JP2002542791A - Synthetic genes for expressing active retroviral proteins in eukaryotes - Google Patents

Abstract

SUMMARY OF THE INVENTION The present invention is a synthetic gene or region of a gene for high level expression of retroviral proteins in eukaryotic cells having improved codon usage as compared to a wild-type gene, comprising: The retroviral protein obtained is characterized by having enzymatic activity in eukaryotic cells. In addition, the invention relates to a synthetic gene or region of a gene encoding a retroviral enzyme or a portion of a retroviral enzyme normally expressed in a mammal or other eukaryotic cell, wherein the wild-type gene encodes the enzyme. Is replaced by a preferred codon encoding the same amino acid. The retroviral protein may be a protease, reverse transcriptase, integrase protein, or its polyprotein gag-pol precursor. In one embodiment, the retroviral protein having enzymatic activity is a lentiviral protein. In another embodiment, the protein having enzymatic activity is a pol enzyme. In a more preferred embodiment, the protein having enzymatic activity is a lentiviral integrase. In a further preferred embodiment, the enzyme is an HIV enzyme. In a more preferred embodiment, the protein having enzymatic activity is HIV integrase. The invention also includes a method for detecting intracellular integrase using a reporter gene without a promoter.

Description

DETAILED DESCRIPTION OF THE INVENTION

The present invention relates to the design of a synthetic gene for expressing a retroviral protein in a eukaryotic cell, particularly a mammalian cell, a synthetic gene, an expression vector containing the gene, and a gene for stably retaining the gene. It relates to a nuclear cell and a detection method.

[0002]

[Technical background]

Retroviruses are diploid positive-strand RNA viruses that contain integrated DNA
Replicate through intermediates. Retroviruses typically include a protein-containing lipid envelope surrounding a protein-encapsulating core with the viral genome. In infected cells, the retroviral genome is reverse transcribed into double-stranded DNA by a reverse transcriptase encoded by the virus that is part of the retroviral particle. The particles also contain other enzymes such as integrase. Integrase is a virus-encoded enzyme that causes a process called retroviral integration that inserts a viral DNA copy into the host cell chromosome. (For an overview, Brown (1997)
"Retrovirus" (Cold Spring Harbor Laboratory Press, USA) pp. 161-203). Integration is an essential step in the replication cycle of the human immunodeficiency virus type 1 (HIV-1), the causative agent of AIDS (LaFemina et al. (1992), J. Virol. 66:
7414-7419). Since the existence of the human counterpart is unknown, integration has received much attention as a potential new antiviral target. However, the development of integrase inhibitors has the problem that there is no relevant cell integration assay.
That is, integrase activity is typically assessed using a test tube reaction based on artificial oligonucleotides. Therefore, there is a need to provide an intracellular integration assay.

[0003] The wild-type retroviral genome contains at least three genes known as the gag, pol and env genes. The gag gene encodes an internal core structural protein, the pol gene encodes a specific enzyme such as protease, reverse transcriptase and integrase, and the env gene encodes a retroviral envelope glycoprotein. Different retroviral integrases vary in size from 30 kDa to 46 kDa, which are encoded by the 3 'end of the pol gene and released from the gag-pol polyprotein precursor by proteolytic processing. The amino-terminal domain of integrase is characterized by a zinc finger (HHCC), which is universally conserved in all retroviruses and essential for in vivo integration. This particular domain is the region best conserved with the essential DD35E motif involved in catalysis. This moiety can catalyze the degradation reaction in vitro. The carboxy-terminal domain is called the DNA binding domain and shows the lowest sequence conservation. This fragment is required for 3 'end processing and integration. The active enzyme exists as a multimer, where the active domain is believed to be capable of transcomplementing the inactive domain.

[0004] In the past, transient expression of avian sarcoma leukemia virus (ASLV) integrase in COS cells has been obtained (Morris-Vasios et al. (1988),
J. Virol. 62: 349-353). A mouse cell line that stably expresses Rous sarcoma virus (RSV) integrase has also been reported (Mumm et al. (1992), Viro
logy 189: 500-510). Expression levels are not specified, but appear to be relatively low. HIV-1 integrase (IN) is available from E. coli (Sherman and Fyfe (1990), Proc. Natl. Acad. Sci. USA 87, 5119-5).
123), insect cells using baculovirus (Bushman et al. (1991), Science
294: 1555-1558), and Saccharomyces cerevisiae (Caumont)
(1996), Curr. Genet. 29: 503-510). In yeast,
Integrase expression has been shown to be detrimental in cells with incomplete DNA repair. High level expression of HIV-1 integrase in mammalian cells is still elusive, largely because of the HIV-1 gag and po
l expression is Rev dependent (Cullen (1992)
), Microb. Rev. 56: 375-395). In mammalian cells, Rev-dependent expression of HIV-IN or HIV-IN fused to β-galactosidase or GFP has been previously reported (Faust et al. (1995), Biochem. Mol. Biol.
Int. 36: 745-758; Kukolj et al. (1997), J. Virol. 71: 843-847.
Pruimmers et al., (1999), Virology 258: 327-332). However, expression levels were always low, even after transient transfection. In the absence of Rev, multiple inhibitory or unstable sequences (INS), also called cis-acting repressor sequences (CRS), in mRNA prevent protein expression. Possible mechanisms include nuclear retention or mRNA instability. MRNA containing CRS
Was trapped in the nucleus, and it was observed that the inhibition of expression was due, at least in part, to low translocation of mRNA to the cytosol (Mikaelian et al. (1996)).
, J. Mol. Biol. 257: 246-264; Borg et al. (1997), Virology 236: 95-103).
Elements of the RNA processing machinery may be involved in nuclear trapping of mRNA, including CRS. In addition, there is evidence that some regions of the HIV-1 genome that contribute to mRNA instability have high AU content. They may represent binding sites for cellular factors that contribute to mRNA instability (Schneider et al. (1997), J. Virol. 71: 4892-4903). According to another hypothesis, m
RNA is not translated efficiently without Rev. Whatever the mechanism of inhibition observed, it is clear that the inhibition is caused by specific levels of mRNA and is due to some AU-rich regions. In the HIV replication cycle, inhibition is reduced in a manner controlled by the interaction of Rev with the Rev response element (RRE) (Schwartz et al. (1992), J. Virol. 66: 150-).
159). From this perspective, efficient Rev of virus particles can be achieved by mutating some INS while preserving the coding function for gag-pol transcripts.
It is not surprising that independent expression was obtained (Schneider et al. (1997), J. V.
irol. 71: 4892-4903). In the case of HIV gp120 mRNA, the mRNA
It has been shown that low translational ability due to inefficient codon usage, but not instability, is responsible for low level protein expression (Haas et al., 1996; Schneider et al. (1997), J. Virol. 71 : 4892-4903).

In the test tube method of cooperative integration analysis described in US Pat. No. 5,811,270 (Grandgenett), a viral integrase enzyme is first incubated with a donor DNA molecule and then a target DNA molecule. Incubated with For analysis of cooperative integration products, the donor DNA has at least one unique restriction enzyme cleavage site. The method described is based on HI
It is said to be useful for integrase studies, such as screening for V-1 or HIV-2 integrase inhibitors, and for the generation of non-human transgenic animals and gene transfer. The integrase used is purified from the virus particles and its activity is analyzed in vitro rather than in cells.

US Pat. No. 5,795,737, WO 96/09378, WO 97/11086
And WO 98/12207 all describe a method for producing a synthetic gene that encodes a protein normally expressed in mammalian cells, whereby the synthetic gene replaces the protein encoded in mammalian cells. Overexpression has been reported. This known synthetic gene is constructed by using the duplication of the genetic code to replace an unfavorable or less preferred codon with a preferred codon encoding the same amino acid. Although an example of a synthetic env gene encoding an envelope glycoprotein is shown, the expression of a protein having enzymatic activity in a host cell is not discussed. Methods for designing a synthetic gene to overexpress a protein while preserving the enzymatic activity of the protein cannot be derived from known teachings. Inability to show enzyme activity in cells (
There are a number of factors that can cause expression of the (retroviral) protein. The expressed enzyme can be defective for a number of reasons, including the need for inhibition of the enzyme in cells and the need for the simultaneous presence of another viral protein. In addition, it is not clear whether certain enzymes can be overexpressed, and there may be some limiting factors such as poor solubility or cytotoxicity. On the one hand, high levels of expression of the retroviral enzyme are required to detect enzymatic activity, and on the other hand, too high a level can lead to protein precipitation or cytotoxicity. Appropriate intracellular concentrations are required for all retroviral enzymes to be active in cells. If unsuccessful, it is proposed to replace the undesired codons by a certain percentage, for example 90%, 80%, 70% ..., but the exact choice of how to choose which codons to replace is suggested. No teaching. In particular, it has not been shown that the frequency of a particular nucleotide pair is associated with high levels of gene expression. It is not critical that the mechanism of RRE instability (in env) is the same as, or even related to, the problem of mRNA instability in gag and pol. In fact, there is evidence that the mechanism is different. Therefore, it is not possible to predict whether the problem of instability of the gag and pol genes can be corrected based on the Rev-independent expression of the env gene.

