a hybrid promoter in which a promoter having a relatively strong expression power and an easily controllable promoter operator as described in No. 94790 are linked. Among them, the hybrid promoter of trp and lacUV5 promoter / operator, which is called “tac”, has both strong expression and easy control, and is a particularly useful promoter / operator in the production of proteins by gene recombination. (In addition to the above publication, Proc.Nat1.Acad.Sci.USA, Volume 80, 21-2
5 pages, 1983). However, the promoter such as tac described in JP-A-57-194790 has a problem that it cannot be easily manufactured because two kinds of promoters are linked between the -35 region and the -10 region. Because the expression of a promoter is considered to be affected by the highly conserved nucleotide sequences of the −35 and −10 regions, as well as the distance and sequence between these regions, such promoters are -35 when manufacturing
It is necessary to prepare a large number of different numbers and types of bases between the −10 region and −10 region and examine the promoter activity of each. Further, as a promoter having a very strong expression power, a T7 promoter, especially a φ10 promoter (AH Rosenberg et al., Gene, 56, 125-135, 1987).
Year) is known. However, since the T7 promoter requires T7 RNA polymerase, λ phage (Studier et al., J. Mol. Biol., 189, 113:
1986) has the limitation that E. coli lysogenized must be used.

[0004]

Therefore, it is desired to develop a promoter which has a strong expression in prokaryotes, particularly in Escherichia coli, and which can be easily produced.

[0005]

DISCLOSURE OF THE INVENTION The present inventors have found a novel sequence that promotes expression as a sequence between the −35 region and the −10 region in a prokaryotic promoter. We succeeded in developing a promoter and completed the present invention. That is, the present invention is
(1) A promoter containing the same or substantially the same base sequence as the base sequence represented by SEQ ID NO: 34,
(2) Between the arbitrary −35 region and −10 region,
The promoter according to (1) above, which contains the same or substantially the same base sequence as the base sequence represented by SEQ ID NO: 34, and (3) any -35 region is the base sequence represented by SEQ ID NO: 37. (4) The promoter according to (2) above, (4) wherein the arbitrary -10 region is the nucleotide sequence represented by SEQ ID NO: 38 or SEQ ID NO: 39.
The promoter according to (2), which has the nucleotide sequence represented by SEQ ID NO: 35.
(6) The promoter according to (2) above, which has the nucleotide sequence represented by SEQ ID NO: 36, (7) above (1) to
DN containing the promoter according to any one of (6)
A, (8) A recombinant vector containing the promoter according to any one of (1) to (6) above or the DNA according to (7) above, (9) Any of the above (1) to (6) The recombinant vector according to the above (8), which comprises a DNA having a structural gene under the expression control of the promoter according to the above.
(10) The recombinant vector described in (9) above, which is represented by pNP3GHNO12 whose structural gene is a human growth hormone gene, (11) a transformant transformed with the recombinant vector described in (9) above, ( 12) Escherichia coli MM294 / pNP3GHNO12 which is a transformant transformed with the recombinant vector described in (10) above.
(FERM BP-7611), (13) Above (1
1) A method for producing a protein or a salt thereof, which comprises culturing the transformant according to 1) to produce a protein encoded by a structural gene, and (14) above (12)
A method for producing the human growth hormone or a salt thereof, which comprises culturing the transformant described above to produce human growth hormone, (15) The recombinant vector according to (9) above, wherein the structural gene is a reporter gene. , (16) The reporter gene is a kanamycin resistance gene or GFP
A recombinant vector according to (15) above, which is a gene, (1
7) A transformant transformed with the recombinant vector described in (15) above, (18) A transformant transformed with the recombinant vector described in (16) above, (19) represented by SEQ ID NO: 34. A DNA containing the same or substantially the same nucleotide sequence as the nucleotide sequence represented by (20)
A method for producing the DNA according to (20) above, which comprises a nucleotide sequence identical or substantially identical to the nucleotide sequence represented by SEQ ID NO: 34 between the 35 region and the -10 region, and (21) for producing a promoter (19) or (20) above
Use of the described DNA, (22) use of the promoter according to any one of (1) to (6) above for producing a protein encoded by a structural gene.

Further, the present invention provides (23) arbitrary -35.
DNA having a promoter region having the same or substantially the same nucleotide sequence as the nucleotide sequence represented by SEQ ID NO: 34 between the region and the −10 region, (24)
A recombinant vector containing the DNA according to (23) above,
And (25) a DNA having a structural gene under the expression control of a promoter region having the same or substantially the same nucleotide sequence as the nucleotide sequence represented by SEQ ID NO: 34 between the arbitrary −35 region and −10 region The recombinant vector according to (24) above, which comprises:

[0007]

BEST MODE FOR CARRYING OUT THE INVENTION The present invention relates to a prokaryotic promoter (hereinafter abbreviated as the promoter of the present invention) containing a base sequence which is the same or substantially the same as the base sequence represented by SEQ ID NO: 34. In particular, a promoter containing a nucleotide sequence identical or substantially identical to the nucleotide sequence represented by SEQ ID NO: 34 between any of the −35 region and the −10 region is preferable. Furthermore, a promoter containing the nucleotide sequence represented by SEQ ID NO: 34 between the arbitrary −35 region and −10 region is preferable. The above-mentioned “base sequence substantially the same as the base sequence represented by SEQ ID NO: 34” is a base sequence which hybridizes with the base sequence represented by SEQ ID NO: 34 under high stringent conditions, Any DNA sequence may be used as long as it has substantially the same activity as the promoter activity of the nucleotide sequence represented by SEQ ID NO: 34. -35
The number of bases of the sequence arranged between the region and the −10 region is usually 15 to 21, preferably 16 to 18, particularly preferably 17 bases. The DNA capable of hybridizing with the base sequence represented by SEQ ID NO: 34 includes, for example, about 70% or more, preferably about 80% or more, more preferably about 90% or more, most preferably about 90% or more of the base sequence represented by SEQ ID NO: 34. Preferably, there is a DNA containing a nucleotide sequence having a homology of about 95% or more.

Hybridization can be carried out by a known method or a method analogous thereto, for example, Molecular Cloning 2nd (J. Sambrook et al.
al., Cold Spring Harbor Lab. Press, 1989). When a commercially available library is used, it can be performed according to the method described in the attached instruction manual. More preferably, it can be carried out under high stringent conditions. The high stringent conditions include, for example, a sodium concentration of about 19 to 40 mM, preferably about 19 to 2
At 0 mM, the temperature is about 50-70 ° C, preferably about 60-
The conditions of 65 ° C. are shown. Especially, the sodium concentration is about 19m
Most preferred is when M is at a temperature of about 65 ° C.

In the present invention, the "-35 region" is usually 6 to 8 base pairs, preferably 6 base pairs, present in the vicinity of about 35 base pairs upstream of the transcription initiation point of genomic DNA encoding any prokaryotic protein. A sequence region consisting of base pairs,
It means a region essential for promoter activity. For example, Nu
cleic Acids Research, volume 11, Number 8, p.2238-
2242, 1983 or Nucleic Acids Research, volume 15, N
The nucleotide sequences described in umber 5, p.2343-2361, 1987 and the like are used. More specifically, the base sequences shown in Table 1 can be used as the arbitrary -35 region,
Among them, the base sequence represented by SEQ ID NO: 37 is preferably used.

[0010]

[Table 1]

In the present invention, the "-10 region" is usually 6-8 existing in the vicinity of about 10 base pairs upstream of the transcription initiation site of the genomic DNA encoding any protein of prokaryote.
A sequence region consisting of base pairs, preferably 6 base pairs, which means a region essential for promoter activity. For example, Nucleic Acids Research, volume 11, Number 8,
p.2238-2242, 1983 or Nucleic Acids Research, volum
The nucleotide sequences described in e 15, Number 5, p.2343-2361, 1987, etc. are used. More specifically, any −
As the 10 region, the base sequences shown in Table 2 can be used, and among them, SEQ ID NO: 38 or SEQ ID NO: 39.
The base sequence represented by is preferably used.

[0012]

[Table 2]

Accordingly, specific examples of the promoter of the present invention include, for example, (1) the nucleotide sequence represented by SEQ ID NO: 35 (between the nucleotide sequence represented by SEQ ID NO: 37 and SEQ ID NO: 38, the sequence number: NP3 promoter containing the nucleotide sequence containing the nucleotide sequence represented by 34 (FIG. 8), (2) the nucleotide sequence represented by SEQ ID NO: 36 (the nucleotide sequence represented by SEQ ID NO: 37 and SEQ ID NO: 39) And the trp3 promoter (FIG. 8) containing the base sequence represented by SEQ ID NO: 34).

A DNA containing the same or substantially the same nucleotide sequence as the nucleotide sequence represented by SEQ ID NO: 34, or the nucleotide sequence represented by SEQ ID NO: 34 between any of the -35 region and the -10 region. DNA containing the same or substantially the same nucleotide sequence as (hereinafter, referred to as DN of the present invention).
A) is useful as a material for producing the above-mentioned promoter of the present invention. The DNA and promoter of the present invention can be synthesized using known methods.
Replacement of the nucleotide sequence of DNA is carried out by PCR or a known kit such as Mutan ^™ -super Express Km (Takara Shuzo Co., Ltd.), M
ODA-LA PCR using utan ^TM -K (Takara Shuzo Co., Ltd.)
Method, gapped duplex method, Kunkel method or the like or a method similar thereto can be used. The obtained DNA or promoter can be used as it is, or if desired after digestion with a restriction enzyme or addition of a linker, depending on the purpose.

