JP2002531054A - Nucleic acids and proteins from group B streptococci - Google Patents

Abstract

  (57) [Summary] Novel protein antigens from group B streptococci are disclosed along with the nucleic acid sequences that encode them. Also disclosed are vaccines and their use in screening methods.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001] The present invention relates to Streptococcus agalactiae.
agalactiae), nucleic acid molecules encoding such proteins, and the use of the proteins as antigens and / or immunogens and in detection / diagnosis. The invention also relates to a method for rapidly screening bacterial genomes to isolate and characterize bacterial cell envelope-related or secreted proteins.

[0002] Group B streptococci (GBS) (Streptococcus agalactiae) are capsular bacteria that emerged in the 1970s as the major human pathogens causing sepsis and meningitis in newborns as well as adults. The prevalence of early-onset neonatal infections varies between 0.7 and 3.7 per 1000 births in the first five days of life,
About 20% of cases are fatal. 25-50% of newborns surviving the infection
Often suffers from neurological sequelae. Late-onset neonatal infections occur at the rate of about 0.5-1.0 per 1000 births, from 6 days to 3 months of age.

[0003] A link has been established between the colonization of the maternal genetic system by GBS at birth and the risk of neonatal sepsis. In humans, it has been established that the rectum will serve as a repository for GBS. Sensitivity in neonates is associated with low concentrations or deficiencies of IgG antibodies to capsular polysaccharides found in GBS that cause human disease. US strains isolated from clinical cases usually belong to capsular serotypes Ia, Ib, II, III, although serotype V appears to be of increasing severity. Type VIII GBS is the leading cause of neonatal sepsis in Japan.

[0004] Possible preventive measures include administration of antibiotics to the mother during or after delivery, but there is concern that the emergence of resistant bacteria and, in some cases, allergic reactions. Inducing long-lasting maternal-derived immunity by vaccination of growing girls is one of the most promising approaches to prevent GBS infection in newborns. The capsular polysaccharide antigens of these microorganisms have received the most attention for vaccine development. Studies in healthy adult volunteers have shown that serotypes Ia, II and II
The I polysaccharide is non-toxic and has been shown to be approximately 65%, 95% and 70% immunogenic in non-immunized adults, respectively. One of the problems with using capsular antigens as vaccines is that the rate of response varies depending on the pre-immune condition and the polysaccharide antigen, and all vaccines have been demonstrated in GBS polysaccharide vaccine studies in human volunteers. It does not produce the proper level of IgG antibodies.

[0005] Some people do not respond despite repeated stimulation. These properties are due to the T-independence of the polysaccharide antigen. One way to increase the immunogenicity of these vaccines is to increase the T cell dependence of the polysaccharide by attaching proteins to them. Although the use of polysaccharide conjugates seems promising, problems with the nature of the carrier protein are still open. A conjugate vaccine against GBS, in addition to the cost of the vaccine, will require at least four different conjugates for preparation.

[0006] Recent evidence also suggests that bacterial surface proteins may be useful in conferring immunity. The so-called Rib protein, found most in serotype III strains but rarely in serotypes Ia, Ib or II,
Immunizes against challenge with Rib-expressing GBS in animal models (Stalhammer-Kallemarm et al., Journal of Experimenta
1 Medicine 177 : 1593-1603 (1993)). Another surface protein of interest as a component of the vaccine is the C protein alpha antigen.
This protected the vaccinated mice against lethal infection with the strain expressing the alpha protein. The amount of antigen expressed by GBS varies significantly.

[0007] Vaccination approaches to GBS infection that rely on the use of capsular polysaccharides tend to vary the rate of response significantly depending on the pre-immune condition and the particular type of polysaccharide antigen used. Has disadvantages. Trial results in human volunteers have shown that the rate of response is only around 65% for some of the key capsular antigens (Larsson et al., Infection and
Immunity 64 : 3518-3523 (1996)). It is also unclear whether all individuals responding to the vaccine will have adequate levels of polysaccharide-specific IgG that can cross the placenta and confer immunity to the newborn. Coupling protein carriers to polysaccharide antigens will allow them to be turned into T-cell dependent antigens and increase their immunogenicity.

[0008] Preliminary studies using GBS III-type polysaccharide tetanus toxin conjugate have been carried out.
Makers, Reviews of Infectious Diseases 7 458-467 (1985), Baker et al., The New Engla.
nd Journal of Medicine319: 1180-118
5 (1988), Paolech et al., Infection and Immuni.
ty64677-679 (1996), Paolech et al., Infectio.
n and Immunity62: 3236-3243 (1994)),
In developed countries, many adults are immunized against tetanus within the last five years, so
Use is inconvenient. Use of additional enhancers with tetanus toxin reduces harm.
(Boyer, Current Opinions in Ped
iatrics7: 13-18 (1995)). Polysaccharide conjugate vaccines
Has the disadvantage of being expensive to produce and manufacture compared to many species of vaccine
. It is also induced by cross-reaction between GBS polysaccharide and sialic acid-containing human glycoprotein.
There is also a risk of the problem being raised.

[0009] An alternative to polysaccharides as antigens is the use of GBS-derived protein antigens. Recent evidence suggests that the GBS surface-associated protein Rib and alpha C protein may be used to confer immunity against GBS infection in experimental model systems (Starhammer-Kallemarm et al. (1993) supra; Larson et al. (1996) supra). However, these two proteins are not conserved in all serotypes of GBS that cause disease in humans. Even assuming that these antigens are immunogenic and elicit a protective level of response in humans, these antigens are not present because 10% of infectious group B streptococci do not express Rib or C protein alpha. It does not confer protection against infection.

[0010] The present invention provides a novel screening method specifically designed to identify group B streptococcal genes encoding bacterial cell surface-associated or secreted proteins (antigens) using vaccines against GBS. The aim is to overcome the problem. The proteins expressed by these genes are immunogenic and therefore will be useful in preventing and treating group B streptococcal infection. For the purposes of this application, the term "immunogenic" means that these proteins elicit a protective immune response in a patient. Using this novel screening method, a number of genes encoding novel group B streptococcal proteins have been identified.

Thus, in a first aspect, the invention relates to FIG. The present invention provides a group B streptococcal protein, a fragment thereof, or a derivative thereof, having one sequence selected from the sequence group shown in 1.

It is clear to the person skilled in the art that proteins and polypeptides belonging to this group may be cell surface receptors, adhesion molecules, transport proteins, membrane structural proteins and / or signal generating molecules. There will be.

[0013] Changes in the amino acid sequence of the protein may occur without affecting the function of the protein. These include amino acid deletions, insertions and substitutions, and may be the result of alternative splicing and / or the presence of multiple translation initiation and termination sites. Polymorphisms may occur as a result of an unfaithful translation process. Such changes in the amino acid sequence are tolerated if they do not affect protein function.

Thus, the present invention provides a derivative of a protein, polypeptide or peptide of the present invention or a derivative of the protein, polypeptide or peptide of the present invention that exhibits at least 50% identity to the protein, polypeptide and peptide described herein Mutants are also included. Preferably, the degree of sequence identity is at least 60%, preferably higher than 75%.
More preferably more than 80%, more preferably more than 90% or 95%.

The term “identity” can be used to describe the similarity between two polypeptide sequences. A software package well known in the art for performing this operation is the CLUSTAL program. This compares the amino acid sequences of the two polypeptides and finds the optimal sequence by appropriately inserting spaces in each sequence. Also, amino acid identity or similarity for the optimal sequence (identity of amino acid type plus conservation) can be calculated using a software package such as BLASTx. The program aligns the longest range of similar sequences and determines a matching value. Regardless of the pattern comparison, some similar regions are found, each with a different score. Those skilled in the art will appreciate that two polypeptides of different lengths can be compared over the entire length of a longer fragment. Alternatively, smaller regions may be compared. Usually, sequences of the same length are compared to make a useful comparison.

Manipulation of DNA encoding a protein is a particularly effective technique both for modifying the protein and for mass production of the protein for purification purposes. This includes the use of PCR techniques to amplify the desired nucleic acid sequence. Thus, the sequence data described herein can be used to design primers for use in PCR, thereby allowing the desired sequence to be targeted and then highly amplified.

Typical primers are at least 5 nucleotides in length, and are generally at least 10 nucleotides in length (eg, 15 to 25 nucleotides in length). In some cases, primers of at least 30 or at least 35 nucleotides in length may be used.

As a further alternative, chemical synthesis may be used. This may be automated. Relatively short sequences are chemically synthesized and ligated together to form longer sequences.

Thus, in a further aspect, the present invention provides a sequence comprising: (i) FIG. (Ii) a sequence complementary to any of the sequences (i), (iii) the same protein as the sequence (i) or (ii), Or a sequence encoding a polypeptide, (iv) a sequence exhibiting substantial identity to any of the sequences of (i), (ii) and (iii),
Or (v) FIG. A nucleic acid molecule comprising or consisting of a sequence encoding a derivative or fragment of the nucleic acid molecule shown in 1.

The term “identity” is also used to describe the similarity between two individual DNA sequences. Best Fit Program (Smith and Waterman, Ad
vences in applied Materials, 482-48
9 (1981)) finds the most similar segment between two nucleic acid sequences, while the GAP program aligns the sequences along the entire length of the sequence and optimally aligns them by inserting spaces in each sequence as appropriate. 5 is an example of the type of computer software used to find it.

The term “RNA equivalent” as used above means that a given RNA molecule has a sequence that is complementary to the sequence of a given DNA molecule, and the “U” of the RNA in the genetic code Takes the place of "T" into account.
Nucleic acid molecules can be isolated or recombinant.

[0022] The nucleic acid molecule can be isolated or recombinant. DNA constructs can be readily made using methods well known to those skilled in the art. These techniques are described, for example, in
Sambrook et al., Molecular Cloning Second Edition, Cold Spring Harb.
OUR LABORATORY PRESS (1989).
Modifications of DNA constructs and expressed proteins, such as the addition of promoters, enhancers, signal generating sequences, leader sequences, translation initiation and termination signals and DNA stability control regions or fusion partners, will be facilitated. .

Usually, the DNA construct is inserted into a vector of phage or plasmid origin. Protein expression is achieved by transformation or transfection of the vector into a host cell of eukaryotic or prokaryotic origin. Such vectors and appropriate host cell types still form a further aspect of the invention.

[0024] The Group B streptococcal proteins (antigens) described herein can further be used to raise antibodies or to produce affibodies. These can be used to detect group B streptococci.

Thus, in a further aspect, the invention provides an antibody, affibody or derivative thereof that binds to one or more of the proteins, polypeptides, peptides, fragments or derivatives thereof described herein. I do.

Antibodies for the purposes of the present invention may be monoclonal or polyclonal. Polyclonal antibodies can be obtained from a suitable animal host (eg, mouse, rat, guinea pig,
(Rabbit, sheep, goat or monkey) can be produced by injecting the animal with a protein described herein, or a homolog, derivative or fragment thereof, to stimulate its production. If necessary, an adjuvant may be administered with the protein. Well-known adjuvants include Freund's adjuvant (complete and incomplete) and aluminum hydroxide.
The antibody can then be purified, taking advantage of its binding properties to the proteins described herein.