It is an object of the present invention to develop an effective expression system for retroviral proteins having enzymatic activity in eukaryotic cells, especially mammalian cells, especially for HIV-1 integrase.

[0008] It is a further object of the present invention to provide a more efficient detection method for retroviral enzyme inhibitors.

It is a further object of the present invention to provide a design method for the construction of a gene encoding a retroviral protein having enzymatic activity.

[0010] A further object of the present invention is to provide an expression vector capable of carrying a gene to a target cell in order to express in a cell a protein having an enzymatic activity encoded by the gene.

[0011]

Summary of the Invention

The present invention is a synthetic gene or region of a gene for high level expression of a retroviral protein in eukaryotic cells having improved codon usage compared to a wild-type gene, wherein the expressed retroviral protein is It is characterized by having enzymatic activity in eukaryotic cells. In addition, the invention relates to a synthetic gene or region of a gene that encodes a retroviral enzyme or a portion of a retroviral enzyme that is normally expressed in mammals or other eukaryotic cells, wherein the wild-type gene encodes the enzyme. Is replaced by a preferred codon encoding the same amino acid. "A region of a gene having improved codon usage" refers to the transcribed mR of a gene.
In NA, the normally unstable sequence (INS) or cis-acting repressor sequence (C
(RS) means that it may be sufficient to change the codon only in the part of the gene that produces it.

“Retroviral protein or enzyme normally expressed in a mammal or eukaryotic cell” means a protein or enzyme that is expressed in a mammal or eukaryotic cell under disease conditions. These are genes encoded by retroviruses (including lentiviruses) that are expressed in mammals or eukaryotic cells after infection.

In a preferred embodiment, the synthetic gene expresses a retroviral enzyme in a mammalian or eukaryotic cell culture system at a level of at least 200% of the level expressed by the "native" (or "native") gene. it can.

[0014] The retroviral protein may be a protease, reverse transcriptase, integrase protein, or its polyprotein gag-pol precursor. In one embodiment, the retroviral protein having enzymatic activity is a lentiviral protein. In another embodiment, the protein having enzymatic activity is po
l enzyme. In a more preferred embodiment, the protein having enzymatic activity is a lentivirus integrase. In a further preferred embodiment, the enzyme is an HIV enzyme. In a more preferred embodiment, the protein having enzymatic activity is HIV integrase. The enzymatic activity includes at least the integration function, ie, the promotion or stimulation of the integration of the DNA fragment into the host cell DNA, preferably into the chromosome of the host cell. The integrase here is expressed alone, ie as a single component independent of any retroviral components.

“Retroviral components” include Tat, Rev, Nef, Vpu, Vif, V
pr etc., retroviruses, specifically lentiviruses, more particularly HIV
-1 means regulatory and accessory proteins.

The present invention is also characterized in that the vector is a eukaryotic expression vector containing a synthetic gene or a gene region. Preferably, the expression vector contains a constitutive or inducible or tissue specific promoter. After transfection of the vector into eukaryotic cells by any suitable, e.g., established transfection procedure, expression from eukaryotic expression vectors may be transient. The vector may be any suitable vector, such as a plasmid, a mammalian or insect virus. In eukaryotic cell lines that stably maintain the expression vector, expression may be permanent. The expression vector may be included in a packaging structure for generating retroviral particles for gene transfer. The retroviral particles may be lentiviral particles.

Another aspect of the invention features a eukaryotic cell line that carries a synthetic gene or region of a gene. The cell line preferably uses a constitutive, inducible or tissue-specific promoter to express the protein having retroviral enzymatic activity. The expressed retroviral protein is an enzymatic activity which can be measured, for example, by complementation of an enzyme-deficient virus or, in the case of an integrase, by stimulating or facilitating the insertion of the DNA molecule into another chromosome, preferably the chromosome of the cell. Is shown.

The invention also includes non-human transgenic animals that carry a synthetic gene or gene region. Expression of the gene or region of the gene may be induced at any time using an inducible promoter, or alternatively, using a tissue-specific promoter in the desired tissue.

The invention also features a method for preparing a retroviral protein having enzymatic activity or a synthetic gene or region of a gene encoding a portion of such a protein. This method aims not only to identify and use the preferred codon usage but also to increase the stability of the mRNA during expression, at the same time and even predominantly. The method includes the step of identifying a subgroup of genes from the entire set of genes of the target eukaryotic cell that encodes a protein that is readily and / or highly expressed in the target cell. This subgroup may contain up to 10 genes, more typically up to 5 genes. From the codon sequences of these identified genes, preferred codon usage and preferred nucleotide relationships or nucleotide pair frequencies are identified. Preferred codon usage means that, for a particular amino acid, a particular codon for encoding that amino acid is selected as a preferred codon based on the high usage of the preferred codon in a selected group of genes. Preferred codon relationships refer to the proportions and combinations of various nucleotides commonly found in genes of the target eukaryotic cell. One particular nucleotide relationship is GC content or GC nucleotide versus frequency. Preferred codon usage is used to identify undesired codons in the natural gene encoding the enzyme, and one or more undesired codons are replaced by a preferred codon encoding the same amino acid as the codon being replaced. By biasing this substitution, a favorable nucleotide relationship or nucleotide pair frequency is obtained, resulting in better optimized conditions for expression in eukaryotes compared to the use of only preferred codon usage. This substitution may be made based on random selection from alternative codons encoding the same amino acid at each position using a random number generator, biasing alternative codon selection based on preferred codon usage. The desired nucleotide relationship or nucleotide pair frequency. In addition, potential splicing sites are removed and CpG methylation sites are removed while keeping the overall nucleotide relationship or nucleotide pair frequency close to the preferred one, for example, while keeping GC content and codon usage close to the preferred one. The synthetic gene sequences may be edited in reduced numbers. The GC content should be close to the preferred frequency of use in target cells, for example about 60% in mammalian cells.
The preferred range of GC content is 53% to 63%, more preferably 55% to 61% for gene expression in human cells. A Kozak consensus sequence (ANNATGG) may be added to provide for efficient translation initiation.

It is not necessary to replace every undesired codon with a preferred codon. Increased expression can be achieved by simply substituting unfavorable codons with partially preferred codons. Under some circumstances, it may be desirable to replace only some of the undesirable codons with preferred codons to obtain intermediate levels of expression.

“Synthetic gene” refers to a nucleotide sequence that encodes a naturally occurring protein in which some of the naturally occurring codons have been replaced by other codons. For example, unfavorable codons are replaced by preferred codons encoding the same amino acid. However, by substituting codons to create synthetic genes, expression of diverse genes (from eukaryotes, mammals, prokaryotes or viruses) in eukaryotic cells such as, for example, mammalian cells (especially human cells) May be increased relative to the expression of the naturally occurring gene. Accordingly, the invention includes improving the expression of genes from any source in eukaryotic cells, particularly mammalian cells, by the codon substitution methods described herein.

A “vector” is a plasmid or DNA derived from a mammalian or insect virus, into which a fragment of DNA can be inserted or cloned, for example.
Means a molecule. Vectors may contain one or more unique restriction sites and may be capable of autonomous replication in a defined host or mediator cell to regenerate the cloned sequence. Thus, "expression vector" means any autonomous element that can direct the synthesis of a protein. Such DNA expression vectors include mammalian plasmids and viruses.

“Packaging Structure” or “Packaging Vector” of Retrovirus
By means a plasmid-based or virus-based vector or structure that is configured to encode the proteins necessary to produce a virus particle lacking genomic RNA. Generally this means providing the gag, pol and env gene products. The lentiviral packaging structures of interest include changes to the coding sequence of the gag or pol proteins (ie, synthetic genes) to increase lentiviral protein expression and increase safety. For biosafety reasons, the packaging function is often split into two genomes, one expressing the gag and pol genes and the other expressing the env gene product. In the packaging structure according to the invention, regulators of gene expression, such as the Rev gene product, are no longer required. The increased biosafety of these packaging structures is based on a reduced risk for (homologous) recombination of these synthetic genes with their wild-type counterparts.

