JP2002500040A - Extending cell life, methods and reagents - Google Patents

Abstract

  (57) [Summary] The present invention relates to methods and reagents for increasing the life span of a cell, eg, the number of mitosis. In general, the method of the invention relies on the ectopic expression of the telomerase catalytic subunit EST2 or a biologically active fragment thereof. The methods of the present invention are useful both in vivo, ex vivo and in situ.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001] linear chromosome the Background eukaryotic cells provides a biological benefit of rapid recombination, combinations, and diversification. However, linear DNA is inherently more unstable than the circular form. To address this difficulty, eukaryotic chromosomes are capped at the ends of the chromosome and protect their ends from degradation and end-to-end fusion, DNA
-Evolved to include terminal granules, one of the protein structures (Blackburn (198
4) Annu Rev Biochem 53: 163-194; Blackburn (1991) Nature 350: 569-573; Zak
ian (1995) Science 270: 1601-1607).

[0002] The telomere DNA component consists of a tandem repeat of a guanine-rich sequence essential for telomere function (Blackburn, supra; Zakian, supra). These repeats are
A special enzyme, telomerase (Greider (1995) "Telomerase Biochemistry and Regulation" In: Telem
eres, EHBlackburn and CWGreider, Eds.Cold Spring Harbor Press, Cold
Spring Harbor, NY, pp. 35-68). This telomerase enzyme
Cellular DNA-dependent DNA polymerases provide a non-directional mode of their synthesis and 5
'It is essential for the complete replication of telomere DNA, as their distal end cannot be replicated because of their requirements for RNA primers. DNA
Removal of the extreme terminal RNA primer after priming of the synthesis leaves a nick that cannot be replicated by these polymerases (Olovnikov (1971) Dokl. Akad. Nauk
SSSR 201: 1496-1499; Watson (1972) Nat New Biol 239: 197-201). Telomerase overcomes this problem by the donovo addition of single-stranded, small terminal DNA to the ends of chromosomes (Greider and Blackburn (1985) supra; Greider and Blac).
kburn (1989) Nature 337: 331-337; Yu, et al. (1990) Nature 344: 126-132; G
reider (1995) supra).

[0003] Telomerase enzymes, which have been characterized to date, are based on the use of an RNA template that is present as a subunit of the telomerase holoenzyme to produce terminal DN
It is an RNA-dependent DNA polymerase that synthesizes the A-repeat sequence (Greider (1995)
Supra). Genes that specify the telomerase RNA subunit have been cloned from various species, including humans (Feng, et al. (1995) Science 269:
1236-1241; Greider (1995), supra), and have been shown to be essential for telomerase function in vivo (Yu, et al. Supra; Yu and Blackburn).
(1991) Cell 67: 823-832; Singer and Gottschling (1994) Science 266: 404-40
9; Cohn and Blackburn (1995) Science 269: 396-400; McEachern and Blackbur
n (1995) Nature 376: 403-409). In addition, three proteins associated with telomerase activity have been identified to date. p80 and p95 were purified from the ciliate tetrahimina (Collins, et al. (1995) Cell 81: 677-686), and the gene encoding the mammalian homolog of p80, TP1 / TLP1, was also cloned (Harrington).
, et al. (1997) Science 275: 973-977; Nakayama, et al. (1997) Cell 88: 875.
-884). The specific mechanism by which these proteins are involved in telomerase function has not been defined.

[0004] Only recently, two related proteins, Est2p from the yeast Saccharomyces cerevisiae and p123 from the ciliate Euprotes aediculatus, are the catalytic subunits of telomerase in each species. (Counter, et al. (1997) PNAS US
A 94: 9202-9207; Lingner, et al. (1997) Science 276: 561-567). EST2 was first identified as a gene required for telomere maintenance in yeast (Le
ndvay, et al. (1996) Genetics 144: 1399-1412). This is essential for telomerase activity (Counter, et al. Supra; Lingner, et al. Supra). Both yeast and eupotes proteins have a hole mark (h
allmark). Substitution of some such residues in Est2p abolishes telomerase activity (Counter, et al. Supra.
Lingner, et al. Supra). Mammalian homologues of these telomerase subunits have not yet been reported.

[0005] As predicted from the known enzymatic properties of telomerase, genes encoding either catalytic proteins or template RNA subunits in ciliate Tetrahimina by overexpression of an inactive form of telomerase DNA or in yeast Mutations disrupt the function of this enzyme, thereby progressively shortening telomeres as cells pass through successive replication cycles (Yu, et al.
al. supra; Singer and Gottschling supra; McEachern and Blackburn supra; Le
ndvay, et al. supra; Counter, et al. supra; Lingner, et al. supra). This loss of telomere DNA will ultimately lead to death if not overcome. Lethality appears to be induced when the terminal granules are cut below a critical threshold level. Thus, without a compensatory mechanism, enzyme cell lines lacking telomerase activity have a lifespan determined by the length of their terminal granules.