[0027] Monoclonal antibodies can be produced from hybridomas. These can be formed by fusing myeloma cells with spleen cells producing the desired antibody to form an immortal cell line. Thus, the well-known Kohler and Milstein technique (Nature 256 (1975)) or a subsequent variation of this technique can be used.

Techniques for producing monoclonal and polyclonal antibodies that bind to a particular polypeptide / protein are now well developed in the art. These are described in standard immunology textbooks, such as Reutt et al., Immunology Second Edition (1989), Churchill Livingstone, London.

[0029] In addition to whole antibodies, the invention includes derivatives thereof that can bind to the proteins and the like described herein. Thus, the present invention includes antibody fragments and synthetic constructs. Examples of antibody fragments and synthetic constructs are Dougaru et al, it is described in Tibtech 1 2 372-379 (9 January 1994).

Examples of antibody fragments include, for example, Fab, F (ab ′) ₂ and Fv fragments. Fab fragments (these are described in Leucht et al., Supra). The Fv fragments can be modified to create synthetic constructs known as single-chain Fv (scFv) molecules. It contains a peptide linker covalently linking the V _h and V ₁ regions. This linker contributes to the stability of the molecule. Other synthetic constructs used include CDR peptides. These are synthetic peptides containing antigen binding determinants. Further, a peptidomimetic may be used. These molecules are usually conformationally restricted organic rings, mimicking the structure of a CDR loop, and include antigen-interacting side chains.

[0031] Synthetic constructs include chimeric molecules. Thus, for example, humanization (
Or primatized) antibodies or derivatives thereof are within the scope of the invention. An example of a humanized antibody is an antibody that has a region of the human framework but has a rodent hypervariable region. Methods for producing chimeric antibodies are described, for example, in Morrison et al., PNAS, 81 , 68.
51-6855 (1984) and Takeda et al., Nature 314 , 452-.
454 (1985).

[0032] Synthetic constructs also include molecules that include additional moieties that, in addition to antigen binding, provide a molecule with some desired properties. For example, the additional portion may be labeled (
For example, a fluorescent or radioactive label). Alternatively, it may be a pharmaceutically active ingredient.

Affibodies are proteins found to bind to target proteins with low dissociation constants. These are selected from phage display libraries expressing segments of the target protein of interest (Nord K, Gunnar Luson E, Lindal J, Stahl S, Woolen M, Nigren PA, Department of Biochemistry and Biotechnology, Royal Institute of Technology (KTH), Stockholm, Sweden).

In a further aspect, the invention provides an immunogenic composition comprising one or more of the proteins, polypeptides, peptides, fragments or derivatives thereof, or nucleotide sequences described herein. This type of composition is useful in patients.
It may be useful for treating or preventing group B streptococcal infection. In a preferred aspect of the invention, the immunogenic composition is a vaccine.

In another aspect, the invention relates to i) the use of an immunogenic composition described herein in the preparation of a medicament for the treatment or prevention of a group B streptococcal infection, preferably the medicament is Ii) a method of detecting group B streptococci comprising the step of contacting the sample to be tested with at least one antibody, affibody or derivative thereof as described herein; A method for detecting group B Streptococcus comprising contacting with at least one protein, polypeptide, peptide, fragment or derivative described herein; iv) at least one of the samples to be tested described herein. A method for detecting group B streptococci comprising contacting two nucleic acid molecules, v) a group B linkage comprising an antibody, affibody or derivative thereof as described herein. A kit for the detection of cocci, vi) for the detection of group B streptococci comprising at least one of the proteins, polypeptides, peptides, fragments or derivatives thereof of group B streptococci described herein. Kits, vii) kits for detecting group B streptococci comprising at least one nucleic acid of the invention.

By using a novel screening method for specifically identifying a group B streptococcal gene encoding a bacterial cell envelope-related protein or a secreted protein as described above, the novel protein described herein is identified, Isolated.

The information required for protein secretion / export has been extensively studied in bacteria. In most cases, release requires a signal peptide located at the N-terminus of the precursor protein. This signal peptide directs the precursor to a transport site on the membrane. During or after transport, the signal peptide is removed by a signal peptidase. The final destination / localization of the protein is determined by sequences other than the leader peptide sequence (whether it is secreted extracellularly or anchored to a bacterial surface scaffold).

Recently, Pocute et al. (J. Bacteriol. 180 : 1904-1)
912 (1998)) describe a screening vector that incorporates the nuc gene lacking its own signal leader as a reporter and identifies proteins released by Gram-positive bacteria, and described it in L. et al. Applied to Lactis. Staphylococcus nuclease is a thermostable monomeric enzyme secreted naturally,
It is efficiently expressed and secreted by a range of Gram-positive bacteria (Shortle, Ge
ne 22 : 181-189 (1983); Kobasevic et al. Bacte
riol. 162 : 521-528 (1985); Miller et al. Bac
terol. 169 : 3508-3514 (1987); Libre et al., J.
. bacteriol. 174 : 1854-1861 (1992); Laroy et al. Bacteriol. 176 : 5135-5139 (199
4), Pocute et al., 1998 (supra). This screening vector (pF
UN) is a ColE1 that promotes replication in E. coli and certain other Gram-negative bacteria.
Includes pAMβ1 replicons that function in a broad host range of Gram-positive bacteria as well as replicons. Using the unique cloning site present in this vector,
Transcriptional and translational fusions between the cloned genomic DNA fragment and the truncated open reading frame of the nuc gene lacking its own signal secretion leader can be made. Since the secretion of nucleases can be easily detected using a simple and sensitive plate test, i.e., the recombinant colonies secreting nucleases while the control colonies remain white, the test that develops a pink halo, the nuc gene is It becomes an ideal reporter gene (Shortle, 198
3 (supra); Laroy et al., 1994 (supra)).

A direct screen for identifying and isolating DNA encoding bacterial cell envelope-related proteins (antigens) or secreted proteins (antigens) in pathogenic bacteria has been developed by the inventors. This utilizes a vector system (pTREP1 expression vector) in Lactococcus lactis that flank the DNA encoding the surface protein from group B streptococcus and specifically detects the DNA sequence associated therewith. In addition, this screening vector incorporates a nuc gene encoding a staphylococcal nuclease as a reporter gene.

Only part of the nuc gene encoding the mature nuclease protein (excluding its signal peptide sequence) was It is cloned into the pTREP1 expression vector in Lactis. In this form, the nuclease encoded by nuc cannot be secreted even though it can be expressed in the cell. Next, the reporter vector was randomly ligated with appropriately enzymatically digested genomic DNA from group B streptococci, and Cloned into Lactis and used as a screening system for sequences that release nucleases. Thus, the gene sequence / partial gene sequence encoding the released protein from group B streptococci is isolated. Once a partial gene sequence has been obtained, the full-length sequence encoding the released protein will be readily obtained using techniques well known to those skilled in the art.

In having a promoter, the pTREP1-nuc vector differs from the pFUN vector described in Pocute et al. (1998) (supra). This is directly L. Lactis by screening Nuc activity directly. Lactis was used to identify the released protein. Since the pFUN vector does not contain a promoter upstream of the nuc open reading frame, the cloned genomic DNA fragment must provide signals for transcription in addition to the elements required for Nuc translation initiation and secretion. . This restriction can prevent isolation of genes that are remote from the promoter, for example, genes within the polycistronic operon. Furthermore, promoters derived from other types of bacteria have been described in L. et al. There is no guarantee that lactis will recognize and function. Certain promoters are under strict control in their natural host, but That may not be the case at Lactis. Conversely, the presence of the P1 promoter in the pTREP1-nuc-based vector ensures that promoterless DNA fragments (or DNA fragments containing promoter sequences that are not active in L. lactis) are still transcribed.
Thus, yet another advantage of the present invention is that genes that have been overlooked by other screening methods are identified.

Thus, in a further aspect, the invention provides the following steps:-ligating a reporter vector comprising a nucleotide sequence encoding the mature form of the Staphylococcus nuclease gene and the upstream promoter region with DNA from Gram-positive bacteria Transforming the resulting vector into Lactococcus lactis cells; and assaying the secretion of Staphylococcus nuclease protein in the transformed cells. A method for screening DNA encoding an antigen or a surface antigen is provided.

[0043] Preferably, the reporter vector is provided in FIG. PTREP1-nu shown in Figure 4
c vector.

[0044] In another aspect, the invention relates to a method for screening DNA encoding a released or surface antigen of a Gram-positive bacterium, as shown in FIG. 4 is provided. Examples of Gram-positive bacteria to be screened include group B streptococci, Streptococcus pneumoniae, Staphylococcus aureus or pathogenic group A streptococci.

If we have identified a group of important proteins, such proteins are potential targets for antimicrobial therapy. However, it is necessary to determine whether each protein is essential for viability of the microorganism. Thus, the present invention is a method of determining whether a protein or polypeptide described herein represents a potential antimicrobial target, comprising the steps of inactivating said protein; Also provided is a method comprising determining whether the group streptococci are still alive.

A suitable method for inactivating a protein is to selectively knock out the gene, ie, prevent the expression of the protein, and determine if this results in a lethal change. Suitable methods for performing such gene knockouts are described in Li et al. N. A. S. 94 : 13251-13256 (1
997) and Corkman et al.

In a final aspect, the present invention antagonizes, inhibits, or otherwise agonizes the function or expression of a protein or polypeptide of the present invention in the manufacture of a medicament for the treatment or prevention of group B streptococcal infection. Provide the use of drugs that can be interfered with.

The invention will now be illustrated by the following examples, which should not be construed as limiting in any way. The examples refer to the following figures.

Example 1 More than 100 putative / partial gene sequences putatively encoding proteins released in agalactiae were identified using the nuclease screening system of the present invention. These were further analyzed to remove artifacts. The nucleotide sequence of the gene identified using the screening system was characterized using several parameters described below. All of these sequences have not been previously disclosed and are novel.

1. The leader / signal peptide sequences of all putative surface proteins were analyzed. Bacterial signal peptide sequences share a common design. These are the short positive N-terminus (N region) immediately upstream of the hydrophobic residue range (central-h region), followed by the more polar C-terminal portion (c region) containing the cleavage site. It is characterized by Examine the hydropathy profiling of the putative protein using computer software (Marks, Nuc.
Acid. Res. 16 : 1829-136 (1988)), which is used to identify the typical unique hydrophobic portion (h region) of the leader peptide sequence. In addition, the presence / absence of a potential ribosome binding site (Shine-Dalgarno sequence required for translation) is described.

[0051] 2. All putative surface protein sequences were used to search an OWL sequence database, such as a translation of the Genbank and Swiss plot databases. This allowed the identification of similar sequences previously characterized at the functional level as well as the sequence level. Information can also be provided that indicates whether these proteins are truly surface related or not artificial.