The present invention is further characterized in that it is a synthetic part of a gene encoding a desired part of the protein. Such synthetic gene fragments are similar to the synthetic genes of the present invention except that they encode only a portion of the protein. This portion of the gene encodes a portion of an enzyme having some enzymatic activity, for example, it may have catalytic activity, for example, the synthetic gene may encode the catalytic core of the enzyme, for example, it may be a reverse transcriptase May be a part of.

The present invention also includes a method for detecting intracellular integrase using a reporter gene without a promoter. The reporter gene may be luciferase, GFP or an antibiotic selection marker (eg, neomycin resistance, etc.). This reporter gene structure may be used for retroviral enzymes such as integrases according to the invention, such as integrases expressed from synthetic genes in stable cell lines or in transient mode after transfection of an expression vector. It may be used as a substrate for an enzyme.

[0026] The present invention provides human immunodeficiency virus type 1 (HIV) in mammalian cells.
-1) retroviral enzymes such as integrase, especially lentiviral enzymes,
Alternatively, a synthetic gene for efficiently expressing a part of a retroviral enzyme and a method for designing and constructing the same may be provided. This synthetic gene avoids mRNA instability by increasing the GC content of the wild-type integrase gene from 40% to 59%. Synthetic genes cloned into eukaryotic expression vectors provide for efficient expression of HIV-1 integrase in various mammalian cell lines. The amino terminus of this protein was as expected from the sequence after removal of the first methionyl residue. Nuclear localization of the recombinant protein was demonstrated by fluorescence microscopy. A 293T cell line stably expressing HIV-1 integrase was obtained. Integrase functionality was demonstrated by transcomplementation experiments. Lentiviral vector particles with an inactivating D64V mutation in the integrase gene were obtained, which were able to stably transduce 293T cells when complemented in a production cell line with an integrase expressed from the synthetic gene. . When infecting cell lines that stably express integrase with defective viral particles, complementation of integrase function was observed. Transfection following the IRES with a linear promoterless DNA substrate containing the reporter gene adjacent to the HIV LTR terminus resulted in reproducibly higher reporter signals in cells expressing integrase. The increase in reporter gene activity was stable in subcultures of transfected cells,
It can be concluded that the integrase performed the insertion of the linear DNA substrate into the chromosome of the cell. The rate of increase in the reporter signal by the integrase expressed from the mutant synthetic gene containing the D64V mutation was significantly reduced, indicating that the enzyme activity of this enzyme was required. The established cell integration system according to the invention is useful for studying the interaction of host and viral factors during integration, for specific HIV
Facilitate the development of integration inhibitors and the design of gene transfer systems.

The present invention, its advantages and embodiments will be described with reference to the accompanying drawings.

[0028]

Description of an exemplary embodiment

The present invention will be described mainly with reference to synthetic genes for overexpressing HIV integrase in mammalian cells, but the present invention is not limited thereto but only by the claims.

It has long been known that the expression of eukaryotic genes in prokaryotes can be optimized by designing synthetic genes with improved codon usage. The concept of increasing eukaryotic gene expression in eukaryotic cells by improving codon usage has been demonstrated, but is poorly established. It is known from bacteria that general rules are rarely applied (Macrise (Ma
krides) F. (1996), Microb. Rev 60: 512-538).

[0030] Retroviral enzymes such as integrase usually do not function as soluble proteins in the host cell cytoplasm during the infection cycle. Integrase is part of a large, undefined nucleoprotein complex called the pre-integration complex, which contains reverse transcriptase, nucleocapsids, matrix proteins, and viral DNA.
And other factors. It is not clear that integrase has enzymatic activity alone in the cytoplasm of the target cell; for example, there may be cellular factors that inhibit activity or viral factors that are lacking in this environment. Further, the integrase thus expressed is used as an artificial DNA substrate (DIPR described later).
It is not clear that it interacts with One aspect of the invention is to disassemble the pre-integration complex to obtain a simple integrase-linear DNA interaction. One embodiment of the invention is a retroviral enzyme in eukaryotic cells,
In particular, a method for detecting and using the enzymatic activity of lentiviral enzymes, especially integrase alone.

First, Re in cells transfected with IN-RRE
v based on the inference that co-expression of v will increase the level of expression of IN
Eukaryotic expression vectors encoding V-1 IN and IN-RRE have been constructed. However, in human cells transiently transfected with these expression vectors, immunofluorescence microscopy or Western blotting (
Little or no expression of IN was detected by any of FIG. 1).
An alternative approach involved introducing a simian retrovirus type 1 constitutive trafficking sequence (CTE) after the integrase gene. Again, when the exposure time of blotting was extended, expression could be detected only slightly, and the expression amount was 10 × 1
0 was ^six transfected cells per just 40 ng. Construction of a C-terminal fusion (GFP-IN) to green fluorescent protein (GFP) resulted in more pronounced expression of wild-type HIV-1 integrase expressed in mammalian cells (Pluimels et al. (1999), Virology 258: 327-332). R
According to Cucordi et al. (1997) (J. Virol. 71: 843-847) expressing integrase as a C-terminal fusion protein with β-galactosidase in the absence of ev,
Rev co-expression was not required. The effect of INS in the IN gene on protein expression levels was exemplified by a 5-fold decrease in the expression level of the GFP-IN structure compared to the parental GFP (Pruimels et al. (1999), Virology 258:
327-332). The present invention is based on a synthetic gene for HIV-1 integrase with increased stability of endogenous mRNA. The use of such synthetic genes results in high expression levels as well as enzymatic integrase activity as can be demonstrated by complementation tests.

According to the present invention, high level expression of HIV-1 IN is obtained in various mammalian cell lines by synthesizing integrase genes with increased GC content. This enzyme was shown to complement the defective integrase carried by the HIV-1-derived vector particles and act trans to a linear DNA substrate encoding a reporter gene adjacent to the LTR fragment.

Design and Construction of Synthetic Integrase Genes Based on the knowledge that codon usage in prokaryotes is significantly different from that of eukaryotes, synthetic genes have been previously used to optimize the expression of eukaryotic genes in bacteria. Has been built. The HIV gene (of the lentivirus) is not optimal for high level expression in eukaryotic cells. This is related to the mechanism used by HIV to avoid mRNA instability, namely Rev. In the replication cycle, the early mRNA transcript is spliced, resulting in the expression of regulatory proteins such as Tat and Rev. Only late in this cycle does Rev accumulation and Rev-RRE interaction inhibit splicing,
Suppression of T-rich labile sequences results in unspliced transcripts encoding structural and enzymatic proteins. Synthetic genes according to the invention clearly increase protein expression in mammalian cells, a necessary condition for detecting the functionality of the enzyme in cells, but in the context of replicating HIV, GC The presence of genes with increased content interferes with the mechanism of regulation of gene expression and can be detrimental to viral replication.

According to one embodiment of the invention, synthetic viral genes are designed for more optimized and more efficient expression in mammalian cells. The GC content of the HIV-1 integrase gene is 40%, whereas the GC content of highly expressed human genes averages 55-61%. Thus, GC content is one aspect of the preferred nucleotide relationship or nucleotide pair frequency according to the present invention.
By using the degenerate nature of the genetic code and selecting the preferred codon usage in the synthetic gene, the GC of the synthetic gene encoding HIV integrase
The code content can be increased up to 66% without changing the amino acid sequence. However, according to the invention, this is not preferred. First, according to the invention, preference is given to the preferred trimers (codons) found in a small group of well / strongly expressing human genome genes, for example the human β-globin, α-, γ-actin and EF2 genes. Biased alternative codon selection (method of determining preferred codon usage). In addition, this bias should be close to the preferred nucleotide relationship or nucleotide pair frequency, ie, if the GC content is between 53% and 6%.
3%, more preferably 55-61%. 66% actually
A GC content of more than 59% was achieved. Other rules for redesigning retroviral genes for eukaryotic expression are as follows. (I) removal of potential splicing sites, (ii) reduced number of CpG methylation sites, (iii) introduction of 5 'and 3' untranslated regions (UTRs) of mammalian mRNA (in the case of human β-globin) (Iv) addition of an extra N-terminal peptide (Met-Gly in the examples below) for efficient translation initiation. As a result, expression levels from synthetic genes in various mammalian cell lines were at least 25 times higher than expression levels from the native integrase gene. Efficient expression was also obtained in yeast (Pichia pastoris) (data not shown).