[0006] In humans, telomerase activity is readily detectable in cells of the germline and in certain stem cell compartments. However, enzyme activity is undetectable in most somatic cell lines (Harley, et al. (1994) Cold Spring Harbor Symp. Q
uant. Biol. 59: 307-315; Kim, et al. (1994) Science 266: 2011-2015; Brocco
li, et al. (1995) PNAS USA 92: 9082-9086; Counter, et al. (1995) Blood 85
: 2315-2320; Hiyama, et al. (1995) J Immunol 155: 3711-3715). Consistent with this, telomeres in most types of human somatic cells become more likely as the age of the organism increases, similar to the situation found in yeast cells and protozoa experimentally derived from functional telomerase enzymes. As culture passages are repeated, they become shorter (Harley
, et al. (1990) Nature 345: 458-460; Hasie, et al. (1990) Nature 346: 866-
868). Eventually, the growth of cultured human cells is stopped at what is termed senescence, before apparently the terminal granules of these cells become dangerously short (Hayflick and Moo
rhead (1961) Exp Cell Res 25: 585-621; Goldstein (1990) Science 249: 1129-
1133).

[0007] Cultured normal human cells prevent senescence, thereby allowing them to continue growing when transformed with various reagents. In such cultures, truncation of the telomere continues until a point is reached at which the telomere becomes so short that it is termed a fraction (Counter, et al. (1992) EMBO J 11: 1921-1929; Counter, et al. (1994a
) J Virol 68: 3410-3414; Shay, et al. (1993) Oncogene 8: 1407-1413; Klinge
hutz, et al. (1994)). Probably the most clearly explained benefit in SV40-transformed cells is characterized by karyotypic instability, in particular the kind of instability observed in functional telomeres lacking chromosomes, and significant levels of cell death. (Sack (1981) In Vitro 17: 1-19). The shared phenotype is reminiscent of the phenotype observed in tetrahymina cells and yeast in which telomerase function has been experimentally disrupted.

[0008] The simplest interpretation of these data is that the longevity of telomerase-negative human cells is ultimately limited by the length of the telomere, as is the lifespan of their yeast and ciliate counterparts. That is. Rare human cells that have acquired the ability to grow indefinitely emerge from the shared population at a frequency of 10 ^-6 -10 ^-7 (Hushtscha and Holliday (1
983) J Cell Sci 63: 77-99; Shay and Wright (1989) Exap Cell Res 184: 109-1
18). This indicates that a mutation event is required to confer an immortal phenotype on these cells. Immortal cells that evade sharing are characterized by readily detectable levels of telomerase activity and stable telomeres (Counter, e
t al. (1992) supra; Counter, et al. (1994a) supra; Shay, et al. (1995) Mol
Cell Biol 15: 425-432; Whitaker, et al. (1995) Oncogene 11: 971-976; Goll
ahon and Shay (1996) Oncogene 12: 715-725; Klingelhutz, et al. (1996) Nat
ure 380: 79-82). This suggests that activating telomerase can overcome the limitation of cell line longevity imposed by terminal granule length.

[0009] Telomerase activation appears to be an important step in the course of human cancer. Unlike normal human cells, cancer cells can be established as permanent cell lines and are therefore presumed to have undergone immortalization during the course of tumorigenesis. In addition, telomerase activity is readily detected in the majority of human tumor cells analyzed to date (Counter, et al. (1994b) PNAS USA 91: 2900-2904; Kim, et
al. 1994 supra; Shay and Bacchetti (1997) Eur J Cancer 33: 787-791).

[0010] These various observations, taken together, suggest that the restriction to long-term cell replication imposed by truncated telomeres is an important anti-cancer drug used by the body to block the expansion of precancerous cell clones. Incorporated in a model suggesting that it functions as a neoplastic mechanism. According to such a model, tumor cells transcend the distribution barrier and appear as a population of cells that have become immortalized by activating telomerase that was not previously expressed, which population has become their terminal granules. (Counter, et al. (1992) supra; Counter, et al. (1994a) supra; Harley, et al.)
al. (1994) supra).