Since the promoter of the present invention has an excellent promoter activity, an expression vector in which a structural gene encoding a target peptide or protein is operably linked to the downstream of the promoter is prepared, and the expression vector is expressed. A target peptide or protein can be efficiently produced in large quantities using a vector. The structural gene may be any protein of any species as long as it is a protein that does not show cytotoxicity to the prokaryotic organism that is the host. For example, in the pharmaceutical industry, growth factors such as human growth hormone and interleukin 1 Leukins, interferons such as interferon α, RANTE
Genes encoding chemokines such as S and physiologically active peptides such as insulin are used, or genes encoding unknown proteins deduced from genomic information are used for research and screening.

In order to investigate the activity of the promoter of the present invention, a detectable structural gene downstream of the promoter,
A so-called reporter gene may be linked. Various structural genes are used as the reporter gene linked to the downstream of the promoter region. As a reporter gene, kanamycin resistance gene, GFP (green fluo)
rescent protein), GFP genes such as GFPuv (Experimental Medicine separate volume, experimental course in the post-genome era 3, GFP and bioimaging, Yodosha (2000)), luciferase gene, CAT (Chloramphenicol acetyltransferase). transferase) gene, alkaline phosphatase gene, or β-galactosidase gene are widely used, but any other structural gene can be used as long as there is a method for detecting its gene product.

The invention therefore also relates to an expression vector for a prokaryotic host containing the promoter according to the invention. In order to incorporate the structural gene into a vector, the structural region should be downstream of the promoter, in the direction in which the structural gene is correctly transcribed, and in such a positional relationship that the promoter functions properly with respect to the structural gene. , Can be connected. The ligation may utilize a restriction enzyme cleavage site,
It can be performed using the ligase reaction without the appropriate restriction enzyme sites. The expression vector of the present invention may contain other elements that can function in prokaryotes, such as an enhancer sequence that promotes the promoter activity and a transcription termination site.

The expression vector containing the promoter of the present invention prepared as described above can be used to transform a suitable host, and such a transformant can be used to produce a protein. It can be carried out. As a host transformed with the above recombinant vector, for example, Escherichia genus, Bacillus genus and the like are used. Specific examples of Escherichia bacteria include Escherichia coli (Esch
erichia coli) K12 DH1 (Proc. Natl. Acad. Sci. Sci. of Proc. of the National Academy of Sciences of the USA)
USA), 60, 160, 1968), JM103 (Nucleic Acids Resear
ch), Volume 9, 309, 1981), JM109, JA221
(Journal of Molecular Biology (Jo
urnal of Molecular Biology), 120, 517, 1978
Year), HB101 (Journal of Molecular
Biology, 41, 459, 1969), C600 (Genetics, 39, 440, 1954)
Are used. Examples of the bacterium of the genus Bacillus include Bacillus subtilis MI114.
(Gene, 24, 255, 1983), 207-21 (Journal of Biochemistry
Chemistry), 95, 87, 1984).

More specifically, for transforming Escherichia, for example, Procedures of the
National Academy of Sciences of the USA (Proc. Natl. Acad. Sci. US
A), 69, 2110 (1972) and Gene, 17
Vol. 107, p. 107 (1982) and the like. For transforming Bacillus, for example, Molecular & General Genetics, 168, 111.
It can be performed according to the method described on page (1979).

Culturing of the transformant is carried out by a known method. When the host is culturing a transformant that is a bacterium of the genus Escherichia, a bacterium of the genus Bacillus, a liquid medium is suitable as a medium used for the culture, and among them, a carbon source necessary for the growth of the transformant, A nitrogen source, an inorganic substance, etc. are contained. Examples of the carbon source include glucose, dextrin, soluble starch and sucrose, and examples of the nitrogen source include ammonium salts, nitrates, corn steep liquor, peptone, casein, meat extract, soybean meal and potato extract. Examples of the inorganic or organic substance and the inorganic substance include calcium chloride, sodium dihydrogen phosphate, magnesium chloride and the like. In addition, yeast extract, vitamins, growth promoting factor and the like may be added. The pH of the medium is preferably about 5-8. The medium for culturing Escherichia, for example, glucose,
M9 medium containing casamino acids (Miller, Journal of Experiments in Molecular
Genetics (Journal of Experiments in Molecu
lar Genetics), pp. 431-433, Cold Spring Harbor Labo
ratory, New York (1972)) is preferable. In order to make the promoter work efficiently if necessary, for example, 3β-indolylacrylic acid or isopropyl-β-D
-An expression-inducing agent such as thiogalactopyranoside (IPTG) can be added. When the host is a bacterium belonging to the genus Escherichia, the culture is usually carried out at about 15 to 43 ° C. for about 3 to 24 hours, and if necessary, aeration and stirring can be added. When the host is Bacillus, the culture is usually about 30-4.
It is carried out at 0 ° C. for about 6 to 24 hours, and aeration and stirring can be added if necessary.

As described above, the inside of the transformant cell,
The desired peptide or protein can be produced on the cell membrane or extracellularly. The target peptide or protein can be separated and purified from the culture described above, for example, by the following method. When the target peptide or protein is extracted from cultured bacterial cells or cells, after the culture, the bacterial cells or cells are collected by a known method, suspended in an appropriate buffer solution, and then subjected to ultrasonic waves, lysozyme and / or freeze-thawing. A method of obtaining a crude extract of peptide or protein by centrifuging or filtering after destroying the bacterial cells or cells by, for example, is appropriately used. The buffer solution may contain a protein denaturing agent such as urea or guanidine hydrochloride, or a surfactant such as Triton X-100 ^™ . When the peptide or protein is secreted into the culture medium, after the completion of the culture, the cells or the cells and the supernatant are separated by a suitable method known in the art, for example, by centrifugation, and the supernatant is collected. The peptide or protein contained in the culture supernatant or the extract thus obtained can be purified by appropriately combining known separation / purification methods. Known separation and purification methods for these include methods utilizing solubility such as salting out and solvent precipitation, dialysis, ultrafiltration, gel filtration, and SDS.
-Methods mainly utilizing difference in molecular weight such as polyacrylamide gel electrophoresis, methods utilizing difference in charge such as ion exchange chromatography, methods utilizing specific affinity such as affinity chromatography, reversed-phase high-performance liquid A method utilizing a difference in hydrophobicity such as chromatography and a method utilizing a difference in isoelectric point such as isoelectric focusing are used.

When the peptide or protein thus obtained is obtained as a free form, it can be converted into a salt by a known method or a method analogous thereto, and conversely, when it is obtained as a salt, it is known. Can be converted into a free form or other salt by the method described above or a method similar thereto. Examples of the salt include salts with inorganic bases, salts with organic bases, salts with inorganic acids, salts with organic acids, salts with basic or acidic amino acids, and the like. Preferable examples of the salt with an inorganic base include alkali metal salts such as sodium salt and potassium salt, alkaline earth metal salts such as calcium salt and magnesium salt, and aluminum salt and ammonium salt. Preferable examples of the salt with an organic base include trimethylamine, triethylamine, pyridine, picoline, 2,6-lutidine,
Examples thereof include salts with ethanolamine, diethanolamine, triethanolamine, cyclohexylamine, dicyclohexylamine, N, N′-dibenzylethylenediamine and the like. Preferable examples of salts with inorganic acids include salts with hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid and the like. Suitable examples of salts with organic acids include, for example, formic acid,
Examples thereof include salts with acetic acid, propionic acid, fumaric acid, oxalic acid, tartaric acid, maleic acid, citric acid, succinic acid, malic acid, methanesulfonic acid, benzenesulfonic acid and benzoic acid. Suitable examples of salts with basic amino acids include:
Examples thereof include salts with arginine, lysine, ortinine, and preferable examples of the salt with acidic amino acid include salts with aspartic acid, glutamic acid and the like. In addition, the peptide or protein produced by the recombinant can be optionally modified or the polypeptide can be partially removed by acting an appropriate protein-modifying enzyme before or after the purification. Examples of the protein-modifying enzyme include trypsin, chymotrypsin, arginyl endopeptidase, protein kinase, glycosidase and the like. The presence of the thus produced peptide or protein or a salt thereof can be measured by an enzyme immunoassay using a specific antibody.