[0052] 3. The novelty of the putative S. agalactiae surface protein will also be evaluated. Some of the proteins identified have or do not have the typical leader peptide sequence and will not show homology to any DNA / protein in the database. Indeed, these proteins represent a major advantage of our screening method, a method for isolating atypical surface-related proteins, and these proteins are not compatible with all previously described screening methods. Would not have been found.

Construction of Three Reporter Vectors to Identify and Isolate Genomic DNA Fragments from Pathogenic Bacteria Encoding Secreted or Surface-Related Proteins and Their Construction. The use in Lactis is described below.

Construction of the reporter vector pTREP1-nuc system (a) Construction of the expression plasmid pTREP1 The pTREP1 plasmid is a high copy number (40-80 per cell) theta-replicating Gram-positive plasmid, which has been described previously per se. It is a derivative of the pTREX plasmid, which is a derivative of the pIL253 plasmid. pIL253 is p
Incorporates a broad Gram-positive host range replicon of AMβ1 (Simon and Chopin, 1988), and Not a mobile due to Lactis sex factor.
PIL253 also lacks the tra function required for transfer or effective mobilization by the conjugative parent plasmid exemplified by pIL501. Enterococcus pAM
The β1 replicon has previously been transferred to a variety of species, including not only Clostridium acetobutylicum but also Streptococcus, Lactobacillus and Bacillus species (Leblanc et al., Proceedings of the Nation).
al Academy of Science USA 75: 3484-3
487 (1978)). This indicates that the pAMβ1 replicon has potentially broad host range availability. The pTREP1 plasmid represents a constitutive transcription vector.

[0055] The pTREX vector was constructed as follows. An artificial DNA fragment containing a putative RNA stabilizing sequence, a translation initiation region (TIR), a multiple cloning site for insertion of a target gene, and a transcription terminator was annealed with two complementary oligonucleotides to obtain Tf1 DNA polymerase. By elongation using The sense and antisense oligonucleotides have Nh at their 5 'ends, respectively.
Includes recognition sites for eI and BamHI to facilitate cloning. This fragment was cloned between the EcoRI and HindIII sites in pLET1 (Wells et al., J. Appl. Bacteriol. 74 : 629-636).
(1993)), a pUC19 derivative comprising a T7 expression cassette
It was cloned between the XbaI and BamHI sites of C19NT7. The resulting construct was named pUCLEX. Next, the complete expression cassette of pUCLEX was cut with HindIII, blunt-ended and removed, followed by EcoRI of pIL253.
The vector pTREX was cloned into the RI site and the SacI blunt site and then cut with EcoRI (Wells and Schofield, InC
current advices in metabolism, geneti
cs and applications-NATO ASI Series H 9 8: 37-62 (1996) ). The putative RNA stabilizing sequence and TIR were derived from the E. coli T7 bacteriophage sequence and were modified at one nucleotide position to increase the complementation of the Shine-Dalgarno (SD) motif to the Lactococcus lactis ribosomal 16sRNA (Schofield et al. , Personal communication, Department of Pathology, Cambridge University).

Lactococcus lactis MG1363 chromosome DN showing promoter activity
The A fragment was subsequently named P7, which was cloned between the EcoRI and BglII sites in the expression cassette to create pTREX7. This active promoter region had previously been isolated using the promoter probe vector pSB292 (Waterfield et al., Gene 165 : 9-15 (19).
95)). This promoter fragment was amplified by PCR using Vent DNA polymerase according to the manufacturer's instructions.

Next, the pTREP1 vector was constructed as follows. Termination of transcription, forward p
An artificial DNA fragment containing a UC sequencing primer, a promoter multiple cloning site region and a general translation termination sequence was annealed together with two partially overlapping complementary synthetic oligonucleotides, using a sequenase according to the manufacturer's instructions. Created by stretching. Sense and antisense (pTREP _F and pTREP _R ) oligonucleotides have EcoRV and Bam at the 5 ′ end.
Each contains an HI recognition site to facilitate cloning into pTREX7.
The transcription termination was that of the Bacillus penicillinase gene and has been shown to be effective in Lactococcus (Jos et al., Applied and E).
nvironmental Microbiology 50 : 540-54
2 (1985)). This was considered necessary, as it was confirmed that the expression of the target gene in the pTREX vector was leaky, and it was considered to be the result of promoter activity of unknown function in the origin region. (Schofield et al., Personal communication, Department of Pathology, Cambridge University). Sequencing of the forward pUC primer involves directly enabling the sequencing of the cloned DNA fragment. Translation stop sequences encoding stop codons in three different reading frames were included to prevent translational fusion between the vector gene and the cloned DNA fragment. First, the pTREX7 vector was digested with EcoRI and blunt-ended using the 5'-3 'polymerase activity of T4 DNA polymerase (NEB) according to the manufacturer's instructions. The pTREX7 vector, which had been digested with EcoRI and blunt ended, was digested with BglII, thus removing the P7 promoter. Next, the annealed synthetic DNA fragment derived from the synthetic oligonucleotide was digested with EcoRV and BamHI, and cloned into EcoRI (blunted) -BglII digested pTREX7 vector to prepare pTREP. Next, the MG1363 chromosomal promoter of Lactococcus lactis designated P1 was cloned between the EcoRI and BglII sites of the pTREP expression cassette to form pTREP1. This promoter was also isolated and characterized by the promoter probe vector pSB292 according to Waterfield et al. (1995) (supra). The P1 promoter fragment was amplified from the beginning by PCR using vent DNA polymerase according to the manufacturer's instructions and cloned into pTREX as an EcoRI-BglII DNA fragment. The EcoRI-BglIIP1 promoter containing the fragment was excised from pTREX1 by restriction enzyme digestion and used for cloning into pTREP (Schofield et al., Private communication, Department of Pathology, Cambridge University).

(B) S. PCR amplification of aureus nuc gene The nucleotide sequence of the aureus nuc gene (EMBL database accession number V01281) was used to design synthetic oligonucleotide primers for PCR amplification. These primers were designed to amplify the mature form of the nucA gene, designated nucA, which was generated by the protease hydrolytic cleavage of the N-terminal 19-21 amino acids of the secreted propeptide designated as Sunase B. (Shortle, 1983 (above)). Three sense primers (Fig.
NucS1, nucS2, and nucS3) shown in FIG.
The genes had EcoRV or SmaI blunt-ended restriction endonuclease cleavage sites in different reading frames for the gene. BglII and BamHI were further incorporated at the 5 'ends of the sense and antisense primers, respectively,
Facilitating cloning into pTREP1 cut with HI and BglII. The sequences of all primers are shown in FIG. 3 is shown. Mature form of nuclease gene (Nu
The three nuc gene DNA fragments encoding cA) were amplified by PCR using each sense primer in combination with an antisense primer. The nuc gene fragment was prepared under the conditions recommended by the manufacturer. Aureus genomic DNA template, V
The DNA was amplified by PCR using ent DNA polymerase (NEB). 93 ° C
After a 2 minute initial denaturation step, 30 cycles of denaturation at 93 ° C. for 45 seconds, annealing at 50 ° C. for 45 seconds and extension at 73 ° C. for 1 minute were followed by an extension step at 73 ° C. for a final 5 minutes. The PCR amplification product was purified using a wizard wash column (Promega) to remove unincorporated nucleotides and primers.

(C) Construction of pTREP1-nuc Vector The purified nuc gene fragment described in section b was digested with BglII and BamHI under standard conditions, ligated to pTREP1 which had been digested with BamHI and BglII and dephosphorylated. Reporter vectors pTREP1-nuc1, pTR
The EP1-nuc2 and pTREP1-nuc3 lines were created. These vectors are shown in FIG. Described in 4. Using reagents and buffers supplied by the manufacturer or using standard techniques (Sambrook and Maniatis, Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Lab).
Oratory Press: Cold Spring Harbor (
1989)) to perform general molecular biology techniques. Each pTREP1-n
The expression cassette in the uc vector contains a transcription termination region, the Lactococcus promoter P1, a unique cloning site (BglII, EcoRV or SmaI).
) Followed by the mature form of the nuc gene and the second transcription termination. Note that sequences required for translation and secretion of the nuc gene have been deliberately omitted in this construction. Such elements are provided only by appropriately digested foreign DNA fragments (target bacteria) that can be cloned into a unique restriction site located immediately upstream of the nuc gene.

(D) Screening for proteins secreted by group B streptococci Genomic DNA isolated from group B streptococci (S. agalactiae) was digested with the restriction enzyme Tru9I. Recognizes the sequence 5'-TTAA-3 'because it can effectively cleave A / T-rich genomes and produce random genomic DNA fragments in a preferred size range (typically 0.5-1.0 kb on average) This enzyme was used. This size range was preferred because it increases the likelihood that a new gene sequence can be transcribed using the P1 promoter. However, many streptococcal promoters have been described in L. et al. The P1 promoter may not be necessary in all cases because it may be recognized in Lactis. DNA fragments of different size ranges. Agaractiae genomic DNA was purified from a partially digested product with Tru9I. Tru9
Since the I restriction enzyme forms a cohesive end, the DNA fragment is EcoRV or SmaI
The blunt ends had to be made before ligation into the truncated pTREP1-nuc vector. This was done by a partially filling enzyme reaction using the 5'-3 'polymerase activity of the Klenow enzyme. Briefly, Tru9I digested DNA is
T4 DNA ligase buffer (New England Biolabs; NEB) (1
x) and the required dNTPs, in this case dATP and dTTP, were dissolved in 33 μM of each added solution (usually 10-20 μl in total volume). Add Klenow enzyme (
1 unit of Klenow enzyme (NEB) per μg of DNA),
Incubated for 5 minutes. The reaction was stopped by incubating the mixture at 75 ° C. for 20 minutes. Next, pTREP digested with EcoRV or SmaI
-Nuc plasmid DNA was added (usually 200-400 ng). Next, 400 units of T4 DNA ligase (NEB) and T4 DNA ligase buffer (1 ×) were added to the mixture, and the mixture was incubated at 16 ° C. overnight. The ligation mixture was directly mixed with 1/10 volume of 100% ethanol and 3M sodium acetate (pH 5
. 2) precipitated in L. Lactis MG1363 was used to transform (Gasson, J. Bacteriol. 154 : 1-9 (1983)).
Alternatively, Bg is added to the gene cloning site of the pTREP-nuc vector.
An II site is also included and can be used, for example, for cloning Sau3AI digested genomic DNA fragments.

Substantially as described in Shortle, 1983 (supra) and Le Loire et al., 1994 (supra). Lactis-transformed colonies were grown on brain heart infusion agar and nuclease secreting (Nuc ⁺ ) clones were plated with toluidine blue DNA agar overlay (0.05 M Tris pH 9.0, 10 g agar per liter, 10 g NaCl per liter, 0 g NaCl). .1 mM CaCl ₂ ,
0.03% wt / vol salmon sperm DNA and toluidine blue O dye 90m
g). The plate was then incubated at 37 ° C. for 2 hours. The nuclease secreting clone developed a pink halo that was easily identifiable. Plasmid DNA was transformed with Nuc ⁺ recombinant L. The DNA insert was isolated from the Lactis clone and the DNA insert The single strand was sequenced using the NucSeq sequencing primer described in No. 3. This primer is sequenced directly along the DNA insert.