According to one embodiment of the present invention, to achieve high level expression of HIV-1 integrase in a human cell line, the codon usage of a human gene that is constitutively overexpressed in nucleotide codon usage Genes are provided by maintaining the amino acid sequence of IN from the HIV-1 pNL4-3 clone while adapting to frequency ("preferred codon usage"). The first of artificial IN reading frame
Version is based on the random selection of alternative codons at each position using a random number generator, human β-globin, α-, γ-actin and EF2
Preferred trimers found in the gene were preferentially biased. The DNA sequence was then substantially edited to remove potential splicing sites and reduce the number of CpG methylation sites, but with optimal overall GC content and codon usage ("favorable nucleotide relationships"). Or "nucleotide versus frequency"). The last version of the synthetic gene (Figure 2 or SEQ ID NO: 1) contains fragments of the 5 'and 3' untranslated regions from β-globin mRNA. This gene encodes a wild-type HIV-1 integrase to which an N-terminal Met-Gly dipeptide has been added. This extra glycine codon completes the Kozak consensus sequence (ANNATGG) required for efficient translation initiation. The overall GC content in the synthetic gene is 59% compared to 40% in the wild type. This gene was constructed by stepwise cloning from six synthetic DNA fragments, each approximately 150 bp in length. FIG. 2 or SEQ ID NO: 1
It should be understood that various homologues of the genes set forth in the above are included within the scope of this invention. By reapplying the random number biasing procedure according to the present invention, alternative sequences result, which all encode the same protein and all have similar favorable nucleotide relationships or nucleotide pair frequencies. All such synthetic gene homologs are included within the scope of the present invention.

[0036] Synthetic genes include modifications to those described above, and the following modifications and improvements of synthetic genes are included within the scope of this invention. For example, a leader peptide may be substituted to affect translation efficiency and potential myristoylation (eg, Met-Al
a modified version has been constructed). Transcript stability may be optimized by replacing the 5 'and 3'-UTRs with UTRs from other mammalian mRNAs. Mutations in the open reading frame are also included within the scope of the invention, where it is preferred that the standard integrase sequences (eg, HHCC and DD35E) remain unchanged. For example, a more soluble version can be made by introducing the F185K / F185H mutation. Other mutations may induce an increase or alteration of the catalytic activity of the enzyme in eukaryotic cells. For example, this invention is known to significantly reduce the enzymatic activity of integrase D
Includes a modified synthetic gene with a 64V mutation. Synthetic genes of integrase to which genetic information of domains of other proteins are added are also included in the scope of the present invention.
These domains preferably add additional properties to the enzyme, such as sequence specificity in DNA binding. Examples of methods for conferring specificity on a gene encoding integrase are described in WO 96/37626 and US Pat. No. 5,811,270, but they do not describe specific innovative aspects of the invention. .

The synthetic gene for HIV-1 integrase was designed to avoid the instability sequence (INS) -induced inhibition of gene expression in the wild-type integrase gene. This approach is generally applicable to retroviral integrase. In particular, the above-described design methods may be used for redesign of any retroviral viral gene encoding a protein with enzymatic activity for efficient expression in eukaryotes. In particular, the method of designing a synthetic gene according to the invention increases the expression in eukaryotes of retroviral genes encoding proteins having enzymatic activity, especially lentiviral integrase and common pol proteins. This particular approach of the present invention can also be applied to redesign gag genes where mRNA instability due to the presence of the INS sequence is a concern rather than low translational capacity as in env. Rev plays a role in suppressing the effects of INS
Although well studied only in the case of IV-1, all other lentiviruses are known to encode proteins similar to Rev. Similarly, human T and bovine leukemia viruses (HTLV and BLV) also encode Rev. Mason-Pfizer simian virus and simian retrovirus-1 (
Simple retroviruses, such as SRV-1), have unspliced mRNA
From the nucleus. It has been shown that CTE can functionally replace Rev that interacts with RRE. Indeed, using the method of the present invention, low levels of transient expression from a wild-type integrase gene having a CTE downstream of SRV-1 were obtained. The design of a synthetic gene according to the invention is described in Rev.
This approach can improve the expression of common retroviral enzymes, and especially integrase, since there is no need for the presence of RRE or CTE in the co-expression and structure of E. coli.

A variety of eukaryotic expression plasmids can be used to create a mammalian expression vector. Expression may be under the control of a constitutive promoter (eg, hCMV and RSV) or an inducible promoter. Examples of (commercially available) inducible expression systems are the ecdysone- and tetracycline-inducible (Tet-off and Tet-on) expression systems. Tissue-specific promoters that limit expression in specific tissues are also contemplated. Examples are the established neuron-specific promoters Thy-1 and enolase. Although a cell line stably expressing integrase was obtained, inducible promoters may limit cytotoxicity. In transgenic non-human animals carrying a synthetic gene, expression may be induced when desired using an inducible promoter, or expression may be induced in a desired tissue using a tissue-specific promoter. .

[0039] The synthetic gene for transient and stable expression integrase of HIV-1 integrase in 293T and HeLa cells (IN ^S), in the expression vector pCEP4 and pBK-RSV, respectively human cytomegalovirus (hCMV) and Cloned under the control of the Rous sarcoma virus (RSV) promoter. 29
Transient and stable expression of IN was obtained in both 3T and HeLa cell lines, which were confirmed by immunoblotting (FIGS. 1, 3) and indirect immunofluorescence (data not shown). In transfected 293T cells, the expression level from the hCMV promoter was 10 −10 per 10 × 10 ⁶ cells.
20 μg of IN, which is at least 25 times higher than that obtained with an expression vector containing the unfused wild-type HIV-1 integrase gene.

[0040] 293T cells by episomal expression vector pCEP-IN ^S transfected, stable cell lines obtained by selecting the hygromycin B 2
It was named 93T-IN ^S. By indirect immunofluorescence staining, 80-9 of the selected cells
0% was shown to produce detectable levels of integrase. The expression level assessed by quantitative immunoblotting was approximately 0.5 μg integrase per 10 × 10 ⁶ cells. Decrease in cell growth rate of the 293T-IN ^S (30-50% compared to parental 293T cell line) suggests cytotoxicity of integrase in mammalian cells.

In HeLa cells, integrase was found only in the nucleus. In 293T cells, transient transfection typically results in an irregular granular cytoplasmic distribution of IN, probably due to protein precipitation. In the 293T cell line selected for stable expression of IN, the nuclear localization of IN was evident. In the middle and late steps of mitosis, IN remained stably associated with the chromosome.

Solid phase N-terminal sequencing of integrase purified from transiently transfected 293T cells revealed the following amino termini: Gly-Phe-
Leu-Asp-Gly-Ile-Asp-Lys. This is the sequence predicted from the synthetic gene, where the starting methionine is removed after translation.

Functionality of IN ^S Complementation of IN-Deficient Vector Particles To demonstrate whether integrase expressed from synthetic genes in mammalian cells has enzymatic activity, a lentiviral vector derived from an HIV in which IN is integrase-deficient Were tested for their ability to complement. HIV-1 derived lentiviral vectors have been developed by Naldini et al. And Zufferey et al. (Nardini et al. (1996), Science 272: 263-267; Zuffale et al.).
(1997), Nature Biotechnol. 15: 871-875). 293T cells are transfected with a packaging plasmid encoding the viral gag and pol proteins, a plasmid encoding the vesicular stomatitis virus envelope, and a plasmid encoding the reporter gene flanked by two terminal repeats (LTR). As a result, pseudo-type lentiviral vector particles were generated. A wild type vector (WT vector) was generated using the first generation packaging plasmid pCMVΔR8.2 containing all HIV genes except env and the transfer vector pHR'-CMVLacZ. pCMVΔR8.2IN (D64V)
(Nardini et al. (1996), Science 272: 263-267) were used to generate integrase-deficient virus particles (D64V vector). D64 of the integrase gene
The V mutation is known to abolish integrase activity without affecting other steps of infection (Leavitt et al. (1993), J. Biol. Chem. 26
8: 2113-2119; Rarevit et al. (1996), J. Virol. 70: 721-728). The transduction titer of the D64V vector in 293T cells was 20-fold lower than that of the WT vector (Table 1). This has been previously reported (Nardini et al. (1996),
Science 272: 263-267). Since β-galactosidase expression after D64V transduction is significantly reduced by cell subculture (Table 1), D64V
Most of the "background" expression observed after transduction is due to transcription from unincorporated circular viral DNA. However, in some transduction experiments, one or two galactosidase positive colonies were observed. The residual transduction activity of the D64V virus has been previously observed (Gaul (
Gaur) and Rarevit (1998), J. Virol. 72: 4678-4685). This integration may not be dependent on viral integrase.