The sequence numbers in the sequence listing in this specification show the following sequences. [SEQ ID NO: 1] This shows the base sequence of primer 1 used in Reference Example 1. [SEQ ID NO: 2] This shows the base sequence of primer 2 used in Reference Example 1. [SEQ ID NO: 3] This shows the base sequence of synthetic DNA (i) used in Reference Example 1. [SEQ ID NO: 4] This shows the base sequence of synthetic DNA (ii) used in Reference Example 1. [SEQ ID NO: 5] Synthetic DNA (iii) used in Reference Example 1
The base sequence of is shown. [SEQ ID NO: 6] This shows the base sequence of synthetic DNA (iv) used in Reference Example 1. [SEQ ID NO: 7] This shows the base sequence of synthetic DNA (v) used in Reference Example 2. [SEQ ID NO: 8] This shows the base sequence of synthetic DNA (vi) used in Reference Example 2. [SEQ ID NO: 9] This shows the base sequence of synthetic DNA 1 used in EXAMPLE 1. [SEQ ID NO: 10] This shows the base sequence of synthetic DNA2 used in Example 1. [SEQ ID NO: 11] This shows the base sequence of synthetic DNA3 used in Example 1. [SEQ ID NO: 12] This shows the base sequence of synthetic DNA4 used in Example 1. [SEQ ID NO: 13] This shows the base sequence of synthetic DNA5 used in Example 2. [SEQ ID NO: 14] This shows the base sequence of synthetic DNA 6 used in EXAMPLE 2. [SEQ ID NO: 15] This shows the base sequence of synthetic DNA 7 used in EXAMPLE 3. [SEQ ID NO: 16] This shows the base sequence of synthetic DNA 8 used in EXAMPLE 3. [SEQ ID NO: 17] This shows the base sequence of synthetic DNA 9 used in EXAMPLE 4. [SEQ ID NO: 18] Synthetic DNA10 used in Example 4
The base sequence of is shown. [SEQ ID NO: 19] Synthetic DNA11 used in Example 6
The base sequence of is shown. [SEQ ID NO: 20] Synthetic DNA12 used in Example 6
The base sequence of is shown. [SEQ ID NO: 21] Synthetic DNA13 used in Example 6
The base sequence of is shown. [SEQ ID NO: 22] Synthetic DNA14 used in Example 6
The base sequence of is shown. [SEQ ID NO: 23] Synthetic DNA15 used in Example 7
The base sequence of is shown. [SEQ ID NO: 24] Synthetic DNA16 used in Example 7
The base sequence of is shown. [SEQ ID NO: 25] Synthetic DNA17 used in Example 7
The base sequence of is shown. [SEQ ID NO: 26] Synthetic DNA18 used in Example 7
The base sequence of is shown. [SEQ ID NO: 27] Synthetic DNA19 used in Example 7
The base sequence of is shown. [SEQ ID NO: 28] Synthetic DNA20 used in Example 7
The base sequence of is shown. [SEQ ID NO: 29] Synthetic DNA21 used in Example 7
The base sequence of is shown. [SEQ ID NO: 30] Synthetic DNA22 used in Example 8
The base sequence of is shown. [SEQ ID NO: 31] Synthetic DNA23 used in Example 8
The base sequence of is shown. [SEQ ID NO: 32] Synthetic DNA24 used in Example 8
The base sequence of is shown. [SEQ ID NO: 33] Synthetic DNA25 used in Example 8
The base sequence of is shown. [SEQ ID NO: 34] -3 in the promoter of the present invention
The base sequence arrange | positioned between 5 area | region and -10 area | region is shown. [SEQ ID NO: 35] This shows the base sequence of the NP3 promoter of the present invention. [SEQ ID NO: 36] This shows the base sequence of trp3 promoter of the present invention. [SEQ ID NO: 37] This shows the base sequence of -35 region. [SEQ ID NO: 38] This shows the base sequence of the -10 region. [SEQ ID NO: 39] This shows the base sequence of region-10.

[0024]

The present invention will be described in more detail with reference to the following examples, which are not intended to limit the scope of the present invention. The transformant Escherichia coli (Es obtained in Reference Example 1 below)
cherichia coli) JM109 / pGFPNP is 200
From July 17, 2000, Japan Patent Institute for Biotechnology, National Institute of Advanced Industrial Science and Technology, National Institute of Advanced Industrial Science and Technology, 1st, 1-1-1, Higashi, Tsukuba, Ibaraki, Japan Institute of Engineering and Technology (NI
BH)) with deposit number FERM BP-7223,
Since April 24, 2000, the Fermentation Research Institute (I), 2-17-85, 13-honhonmachi, Yodogawa-ku, Osaka, Japan
FO) under the deposit number IFO 16426. The plasmid pTCHG used in Example 8 below.
Transformant E. coli that retains H-Na (Escherichia co
li) (MM294 (DE3), pTCHGH-Na)
Since December 10, 1997, Chuo No. 6 (Postal Code 305-856), 1-1 1-1 Higashi, Tsukuba, Ibaraki, Japan
6) Independent Administrative Institution, National Institute of Advanced Industrial Science and Technology, Patent Biological Depository Center (formerly Ministry of International Trade and Industry, Institute of Industrial Science and Technology, Institute of Biotechnology (NIBH)), deposit number FERM BP-68
No. 88, and since October 16, 1997, has been deposited with the IFO under deposit number IFO16124. The plasmid pNP3GHNO1 used in Example 8 below.
Transformant Escherichia coli M retaining 2
M294 / pNP3GHNO12, 2 May 2001
From the 4th, 1-1-1, Higashi 1-1-chome, Tsukuba-shi, Ibaraki, Japan Deposit No. FE at National Institute of Advanced Industrial Science and Technology, National Institute of Advanced Industrial Science and Technology, Central No. 6 (zip code 305-8566)
Also as RM BP-7611, May 17, 2001
It has been deposited with the IFO under the deposit number IFO 16630 from the day.

Reference Example 1 Construction of plasmid pGFPNP 1) Construction of plasmid pGFPuvqc Primer 1: CGTTATCCGGATCACATGAAACGGCATG (SEQ ID NO: 1) and primer 2 to eliminate the NdeI cleavage site present in the GFPuv structural gene of pGFPuv (Clontech). : CATGCCGTTTCATGTGATCCGGAT
Site-directed mutagenesis using AACG (SEQ ID NO: 2) (Qu
ickChange ^TM Site Directed Mutagenesis Kit, manufactured by Stratagene) to change the 77th histidine codon to C
By replacing AT with CAC, the plasmid pGFPuvqc
Got 2) Construction of plasmid pGFPuvqd Plasmid pGFPuvqc was cleaved with HindIII (Takara Shuzo) and KpnI (Takara Shuzo), and a band of about 3.3 kbp was cut out by agarose electrophoresis, and QIA was extracted from the gel.
DNA using quick Gel Extraction Kit (Qiagen)
Was recovered. Synthetic DNA (i): AGCTTCATATGTTCGAAGTACTA
GATCTGGTAC (SEQ ID NO: 3) and synthetic DNA (ii): CAGA
TCTAGTACTTCGAACATATGA (SEQ ID NO: 4) (100 pmol each) was dissolved in a TE buffer, held at 90 ° C. for 10 minutes, and then gradually cooled to room temperature for annealing. The DNA fragment thus annealed was treated with HindII of pGFPuvqc.
Ligation kit ver.2 (Takara Shuzo) was used for insertion into the I-KpnI portion to obtain plasmid pGFPuvqd. 3) Construction of plasmid pNPHGH pTCHGH described in Reference Example 1 of WO00 / 20439
A plasmid pNPHGH in which the T7 promoter of Na was replaced with the synthetic promoter NP2 was constructed as follows. The plasmid pTCHGH-Na was cut with EcoRI (Takara Shuzo) and XbaI (Takara Shuzo), and a band of about 4.6 kbp was cut out by agarose gel electrophoresis, and QIA was extracted from the gel.
DNA using quick Gel Extraction Kit (Qiagen)
Was recovered. Synthetic DNA containing synthetic promoter NP2
(iii): AATTCTATAAAAATAATTGTTGACATATTTTATAAATTTTGGC
ATAATAGATCTAATTGTGAGCGGATAACAATTCTGCAGAAGCTTGAGCTC
Synthetic DNA (iv) containing GGTACCCGGGGATCCT (SEQ ID NO: 5) and its complementary nucleotide sequence: CTAGAGGATCCCCGGGTACCGAGCTC
AAGCTTCTGCAGAATTGTTATCCGCTCACAATTAGATCTATTATGCCAAA
ATTTATAAAATATGTCAACAATTATTTTTATAG (SEQ ID NO: 6)
100 pmol of each was dissolved in a TE buffer, held at 90 ° C. for 10 minutes, and then gradually cooled to room temperature for annealing. This double-stranded DNA fragment was used for EcoRI of pTCHGH-Na.
Ligation kit ver.2 (Takara Shuzo) was used for insertion into the -XbaI portion to obtain plasmid pNPHGH. 4) Construction of plasmid pGFPNP The plasmid pNPHGH was cleaved with BamHI (Takara Shuzo), and the terminal portion was blunted using a DNA Blunting Kit (Takara Shuzo). Next, after cutting with NdeI, a band of about 4.6 kbp was cut out by agarose electrophoresis, and QIA was extracted from the gel.
DNA using quick Gel Extraction Kit (Qiagen)
Was recovered. The plasmid pGFPuvqd was cleaved with NdeI and StuI and subjected to agarose electrophoresis to about 0.8.
Cut out the kbp band and use the QIAquick Gel Extrac from the gel.
DNA containing the structural gene of GFPuv was recovered using the tion Kit (Qiagen). Recovered DNA is pNPHG
Ligation k in the NdeI-BamHI (smoothing) part of H
It was inserted using it ver.2 (Takara Shuzo) to obtain a plasmid pGFPNP for N-terminal optimized sequence selection. Plasmid pG
FPNP is a GF transcribed by the NP2 promoter.
It is an expression plasmid containing the Puv structural gene and having NdeI, ScaI, and AgeI cleavage sites upstream of the GFPuv structural gene, and DNA fragments can be inserted using these restriction enzyme sites. Plasmid pGF
E. coli JM109 was transformed with PNP to obtain E. coli JM109 / pGFPNP.