Although the above examples are particularly relevant to group B streptococci, those skilled in the art will use similar screening techniques to detect proteins released and secreted in other Gram-positive bacteria, such as S. pneumoniae It will be clear what can be done.

[0063] Example 2: DNA referred to as pcDNA3.1 + less pcDNA3.1 as screening DNA vaccine vector of group B streptococcus from genes in the vaccine experiment, commercially, available pcDNA3.1 + plasmid (Invitrogen) Was used as a vector in all DNA immunization experiments, such as a gene target derived using the LEEP system. pcDNA3.1 is stable at high levels in mammalian cells and is designed to be transiently expressed;
A Has been widely and effectively used as a host vector to test candidate genes from various pathogens in vaccination experiments (Zang et al., 1997; Kral and Splitter, 1997; Anderson et al., 1996).

This vector contains a human cytomegalovirus (CMV) immediate early promoter / enhancer that effectively and at high levels expresses target genes in a wide variety of mammalian cells and cell types including both muscle and immune cells. Downstream, it has multiple cloning sites to facilitate cloning of multiple gene targets.
This is important for an optimal immune response, as it remains unknown which cell type is most important in generating a protective response in vivo.
The plasmid also contains the ColE1 origin of replication, which favors high copy number replication and growth in E. coli, and the ampicillin resistance gene (B-lactamase) for selection in E. coli. In addition, pcDNA3.1 has a T7 promoter / priming site upstream of the MCS that allows in vitro transcription of the cloned gene in the sense orientation.

Preparation of DNA Vaccines Oligonucleotide primers were designed for each gene of interest derived using the LEEP system. Each gene was thoroughly probed and primers were designed to target, where possible, those parts of the gene that would encode only the mature part of the protein ( Appendix I ). It was desired that the expression of a sequence encoding only the mature portion of the target gene protein facilitate accurate folding when expressed in mammalian cells. For example, in most cases, the putative N-terminal signal peptide sequence is p
Primers were designed so as not to be included in the final amplification product cloned into the cDNA 3.1 expression vector. The signal peptide directs the polypeptide precursor via the protein release pathway to the cell membrane. In this protein release pathway, the signal peptide is usually cleaved by signal peptidase I (or signal peptidase II in the case of lipoproteins). Thus, the signal peptide does not form any part of the mature protein, whether the mature protein is on the bacterial surface or secreted. If the N-terminal leader peptide sequence was not immediately apparent, primers were designed to target the entire gene sequence for cloning and ultimately expression in pcDNA3.1.

All forward and reverse oligonucleotide primers incorporated appropriate restriction enzyme sites to facilitate cloning into the MCS region of pcDNA3.1.
Also, all forward primers should have the conserved Kozak nucleotide sequence 5 immediately upstream of the "atg" translation initiation codon in reading frame with the target gene insert.
It was designed to include '-gccacc-3'. This Kozak sequence facilitates recognition of the starting sequence by eukaryotic ribosomes. Typically, a forward primer incorporating a BamHI restriction enzyme site has the sequence 5'-cg ggatcc gccacca
Beginning with tg-3 ', a sequence homologous to the 5' end of that portion of the gene to be amplified was followed. NotI restriction enzyme site sequence 5'-t was included in all reverse primers.
tgcggccgc- 3 'was incorporated. All gene-specific forward and reverse primers were designed to be consistent in melting point temperature to facilitate their amplification.

All gene targets were analyzed by PCR. Agaractiae genomic DNA template was amplified using Vent DNA polymerase (NEB) or rTth DNA polymerase (PE Applied Biosystems) under conditions recommended by the manufacturer. A typical amplification reaction involves an initial denaturation step at 95 ° C. for 2 minutes followed by 95 ° C.
30 seconds of denaturation, 30 seconds of annealing at the appropriate melting temperature, and 72 ° C.
One minute extension (1 minute per kilobase of DNA to be amplified) includes 35 cycles. This was followed by a final extension period of 10 minutes at 72 ° C. All PCR amplification products were extracted once with phenol chloroform (2: 1: 1), once with chloroform (1: 1), and precipitated with ethanol. The specific DNA fragment was
Isolated from agar gel using the k-gel extraction kit (Quiagen). The purified amplified gene DNA fragment is digested with an appropriate restriction enzyme, and pcD is digested using E. coli as a host.
It was cloned into the NA3.1 plasmid vector. Restriction mapping and DNA
Sequencing confirmed the successful cloning and maintenance of the gene. Recombinant plasmid DNA was isolated on a large scale (> 1.5 mg) using Plasmid Mega Kit (Quiagen).

In at least one trial of the DNA immunization experiment, S. aureus was used as a positive control. It was decided to include the agalactiae rib gene. Rabbit antiserum to Rib protein (Stallhammer-Kalman et al., 1993) and highly purified preparations of Rib protein itself (Larsson et al., 1999; Larsson et al., 1996) are resistant to lethal infection with antigen expressing strains. It has been shown to defend.
All of the serotype III strains were shown to express the Rib antigen, and were analyzed by laboratory Southern blot analysis. Agalactiae serotype III (strain 97/0099) alone contains the rib gene, thereby confirming that it is a positive control for whole DNA immunization experiments as part of a DNA vaccine. ri
Oligonucleotide primers were designed to target only the mature part of the b gene ( Appendix I ) and included the appropriate restriction sites for cloning into pcDNA3.1. rib was converted to tTth DNA polymerase (PE Applied
(Biosystems) under the conditions recommended by the manufacturer. Cloning conditions were the same as above.

S. Confirmation of prepared strains of standard agaractiae inoculum Agalactiae serotype III (strain 97/0099) is a recent clinical isolate from cerebrospinal fluid of neonates with meningitis. This hemolytic strain of group B streptococci was epidemiologically tested and evaluated at Respiratory and Systematic Infection Laboratory, PHLS Central Public Health Laboratory, NW95HT, London, 61 Colindale Avenue. We passed this strain twice before arriving in the lab. Upon arrival on the agar slope,
4-5 colonies were wiped out and used immediately to inoculate Todd Hewitt / 5% horse blood broth and incubated statically at 37 ° C overnight. The overnight culture was then
. A 5 ml aliquot was used to make a 20% glycerol bacterial stock for long-term storage at -70 ° C. Glycerol stocks were spread on Todd Hewitt / 5% horse blood agar plates to confirm survival.

[0070]In vivo passage of group B streptococci S. Freezing culture of Agalactiae serotype III (strain 97/0099) (strain)
On the Todd Hewitt / 5% blood agar plate,
Single colonies were grown overnight at 37 ° C. Wipe 4-5 colonies, Todd
-Used for inoculation of Hewitt / 5% horse blood, and cultured again overnight. This overnight culture
Todd-Hewitt solution (1: 100 dilution) using a 0.5 ml aliquot of the product
50 ml was inoculated and cultured at 37 ° C. Overnight (since the toxicity of this strain is unknown)
Make 10-fold serial dilutions of the culture and intraperitoneally administer CBA / ca mice in duplicate in each
(IP) passage. The surviving numbers were counted for the different inoculants used for the passage. Mau
Group of 10⁸-10^FourDifferent pathogen concentrations in the range of colony forming units (cfu)
Attacked. The symptomatic mice were finally anesthetized and a cardiac puncture was performed (most
High dose, ie 1 × 10⁸Only mice challenged with cfu developed). Times
Serum broth 50 ml (Todd Hewitt /
20% inactivated fetal calf serum). Monitor this culture continuously,
Grow to log phase. As bacteria grow, blood becomes more lysed and
OD due to the presence of underground blood₆₀₀Reading is interrupted, and the culture is constantly
I needed to monitor. When late log phase / early stationary phase is reached, the culture is
Transfer to a new 50 ml tube to eliminate dead bacterial cells, retain remaining blood cells,
Settled to the bottom of the test tube. Next, transfer the 0.5 ml aliquot to a sterile cryogenic vial,
Frozen in liquid nitrogen and stored at -70 ° C. Viable count is one standard inoculum
Aliquots were made to determine bacterial counts. This allows about 5 × 10 ⁸ It was determined to be cfu.

[0071]Intraperitoneal challenge and toxicity test of group B streptococcal standard inoculum Whether the standard vaccination is reasonably toxic for use in vaccination trials
The dose range was used to challenge the animals. Partial mark of frozen standard inoculum strain
The book was melted at room temperature. From the viable cell count data, per 1 ml for standard inoculum
The cfu number was already known. First, serial dilutions of the standard inoculum are performed by Todd Hue.
Prepared with the mouse and 1 mouse per 500 μl volume of Todd-Hewitt solution
× 10⁸~ 1 × 10^FourThe dose of cfu was administered intraperitoneally. Different dosages
The survival times of the groups of mice inoculated with the bacteria were compared. Standard inoculum is moderately toxic
1x10⁶The dose of cfu is best suited for use in further vaccine trials.
Was deemed out of date. In addition, 5x10^FiveFrom 5x10⁶cfu dosage range
The optimization was performed by comparing the mice that received. The optimal dose is about 2.5x10 ⁶ cfu was found. This is a 100% lethal dose for a short time
It reproducibly matched the final point determined by the survival time within the range. All this
Throughout all experiments, the dosed mice should be constantly monitored to calculate survival time.
In addition, he clarified the symptoms and the stage of progression of the symptoms.

Vaccination trials DNA was administered to 6 week old CBA / ca mice (Harlan, UK) to perform a vaccine trial in mice. The vaccinated mice were divided into six groups, each group comprising a recombinant pcDNA3 containing a specific target gene sequence derived using the LEEP system.
. Immunized with one plasmid DNA. DNA in Dulbecco's PBS (Sigma)
A total of 100 μg was injected intramuscularly into the tibialis anterior muscle of both hind paws. 4 weeks later, same amount of DN
This operation was repeated using A. As a comparison, a control group of mice was used in all vaccine studies. These control groups were immunized with no DNA vaccination or with the same non-recombinant pcDNA3.1 plasmid DNA over time. Four weeks after the second immunization, all groups of mice received a lethal dose of S. es. Agalactiae serotype III (strain 97/0099) was administered intraperitoneally. Serial dilutions of the inoculum were spread on Todd Hewitt / 5% blood agar plates to determine the actual number of bacteria administered. Three to four days after infection, all mice were sacrificed. In the infection operation, S. cerevisiae of the administered mice was Symptom progression related to the onset of agalactiae-induced disease was monitored. Typical symptoms include, in an appropriate order, piloerection, stoop, spillage from the eyes, increased lethargy and resistance to movement, often as a result of apparent paralysis of the lower body / hind foot area. Usually, the latter symptom coincides with the progression of death,
At this stage, the mice were culled so as not to suffer further. These mice appeared very close to death and the time of this selection was used to determine survival time for statistical analysis. If a mouse died, the survival time was calculated by averaging the last time that a particular mouse was alive and the time that a particular mouse was alive to determine a more accurate time of death.