[0044] After the quadruple transient transfection of producer cells containing the expression vector pCEP-IN ^S containing the synthetic gene, to produce a complemented vector (C IN). C
IN restored the transduction activity to a maximum of 30% (Table 1). Complementation was due to stable integration since the same proportion of galactosidase positive colonies were counted after multiple subcultures of the transduced cells. The principle of transcomplementation of the IN-deficient virus was previously demonstrated using the VPR-IN fusion expression construct (Fletcher et al. (1997), EMBO J. 16: 5123-5138). The transduction activity of the IN catalytic domain mutation was restored to a maximum of 20% by transcomplementation with VPR-IN. However, in the absence of VPR, the expression construct for wild-type integrase achieved only 0.04% complementation efficiency (Fletcher et al. (1997), EMBO J. 16: 5123-5138).
). The synthetic gene according to the invention in the absence of VPR obtains a complementation activity which is 750 times more pronounced.

In addition, evidence was obtained for the transcomplementing activity of integrase expressed from synthetic genes in target cells (Table 1). Transduction of IN-expressing 293T cells with IN-deficient virus particles showed higher transduction efficiency than parental 293T cells. After subculturing the transduced cells, the differences became more apparent. This indicates a catalytic interaction between the integrase present in the recipient cell and the complex before integration of the incoming vector. Increased transduction efficiencies were also obtained for wild-type and complemented vectors. This may suggest that the amount of active integrase present in the virion is dose-limiting, or that the integrase present in the target cell is overriding inhibitory host factors.

Detection of Integrase Activity Using Reporter Gene without Promoter (DIP
R) HIV integration in the chromosome does not show strict sequence specificity, but a weak consensus for the integration site was found (Carteau et al. (1998), J. Vi.
rol. 72, 4005-4014). It is not officially proven, but generally accepted, that retroviral integration is preferred in open chromatin near or within the active transcription unit (Rohdewohld et al. (198
7), J. Virol. 61: 336-343; Shardin et al. (1990), J. Virol. 64, 907-912;
Vijaya et al. (1986), J. Virol. 60: 683-692; Cartou et al. (1998), J.
Virol. 72, 4005-4014). The design of a promoterless reporter substrate to measure integrase activity in cell culture is based on this finding (FIGS. 4A-C).
). According to an embodiment of the present invention, there is proposed a method wherein, when inserted into a region transcribed to chromosomal activity, read-through transcription of a reporter gene without an integrated promoter occurs. The designed structure is an HIV that provides an integrase recognition site
Linear DNA fragment adjacent to the 200 bp terminal fragment of the LTR. The marker gene may encode, for example, luciferase. The presence of an IRES (internal ribosome entry site) before the luciferase open reading frame results in cap-independent translation of the mRNA transcript (FIG. 4A).

After transfection with this DIPR substrate (FIGS. 4B, C), 29
3T-IN ^S measured luciferase activity in cells was always 4 to 10-fold higher than the parent 293T cells (Table 2). In the DIPR assay, the activity of the D64V mutant integrase was reduced compared to the wild-type integrase (data not shown). These results show the activity of the integrase expressed in the cell (expressed by the synthetic gene according to the invention) (FIG. 4C). Alu-PC
Sequencing of the integrated linear DNA molecule in 293T cells transiently expressing integrase from synthetic genes using R revealed that 3 'in 10% of the integrants.
Characteristic removal of GT dinucleotide was shown. In control cells that do not express integrase, none of the DNA inserts exhibited this feature.

Applications Examples of the invention include the construction of efficient eukaryotic expression vectors for retroviral enzymes, such as HIV-1 integrase, based on the production of synthetic genes. After transfection of the plasmid into eukaryotic cells by any established transfection procedure, expression from eukaryotic expression vectors may be transient. In cell lines that stably maintain the expression vector, expression may be permanent. An important aspect of the invention and its application is the functionality of the expressed retroviral protein with enzymatic activity, in contrast to the mere high-level expression of retroviral proteins without enzymatic activity.

Intracellular Integrase Test for the Evaluation of Integrase Inhibitors This embodiment of the invention evaluates integrase activity in cells transfected with a DNA substrate flanked by a fragment of the HIV LTR, so-called mini HIV. Assays to perform The data in both assays indicate the enzymatic activity of IN.

In the DIAS (detection of integrase activity by antibiotic selection) test,
There is a resistance gene for cytotoxic drugs in the DNA of mini HIV. The presence of IN in transfected cells facilitates stable insertion of the resistance gene into the chromosome. Scoring was performed by comparing the remaining number of colonies resistant to the cytotoxic drug with cells transfected with the heterologous DNA.

In DIPR (detection of integrase activity using a reporter gene without a promoter), a reporter gene without a promoter (luciferase) exists downstream of the internal ribosome entry site (IRES) of mini HIV (FIG. 4A
). Due to the presence of IN in the transfected cells (FIG. 4B),
Stable insertion of the reporter structure into the host chromosome in close proximity to the promoter of the cell is facilitated (FIG. 4C). Scoring is performed by measuring the activity of an enzyme, such as luciferase, expressed from a marker gene without a promoter. The latter assay is very suitable for evaluating integrase inhibitors in cell culture in microtiter plate format and is adaptable for high-throughput screening. Potential integrase inhibitors can eliminate or significantly reduce the level of detectable signal from a promoterless marker gene.

[0052] Such assays according to the present invention include screening for test inhibitory compounds from a large library of synthetic or natural compounds. Synthetic compound libraries
For example, Maybridge Chemical Company (Trevillette, Cornwall, UK), Comgenex (Princeton, NJ), Brandon
Commercially available from Associates (Merrimack, NH) and Microsource (New Milford, CT). A rare chemical library is available from Aldrich Chemical Company (Milwaukee, WI).
Alternatively, a library of natural compounds in the form of bacterial, fungal, plant and animal extracts is available, for example, from New Chemical Entities, Bread Institute, Bozel, WA or MycoSearch (NC), It is available from Chiron and the like, and can be easily manufactured. Plant extracts are also available from the University of Ghent, Belgium. In addition, natural and synthetically produced libraries and compounds are readily modified by conventional chemical, physical, and biological means.

Means for Non-Viral Cellular Gene Transfer Cell lines that express integrase from synthetic genes have the property of incorporating foreign DNA adjacent to the LTR fragment. Therefore, these cell lines are easier to transduce. An example of this invention is the generation of a highly transducible (at least 200% relative to the parent cell) eukaryotic cell line (or cell culture system). Embodiments of the invention also increase the efficiency of (non) homologous recombination in ES cells by transient expression from a plasmid or after induction of retroviral integrase expression in ES cells transfected with a synthetic gene. Applications in transgenic technology. The synthetic gene according to the present invention may be introduced into the cell by any transfection agent or method (eg, electroporation or lipofection), resulting in stable integration of the DNA into the chromosome.

Retroviral (Lentiviral) Vector Packaging Structure From complementation experiments, integrase expressed from synthetic genes in producer cells can complement integrase-deficient lentiviral viral particles encoded by the packaging plasmid, and thus It is clear that proteins expressed by the staging structure can be substituted. Thus, in expression vectors based on one or more synthetic genes for the lentiviral gag-pol gene, the synthetic gene can replace the native gene in the packaging structure, resulting in Rev-independent high level protein expression. Is obtained. The invention includes a non-lentivirus complex retrovirus-based packaging structure in which protein expression is dependent on a Rev homolog such as Rex in the case of HTLV-1. Lentiviral vectors themselves capable of transducing non-dividing cells are known in the art (see Nardini et al. (1996), Science 272: 263-267, Zuffale et al. (1997), Nature Biotechnol. 15: 871-875). . Generally, vectors are plasmid-based or virus-based and are configured to retain sequences essential for nucleic acid integration, selection, and transfer of the nucleic acid in a host cell. The gag, pol and env genes of interest are known in the art.
Briefly, a first vector may provide a nucleic acid encoding a viral gag and a viral pol, and a second vector may provide a nucleic acid encoding a viral env gene product for generating a packaging cell. Good. The packaging cell or cell line supplies the proteins needed to produce infectious virions in trans and cannot itself package the endogenous viral genomic nucleic acid (Watanabe and Temin (1983), Molec. Cell Biol). 3 (12): 2241-2249; Mann et al. (1983), Cell 33: 153-159; Embretson and Temin (1987), J. Virol. 61 (9): 2675-2683). By introducing a transfer vector that is a vector that gives a heterologous gene to such a packaging cell, a producer cell that releases infectious particles having the foreign gene of interest can be obtained. Transfection or infection methods are well known by those skilled in the art. After co-transfection of the packaging vector or transfer vector into the packaging cells or cell lines, the recombinant vector is recovered from the culture and titered by standard methods used by those skilled in the art.