Reference Example 2 Plasmid pNPHGHlac
Construction of ts After pNPHGH constructed in Reference Example 1 was cleaved with MscI, the terminal portion was dephosphorylated with Bacterial Alkaline Phosphatase (Nippon Gene). The plasmid pET11a (Takara Shuzo) was cleaved with NaeI, a band of about 1.6 kbp was cut out by agarose electrophoresis, and the DNA was recovered from the gel using QIAquick Gel Extraction Kit (Qiagen). The DNA fragment containing this lacI was ligated to the MscI digestion site of pNPHGH using the Ligation kit ver.
(Takara Shuzo) and inserted into the plasmid pNPHGH1
I got ac. Furthermore, the following operation was performed in order to replace the T7 terminator part with a synthetic terminator. The plasmid pNPHGHlac was cut with EspI and PvuI, a band of about 6.1 kbp was cut out by agarose gel electrophoresis, and the DNA was recovered from the gel using QIAquick Gel Extraction Kit (Qiagen). Synthetic DNA (v): TGA
GCATGCATACTAGTCTCGAGTAATCCCACAGCCGCCGCCAGTTCCGCTGG
CGGCGGCATTTTCGAT (SEQ ID NO: 7) and synthetic DNA (v
i): CGAAAATGCCGCCGCCAGCGGAACTGGCGGCGGCTGTGGGATTACT
CGAGACTAGTATGCATGC (SEQ ID NO: 8) was added to 100 pmol of each T
It was dissolved in the E buffer solution, kept at 90 ° C. for 10 minutes, then gradually cooled to room temperature and annealed. This DNA is pNP
Ligation kit on the EspI-PvuI part of HGHlac
Ligation was performed using ver.2 (Takara Shuzo) to obtain the plasmid pNPHGHlacts.

Example 1 Construction of plasmid pKMNP for high expression promoter search For high expression promoter search, primary selection using a kanamycin resistance gene as a reporter was followed by secondary selection using GFP (green fluorescent protein) as a reporter. It was carried out by doing. Construction of the plasmid pKMNP used for primary selection was performed as follows (FIG. 1).
The plasmid pACYC177 (Wako Pure Chemical Industries, Ltd.) was cleaved with restriction enzymes NheI and XhoI, and a band of about 3.6 kbp was cut out by agarose electrophoresis, and QIA was extracted from the gel.
DN using quick Gel Extraction Kit (Qiagen)
A was collected. Synthetic DNA1: CTAGCGAATTCGAGCATATGAG
CACTAGTGCATGCGAGCCATATTCAACGGGAAACGTCTTGC (SEQ ID NO: 9) and synthetic DNA2: TCGAGCAAGACGTTTCCCGTTGAA
TATGGCTCGCATGCACTAGTGCTCATATGCTCGAATTCG (SEQ ID NO: 10) Each 100 pmol was dissolved in TE buffer, and synthetic DNA 1 and synthetic DNA 2 (each 0.1 mmole / L) 2 μL, ATP solution 2 μ
L, T4 polynucleotide kinase 1 μL, attached 10
x Reaction buffer (2 μL) and distilled water (11 μL) were added, and the temperature was 37 ° C.
The reaction was carried out for 1 hour to perform phosphorylation. 10 at 90 ° C
After holding for a minute, it was gradually cooled to room temperature and annealed. This annealed DNA fragment was designated as pACYC.
Ligation kit ver.2 on NheI-XhoI part of 177
(Takara Shuzo) to obtain a plasmid pACYCMII in which restriction enzymes EcoRI and SphI cleavage sites were introduced upstream of the kanamycin resistance gene. Plasmid p
ACYCMII was cut with EcoRI and SphI, a band of about 3.6 kbp was cut out by agarose gel electrophoresis, and DNA was recovered from the gel using QIAquick Gel Extraction Kit (Qiagen). P constructed in Reference Example 1
GFPNP was cleaved with EcoRI and NdeI, a band of about 0.15 kbp was cut out by agarose gel electrophoresis, and DNA was recovered from the gel using QIAquick Gel Extraction Kit (Qiagen). Synthetic DNA3: TATGAGGGTACC
GCCGGCTGCATG (SEQ ID NO: 11) and synthetic DNA4: CA
GCCGGCGGTACCCTCA (SEQ ID NO: 12) 100 pmol each TE
Dissolve in buffer and synthesize DNA3 and DNA4 (0.
1 mmole / L) 2 μL each, ATP solution 2 μL, T4 polynucleotide kinase 1 μL, attached 10x reaction buffer 2 μL
And 11 μL of distilled water were added, and the mixture was reacted at 37 ° C. for 1 hour to perform phosphorylation. After holding at 90 ° C. for 10 minutes, it was gradually cooled to room temperature and annealed. This annealed DNA fragment and pGFPNP EcoRI-
The NdeI fragment was added to EcoRI-Sp of pACYCMII.
The ligation kit ver.2 (Takara Shuzo) was inserted into the hI portion to obtain a plasmid pKMNP. This plasmid has a kanamycin resistance gene downstream of the NP2 promoter (FIG. 8) that functions in E. coli. By replacing this promoter region with a candidate promoter sequence having a random sequence between the −35 region and the −10 region, it is possible to search for a high expression promoter using kanamycin resistance as an index.

Example 2 Construction of plasmid pGFPNPv3 for high expression promoter search Construction of pGFPNPv3 used for secondary selection was carried out as follows (FIG. 2). Synthetic DNA5: GATGAGCTCTACAAATAATAAATTCC in order to eliminate the EcoRI cleavage site present downstream of the GFPuv structural gene within the EcoRI cleavage sites present in two places in pGFPNP constructed in Reference Example 1.
AACTGAGCGC (SEQ ID NO: 13) and synthetic DNA6: GCGC
TCAGTTGGAATTTATTATTTGTAGAGCTCATC (SEQ ID NO: 14)
Using Quick Change Site Directed Mutagenesis Kit
EcoRI existing downstream of the GFPuv structural gene by site-directed mutagenesis (manufactured by Stratagene)
A plasmid pGFPNPv3 in which the cleavage site was deleted was obtained. Since the plasmid pGFPNPv3 has NdeI and EcoRI cleavage sites upstream of the GFPuv structural gene, it is possible to use GF with the candidate promoter sequence primarily selected using the plasmid pKMRND constructed in Example 3 below.
It is possible to replace the NP2 promoter sequence upstream of Puv. Thereby, the expression efficiency of the candidate promoter can be measured by the fluorescence intensity of GFPuv.

Example 3 The primary selection plasmid pKMNP using the kanamycin resistance gene as a reporter was digested with the restriction enzyme BglII (Takara Shuzo).
And digested with EcoRI (Takara Shuzo) and removed the band of about 50 bp by agarose gel electrophoresis.
The DNA fragment was purified using l Extraction Kit (Qiagen). The obtained DNA fragment lacks the NP2 promoter region upstream of the kanamycin resistance gene. Next, synthetic DNA 7: ACAATTAGATCTATTATGNNNNNNNNNNNN
Using NNNNNTGTCAACAATTATTTTTATAGAATTCATCGATAAGCTT (SEQ ID NO: 15) as a template, synthetic DNA8: AAGCTTATCG
Using ATGAATTC (SEQ ID NO: 16) as a primer
Double-stranded DNA by Z-Taq DNA polymerase (Takara Shuzo)
Was prepared. The extension reaction solution contained Z-Taq DNA polymerase 1
0 μL, 50 μL of the attached 10x Reaction buffer, dNTP
80 μL of mixture, 3. Synthetic DNA7 (141 μmol / L) 3.
6 μL, synthetic DNA 8 (100 μmol / L) 5 μL, distilled water
It was prepared by adding 490 μL. The extension reaction was carried out at 95 ° C for 15 seconds and 68 ° C for 15 minutes. After the reaction solution after the extension reaction was concentrated and desalted using Microcon 30 (Japan Millipore), double-stranded DNA was cleaved with BglII (Takara Shuzo) and EcoRI (Takara Shuzo). The double-stranded DNA was cleaved with a restriction enzyme as follows. A reaction solution consisting of 25 μL of the reaction solution after concentration and desalting, 3 μL of Buffer H (Takara Shuzo), 1 μL of BglII and EcoRI was kept at 37 ° C. for one day to carry out the cleavage reaction. The reaction liquid after this cutting is Microcon 30 (Japan Millipore)
After concentrating and desalting with, the band of about 50 bp was cut out by agarose gel electrophoresis, and the QIAquick Gel was used.
The DNA fragment was purified using Extraction Kit (Qiagen). This DNA fragment was designated as BglII-of pKMNP.
Ligation kit ver.2 (Takara Shuzo) was used for insertion into the EcoRI portion, and E. coli MM294 was transformed. 10 μL of the ligation solution was added to 100 μL of E. coli MM294 strain competent cells that had been ice-cooled, and the mixture was left to stand under ice cooling for 30 minutes. Then, after heat shock at 42 ° C. for 45 seconds, 900 μL of SOC medium was added and shake culture was carried out for 1 hour. The shake-cultured culture solution was inoculated into LB medium containing kanamycin (100 mg / L). By culturing in a medium containing kanamycin, a clone carrying a plasmid having a nucleotide sequence having a high promoter activity inserted in the promoter portion upstream of the kanamycin resistance gene selectively grows. After culturing overnight at 37 ° C., the cells were collected and the plasmid was purified from the cells using the QIAprep plasmid kit (Qiagen). These plasmids pKMRND are plasmids in which a candidate promoter having a random base sequence is inserted upstream of the kanamycin resistance gene (Fig. 3).