Results Interpretation Positive results were each cloned, used in the challenge experiment, and identified as a DNA sequence that provided protection against the challenge. The DNA sequence was determined to be protective if: If the DNA sequence gave a statistically significant protection (95% confidence level (p> 0.05), as determined by the Mann-Whitney U test). -If the DNA sequence shows some protection, even if it is not marginal or significant using Mann-Whitney. For example, if one or more out-of-bounds mice survive significantly longer compared to control mice. In this case, the time until the first death is longer than that of one mouse in the control group.

When the clarity of some results can be affected by problems with the administration of the DNA vaccine, it is acceptable for marginal or insignificant results to be considered as potential positives. Indeed, large variations in survival time may reflect different levels of immune response between different members of a given group.

Results Statistical Analysis of Survival Time-LEEP DNA Immunization and GBS Challenge Trial 1 ( FIG. 4a)

[0076]

[Outside 1]

(T) Symptoms of infection were noted but were terminated at the end of the experiment. A p-value of 1 indicates statistical significance when compared to the pcDNA3.1 control. A p-value of 2 indicates statistical significance when compared to the rib positive control.

All DNA vaccines show a similar protection pattern to that obtained with the rib DNA vaccine originally used as a positive control.

17 (ID-8) Mice immunized with the “17 (ID-8)” DNA vaccine did not show significantly longer survival time compared to the unvaccinated control group. However,
There were two out-of-bounds mice, one of which survived the duration of the experiment despite progression of symptoms. This group also showed a much wider range of survival times as reflected by the mean survival value. The average survival time of this unvaccinated control group is about 14 hours longer.

18 (ID-9) Mice immunized with the “18 (ID-9)” DNA vaccine did not show significantly longer survival time compared to the unvaccinated control group. However,
There was one out-of-bounds mouse that survived the duration of the experiment despite progression of symptoms.

20 (ID-25) Mice immunized with the “20 (ID-25)” DNA vaccine did not show significantly longer survival time compared to the unvaccinated control group. However, there was one out-of-bounds mouse that survived the duration of the experiment despite progression of symptoms.

Statistical Analysis of Survival Time-LEEP DNA Immunization and GBS Challenge Trial 2 ( FIG. 4b)

[0083]

[Outside 2]

(T) —Shows symptoms of infection but was terminated at the end of the experiment. A p-value of 1 indicates statistical significance when compared to the pcDNA3.1 control. A p-value of 2 indicates statistical significance when compared to a non-vaccinated control.

There was no significant difference in the survival times exhibited by the pcDNA3.1 control group and the non-vaccinated control group. This was 35.858 hours (pcDNA3.
Very similar survival times of 1) and 34.166 hours (not vaccinated) were confirmed.

22 (ID-10) Mice immunized with the “22 (ID-10)” DNA vaccine showed significantly longer survival times compared to the non-vaccinated control group, but pcDNA3.1.
Not shown when compared to the control group. In addition, the time to first death in this group is pcD
Prolonged by about 12 hours compared to the NA3.1 control group and the non-vaccinated control group. The mean survival time of 43.691 hours is also significantly longer than that determined in both control groups.

28 (ID-13) Mice immunized with the “28 (ID-13)” DNA vaccine had pcDNA3.
It did not show significantly longer survival time compared to one control group and non-vaccinated control group. However, there were three out-of-bounds mice, of which two
The animals survived the duration of the experiment despite showing symptoms. In addition, the time to first death in this group was increased by about 9 hours compared to the pcDNA3.1 control group and the unvaccinated control group. In addition, the average survival time of 52.449 hours is considerably longer than the time determined in both control groups, and also shows a wide range of survival time.

Statistical Analysis of Survival Time-LEEP DNA Immunization and GBS Challenge Trial 3 ( FIG. 4c)

[0089]

[Outside 3]

The p values indicate statistical significance when compared to unvaccinated controls.

70 (ID-42) Mice immunized with the “70 (ID-42)” DNA vaccine did not show significantly longer survival time compared to the unvaccinated control group. However, the first death in this group was prolonged (about 3 hours) compared to the non-vaccinated group. In addition, this group has an average survival time of about 8 hours longer than the unvaccinated group.

94 (ID-48) Mice immunized with the “94 (ID-48)” DNA vaccine showed significantly longer survival times compared to the unvaccinated control group.

86 (ID-47) Mice immunized with the “86 (ID-47)” DNA vaccine showed significantly longer survival times compared to the unvaccinated control group.

51 (ID-37) Mice immunized with the “51 (ID-37)” DNA vaccine showed significantly longer survival times compared to the unvaccinated control group.

Statistical Analysis of Survival Time-LEEP DNA Immunization and GBS Challenge Trial 4 ( FIG. 4d)

[0096]

[Outside 4]

(T) -showed signs of infection but was terminated at the end of the experiment. p-values indicate statistical significance when compared to unvaccinated controls.

9 (ID-6) Mice immunized with the “39 (ID-6)” DNA vaccine showed significantly longer survival compared to the control group.

Statistical Analysis of Survival Time-LEEP DNA Immunization and GBS Challenge Trial 6 ( FIG. 4e)

[0100]

[Outside 5]

(T) -showed signs of infection, but was terminated at the end of the experiment. A p-value of 1 indicates statistical significance when compared to the pcDNA3.1 control. A p-value of 2 indicates statistical significance when compared to a non-vaccinated control.

There was no significant difference in survival time between the pcDNA3.1 control group and the non-vaccinated control group. This indicates a very similar mean survival time of 3
Confirmed at 4.558 hours (pcDNA 3.1) and 34.316 hours (not vaccinated).

32 (ID-15) Mice immunized with the “32 (ID-15)” DNA vaccine had pcDNA3.
It did not show significantly longer survival time compared to one control group and non-vaccinated control group. However, there were two out-of-bound mice in the "32 (ID-15)" group, one of which survived the duration of the experiment despite showing symptoms. This group also shows extensive survival time.

39 (ID-17) Mice immunized with the “39 (ID-17)” DNA vaccine showed significantly longer survival times compared to the non-vaccinated control group, but pcDNA 3.1.
It was not significant compared to the control group. This group showed a much longer mean survival time (44.016 hours) than the time determined in both control groups.

Mice immunized with 57 (ID-40) “32 (ID-15)” DNA vaccine had pcDNA3.
It did not show significantly longer survival time compared to one control group and non-vaccinated control group. However, the "32 (ID-15)" group had one out-of-bounds mouse and survived the duration of the experiment despite showing symptoms.

Survival Data-Set B Statistical Analysis of Survival Time-LEEP DNA Immunization and GBS Challenge Trial 2 ( FIG. 5a)

[0107]

[Outside 6]

A p-value of 1 indicates statistical significance when compared to the pcDNA3.1 control. A p-value of 2 indicates statistical significance when compared to a non-vaccinated control.

There was no significant difference in survival time between the pcDNA3.1 control group and the non-vaccinated control group. This shows a very similar mean survival time of 35.8.
Confirmed at 58 hours (pcDNA 3.1) and 34.166 hours (unvaccinated).

13 (ID-72) Mice immunized with the “13 (ID-72)” DNA vaccine were identified as pcDNA3.
It did not show significantly longer survival time compared to one control group and non-vaccinated control group. However, there was one out-of-bounds mouse, pcDNA3
. One control group and the non-vaccinated control group each survived about 24 hours longer than the longest surviving mice. In addition, the time to first death of this group is pc
DNA was prolonged compared to the control group and the non-vaccinated control group.
The average survival time of 43.582 hours is significantly longer than in both control groups.

Statistical Analysis of Survival Time-LEEP DNA Immunization and GBS Challenge Trial 3 ( FIG. 5b)

[0112]

[Outside 7]

The p-values indicate statistical significance when compared to unvaccinated controls.

3-60 (ID-65) Mice immunized with the “3-60 (ID-65)” DNA vaccine showed significantly longer survival times compared to the unvaccinated control group.

3-5 (ID-66) Mice immunized with the “3-5 (ID-66)” DNA vaccine showed significantly longer survival times compared to the non-vaccinated control group.

Statistical Analysis of Survival Time-LEEP DNA Immunization and GBS Challenge Trial 4 ( FIG. 5c)

[0117]

[Outside 8]

(T) -showed symptoms of infection, but was terminated at the end of the experiment. p-values indicate statistical significance when compared to unvaccinated controls.

3-40 (ID-67) Mice immunized with “3-40 (ID-67)” DNA vaccine did not show significantly longer survival time compared to unvaccinated control group . However, there was one out-of-bounds mouse that survived about 43 hours longer than the longest surviving mouse in the unvaccinated control group.

3-30 (ID-68) Mice immunized with the “3-30 (ID-68)” DNA vaccine showed significantly longer survival times compared to the unvaccinated control group.

Mice immunized with 3-38 (ID-69) “2-19 (ID-73)” DNA vaccine did not show significantly longer survival time compared to unvaccinated control group . However, there was one out-of-bounds mouse that survived about 32 hours longer than the longest surviving mouse in the unvaccinated control group. In addition, the time to first death was increased (about 8 hours) compared to the unvaccinated control group.

Statistical Analysis of Survival Time-LEEP DNA Immunization and GBS Challenge Trial 5 ( FIG. 5d)

[0123]

[Outside 9]

The p values indicate statistical significance when compared to non-vaccinated controls.

141 (ID-70) Mice immunized with the “141 (ID-70)” DNA vaccine showed significantly longer survival times compared to the non-vaccinated control group.

3-20 (ID-71) Mice immunized with the “3-20 (ID-71)” DNA vaccine did not show significantly longer survival time compared to the unvaccinated control group . However, there was one out-of-bounds mouse that survived about 10 hours longer than the longest surviving mouse in the unvaccinated control group.

2-19 (ID-73) Mice immunized with “2-19 (ID-73)” DNA vaccine did not show significantly longer survival time compared to unvaccinated control group . However, there were three out-of-bounds mice that survived about 4 hours, about 10 hours and about 23 hours longer than the longest surviving mice in the unvaccinated control group. This is reflected in a longer average survival time of 48.749 hours and a much wider survival time range.

3-6 (ID-74) Mice immunized with the “3-6 (ID-74)” DNA vaccine did not show significantly longer survival time compared to the unvaccinated control group . However, there were three out-of-bounds mice that survived about 4 hours, about 10 hours and about 23 hours longer than the longest surviving mice in the unvaccinated control group. This is reflected in a longer average survival time of 49.599 hours and a much wider survival time range.

Statistical Analysis of Survival Time-LEEP DNA Immunization and GBS Challenge Trial 6 ( FIG. 5e)

[0130]

[Outside 10]

(T) -showed signs of infection, but was terminated at the end of the experiment. A p-value of 1 indicates statistical significance when compared to the pcDNA3.1 control. A p-value of 2 indicates statistical significance when compared to a non-vaccinated control.