The foreign or heterologous gene carried by the transfer vector can be any transcribable nucleic acid of interest, but is a nucleic acid that encodes a polypeptide that has therapeutic benefit or is of interest for gene therapy. Is preferred. The env gene in the (second) packaging vector may be derived from any virus, including retroviruses, and is preferably amphoteric to allow transduction of human and other species of cells. , Preferably under the control of non-endogenous regulatory sequences. Vectors may be made target-specific by linking the env protein with an antibody or ligand for a particular receptor of a particular cell type (cell targeting).

The design of the gag-pol synthetic gene is based on the mRN associated with these wild-type genes.
Based on a method to avoid instability of A. The method we use to generate expression structures for high levels of active HIV-1 integrase and for Rev-independent eukaryotic expression will be used preferentially. Further construction of the vectors of the present invention, each replacing the native gag-pol gene with a synthetic gene of the present invention, uses standard ligation and restriction enzyme techniques that are well understood in the art (Maniatis et al., Molecular Cloning: Laboratory Manual, Cold Spring Harbor Laboratory, NY,
1982).

Biosafety requires measures to reduce as much as possible the risk of producing recombinant replication competent retrovirus (RCR). Dividing the packaging function into two genomes, one expressing the gag and pol genes and the other expressing the env gene product, helps to minimize the potential for RCR. The approach not only minimizes the risk of simultaneous packaging and subsequent transfer of the two genomes, but also greatly reduces the frequency of RCR generation by recombination due to the presence of the three retroviral genomes in the packaging cells. Mutations (Danos and Mulligan (1988), Proc Natl. Acad. Sci 85: 6460-6464) or deletions (Bosselman et al. (1987), Molec . Cell Biol. 7 (5): 1797-1
806; Markowitz et al. (1988), 62 (4): 1120-1124) may be incorporated into undesired gene products. Deletion of the 3 'LTR of both packaging structures further reduces the potential for functional recombinants to form. US5
No. 994,136 describes the generation of a lentiviral vector which further reduces the likelihood of generating replication competent trench virus by functionally deleting the tat gene, which encodes a regulatory protein that drives viral expression through a transcription mechanism. I do. Biosafety of lentiviral vectors is further improved because the possibility of recombination between a transfer vector that still contains the natural genetic information of the lentivirus, such as part of the gag gene, and a synthetic packaging gene is greatly reduced Is done. DNA sequence mismatches, such as those induced by substitution of a nucleotide at the third position relative to the native gene, appear to provide a significant barrier to homologous recombination in a wide range of species. Thus, contaminated or endogenous HIV virions would not exchange the natural integrase gene for synthetic genes through recombination.

Experimental Procedure DNA Structure Construction of Integrase Expression Plasmid The IN open reading frame from HIV-1 clone HXB2 was
Primer 5'-CCCCCAAGCTTGCCAGCCATGTTTTAGA using Pfu DNA polymerase (Stratagene, Cambridge, UK)
TGGAATAGATAAGG and 5'-CCCGTCTC GAG CTTTCC
PCR amplified by TTGAAATACATATATGGGTG, pCEP4 (
(Invitrogen, Leak, The Netherlands) and subcloned into pCEP-IN
I got DNA sequencing confirmed no mutations. The RRE sequence of the HIV-1 clone HXB2 was compared with the primer 5'-TTCCGCTC GAG TAGCA.
CCCCAAGGGCAAAA GAG and 5'-TCGCGGATCCAAAG
PCR amplification was performed using GCACAGCAGTGGTGCAAATG. This PC
The R fragment was subcloned in the sense direction downstream of the integrase gene in pCEP-IN to generate pCEP-IN-RRE. The CTE sequence (obtained from plasmid pS12; Taverno et al., 1996, J. Virol. 70: 5998-6011) was converted to pC
It was cloned in the correct orientation in EP4, after which the integrase gene was inserted upstream of the CTE. As a result, plasmid pCEP-IN-CTE was obtained. p
The construction of GFP-IN has been described by Prymels et al. (1999), (Virology 258: 327-33.
Described by 2). The Rev expression plasmid pEF321-cREV was purchased from the Sandoz Forschungs Inst.
Itut) (Vienna, Austria). PCR amplification and plasmid construction used standard techniques, such as standard ligation and restriction enzyme techniques, and conditions well understood in the art (Maniatis et al., Molecular Cloning: Laboratory Manual, Cold. See Spring Harbor Laboratory, NY, 1982).

Assembly of the Synthetic Gene The sequence of the synthetic gene was divided into six fragments each of about 150 bp in length by restriction sites NheI, PstI, BamHI, NaeI, NarI (shown in FIG. 2), -149, 144-306, 301-456,
451-623, 618-776, and 771-930 (FIG. 2). Each fragment was composed of two partially complementary oligo nucleotides (85) using Sequenase (Amersham-Pharmacia, Buckinghamshire, UK).
-95 nt long, PAGE purification and 5 'phosphorylation, synthesized by Gibco BRL Life Technologies, synthesized by Merelbeke, Belgium) by annealing and extension. Each fragment is transferred to the vector pB
EcoRs of luscriptKS (+) (Stratagene, La Jolla, CA)
Cloned at the V site. Sequence errors found in the resulting clones were
stratagene quick change procedure with coccus furiosus (Pfu) polymerase (for base substitutions in fragments 451-623), or P
Repair was performed using CR (for deletion of the terminal region of fragment 1-149). W
A total 930 bp sequence was constructed by stepwise assembly of fragments similar to the method described in O98 / 12207. Selection of the cloning vector (pBluescript KS or SK) at each step depends on the D
Determined by the toxicity of NA. Finally, the two halves of the IN gene (1-451 and 452-930) were ligated together and pBluescriptKS (
+) Was cloned into to obtain a pIN ^S.

[0060] Construction Plasmid pIN ^S mammalian expression vectors for IN ^S was cleaved by EcoRI, then treated with T4DNA polymerase, and restriction enzyme treated with XhoI. The 1 kb fragment containing the IN ^S gene was cloned into the PvuI of pCEP4 (Invitrogen, Leak, The Netherlands).
And cloned between the I and XhoI sites to obtain pCMV-In ^S. pC
EP4 is an episomal mammalian expression vector that expresses human cytomegalovirus (h
CMV) immediately before. The Epstein-Barr virus origin of replication (oriP) and nuclear antigen (encoded by the EBNA-1 gene) allow extrachromosomal replication in human, primate and dog cells. Due to the presence of the hygromycin resistance gene, clones stably transduced with hygromycin B (Gibco BRL) can be selected. Fragment pBK-RSV expression vector of the same 1kb also cloned between the NheI and XhoI sites of (Stratagene) (NheI sticky ends of the vector DNA were filled using T4DNA polymerase) to give pRSV-IN ^S. In this vector, the expression of the IN ^S gene is driven by the Rous sarcoma virus (RSV) promoter. Geneticin (G418) due to the presence of the neomycin resistance gene
) (Gibco BRL) to select for clones stably transduced.

Construction of Substrates for DIPR Assays DNA substrates for DIPR assays are pLTR-IRES with ScaI
-Obtained by linearization of Luc. This plasmid was constructed in the following manner. First, the pU containing the U3 and U5 regions at the end of the HIV-1 LTR of HXB2
3U5 (Zelepanov et al. (1999), Nucleic Acids Research 27: 2202-2210)
The 50 bp KpnI / EcoRI fragment was cloned between the KpnI and EcoRI sites of pUC19, resulting in pUC-LTR. Then, pUC
-The LTR was partially digested with ScaI and the ScaI site in the ampicillin resistance gene of pUC19 was disrupted by inserting a fragment containing the kanamycin resistance gene from the Tn5 transposon, resulting in pUC-LTR-kan
I got Finally, pBIR (with the IRES-luciferase gene cassette)
Martinez-Salas et al. (1993), J. Virol. 67, 3748-3755.
Of the BamHI / PstI fragment of T4 DNA polymerase (Gibco BRL)
) And cloned into the SmaI site of pUC-LTR-kan to obtain 7.5 kb of pLTR-IRES-Luc.

Cell Culture HeLa and 293 cells were obtained from the American Type Culture Collection. HeLa and 293 cells were transformed with Dulbecco's modified Eagle's medium (
DMEM) (Gibco BRL) with 10% FCS, 0.12% (v / w) sodium bicarbonate (Gibco BRL), 2 mM glutamine (Gibco BRL), 2%
The cells were cultured in a medium supplemented with 0 μg / ml gentamicin (Gibco BRL) at 37 ° C. in a humidified atmosphere of 5% CO ₂ . 293T cells (O. V., France)
(Obtained from Dr. Danos) expresses the SV40 large T antigen and expresses DMEM (Gibco BR)
L) and glutamax with 10% fetal bovine serum, 45 U / m
1 g of penicillin G (Serva, Heidelberg, Germany) and 45 μg
/ Ml streptomycin sulfate (Sigma-Aldrich, Bohnen, Belgium)
And was added.