Example 4 Secondary selection pGFPNPv3 using GFP as a reporter was cleaved with restriction enzymes EcoRI (Takara Shuzo) and NdeI (Takara Shuzo), and a band of about 150 bp was removed by agarose electrophoresis to remove QIAquickGel Extr.
A DNA fragment lacking the promoter region upstream of GFP was obtained using action Kit (Qiagen). The plasmid pKMRND obtained in Example 3 was digested with the restriction enzyme EcoRI.
Cleavage with (Takara Shuzo) and NdeI (Takara Shuzo), excision of about 150 bp band by agarose electrophoresis, and QI
Using Aquick Gel Extraction Kit (Qiagen),
A DNA fragment containing a promoter region having a random sequence was purified. This DNA fragment was designated as E of pGFPNPv3.
It was inserted into the coRI-NdeI portion using Ligation kit ver.2 (Takara Shuzo) (FIG. 4), Escherichia coli MM294 strain was transformed, and spread on LB agar medium containing 10 mg / L tetracycline and incubated at 37 ° C. for 1 hour. It was cultured overnight to form colonies. This colony was inoculated into 0.5 mL of LB medium containing 10 mg / L tetracycline. After culturing at 37 ° C overnight, 50 mL of each colony culture solution was transferred to a 96-well microplate in which 150 mL of physiological saline had been dispensed in advance, and the absorbance at 650 nm (A ₆₅₀ ) was read on a 96-microplate reader. (Nippon Molecular Devices Co., Ltd.), and the fluorescence intensity at an excitation wavelength of 355 nm and a measurement wavelength of 538 nm was measured with a multi-plate fluorescence measuring device (Dainippon Pharmaceutical Co., Ltd.). The value obtained by dividing the fluorescence intensity by the absorbance was shown as the GFP expression efficiency (Fig. 5). Synthetic DN for each colony
A9: TTCATACACGGTGCCTGACTGCGTTAG (SEQ ID NO: 1
7) and synthetic DNA 10: TCAACAAGAATTGGGACAACTCC
Colony PCR was performed using (SEQ ID NO: 18), and insertion of the target DNA fragment was confirmed by agarose electrophoresis. In addition, the product of colony PCR was used as QIAquick PCR Purif
Purified using ication Kit (Qiagen), synthetic DN
As a result of nucleotide sequence analysis using A9 and synthetic DNA10, pGFPRND showed the highest GFP expression efficiency.
No. 6, it was revealed that it had the sequence shown in FIG. 6 upstream of GFP. The underlined portion in the figure (base sequence represented by SEQ ID NO: 34) indicates a region using a random sequence. The promoter sequence obtained here is referred to as the NP3 promoter in the present specification (FIG. 8).

Example 5 Comparison of promoter activities in Escherichia coli strains High expression promoter (NP3) obtained in Example 4 above
GFP expression plasmid pGFPRND No.
6 and pGFPNPv3 having NP2 promoter were used to transform Escherichia coli MM294, JM109, HB101 and DH5 strains, which were applied to LB agar medium containing 10 mg / L tetracycline and cultured overnight at 37 ° C to form colonies. Let 1 randomly formed colony
0 clones were taken and this colony was inoculated into 0.5 mL of LB medium containing 10 mg / L of tetracycline. After culturing overnight at 37 ° C, transfer 50 mL of each colony culture solution to a 96-well microplate in which 150 mL of physiological saline was previously dispensed, and then measure the absorbance at 650 nm (A ₆₅₀ ) with a 96 microplate reader. (Nippon Molecular Devices Co., Ltd.), and the fluorescence intensity at excitation wavelength: 355 nm and measurement wavelength: 538 nm is measured by a multi-plate fluorescence measuring device (Dainippon Pharmaceutical Co., Ltd.)
It was measured by. The value obtained by dividing the fluorescence intensity by the absorbance was shown as the GFP expression efficiency. As shown in FIG. 7, the NP3 promoter selected in Example 4 was MM294, JM used.
109, HB101 and DH5 strains, N in all strains
The expression efficiency was 1.4 to 2.4 times higher than that of the P2 promoter (Fig. 7). It was revealed that the sequence found in Example 4 has a high promoter activity regardless of the type of E. coli host.

Example 6 Ability to express other -10 sequences The NP3 promoter is characterized by the nucleotide sequence of the region between the -35 sequence and the -10 sequence of the NP2 promoter as shown in FIG. This sequence is used in the trp promoter as shown in Fig. 8 in order to examine whether or not high expression can be obtained regardless of the type of other sequences in the promoter, for example, the nucleotide sequence of the -10 region. A promoter having the sequence obtained in Example 4 in the region between the sequence and the −10 sequence was constructed. This promoter was named trp3. Trp upstream of the GFP structural gene
The expression plasmid having a promoter or trp3 promoter was constructed as follows. The plasmid pGFPNPv3 obtained in Example 2 was digested with the restriction enzyme EcoR.
Cut with I (Takara Shuzo) and BglII (Takara Shuzo),
A band of about 4.9 kbp was cut out by agarose electrophoresis, and a DNA fragment lacking the promoter region upstream of GFP was obtained using QIAquick Gel Extraction Kit (Qiagen). Synthetic DNA11: AATTCTATAAAAATAATTGTTGAC
AATTAATCATCGGCTCGTATAATA (SEQ ID NO: 19) and synthetic DNA12: GATCTATTATACGAGCCGATGATTAATTGTCAACAATT
From ATTTTTATAG (SEQ ID NO: 20), the trp promoter is used as a synthetic DNA 13: AATTCTATAAAAATAATTGTTGACAACGCG
CCCAGCGAGTACTATAATA (SEQ ID NO: 21) and synthetic DN
A14: GATATTTTTATTAACAACTGTTGCGCGGGTCGCTCATGATAT
The trp3 promoter was constructed from TATCTAG (SEQ ID NO: 22). That is, synthetic DNA11 and synthetic DNA1
2, or synthetic DNA13 and synthetic DNA14 (each 0.1
mmole / L) 2 μL each, ATP solution 2 μL, T4 polynucleotide kinase 1 μL, attached 10 × reaction buffer 2 μL and distilled water 11 μL were added, and the mixture was reacted at 37 ° C. for 1 hour to perform phosphorylation. Furthermore, after holding at 95 ° C. for 10 minutes, annealing was performed by gradually cooling to room temperature. This annealed DNA fragment was ligated to the EcoRI-BglII portion of the plasmid pGFPNPv3.
E. coli JM inserted using tion kit ver.2 (Takara Shuzo)
The 109 strain was transformed, spread on LB agar medium containing 10 mg / L tetracycline, and cultured overnight at 37 ° C. to form colonies. This colony was inoculated into 0.5 mL of LB medium containing 10 mg / L tetracycline. After culturing overnight at 37 ° C, 50 mL of each colony culture solution was transferred to a 96-well microplate in which 150 mL of physiological saline was previously dispensed, and then the absorbance at 650 nm (A ₆₅₀ ) was 96 microplate. Leader (Japan Molecular Devices Co., Ltd.)
The fluorescence intensity at an excitation wavelength of 355 nm and a measurement wavelength of 538 nm was measured by a multi-plate fluorescence measuring device (Dainippon Pharmaceutical Co., Ltd.). The value obtained by dividing the fluorescence intensity by the absorbance is G
It was shown as the FP expression efficiency (FIG. 9). The trp3 promoter having the sequence obtained in Example 4 between the −35 region and −10 region of the trp promoter showed higher expression efficiency than the trp promoter. From this, it is considered that the promoter having the sequence found in Example 4 between the −35 and −10 regions has high expression efficiency regardless of the type of the nucleotide sequences in the −35 and −10 regions.