There was no significant difference in survival time between the pcDNA3.1 control group and the non-vaccinated control group. This shows a very similar mean survival time of 34.5.
Confirmed at 58 hours (pcDNA 3.1) and 34.316 hours (unvaccinated).

3-51 (ID-75) Mice immunized with the “3-51 (ID-75)” DNA vaccine were pcDNA
3.1 did not show significantly longer survival time compared to the control group, but was relatively close to the non-vaccinated control group. In the “3-51” group, 2
There were out-of-bounds mice, one of which survived the duration of the experiment despite progression of symptoms. The mean survival time of 44.499 hours is much longer than that determined in both control groups, which also show a much wider range of survival times.

3-56 (ID-76) Mice immunized with the “3-56 (ID-76)” DNA vaccine contained pcDNA
3.1 Significantly longer survival time compared to control group, but marginally less significant than non-vaccinated control group.

[0135] Example 3: perform storability Contact and variability First Southern blot analysis of candidate vaccine antigen genes among different isolates of group B Streptococcus, a novel group B Streptococcus isolated using LEEP system The conservation between the serotypes of the genes was determined. Analysis of the serotype distribution of the target gene will also determine its potential use as an antigen component in GBS vaccines. The strain of group B streptococcus whose DNA was analyzed as part of this study is listed in Appendix II.

Amplification of specific target genes as DNA probes for Southern blot analysis and oligonucleotide primers were designed for each of the target genes derived using the labeled LEEP system. Primers were designed to target the entire gene to be examined (all primers are listed in Appendix III). Specific gene targets were amplified by PCR using Vent DNA polymerase (NEB) according to the manufacturer's instructions. A typical reaction is 50 ng of GBS template DNA, 1/10 volume of enzyme reaction buffer, 1 μM of each primer, 250 μM of each dNTP and Vent DNA
Performed in a 100 μl volume containing 2 units of polymerase. A typical reaction is the following: denaturation at 95 ° C. for the first 2 minutes, denaturation at 95 ° C. for 30 seconds, annealing at the appropriate melting temperature for 30 seconds, and extension at 72 ° C. for 1 minute (1 kilobase of DNA to be amplified). Per minute) for 35 cycles. The annealing temperature was determined by the lower melting point of the two oligonucleotide primers. This reaction is 72
Termination was performed at a final extension period of 10 minutes at 10 ° C.

All PCR amplification products were extracted once with phenol-chloroform (2: 1: 1) and once with chloroform (1: 1) and precipitated with ethanol. Specific DNA fragments were isolated from agar gel using QIA Quick Gel Extraction Kit (Quiagen). Purified amplified gene DNA for use as a DNA probe
Fragment the fragment according to the manufacturer's instructions with a DIG nucleic acid labeling kit (Boehringer-Mannheim)
And labeled with digoxigenin.

Southern Blot Hybridization Analysis of Group B Streptococcus Genomic DNA Genomic DNA previously isolated from all strains of Group B streptococci was examined for the conservation of LEEP-induced gene targets. Appropriate DNA concentration is determined by HinDIII, Ec
Digestion was performed using either oRI or BglII restriction enzyme (NEB) according to the manufacturer's instructions and analyzed by agarose gel electrophoresis. After agarose gel electrophoresis of the DNA sample, the gel was denatured with 0.25 M HCl for 20 minutes and the DNA was transferred onto a Hybond ™ N ⁺ (Amersham) membrane by capillary blot overnight. The method was substantially similar to that described by Sambrook et al. (1989), using a Whatman 3MM membrane on a table above a 0.4M NaOH storage tank. After transfer, the filters were briefly washed with 2 × SSC and Saran Wrap (
(Dow Chemical Company) and stored at 4 ° C.

The filters were pre-hybridized, hybridized with a digoxigenin-labeled DNA probe, and washed under the conditions recommended by Boehringer-Mannheim when using a DIG nucleic acid detection kit. This filter was washed with hybridization buffer (1% w / v supplied blocking reagent, 5 × SSC, 0
. Prehybridization was performed in 1% v / v N-lauryl sarcosine, 0.02% v / v sodium dodecyl sulfate (SDS) for 1 hour at 68 ° C. Before adding to the hybridization buffer, add 9 digokesigenin-labeled DNA probes.
Denatured at 9.9 ° C. for 10 minutes. Hybridization was performed overnight in a rotating hybrid test tube in a hybrid mini hybridization oven. The filter was washed twice with 2 × SSC-0.1% SDS for 5 minutes at room temperature to remove unbound probe. Next, the stringency was increased and the filters were washed twice with 0.1 × SSC-0.1% SDS for 15 minutes at 68 ° C. Using a DIG nucleic acid detection kit (Boehringer-Mannheim), the digoxigenin-labeled DNA probe specifically bound was immunologically detected.

The results of the Southern blot analysis show all gene digests and their corresponding Southern blots in the same lane order shown in Table 1.

[0141]

[Table 1]

For comparative purposes, it was decided to analyze the serotype distribution of the GBSrib gene encoding the known prophylactic immunogen Rib. Rib is present in serotype III and for some strains in serotype II, but not in serotype Ia or Ib (Starhammer-Kallemarm et al., 1993). Confirmation of this pattern not only increases the confidence in the interpretation of later results, but also allows the rib gene homologs to
It will also determine whether it is present in the BS serotype. Primers designed for rib amplification and subsequent cloning into pcDNA3.1 (Appendix I) were used to generate rib gene probes for Southern blot analysis.

Southern blot analysis-rib (Fig. 6) 12 34 45 67 8 9 9 10 11 12 13 14 14 15 16 17 18 19 20 Genomic DNA from each strain was completely digested with HinDIII (NEB), The cells were electrophoresed on 0.8% agarose at 40 volts for 6 hours, transferred to a Hybond ™ N ⁺ (Amersham) membrane by Southern blot, and hybridized with a digoxigenin-labeled rib gene probe. Specifically bound DNA probes were identified using a DIG nucleic acid detection kit (Boehringer-Mannheim).

Comment FIG. The Southern blot analysis shown in Figure 7 shows that the rib gene is not conserved across all GBS serotypes. rib were serotype Ia and Ib strains (lanes 2-5) and serotype II strains 118/158 and 97/005.
7 (lanes 8 and 9) does not appear. However, rib appeared to be present in serotype II strains 18RS21 and 1954/92 (lanes 6 and 7) and in all serotype III strains (lanes 10-13). This means
Consistent with previously published data (Stalhammer-Kallemarm et al., 1993). Rib also appears to be present in strains representative of serotypes VII and VII (lanes 17 and 18), but in control strains (lanes 19 and 20) and in strains representative of serotypes IV, V and V (lanes 17 and 18). Lanes 14-16) were absent. The rib gene probe hybridized poorly to strains representing serotypes Ia, Ib, IV, VI, VII and genomic DNA fragments from serotype II strains 118/158 and 97/0057. This may indicate the presence of certain genes with low levels of homology to rib in these strains. These hybridized DNA fragments may contain homologues of the GBS bca gene (Wastfeld et al., 1996), which encodes a Ca protein antigen that shows great homology to the Rib protein. If so, serotypes Ia, Ib, II and II
This would be consistent with previous studies in which all strains of I were shown to be positive for one of the two proteins (Starhammer-Kallemarm et al., 1993). However, the apparent variation in distribution of the rib gene between different GBS serotypes is unlikely to be an ideal candidate for the use of GBS vaccines that are commonly protective for all serotypes.

Southern Blot Analysis-4 (ID-1) ( FIG. 7) 123 4 5 6 7 8 9 9 10 11 12 13 14 14 16 16 17 18 19 20 Genomic DNA from each strain was subjected to HinDIII (NEB). Completely digested, electrophoresed at 40 volts for 6 hours on 0.8% agarose, transferred to Hybond ™ N ⁺ (Amersham) membrane by Southern blot, and digoxigenin-labeled 4 (ID-1)
Hybridized with the gene probe. The specifically bound DNA probe is
Identification was performed using an IG nucleic acid detection kit (Boehringer-Mannheim).

Comments FIG. According to the Southern blot analysis shown in FIG. 7, the gene 4 (ID-1) showed all GB
It turns out that it is conserved in common with S serotype. The gene probe was approximately 3.5 kb of HinDIII digested genomic DNA among DNA digests derived from representative examples of total GBS.
Although hybridized specifically to the fragment, none of the hybrids from both control strains (lanes 19 and 20) hybridized.

Southern Blot Analysis-5- (ID-2) ( FIG. 8 ) 123 4 5 6 7 8 9 9 10 11 12 13 14 15 16 17 18 19 20 Genomic DNA from each strain was subjected to EcoRI (NEB). And electrophoresed on 0.8% agarose for 6 hours at 40 volts, transferred to a Hybond ™ N ⁺ (Amersham) membrane by Southern blot, and hybridized with a digoxigenin-labeled 5 (ID-2) gene probe. Let it soy. The specifically bound DNA probe is converted to DI
It was identified using a G nucleic acid detection kit (Boehringer-Mannheim).

Comment FIG. According to the Southern blot analysis shown in FIG. 7, the gene 4 (ID-1) showed all GB
It turns out that it is conserved in common with S serotype. This gene probe is all GB
Approximately 6.2 kb of EcoRI digested genomic DN of DNA digests from representatives of S
It hybridized specifically to the A fragment, but none of those from both control strains (lanes 19 and 20) hybridized.

Southern Blot Analysis-15 (ID-7) (FIG. 9) 12 34 5 6 7 8 9 9 10 11 12 13 14 15 16 17 18 19 20 Genomic DNA from each strain was subjected to EcoRI (NEB). Digested completely, electrophoresed on 0.8% agarose for 6 hours at 40 volts, transferred to Hybond ™ N ⁺ (Amersham) membrane by Southern blot, and digoxigenin-labeled 15 (ID-7)
Hybridized with the gene probe. The specifically bound DNA probe is
Identification was performed using an IG nucleic acid detection kit (Boehringer-Mannheim).

Comment FIG. From the Southern blot analysis shown in FIG. 7, gene 15 (ID-7)
It turns out that it is conserved commonly to BS serotype. This gene probe is all G
Approximately 6.2 kb EcoRI digested genome D of DNA digests from representatives of BS
Although it hybridized specifically to the NA fragment, it was derived from both control strains (lane 19).
And 20) did not hybridize. This gene probe specifically hybridized to an EcoRI digested DNA fragment in the size range of about 3.5 kb to 5.2 kb.

Southern Blot Analysis-17 (ID-8) (FIG. 10) 12 3 4 5 6 7 8 7 9 9 10 11 12 13 14 14 15 16 17 18 19 20 Genomic DNA from each strain was analyzed with HinDIII (NEB). Completely digested, electrophoresed at 40 volts for 6 hours on 0.8% agarose, transferred to Hybond.TM. N ⁺ (Amersham) membrane by Southern blot, and digoxigenin-labeled 17 (ID-8).
) Hybridized with gene probe. Specifically bound DNA probes were identified using a DIG nucleic acid detection kit (Boehringer-Mannheim).