[0063] 293 and 293T cells were transformed with polyethyleneimine (PEI) (Abdallah (Ab
dallah) et al. (1997), Hum. Gene Therapy 7: 1947-1954). Polyethyleneimine Mw-25,000 was obtained from Sigma-Aldrich (Bonen, Belgium). Cells were prepared in DMEM plus glucose, glutamax and 10% fetal calf serum (FCS) (Gibco BRL)
Cultures were grown to 50-70% confluence. The medium was changed to a medium containing 1% FCS three hours before transfection. A mixture of DNA and PEI was added to the cells in a minimum volume of medium. The next day, the medium was changed to DME containing 25 mM HEPES.
M was replaced. In this manner, the effective transformation obtained was 50-80%.
HeLa cells were routinely transfected by electroporation. First, cells that were 80% confluent were trypsinized and precipitated by low speed centrifugation. The cells were then resuspended in growth medium to a density of 2 × 10 ⁶ cells / ml. 0.5 ml of this solution is placed in a 4 mm cuvette (Eurogen Tech (Eu
rogentec), Slane, Belgium) and add 20 μg of DN to the cell suspension.
A was added. After an electrical pulse (10 μF, 250 V), the cells were rested at room temperature for 10 minutes before dilution into growth medium.

[0064] IN ^S gene in order to establish stable cell lines expressing, pRSV-IN ^S or pCMV-IN cells transfected with ^S, respectively 500 [mu] g /
Cultures were performed in the presence of ml Geneticin (G418) or 200 μg / ml Hygromycin B (both from Gibco BRL). IN expression was assessed by Western blotting and / or indirect immunofluorescence.

Western Blotting and Immunofluorescence For Western blotting and indirect immunofluorescence, recombinant His-tagged H
Rabbit polyclonal antibodies to IV-1IN were raised and established procedures (Ausubel et al. (1987), the latest protocol in molecular biology (Current protoco
Purification was carried out using a 1HiTrap rProtein A column (Pharmacia Biotech, Uppsala, Sweden) according to ls in molecular biology), John Wiley and Sons, New York. Western blotting uses PVDF membrane (Bio-Rad), ECL + chemiluminescence detection system (
Amersham-Pharmacia) and HRP-conjugated goat anti-rabbit antibody (Bio-Rad). The dilution used was 1: 30,000 for the primary antibody and 1: 20,000 for the secondary antibody. Detection limit is recombinant integrase 0.1-
0.5 ng. Total protein concentration was determined on cells lysed with 1% SDS / 1 mM PMSF (Sigma) using the BCA protein assay (Pierce, Illinois, USA). For Western blot analysis, a total protein amount of 10 μg was evaluated.

To detect in situ IN expression by indirect immunofluorescence microscopy
Cells can be placed on glass slides (HeLa cells) or permanox cells.
The cells were cultured in a chamber slide (Gibco BRL) (293T cells). 24-48
After time, 1 mM Mg was added to phosphate buffered saline (PBS).²⁺And 0.5 mM Ca ²⁺ Wash cells with PBS +, fix in 100% methanol
Blocked with 10% fetal calf serum (FCS) in PBS +. Antibody A
Incubation was performed at 37 ° C. in blocking solution. Primary antibody (C
Heron anti-IN) was diluted from 1:20 to 1:80. FITC-conjugated pig of secondary antibody
Anti-rabbit antibody (Dako, Glostrup, Denmark) was diluted 1:40. Nuclear
Staining was performed at 1 μg / ml of 4 ′, 6-diamidino-2-phenylethyl in methanol.
And Ndol (DAPI) (Sigma). Fluorescence microscopy, rights
With a microscope (Wetzlar, Germany), filter block I2 (FITC) or
Or A (DAPI).

Detection of Integrase Activity Using Reporter Gene without Promoter (DIP
24 hours before R) transfection were seeded at a density of 10 ⁶ cells / well 293T and 293T-IN ^S cells in 6-well plates. 5 μg of DNA was transfected per well using PEI. 48 hours after transfection, 5 × 10 ⁵ cells were lysed and luciferase assay ^systemTM
Luciferase activity was determined using (Promega Benelux, Leiden, The Netherlands) and LumiCount ^™ (Packard, Meriden, CT). Lysate protein concentration was determined using the Bradford method (Bio-Rad protein assay, Bio-Rad, Hercules, CA). The specific activity of luciferase was calculated by dividing the luminescence value by the protein concentration.

Lentiviral Vector Generation of Lentiviral Vector HIV-1 derived vector particles, pseudotyped by the vesicular stomatitis virus (VSV) envelope, package 293T cells into viral gag and pol proteins Plasmid (pCMVΔR8.2
) And a plasmid encoding the vesicular stomatitis virus envelope (pMDG
) And a plasmid encoding a reporter gene flanked by two terminal repeats (LTR) (pHR'-CMVLacZ). First generation packaging plasmids containing all HIV genes except env and transfer vectors are described in O.D. Dr. Danos (Geneton, France)
Thanks to For transfection of 293T cells in a 10 cm dish, 700 μl of a mixture of the three plasmids was made in 150 mM NaCl (20 μg vector plasmid, 10 μg packaging structure, and 5 μg envelope plasmid). 700 μl of PE was added to this DNA solution.
Solution I (110 μl of a 10 mM stock solution in 150 mM NaCl) was added slowly. After 15 minutes at room temperature, 2% in DMEM medium with 1% FCS was added.
This DNA-PEI complex was added dropwise to 93T cells. After overnight incubation, the medium was replaced with a medium containing 10% FCS. Supernatants were collected between 2 and 5 days after transfection. Vector particles were precipitated by ultracentrifugation at 25,000 rpm for 2 hours at 4 ° C. in a swinging bucket rotor (SW27 Beckman, Palo Alto, Calif.). Resuspend the pellet in PBS and add 1
A concentration of 00 times was obtained. The different virus stocks have different p24 antigen concentrations (HIV-1
p24 core profile ELISA, Dupont, Dreieich, Germany) and used for complementation assays.

Complementation Experiment Integrase-deficient virus particles were obtained as packaging plasmids (Nardini et al. (1996), Science 272: 263-267). Produced using pCMVΔR8.2IN (D64V) obtained from Dr. Trono (Geneva, Switzerland). Complemented vector was produced by expressing the integrase from pCEP-IN ^S in 293T cells after 4-fold transient transfection. Vector preparation was normalized to p24 antigen count. The vector was added to target cells in the presence of 2 μg / ml polybrene and left overnight. After removing the vector,
The cells were incubated for a further 36 hours. The cells are washed with PBS, fixed with 0.75% formaldehyde / 0.05% glutaraldehyde in PBS, and prepared as needed with X-gal substrate (5 mM potassium ferrocyanide, 5 mM potassium ferricyanide, 2 mM MgCl ₂ and 100 μg / ml of 5-
Bromo-4-chloro-3-indolyl-β-D-galactopyranoside (x-ga
l) (Biotech Trade and Service GmbH, St. Leon-Rot, Germany)) at 37 ° C. overnight. Each transduction experiment was performed in duplicate in a 96-well plate. The transduction efficiency was 1 hour after infection 48 hours after infection.
Cells by counting the number of blue cells in one well
: Divided into two. Half of the sample was left in the wells, confluent and stained (passage 1
) Whereas the other half was cultured in a 48 well plate. Upon confluence, the cells were again split 1: 2. Finally, the cells were cultured in a 24-well plate until confluence (passage 3, dilution 1: 8). After staining, the efficiency of stable transduction was determined by counting blue colonies.

Table

[0071]

[Table 1]

[0072]

[Table 2]

[0073]

[Sequence list]

[Brief description of the drawings]

FIG. 1. HIV-1 I in 293T cells using different expression strategies.
FIG. 4 shows a Western blot analysis of transient expression of N. 293T cells were transiently transfected with various expression vectors. 48 hours after transfection, cell extracts were made using 1% SDS, 1 mM PMSF. Cell extracts representing 10 μg total protein were separated by PAGE and blotted onto PVDF membrane. Detection was performed using a polyclonal antibody against HIV-1 integrase and the ECL + detection system. Lane 1 contains 2.5 ng of recombinant and purified His-tagged HIV-1 integrase (HT-IN). The other lanes contain extracts after transfection with equal amounts of the following plasmids: Lane 2, pCEP4; Lane 3, pCE
P-IN; Lane 4, pCEP-IN-CTE; Lane 5, pCEP-IN-R
RE + pEF-cREV; lane 6, pCMV-IN ^S.