Example 7 Optimization of Human Growth Hormone N-Terminal Nucleotide Sequence An optimal human growth hormone N-terminal nucleotide sequence for expression was selected. 1) pGFPNP was cleaved with restriction enzymes AgeI (Nippon Gene) and NdeI (Takara Shuzo), and a band of about 4.9 kbp was cut out by agarose electrophoresis, and QIAquic
DNA using k Gel Extraction Kit (Qiagen)
A fragment was obtained. Synthetic DNA15: TATGTTCCCAACCATTCCCTTA
TCCAGGCTTTTTGACAACGCTTTA (SEQ ID NO: 23) and synthetic DNA16: CCGGTAAAGCGTTGTCAAAAAGCCTGGATAAGGGAATG
Synthetic DNA15 or synthetic DNA16 (0.1 mmol) for phosphorylating the 5'end of GTTGGGAACA (SEQ ID NO: 24)
/ L) 2 μL each, T4 polynucleotide kinase (Nippon Gene) 2 μL, attached 10x Reaction buffer 2 μL, A
2 μL of TP and 13 μL of distilled water were added, and the reaction was carried out at 37 ° C. for 1 hour. The reaction solution was kept at 96 ° C. for 10 minutes and then gradually cooled to room temperature to form a double strand. This DNA
The fragment was ligated to the AgeI-NdeI portion of pGFPNP.
on kit ver.2 (Takara Shuzo) was used to obtain an expression plasmid pGFPGHNa having a natural base sequence of the human growth hormone N-terminal portion upstream of GFP (FIG. 10). 2) pGFPNP was cleaved with the restriction enzymes AgeI (Nippon Gene) and NdeI (Takara Shuzo), and a band of about 4.9 kbp was cut out by agarose electrophoresis, and QIAquic
DNA using k Gel Extraction Kit (Qiagen)
A fragment was obtained. A random base sequence encoding the N-terminal amino acid of human growth hormone was prepared as follows. Synthetic DNA 17 containing mixed bases: TCAAGAGTTTACCGGT
AAAGCGTTGTCAAAAAGCCTNGANAGNGGDATNGTNGGRAACATATGTTG
GCGCGCCTT (SEQ ID NO: 25), synthetic DNA18: TCAAG
AGTTTACCGGTAAAGCGTTGTCAAAAAGCCTRCTNAGNGGDATNGTNGGR
AACATATGTTGGCGCGCCTT (SEQ ID NO: 26), synthetic DNA
19: TCAAGAGTTTACCGGTAAAGCGTTGTCAAAAAGCCTNGAYAANG
GDATNGTNGGRAACATATGTTGGCGCGCCTT (SEQ ID NO: 27)
And synthetic DNA20: TCAAGAGTTTACCGGTAAAGCGTTGTCAAA
Synthetic DNA21: AAGGCG using AAGCCTRCTYAANGGDATNGTNGGRAACATATGTTGGCGCGCCTT (SEQ ID NO: 28) as a template
Double-stranded D by C-Taq DNA polymerase (Takara Shuzo) using CGCCAACATATG (SEQ ID NO: 29) as a primer
NA was prepared. Each 5 μL of the extension reaction solution is Z-Taq DNA pol.
4μL of ymerase, 10μ of attached 10x Reaction buffer
L, dNTP mixture 16 μL, synthetic DNA17 (44.4 μmo
l / L), synthetic DNA18 (22.2 μmol / L), synthetic DNA1
9 (22.2 μmol / L) and synthetic DNA 20 (11.1 μmol / L)
2 μL each, synthetic DNA 21 (100 μmol / L each) 3 μL, and distilled water 56 μL were prepared. The extension reaction is 95 ° C, 5 seconds; 55 ° C, 5 seconds; and 72 ° C, 10
Performed by minutes. After the reaction solution after the extension reaction was concentrated and desalted using Microcon 30 (Japan Millipore), double-stranded DNA was cleaved with Age I (Nippon Gene) and Nde I (Takara Shuzo). From this reaction solution after cleavage with Age I and Nde I, QIAquick Gel Extraction K
The DNA fragment was purified using it (Qiagen). This DNA fragment was ligated to the Nde I-Age I portion of pGFPNP.
Insert using ion kit ver.2 (Takara Shuzo)
Expression plasmid pG having a random base sequence encoding the N-terminal amino acid of human growth hormone in the terminal portion
FPGHNO was constructed (Figure 11). Plasmid pGF
E. coli M using PGHNa or pGFPGHNO
The M294 strain was transformed, spread on LB agar medium containing 10 mg / L tetracycline, and cultured overnight at 37 ° C. to form colonies. This colony was inoculated into 0.5 mL of LB medium containing 10 mg / L tetracycline. 37
After culturing overnight at ℃, transfer 50 mL of each colony culture solution to a 96-well microplate in which 150 mL of physiological saline was dispensed beforehand, and then measure the absorbance at 650 nm (A ₆₅₀ ) with a 96 microplate reader. (Nippon Molecular Devices Co., Ltd.), and the fluorescence intensity at an excitation wavelength of 355 nm and a measurement wavelength of 538 nm was measured with a multi-plate fluorescence measuring device (Dainippon Pharmaceutical Co., Ltd.). The value obtained by dividing the fluorescence intensity by the absorbance was shown as the GFP expression efficiency. pGFPPHNO clone no. The GFP expression efficiency of 12 is pGFPGHNa
It was about 20% higher than that of (Fig. 13). pGFPGH
No clone No. The base sequence of 12 had four bases replaced as compared to the natural base sequence (Fig. 1).
2).

Example 8 Construction of Human Growth Hormone Expression Strain Using T7 Promoter Human growth hormone expression plasmid pTCHGH-Na using T7 promoter described in WO00 / 20439
Restriction enzymes AgeI (Nippon Gene) and NdeI
Cut by (Takara Shuzo), and agarose gel electrophoresis
Cut out the 4.9 kbp band and use QIAquick Gel Extraction
A DNA fragment was obtained using Kit (Qiagen). Synthetic DNA2 using plasmid pTCHGH-Na as a template
2: AATGCTAAGAGCCCATCGTCTGCACCAGC (SEQ ID NO: 3
0), a synthetic DNA23: CTGTAGGTCTGCTTGAAGATCTGC (SEQ ID NO: 31) was used to carry out a PCR reaction with Pfu DNA polymerase (Takara Shuzo). PCR reaction solution is Pfu DN
2 μL of A polymerase, 10 μL of attached 10x Reaction buffer, 10 μL of dNTP mixture, plasmid pTCH
GH-Na (157 ng / μL) was added in an amount of 0.2 μL, synthetic DNA 22 and synthetic DNA 23 (each 100 μmol / L) was added in an amount of 1 μL, and distilled water was added in an amount of 75.2 μL. The PCR reaction was carried out at 98 ° C for 1 second; 55 ° C for 3 seconds; and 72 ° C for 7 seconds for 25 cycles. QIAquick PCR purificat after PCR reaction
The amplified DNA fragment was purified using an ion kit. Restriction enzymes BstXI (Takara Shuzo) and BanII (Takara Shuzo)
Cleavage, cut out a band of about 0.25 kbp by agarose gel electrophoresis, and use the QIAquick Gel Extraction Kit.
(Qiagen) was used to obtain a DNA fragment. Synthetic DNA
24: TATGTTTCCCACCATACCCTTATCAAGGCTTTTTG (SEQ ID NO: 32) and synthetic DNA 25: CAAAAAGCCTTGATAAGGGT
In order to phosphorylate the 5'end of ATGGTGGGAAACA (SEQ ID NO: 33), synthetic DNA24 and synthetic DNA25 (100 µ
mol / L) 2 μL each, T4 polynucleotide kinase (Nippon Gene) 1 μL, attached 10x Reaction buffer 2 μL,
ATP (2 μL) and distilled water (11 μL) were added, and the reaction was carried out at 37 ° C. for 1 hour. After keeping the reaction solution at 96 ° C for 10 minutes,
It was slowly cooled to room temperature to form a double strand. This DN
A fragment and BanII derived from the PCR product obtained above
-BstXI fragment to NdeI-B of pTCHGH-Na
A human growth hormone expression plasmid pT having an optimized N-terminal base sequence inserted downstream of the T7 promoter by inserting it into the stXI portion using Ligation kit ver.2 (Takara Shuzo)
CHGHNO12 was obtained (FIG. 14). Next, a human growth hormone expression plasmid pNPHGHNO12 having an optimized N-terminal base sequence downstream of the NP2 promoter was constructed as follows. PNP constructed in Reference Example 2
HGHlacts are the restriction enzymes NdeI (Takara Shuzo) and B
Cut with pu1102I (Takara Shuzo), cut out a band of about 5.5 kbp by agarose electrophoresis, and use QIAquick.
A DNA fragment was obtained using Gel Extraction Kit (Qiagen). The plasmid pTCHGHNO12 was cleaved with restriction enzymes NdeI (Takara Shuzo) and Bpu1102I (Takara Shuzo), and a band of about 0.6 kbp was cut out by agarose electrophoresis, and a DNA fragment was obtained using QIAquick Gel Extraction Kit (Qiagen). This DNA fragment was designated as NdeI-Bpu1102I of pNPHGHlacts.
Insert it in the part using Ligation kit ver.2 (Takara Shuzo),
An expression plasmid pNPHGHNO12 was obtained (Fig. 1
5). The plasmid pNPHGHNO12 is a restriction enzyme Nh.
Cleavage was performed with eI (Takara Shuzo) and NdeI (Takara Shuzo), a band of about 5.8 kbp was cut out by agarose electrophoresis, and a DNA fragment was obtained using QIAquick Gel Extraction Kit (Qiagen). The plasmid pGFPRND No. obtained in Example 4 was used. 6 was cleaved with restriction enzymes NheI (Takara Shuzo) and NdeI (Takara Shuzo), and a band of about 0.4 kbp was cut out by agarose electrophoresis.
DNA using k Gel Extraction Kit (Qiagen)
A fragment was obtained. This DNA fragment was inserted into the NheI-NdeI portion of pNPHGHNO12 using Ligation kit ver.2 (Takara Shuzo) to obtain the expression plasmid pNP3GHNO.
12 was obtained (FIG. 16).