Comment FIG. From the Southern blot analysis shown in FIG. 7, gene 17 (ID-8) was
It turns out that it is conserved commonly to BS serotype. This gene probe is all G
Among the DNA digests derived from the representative examples of BS, approximately 2.3 kb of the HinDIII digested genomic DNA fragment was specifically hybridized, but those of both control strains (lane 1)
9 and 20) did not hybridize.

Southern Blot Analysis-22 (ID-10) (FIG. 11) 123 4 5 6 7 8 9 9 10 11 12 13 14 15 16 17 18 19 20 Genomic DNA from each strain was analyzed with BglII (NEB). Digested completely, electrophoresed on 0.8% agarose at 40 volts for 6 hours, and hybonded by Southern blot (
(Trademark) N ⁺ (Amersham) membrane and digoxigenin labeled 22 (ID-10)
Hybridized with the gene probe. The specifically bound DNA probe was identified using a DIG nucleic acid detection kit (Boehringer-Mannheim).

Comment FIG. The Southern blot analysis shown in FIG. 7 shows that gene 22 (ID-10) is conserved in all GBS serotypes. This gene probe is
Except for the serotype Ib strain H36B, specifically hybridized to a BglII digested genomic DNA fragment of about 3.1 kb among DNA digests derived from representative examples of all GBS. In serotype Ib strain H36B, this gene probe is derived from a BglII digested genomic DN.
It hybridized specifically to the A fragment. Gene 22 (ID-10) was absent in both control strains (lanes 19 and 20).

CONCLUSIONS The Southern blot analysis described here demonstrates LEE between different GBS serotypes.
This is a preliminary study on the level of conservation of P-induced genes. The first result is gene 4 (
ID-1), 5 (ID-2), 15 (ID-7), 17 (ID-8) and 22
(ID-10) is present in all serotypes, indicating that they are potential candidate genes for GBS vaccine use. A similar analysis is currently being performed for each gene included in this patent.

Addendum I ID-8 (17) Forward primer 5'-cg ggatcc gccaccatgACCACTTCTCCAAGCTG
TTTTAGC-3 'Reverse primer 5'-tt gcggccgc ACGATTATCAACAAAGTCTCG-3
'

ID-9 (18) forward primer 5′-c ggatcc gccaccatgGCTACTCATATTGGAAG
TTACCAGC-3 'Reverse primer 5'-tt gcggccgc AGGGTTTATTTGTTGAAGTGCTCT
TG-3 '

ID-10 (22) forward primer 5′-c ggatcc gccaccatgTATCTTATATCATTTACC
AATGCCC-3 'reverse primer 5'-tt gcgggccgc TTTATGTATAGAAACAGCAGTCC
C-3 '

ID-13 (28) forward primer 5′-c ggatcc gccaccatgAAAGGAAGAACAACCTA
TTCGTTTAG-3 'Reverse primer 5'-tt gcggccgc AAGAGCAAATTTTCGGTATTCCCT
C-3 '

ID-15 (32) forward primer 5′-c ggatcc gccaccATGAATTGTTGGACACGGAAT
TG-3 'reverse primer 5'-tt gcggccgc TTTTTTCTCTCCCAAAAATAACAC
TAGC-3 '

ID-17 (39) forward primer 5′-c ggatcc gccaccatgGCGACTAAAAGGTTTAGG
TGTTAG-3 'reverse primer 5'-tt gcggccgc TATAGTTTTTAGTTTCAACTTGTC
TAGATG-3 '

ID-25 (20) forward primer 5′-cg ggatcc accatgTATACGAGTTTTACAACCAA
ATCATG-3 'reverse primer 5'-tt gcgggccgc GTCAGCTCGTACGTTTTTTTTAG
C-3 '

ID-37 (51) forward primer 5′-c ggatcc gccaccatgTGTCAAAATGATAGTGA
ACATAAAAAG-3 'reverse primer 5'-tt gcggccgc CTCAAAATAATTTACCTCCAATTC
G-3 '

ID-40 (51) forward primer 5′-c ggatcc gccaccatgGCTCCATTCGAATTTAA
AGATTC-3 'Reverse primer 5'-tt gcggccgc TGATTTACCAGTTTTGGAAGAGTT
C-3 '

ID-42 (70) forward primer 5′-c ggatcc gccaccATGAATAACTATTTATAATAC
ATTGAGAACAG-3 'reverse primer 5'-tt gcggccgc TTCTTTGTTCCAACTTTCTGG-3
'

ID-47 (86) forward primer 5′-c ggatcc gccaccATGATAGAGTGGATTCAAAAC
ACATTTAC-3 ′ Reverse primer 5′-tt gcggccgc TTTATGAACTCAAGCGACGTGTTA
-3 '

ID-48 (94) forward primer 5′-c ggatcc gccaccATGGAGTTTAGTAATTTAGAGA
TATTCGTAAG-3 'Reverse primer 5'-tt gcggccgc CTTGTCCATATTCATCTCCCTTCA
AC-3 '

ID-67 (3-40) forward primer 5′-c ggatcc gccaccatgGCTAGTTTTGTCATGAA
TCATAATGAC-3 'Reverse primer 5'-tt gcggccgc GTTTATTGCTCGTGTTTTAGCTA
AATC-3 '

ID-68 (3-30) forward primer 5′-c ggatcc gccaccatgGCTCTGTAGTTTTTTTTAT
GGTTTCAGTTCAAGC-3 ′ Reverse primer 5′-tt gcggccgc GAAGGCACCGCCCACCTCC-3 ′

ID-69 (3-38) Forward primer 5′-c ggatcc gccaccatgGGTGGAAACCCAAGATAC
CAATCAAGC-3 ′ Reverse primer 5′-tt gcggccgc AACACCTGGTGGGGCGTTTGG-3 ′

ID-70 (141) forward primer 5′-c ggatcc gccaccATGGCTGGGAATCGTAATAAA
CG-3 'Reverse primer 5'-tt gcggccgc AGCCGTCTCTAAAACAGGCTTG-
3 '

ID-71 (3-20) Forward primer 5′-cggatccgccaccatgCTTCCAACGCAGCCGCA
AAAC-3 'reverse primer 5'-ttgcggccgcATTTAGTGTTATTTCTCCTGTTG
CATAATCC-3 '

ID-72 (13) forward primer 5′-cg ggatcc accatgTACACGCCATATTGTTTGAAA
AAAG-3 'reverse primer 5'-tt gcggccgc AAATAATTTCTTTTTGGTTGTTTG
-3 '

ID-73 (2-19) forward primer 5′-c ggatcc gccaccatgAGTAATCAAGAAGTTTC
AGCAAGC-3 'Reverse primer 5'-tt gcggccgc CCATTGTGGAATATCAGCTGAAG
-3 '

ID-74 (3-6) forward primer 5′-c ggatcc gccaccatgGTGCAGGCAGTGGTACC
GCT-3 'reverse primer 5'-tt gcgggccgc GCGCATTGTAACAAATTCCTCAG
-3 '

ID-75 (3-51) Forward primer 5′-cg ggatcc accatgGCTGCCGAGAAGGATAAAAG
-3 'reverse primer 5'-tt gcgggccgc ATTATTTAGCTGCTTTTTTAATG
G-3 '

ID-76 ( 3-56 ) forward primer 5′-cg ggatcc accatgTGTCAGGTTGTTTATGCAA
GTTTTC-3 'reverse primer 5'-tt gcggccgc TTTACTAATTGATAAAGAGCAAC
TTCG-3 '

Rib (control) forward primer 5′-ggggtaccggccaccATGGCTGAAGTAATTTCA
GGAAGT-3 'Reverse primer 5'-cggaatttccgTTAATCCTCTTTTTTTCTTAGAA
ACAGAT-3 '

Appendix II Details of the group B streptococci whose DNA was analyzed for gene conservation (serotype and strain naming) are listed below. Serotype strains Ia 515 Ia A909 Ib SB35 Ib H36B II 18RS21 II 1954/92 II 118/158 II 97/0057 III BM110 III BS30 III M781 III 97/00999 IV 3139 V 1169 / NT VI GBS VI VII VII VII VIII Streptococcal strains (serotype M1, strain NCTC 8198) and Streptococcus pneumoniae (serotype 14) were also included in the analysis as controls.

Addendum III

ID-1 (4) Forward primer 5'-atgaaaaaaattactggaaaaattac-3 'Reverse primer 5'-ctatttttttttttagcgatgtctttttc-3'

ID-2 (5) Forward primer 5′-atgtcaaaaacaaagtaagggcaac-3 ′ Reverse primer 5′-ttttattattgcccaattaccataagttattattg-3 ′

ID-6 (9) Forward primer 5′-atgaaaaaaattttttttctcatggcttatg-3 ′ Reverse primer 5′-tacttcaactgttgatagaggactcct-3 ′

ID-7 (15) Forward primer 5′-ttgttcaatttttagtagttttagaacttgg-3 ′ Reverse primer 5′-ttattattcattgcgtctcaacc-3 ′

ID-8 (17) Forward primer 5′-atgacaaaaaaactattatttgctattattag-3
'Reverse primer 5'-ttaacgattattacaaaagttctgtac-3'

ID-10 (22) Forward primer 5′-atgatacgccagttttttaagagaa-3 ′ Reverse primer 5′-ttttttatgtatagaaaaaagcagtccc-3 ′

References Anderson, Earl. , Gao, Ex. -M. , Papa Constantinopolou, A. Robert M. And Dogan, G. (1996), Immune response of mice after immunization with DNA encoding fragment C of tetanus toxin, Inf
section and Immunity, 64 , 3168-3173. Krall, E. And splitter G.・ A. (1997), Brucella abortus ribosome L7 / L12 gene nucleic acid vaccination elicits an immune response, Vaccine 15 , 1851-57.

[0188] Larsson, C .; Starlhammer-Carlemalm, M. And Lindal, G. , 1996, vaccine injection experiments against capsular bacteria, group B streptococci using highly purified preparations of the cell surface protein Rib, Infect. Immu
n. 64 : 3518-3523. Larsson, C. Starlhammer-Carlemalm, M. And Lindal, G. Prophylaxis against group B streptococcal infection experiments by immunization with a bivalent protein vaccine, Vaccine. 17 : 454-458.

Starm Hammer-Callemalm, M. , Stenberg, El. And Lindal, G. 1993, Protein Rib: a novel group B streptococcal protein that confers preventive immunity, expressed by many strains that cause invasive infections. Wastfeld, M. Starlhammer-Carlemalm, M. , (19
96), identification of a streptococcal surface protein family with extremely repetitive structures;
J. Biol. Chem. 271 : 18892-18897.