FIG. 2 shows the sequence and structure of a synthetic gene. (A) pNL4-
3 shows the sequence of a synthetic DNA encoding HIV-1 integrase No. 3. The amino acid sequence is indicated by one letter code. Restriction enzyme cleavage sites used in the construction are indicated by boxes. The translation start site is underlined. (B) Schematic diagram showing the structure of a synthetic gene. The following areas are shown. 5 'and 3' untranslated regions from β-globin mRNA (
UTR), Met-Gly dipeptide, and integrase open reading frame (ORF). The following three domains of the integrase protein are shown. A zinc finger motif (HHCC), a catalytic core, and a D
NA binding domain.

FIG. 3 shows a Western blot analysis of a 293T-derived cell line stably expressing HIV-1 IN from a synthetic gene. 293T cells to pC
Transfected with MV-IN ^S, stable cell lines were selected with hygromycin B. Cell extracts (10 μg total protein) were separated by PAGE,
Blotted on PVDF membrane. Detection was performed using a polyclonal antibody against HIV-1 integrase and the ECL + detection system. Lanes 1, 2
. Extracts lane 2,293T cell;; 5 ng of recombinant His-tagged HIV-1 integrase lane 3, IN stably expressing 293T cells (293T-IN ^S
) Extract.

FIG. 4 shows detection of integrase activity (DIPR) using a reporter structure without a promoter. 4A to 4C schematically show a method for detecting integrase activity using a reporter gene without a promoter.

[Procedural Amendment] Submission of translation of Article 34 Amendment

[Submission date] August 9, 2001 (2001.8.9)

[Procedure amendment 1]

[Document name to be amended] Statement

[Correction target item name] Claims

[Correction method] Change

[Contents of correction]

[Claims]

──────────────────────────────────────────────────続 き Continuation of front page (81) Designated country EP (AT, BE, CH, CY, DE, DK, ES, FI, FR, GB, GR, IE, IT, LU, MC, NL, PT, SE ), OA (BF, BJ, CF, CG, CI, CM, GA, GN, GW, ML, MR, NE, SN, TD, TG), AP (GH, GM, KE, LS, MW, SD, SL, SZ, TZ, UG, ZW), EA (AM, AZ, BY, KG, KZ, MD, RU, TJ, TM), AE, AL, AM, AT, AU, AZ, BA, BB, BG, BR, BY, CA, CH, CN, CR, CU, CZ, DE, DK, DM, EE, ES, FI, GB, GD, GE, GH, GM, HR, HU, ID , IL, IN, IS, JP, KE, KG, KP, KR, KZ, LC, LK, LR, LS, LT, LU, LV, MA, MD, MG, MK, MN, MW, MX, NO, NZ, PL, PT, RO, RU, SD, SE, SG, SI, SK, SL, TJ, TM, TR, TT, TZ, UA, UG, US, UZ, VN, YU, ZA, ZW (72 Inventor Du Clark, Eric Belgium, Be-3360 Robbenjoel, Parkrahn, 9 (72) Inventor Zerepanov, Peter Belgium, Be-3000 Leuven, Brusselsstrat, 128 (72) Inventor Pruymels, BIM Belgium, Be-3001 Berly, Nance Steenbake, 282 F term (reference) 4B024 AA01 AA11 AA20 BA07 CA01 DA02 EA02 FA10 GA11 HA17 4B063 QA01 QA18 QQ02 QQ21 QR72 QS05 QX01 4B065 AA90X AA97X AA97 AB 4 CA27 CA44 CA46 [Continued from summary] It is a lase. In a further preferred embodiment, the enzyme is an HIV enzyme. In a more preferred embodiment, the protein having enzymatic activity is HIV integrase. The invention also includes a method for detecting intracellular integrase using a reporter gene without a promoter.

Claims (29)

[Claims] 1. A method for detecting intracellular integrase activity using a reporter gene without a promoter. 2. The detection method according to claim 1, wherein the reporter gene may be luciferase, GFP or an antibiotic selection marker. 3. The reporter gene structure is generated from a reporter gene, and the structure is used as a substrate of a retroviral protein having an enzymatic activity expressed from the synthetic gene according to any one of claims 17 to 26. 1 or 2
The detection method described in 1. 4. A packaging structure for a lentiviral or complex retroviral vector based on a synthetic gag or pol gene. 5. The packaging structure according to claim 4, wherein the synthetic gene is the synthetic gene according to any one of claims 17 to 26. 6. A method for transfecting a eukaryotic cell using the expression vector according to claim 27. 7. A eukaryotic cell line carrying the synthetic gene or gene region according to any of claims 17 to 26. 8. The eukaryotic cell line according to claim 7, wherein the protein having retroviral enzymatic activity is expressed using a constitutive, inducible or tissue-specific promoter. 9. The eukaryotic cell line according to claim 7, wherein the expression is stable. 10. A non-human transgenic animal carrying the synthetic gene or the gene region according to any one of claims 17 to 26. 11. The transgenic animal of claim 10, wherein expression of the synthetic gene or region of the gene is induced by an inducible promoter or a tissue-specific promoter. 12. The transgenic animal according to claim 10, wherein the animal is a mammal. 13. A method for preparing a retroviral protein having enzymatic activity in a target eukaryotic cell or a synthetic gene or a region of a gene encoding a portion of such a protein, comprising: 1) easily and / or in a target cell; Identifying a group of genes from the entire set of genes of the target eukaryotic cell that encodes a protein that is naturally expressed at a high concentration; 2) defining a codon sequence for the identified gene and a preferred codon from the sequence Determining the frequency of use and preferred frequency of nucleotide pairs; 3) using the preferred frequency of codon usage to identify unwanted codons in natural genes encoding proteins having enzymatic activity; 4) one or more of the following: Replace these undesired codons with the same amino acids as the codons to be replaced. Substituted with one or more preferred codon encoding the acid, and obtaining a preferred nucleotide pair frequency to bias the substitution method. 14. The step of substituting is performed based on a random selection from alternative codons encoding the same amino acid at each position using a random number generator, and based on preferred codon usage. 14. The method of claim 13, wherein the preferred nucleotide pair frequency is obtained by biasing codon selection. A method for introducing a gene into a eukaryotic cell expressing the synthetic gene or the gene region according to any one of claims 17 to 26. 16. The method of claim 15, wherein the synthetic gene is transiently expressed or is stably integrated into said cell. 17. Expression of a retrovirus gag or pol gene or a region of a retrovirus gag or pol gene for expressing a retrovirus gag or pol protein in a eukaryotic cell, wherein the expressed retrovirus protein is expressed. A level is a level of a synthetic gene or region of a gene that is a level that confers a detectable activity on the wild-type function of a retroviral protein expressed in a eukaryotic cell. 18. The retroviral gene has undesired codons when applied to eukaryotic cells and the number of undesired codons is increased by replacing all of the undesired codons with eukaryotic cells by the preferred codons. The content of nucleotide pairs is 65% or more, the content of GC nucleotide pairs of the synthetic gene is 53% to 63%, more preferably 55% to 61%, and the retrovirus protein expressed is 18. The synthetic gene according to claim 17, wherein the gene is expressed at a level that confers detectable enzymatic activity of a retroviral protein expressed in a eukaryotic cell. 19. The synthetic gene according to claim 17, wherein expression of the gag or pol protein is independent of a retrovirus regulatory protein. 20. The synthetic gene according to claim 17, wherein the retrovirus protein is a lentivirus gag or pol protein. 21. The synthetic gene according to claim 20, wherein the lentiviral protein is an HIV gag or pol protein. 22. A synthesis according to any of claims 18 to 21, wherein the detectable activity of the enzyme function comprises at least promoting or stimulating the integration of the DNA fragment into the host cell DNA, preferably into the chromosome of the host cell. gene. 23. The retroviral protein is a protease, a reverse transcriptase,
The synthetic gene according to any one of claims 17 to 22, which is an integrase protein or its polyprotein gag-pol precursor. 24. The eukaryotic cell is a mammalian cell.
The synthetic gene according to any one of the above. 25. The synthetic gene according to any of claims 17 to 24, wherein the expression of the protein is at least 200% of the expression by a wild-type gene in eukaryotic cells. 26. The synthetic gene according to any of claims 17 to 25, comprising the sequence of Fig. 2A, or a homolog thereof having a GC content of 53% to 63%, preferably 55% to 61%. 27. A eukaryotic expression vector comprising the synthetic gene or the gene region according to any of claims 17 to 26. 28. The expression vector of claim 27, further comprising a constitutive or inducible or tissue specific promoter. 29. The expression vector according to claim 27 or 28, comprising a plasmid, a mammalian or insect virus.