Example 9 Construction of Human Growth Hormone Expression Strain Using NP3 Promoter Escherichia coli MM294 Using Plasmid pTCHGH-Na
(DE3) strain was transformed, and human growth hormone expressing strain MM294 (DE3) / p using T7 promoter was transformed.
TCHGH-Na was obtained. Plasmid pNP3GHNO
Escherichia coli MM294 strain was transformed with 12 and NP
Human growth hormone expressing strain MM2 using 3 promoters
94 / pNP3GHNO12 was obtained.

Example 10 Human Growth Hormone Expression-1 Using the NP3 Promoter-1 Human growth hormone expressing strain MM294 (DE3) / pTCHGH-using the T7 promoter obtained in Example 9
Human growth hormone expression strain MM294 / pNP3GHNO12 using Na and NP3 promoter was added to LB medium (1% peptone, 0.5%) containing 10 mg / L of tetracycline.
% Yeast extract, 0.5% sodium chloride) 1 liter, and it culture | cultivated at 30 degreeC for 16 hours. 75 mL each of the obtained culture solution
1.5 liter of main fermentation medium (1.68% sodium monohydrogen phosphate, 0.3% sodium dihydrogen phosphate, 0.1% ammonium chloride, 0.05% sodium chloride, 0.024% magnesium sulfate, 0.02% Newpol LB-625, 0.0005% Thiamine hydrochloride, 1.5% glucose, 1.0% casamino acid, 1.0% yeast extract) was transferred to a 3L capacity jar culture tank, and aeration and agitation culture was performed at 37 ° C, aeration rate of 16 L / min, and agitation speed of 200 rpm. Started. The turbidity of the culture solution is MM294
The (DE3) / pTCHGH-Na strain reached MM294 / pNP3GHNO12 when it reached about 1200 clet units.
When the strain reaches about 600 klet units, 0.075 mmole /
L portion of isopropyl-β-D-thiogalactopyranoside (IPTG) was added. From 4 hours after the start of culture, 20 g of glucose was added per hour, and the culture was continued until 18 hours after the start of culture. 0.2 mL of the culture solution was withdrawn with time, centrifuged at 12000 rpm for 10 minutes, the supernatant was discarded, and the resulting cells were used to measure the expression level of human growth hormone by the ELISA method. The cells obtained from 0.2 mL of the culture solution were well suspended by adding 0.5 mL of 0.1 mol / L Tris buffer solution (pH 7.0). 0.1 mL of this suspension was added to the extraction buffer (2.5
After adding 0.4 mL of 0.1 mol / L Tris buffer containing sodium dodecyl sulfate (4 mL) and stirring well, ultrasonic disruption was performed at 4 ° C. for 5 minutes using Bioruptor (Olympus).
After sonication, centrifugation was performed at 13,000 rpm at 4 ° C for 10 minutes, and the resulting supernatant was diluted with a dilution buffer (0.02 mol
/ L phosphate buffer, 0.14mol / L sodium chloride, 10% Block Ace (Snow Brand Milk Products), 0.1% Tween20, 0.02% Mert
It was diluted 20603 times with hiolate). Add 0.1 mL of this diluent beforehand.
It was added to a 96-well microwell plate coated with 5 μg / mL of anti-human growth hormone monoclonal antibody, and left at room temperature for 2 hours. Then wash each well with wash buffer (0.02 mol / L phosphate buffer, 0.14 mol / L sodium chloride, 0.1% Tween20) and then add biotinylated rabbit anti-human growth hormone polyclonal antibody solution (5 μg / mL). The mixture was left at room temperature for 1 hour. After thoroughly washing each well with a washing buffer, a 500-fold diluted alkaline phosphatase-streptavidin (Vector) solution was added and left at room temperature for 30 minutes. Further, after thoroughly washing each well with a washing buffer, bluephos microwell phosphatase substrate
The system was used to measure alkaline phosphatase activity in each well. The amount of human growth hormone expressed is the human growth hormone expression strain MM294 (DE3) / pTCHGH-N.
It was shown as a relative value with the maximum expression time per culture medium of strain a as 100 (FIG. 17).

Example 11 Human Growth Hormone Expression-2 Using NP3 Promoter The human growth hormone expression strain MM294 / pNP3GHNO12 using the NP3 promoter was expressed in the same manner as in Example 10. However, 4, 5, 7, and 8 hours after the start of the culture, 0.35% of each yeast extract was supplied and the culture was performed. The expression level of human growth hormone was measured in the same manner as in Example 10, and MM294 (DE
The maximum expression level of 3) / pTCHGH-Na per culture solution is shown as 100. MM294 (DE3), pTCH
In GH-Na, an increase in the expression level was not observed even when the yeast extract was additionally supplied, but MM294 /
In the pNP3GHNO12 strain, the expression level increased up to 1.3 times by additionally supplying the yeast extract (FIG. 18).

[0038]

INDUSTRIAL APPLICABILITY Since the DNA having the NP3 promoter region of the present invention has an excellent promoter activity, it is possible to efficiently connect a structural gene encoding a peptide or protein of interest to the downstream of the promoter. The target peptide or protein can be produced in large quantities.

[0039]