Zang, D. , Young, Ex. , Berry, Jay. , Shen, She. ,
McLarty, G. And Brunham, Earl. C. , (1997), DNA vaccination with major outer membrane protein genes elicits immune gain against Chlamydia trachomatis (pneumonia in mice) infection, Infection
and Immunity 176 , 1035-40.

[Brief description of the drawings]

FIG. 1 (A) shows a number of full-length nucleotide sequences encoding antigen group B streptococcal proteins. FIG. 1 (B) shows the corresponding amino acid sequence.

FIG. It is a continuation of 1.

FIG. It is a continuation of 1.

FIG. It is a continuation of 1.

FIG. It is a continuation of 1.

FIG. It is a continuation of 1.

FIG. It is a continuation of 1.

FIG. It is a continuation of 1.

FIG. It is a continuation of 1.

FIG. It is a continuation of 1.

FIG. It is a continuation of 1.

FIG. It is a continuation of 1.

FIG. It is a continuation of 1.

FIG. It is a continuation of 1.

FIG. It is a continuation of 1.

FIG. It is a continuation of 1.

FIG. It is a continuation of 1.

FIG. It is a continuation of 1.

FIG. It is a continuation of 1.

FIG. It is a continuation of 1.

FIG. It is a continuation of 1.

FIG. It is a continuation of 1.

FIG. It is a continuation of 1.

FIG. It is a continuation of 1.

FIG. 25. It is a continuation of 1.

FIG. 26. It is a continuation of 1.

FIG. It is a continuation of 1.

FIG. 28. It is a continuation of 1.

FIG. 29. It is a continuation of 1.

FIG. It is a continuation of 1.

FIG. 31. It is a continuation of 1.

FIG. 32. It is a continuation of 1.

FIG. 33. It is a continuation of 1.

FIG. It is a continuation of 1.

FIG. 35. It is a continuation of 1.

FIG. 36. It is a continuation of 1.

FIG. It is a continuation of 1.

FIG. 38. It is a continuation of 1.

FIG. 39. It is a continuation of 1.

FIG. 40. It is a continuation of 1.

FIG. 41. It is a continuation of 1.

FIG. 42. It is a continuation of 1.

FIG. 43. It is a continuation of 1.

FIG. 44. It is a continuation of 1.

FIG. 45. It is a continuation of 1.

FIG. 46. It is a continuation of 1.

FIG. 47. It is a continuation of 1.

FIG. 48. 2 indicates a number of oligonucleotide primers used in the screening process. A nucS1 primer designed to amplify the mature form of the nucA gene. A nucS2 primer designed to amplify the mature form of the nucA gene. A nucS3 primer designed to amplify the mature form of the nucA gene. A nucR primer designed to amplify the mature form of the nucA gene. A nucseq primer designed to sequence DNA cloned into the pTREP-Nuc vector. PTREP _F , a nucleic acid sequence containing an ECORV recognition site. This is pTRE
X7 was used to clone the fragment. It is a nucleic acid sequence comprising a recognition site for BAMH1 pTREP _R. This is pTRE
X7 was used to clone the fragment. A forward sequencing primer PUC _F. The cloned D
NA fragments can be sequenced directly. V _R which is a specific example of a gene-specific primer used to further obtain an antigen DNA sequence by a DNA walking method. V1 which is a specific example of a gene-specific primer used to further obtain an antigen DNA sequence by a DNA walking method. V2 which is a specific example of a gene-specific primer used to further obtain an antigen DNA sequence by a DNA walking method.

FIG. 49. 3: (i) Schematic representation of the nucleotide sequence of a unique gene cloning site immediately upstream of the mature nuc gene in pTREP1-nuc1, pTREP1-nuc2 and pTREP1-nuc3. pTREP-
The nuc vectors each contain an EcoRV (Smal site of pTREP1-nuc2) cleavage site, which allows cloning of genomic DNA fragments in three different reading frames for the mature nuc gene. (Ii) Physical and genetic summary map of pTREP1-nuc vector. nuc, macrolide, lincosamide and streptogramin B (MLS)
Expression cassette incorporating resistance determinant and replicon (rep) Ori-pA
Mβ1 is illustrated (scale is not shown). (Iii) An expression cassette showing the various sequence elements involved in gene expression and the location of special restriction endonuclease sites schematically (scale not shown)
.

FIG. 50. 4 shows the results of various DNA vaccine injection trials.

FIG. 51. 4 shows the results of various DNA vaccine injection trials.

FIG. 52. 4 shows the results of various DNA vaccine injection trials. FIG. 5 shows the results of the second group of DNA vaccine injection trials.

FIG. 53. 5 shows the results of the second group of DNA vaccine injection trials.

FIG. 54. 5 shows the results of the second group of DNA vaccine injection trials.

FIG. 55. 6-11 show various Southern blot analyzes of different group B streptococcal strains.

FIG. 56. 6-11 show various Southern blot analyzes of different group B streptococcal strains.

FIG. 57. 6-11 show various Southern blot analyzes of different group B streptococcal strains.

FIG. 58. 6-11 show various Southern blot analyzes of different group B streptococcal strains.

FIG. 59. 6-11 show various Southern blot analyzes of different group B streptococcal strains.

FIG. 60. 6-11 show various Southern blot analyzes of different group B streptococcal strains.

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat ゛ (Reference) A61P 31/04 C07K 16/12 4C086 C07K 14/315 C12N 1/15 4H045 16/12 1/19 C12N 1 / 15 1/21 1/19 C12Q 1/14 1/21 1/34 5/10 1/68 A C12Q 1/14 G01N 33/53 D 1/34 33/569 F 1/68 C12R 1:46) G01N 33 / 53 (C12Q 1/14 33/569 C12R 1:46) // (C12N 15/09 C12N 15/00 ZNAA C12R 1:46) A (C12Q 1/14 5/00 A C12R 1:46) (81) Designated countries EP (AT, BE, CH, CY, DE, DK, ES, FI, FR, GB, GR, IE, IT, LU, MC, NL, PT, SE), CA, CN, JP, US (72) Wells, Jeremy Mark Country, NA 47 Norwich, Cornie, Norwich Research Park, Institute of Food Research, Norwich Laboratory (72) Inventor Hanifi, Cyan Bosco United Kingdom, CB2 1 Keppy Kembridge, Tennis Court Road, Department of Pathology, University of Cambridge F-term (reference) 4B024 AA01 AA11 BA31 BA50 CA04 CA09 CA11 DA01 DA02 DA05 DA11 EA01 EA02 EA03 EA04 FA02 FA06 FA18 GA11 HA01 HA03 HA12 HA15 4B063 QA01 QA19 QQ01 QQ13 QRQ52 QR52 QS05 QS25 QS34 QS36 QX02 4B065 AA01X AA49Y AA57X AA87X AB01 BA01 CA24 CA25 CA45 CA46 4C084 AA02 AA03 AA07 AA13 AA17 BA44 CA53 CA59 ZB352 4C085 AA03 BA13 CC07 CC21 EA01 GG03 A01 A04 A03 A04 A03 A04 BA41 CA11 DA76 DA86 EA31 EA50 FA72 FA74

Claims (23)

[Claims] FIG. A group B streptococcal protein having one sequence selected from the sequence according to 1, or a fragment or derivative thereof. 2. FIG. 2. A polypeptide or peptide of group B streptococci having one sequence selected from the sequence according to 2, or a fragment or derivative thereof. 3. A derivative or variant of the protein, polypeptide and peptide according to claim 1 and 2, wherein the protein, polypeptide and peptide according to claim 1 and 2 have at least 50 Derivatives or variants exhibiting a% identity. 4. The following sequence: (i) FIG. 1 and FIG. 2 or their R
Any of the NA equivalents, (ii) a sequence complementary to any of the sequences of (i), (iii) a sequence encoding the same protein or polypeptide as the sequence of (i) or (ii), (iv) a sequence showing substantial identity to any of the sequences of (i), (ii) and (iii); (v) FIG. 1 or FIG. A nucleic acid comprising or consisting of a sequence encoding a derivative or fragment of the nucleic acid molecule shown in 2. 5. A vector comprising a DNA encoding the expression of one or more of the proteins, polypeptides, peptides, fragments or derivatives thereof according to any one of claims 1 to 3. 6. The method according to claim 5, further comprising a DNA encoding any one or more of a promoter, an enhancer, a signal sequence, a leader sequence, a translation start and stop signal, a region controlling DNA stability, and a fusion partner. Vector. 7. Use of the vector according to claim 5 in transforming or transfecting a prokaryotic or eukaryotic host. 8. A host cell suitable for transforming the vector according to claim 5 or 6. 9. An antibody, affibody, or an antibody that binds to one or more of the proteins, polypeptides, peptides, fragments or derivatives thereof according to any one of claims 1 to 3. Derivatives. 10. An immunogen comprising one or more of the proteins, polypeptides, peptides, fragments or derivatives thereof, or nucleic acid sequences according to any one of claims 1 to 3 and 4. Composition. 11. The immunogenic composition according to claim 10, which is a vaccine. 12. Use of the immunogenic composition according to claim 10 in the preparation of a medicament for treating or preventing a group B streptococcal infection. 13. A method for detecting group B streptococci, comprising a step of bringing a test sample into contact with at least one of the antibodies, affibodies, or derivatives thereof described herein. 14. A method for detecting group B streptococci, comprising the step of contacting a test sample with at least one of the proteins, polypeptides, peptides, fragments or derivatives described herein. 15. A method for detecting group B streptococci, comprising the step of contacting at least one of the nucleic acid molecules described herein with a test sample. 16. A kit for detecting group B streptococci, wherein the kit comprises at least one of the antibody, affibody, or derivative thereof according to claim 9. 17. A kit for detecting group B streptococci, wherein the kit comprises at least one protein, polypeptide, peptide, fragment or derivative thereof of group B streptococci according to claim 1. . 18. A kit for detecting group B streptococci, wherein the kit comprises at least one nucleic acid molecule according to claim 4. Description: 19. A method for screening a DNA encoding a bacterial cell envelope-related antigen or a surface antigen of a gram-positive bacterium, comprising: a nucleotide sequence encoding a mature form of a staphylococcal nuclease gene and an upstream promoter region. Ligating a reporter vector comprising DNA derived from a gram-positive bacterium; transforming the resulting vector into Lactococcus lactis cells; assaying for the secretion of staphylococcal nuclease in the transformed cells. Performing the method. 20. The reporter vector according to FIG. PTREP1- shown in 4
The method according to claim 19, which is one of nuc vectors. 21. The method of claim 19 or claim 20, wherein the Gram-positive bacteria is group B streptococcus, Streptococcus pneumoniae, Staphylococcus aureus or pathogenic group A streptococcus. 22. A method for screening DNA encoding a cell envelope-associated bacterial antigen or secreted bacterial antigen in Gram-positive bacteria, as shown in FIG. The vector shown in 4. 23. A method for determining whether a protein, polypeptide, peptide, fragment or derivative thereof according to claims 1-3 is a potential antimicrobial target, said method comprising inactivating said protein. And determining whether the group B streptococci are still alive.