[Sequence list] Sequence Listing <110> Takeda Chemical Industries, Ltd. <120> Novel Promoter <130> P02-0062 <150> JP 2001-171607 <151> 2001-06-06 <160> 39 <210> 1 <211> 28 <212> DNA <213> Artificial sequence <220> <223> Primer <400> 1 cgttatccgg atcacatgaa acggcatg 28 <210> 2 <211> 28 <212> DNA <213> Artificial sequence <220> <223> Primer <400> 2 catgccgttt catgtgatcc ggataacg 28 <210> 3 <211> 33 <212> DNA <213> Artificial sequence <220> <223> Synthetic DNA <400> 3 agcttcatat gttcgaagta ctagatctgg tac 33 <210> 4 <211> 25 <212> DNA <213> Artificial sequence <220> <223> Synthetic DNA <400> 4 cagatctagt acttcgaaca tatga 25 <210> 5 <211> 109 <212> DNA <213> Artificial sequence <220> <223> Synthetic DNA <400> 5 aattctataa aaataattgt tgacatattt tataaatttt ggcataatag atctaattgt 60 gagcggataa caattctgca gaagcttgag ctcggtaccc ggggatcct 109 <210> 6 <211> 109 <212> DNA <213> Artificial sequence <220> <223> Synthetic DNA <400> 6 ctagaggatc cccgggtacc gagctcaagc ttctgcagaa ttgttatccg ctcacaatta 60 gatctattat gccaaaattt ataaaatatg tcaacaatta tttttatag 109 <210> 7 <211> 69 <212> DNA <213> Artificial sequence <220> <223> Synthetic DNA <400> 7 tgagcatgca tactagtctc gagtaatccc acagccgccg ccagttccgc tggcggcggc 60 attttcgat 69 <210> 8 <211> 64 <212> DNA <213> Artificial sequence <220> <223> Synthetic DNA <400> 8 cgaaaatgcc gccgccagcg gaactggcgg cggctgtggg attactcgag actagtatgc 60 atgc 64 <210> 9 <211> 63 <212> DNA <213> Artificial sequence <220> <223> Synthetic DNA <400> 9 ctagcgaatt cgagcatatg agcactagtg catgcgagcc atattcaacg ggaaacgtct 60 tgc 63 <210> 10 <211> 63 <212> DNA <213> Artificial sequence <220> <223> Synthetic DNA <400> 10 tcgagcaaga cgtttcccgt tgaatatggc tcgcatgcac tagtgctcat atgctcgaat 60 tcg 63 <210> 11 <211> 24 <212> DNA <213> Artificial sequence <220> <223> Synthetic DNA <400> 11 tatgagggta ccgccggctg catg 24 <210> 12 <211> 18 <212> DNA <213> Artificial sequence <220> <223> Synthetic DNA <400> 12 cagccggcgg taccctca 18 <210> 13 <211> 36 <212> DNA <213> Artificial sequence <220> <223> Synthetic DNA <400> 13 gatgagctct acaaataata aattccaact gagcgc 36 <210> 14 <211> 36 <212> DNA <213> Artificial sequence <220> <223> Synthetic DNA <400> 14 gcgctcagtt ggaatttatt atttgtagag ctcatc 36 <210> 15 <211> 73 <212> DNA <213> Artificial sequence <220> <221> variation <222> (19) ... (35) <223> Synthetic DNA <400> 15 acaattagat ctattatgnn nnnnnnnnnn nnnnntgtca acaattattt ttatagaatt 60 catcgataag ctt 73 <210> 16 <211> 18 <212> DNA <213> Artificial sequence <220> <223> Synthetic DNA <400> 16 aagcttatcg atgaattc 18 <210> 17 <211> 27 <212> DNA <213> Artificial sequence <220> <223> Synthetic DNA <400> 17 ttcatacacg gtgcctgact gcgttag 27 <210> 18 <211> 23 <212> DNA <213> Artificial sequence <220> <223> Synthetic DNA <400> 18 tcaacaagaa ttgggacaac tcc 23 <210> 19 <211> 48 <212> DNA <213> Artificial sequence <220> <223> Synthetic DNA <400> 19 aattctataa aaataattgt tgacaattaa tcatcggctc gtataata 48 <210> 20 <211> 48 <212> DNA <213> Artificial sequence <220> <223> Synthetic DNA <400> 20 gatctattat acgagccgat gattaattgt caacaattat ttttatag 48 <210> 21 <211> 49 <212> DNA <213> Artificial sequence <220> <223> Synthetic DNA <400> 21 aattctataa aaataattgt tgacaacgcg cccagcgagt actataata 49 <210> 22 <211> 49 <212> DNA <213> Artificial sequence <220> <223> Synthetic DNA <400> 22 gatattttta ttaacaactg ttgcgcgggt cgctcatgat attatctag 49 <210> 23 <211> 46 <212> DNA <213> Artificial sequence <220> <223> Synthetic DNA <400> 23 tatgttccca accattccct tatccaggct ttttgacaac gcttta 46 <210> 24 <211> 48 <212> DNA <213> Artificial sequence <220> <223> Synthetic DNA <400> 24 ccggtaaagc gttgtcaaaa agcctggata agggaatggt tgggaaca 48 <210> 25 <211> 75 <212> DNA <213> Artificial sequence <220> <221> variation <222> (37), (40), (43), (46), (49), (52), (55) <223> Synthetic DNA <400> 25 tcaagagttt accggtaaag cgttgtcaaa aagcctngan agnggdatng tnggraacat 60 atgttggcgc gcctt 75 <210> 26 <211> 75 <212> DNA <213> Artificial sequence <220> <221> variation <222> (37), (40), (43), (46), (49), (52), (55) <223> Synthetic DNA <400> 26 tcaagagttt accggtaaag cgttgtcaaa aagcctrctn agnggdatng tnggraacat 60 atgttggcgc gcctt 75 <210> 27 <211> 75 <212> DNA <213> Artificial sequence <220> <221> variation <222> (37), (40), (43), (46), (49), (52), (55) <223> Synthetic DNA <400> 27 tcaagagttt accggtaaag cgttgtcaaa aagcctngay aanggdatng tnggraacat 60 atgttggcgc gcctt 75 <210> 28 <211> 75 <212> DNA <213> Artificial sequence <220> <221> variation <222> (37), (40), (43), (46), (49), (52), (55) <223> Synthetic DNA <400> 28 tcaagagttt accggtaaag cgttgtcaaa aagcctrcty aanggdatng tnggraacat 60 atgttggcgc gcctt 75 <210> 29 <211> 18 <212> DNA <213> Artificial sequence <220> <223> Synthetic DNA <400> 29 aaggcgcgcc aacatatg 18 <210> 30 <211> 30 <212> DNA <213> Artificial sequence <220> <223> Synthetic DNA <400> 30 atatgctaag agcccatcgt ctgcaccagc 30 <210> 31 <211> 24 <212> DNA <213> Artificial sequence <220> <223> Synthetic DNA <400> 31 ctgtaggtct gcttgaagat ctgc 24 <210> 32 <211> 35 <212> DNA <213> Artificial sequence <220> <223> Synthetic DNA <400> 32 tatgtttccc accataccct tatcaaggct ttttg 35 <210> 33 <211> 33 <212> DNA <213> Artificial sequence <220> <223> Synthetic DNA <400> 33 caaaaagcct tgataagggt atggtgggaa aca 33 <210> 34 <211> 17 <212> DNA <213> Artificial sequence <220> <223> novel promoter sequence <400> 34 acgcgcccag cgagtac 17 <210> 35 <211> 29 <212> DNA <213> Artificial sequence <220> <223> NP3 promotor <400> 35 ttgacaacgc gcccagcgag taccataat 29 <210> 36 <211> 29 <212> DNA <213> Artificial sequence <220> <223> trp3 promotor <400> 36 ttgacaacgc gcccagcgag tactatact 29 <210> 37 <211> 6 <212> DNA <213> E.coli <220> <223> -35 region <400> 37 ttgaca 6 <210> 38 <211> 6 <212> DNA <213> E.coli <220> <223> -10 region <400> 38 cataat 6 <210> 39 <211> 6 <212> DNA <213> E.coli <220> <223> -10 region <400> 39 tatact 6

[0040]

[Brief description of drawings]

FIG. 1 shows a construction diagram of plasmid pKMNP. However, Km ^r is the kanamycin resistance gene, Amp
Means ampicillin resistance gene and Tc means tetracycline resistance gene. Ori means the origin of replication.

FIG. 2 shows a construction diagram of plasmid pGFPNPv3.

FIG. 3 shows a construction diagram of plasmid pKMRND.

FIG. 4 shows a construction diagram of plasmid pGFPRND.

FIG. 5 shows the expression efficiency of the E. coli clone obtained in Example 4.

FIG. 6 shows E. coli clone N obtained in Example 4.
o. The base sequence of the promoter portion obtained in 6 is shown.

FIG. 7 shows the expression efficiency of the E. coli clone obtained in Example 5.

FIG. 8 shows the NP3 promoter and t of the present invention.
The nucleotide sequence of the rp3 promoter is shown.

FIG. 9 shows the expression efficiency of the Escherichia coli clone obtained in Example 6.

FIG. 10 shows a construction diagram of plasmid pGFPGHNa.

FIG. 11 shows a construction diagram of plasmid pGFPGHNO.

FIG. 12 shows E. coli clone No. obtained in Example 7. 12 shows a base sequence encoding the N-terminal amino acid sequence part of human growth hormone possessed by 12.

FIG. 13 shows the expression efficiency of the E. coli clone obtained in Example 7.

FIG. 14: Plasmid pTCHGHNO12
The construction drawing of is shown.

Figure 15: Plasmid pNPHGHNO12
The construction drawing of is shown.

FIG. 16 shows the plasmid pNP3GHNO12
The construction drawing of is shown.

FIG. 17 shows the results of the culture performed in Example 10.

FIG. 18 shows the results of the culture performed in Example 11.

─────────────────────────────────────────────────── ─── Continuation of front page (51) Int.Cl. ⁷ Identification code FI theme code (reference) C12P 21/02 C12N 5/00 A (72) Inventor Masato Kuriyama 1-chome, Tomobuchicho, Osaka-shi, Osaka No. 10-110 F term (reference) 4B024 AA01 AA03 BA03 CA03 CA05 DA06 EA04 GA11 HA01 4B064 AG13 CA02 CA19 CC24 DA01 DA16 4B065 AA26X AB01 BA02 CA24 CA44

Claims (22)

[Claims] 1. A promoter containing the same or substantially the same base sequence as the base sequence represented by SEQ ID NO: 34. 2. The promoter according to claim 1, which contains the same or substantially the same nucleotide sequence as the nucleotide sequence represented by SEQ ID NO: 34, between any of the −35 region and the −10 region. 3. The promoter according to claim 2, wherein the arbitrary -35 region is the nucleotide sequence represented by SEQ ID NO: 37. 4. The arbitrary -10 region is the nucleotide sequence represented by SEQ ID NO: 38 or SEQ ID NO: 39.
The described promoter. 5. The promoter according to claim 2, which has the nucleotide sequence represented by SEQ ID NO: 35. 6. The promoter according to claim 2, which has the nucleotide sequence represented by SEQ ID NO: 36. 7. A DNA containing the promoter according to claim 1. 8. A recombinant vector containing the promoter according to claim 1 or the DNA according to claim 7. 9. The recombinant vector according to claim 8, which contains a DNA having a structural gene under the expression control of the promoter according to any one of claims 1 to 6. 10. The recombinant vector according to claim 9, which is represented by pNP3GHNO12, wherein the structural gene is human growth hormone gene. 11. A transformant transformed with the recombinant vector according to claim 9. 12. Escherichia coli MM294 / pN which is a transformant transformed with the recombinant vector according to claim 10.
P3GHNO12 (FERM BP-7611). 13. A method for producing the protein or a salt thereof, which comprises culturing the transformant according to claim 11 to produce a protein encoded by a structural gene. 14. A method for producing human growth hormone or a salt thereof, which comprises culturing the transformant according to claim 12 to produce human growth hormone. 15. The recombinant vector according to claim 9, wherein the structural gene is a reporter gene. 16. The recombinant vector according to claim 15, wherein the reporter gene is a kanamycin resistance gene or a GFP gene. 17. A transformant transformed with the recombinant vector according to claim 15. 18. A transformant transformed with the recombinant vector according to claim 16. 19. A DN containing the same or substantially the same base sequence as the base sequence represented by SEQ ID NO: 34.
A. 20. The DNA according to claim 20, which contains the same or substantially the same base sequence as the base sequence represented by SEQ ID NO: 34 between any of the −35 region and the −10 region. 21. A method according to claim 1 for producing a promoter.
Use of DNA according to 9 or 20. 22. Use of the promoter according to any one of claims 1 to 6 for producing a protein encoded by a structural gene.