A major problem posed by this model is the mechanism used to restore telomerase expression during the course of a tumor. Telomerase-related protein TP1 /
TLP1 expression does not reflect the level of telomerase activity (Harrington, et a
l. supra; Nakayama, et al. supra). It is also clear that the level of the human telomerase RNA component, hTR, cannot completely explain the regulation of telomerase activity. The levels of hTR and its mouse counterpart, mTR, increase with the course of the tumor (Feng, et al. (1995) Science 269: 1236-1241; Blasco, et al. (1
996) Nat Genet 12: 200-204; Broccoli, et al. (1996) Mol Cell Biol 16: 3765
-3772; Soder, et al. (1997) Oncogene 14: 1013-1021), the amount of these transcripts is not always correlated with enzyme activity. In fact, hTR or mtr
Transcript levels can be significantly higher in telomerase-negative cells and tissues than in telomerase-positive cancer cells (Avilion, et al. (1996)).
Cancer Res 56: 645-650; Bestilny, et al. (1996) Cancer Res 56: 3796-3802;
Blasco, et al. Supra). Similarly, if telomerase levels increase 100-2000-fold during the immortalization of human cells, hTR message levels will increase at most only 2-fold (Avilion, et al. Supra). Therefore, to explain the development of telomerase activity in the majority of human tumor samples, the hTR and TP1
Subunit suppression cannot be easily quoted. until now,
The rate limiting step in telomerase activity has remained elusive.

[0012] One aspect of the Summary of the Invention The present invention extends the life span of a cell, for example, relates to methods and reagents to increase the number of mitosis. Generally, the method of the present invention provides for the ectopic expression of the telomerase catalytic subunit EST2 or a biologically active fragment thereof, or myc
Or by ectopic expression of a biologically active fragment thereof, or by contacting the cell with a reagent (such as a small organic molecule) that activates EST2 or myc expression or removes a myc inhibitory signal (antagonist). This is due to activation of telomerase activity. “Ectopic expression” can be, for example, by expression of a heterologous or endogenous gene, or by cell-cellular uptake of proteins or ESTs.
Inhibition of the degradation of the 2 or myc protein means that the cells are able to express higher than normal levels of EST2 or myc than if they were normal for the particular starting phenotype. The methods of the invention are useful both in vivo, ex vivo and in situ. Illustrative applications include, but are not limited to, extending a stem cell or progenitor cell culture or implant, extending a skin or other epithelial cell culture or implant, extending a mesenchymal cell culture or implant, and Includes extension of chondrocyte or bone cell culture or implant. Examples of exemplary stem and progenitor cells that can be extended by the methods of the present invention include neurons, hematopoietic cells, epithelial cells, pancreatic cells, hepatocytes, chondrocytes and osteostem and progenitor cells. The method of the present invention can be used for wound healing and other tissue repair, as well as cosmetic (cosmetic) applications. The methods of the invention are applicable to extending the life of normal cell or tissue cultures used to secrete therapeutic or other commercially important proteins and products.

The practice of the present invention will include, unless otherwise indicated, conventional techniques of cell biology, cell culture, molecular cytology, gene transfer biology, microbiology, recombinant DNA, and immunology, which are known to those of skill in the art. Technique is used. Such techniques are described in the literature. For example, Molecular Cloning: A Laboratory Manual, 2nd Ed., Ed. By Sambrook, Frit
sch and Maniatis (Cold Spring Harbor Laboratory Pres: 1989); DNA Cloning
, Volumes I and II (DNGlover ed., 1985); Oligonucleotide Synthesis (M.
J. Gait ed., 1984); Mullis et al. USPatnet No. 4,683,195; Nulceic Acid H
ybridization (BDHames & SJHiggins eds. 1984); Transcription And Tran
slation (BDHames & SJHiggins eds. 1984); Culture Of Animal Cells (R.
I. Freshney, Alan R. Liss, Inc., 1987); Immobilized Cells And Enzymes (IRL
Press, 1986); B. Perbal, A Practical Guide To Molecular Cloning (1984);
the treatise, Methods In Enzymology (Academic Press, Inc., NY); Gene T
ransfer Vectors For Mammalian Cells (JHMiller and MPCalos eds., 1987
, Cold Spring Harbor Laboratory); Methods In Enzymology, Vols. 154 and 1
55 (Wu et al. Eds.), Immunochemical Methods In Cell And Molecular Biolog
y (Mayer and Walker, eds., Academic Press, London, 1987); Handbook Of Ex
perimental Immunology, Volumes I-IV (DMWeir and CCBlackwell, eds., 1
986); Manipulating the Mouse Embryo, (Cold Spring Harbor Laboratory Pres
s, Cold Spring Harbor, NY, 1986).

BRIEF DESCRIPTION OF THE DRAWINGS FIG . HEST2 encodes human homologues of Est2p and p123. H
Yeast Est2p and Euprotes p12 of the predicted amino acid sequence of EST2
Match with 3 homologs. Amino residues in the shaded and open blocks are identical between at least two proteins. Identical amino acids in the RT motif are in open boxes, examples of telomerase-specific motifs are in shaded boxes surrounded by lines, and all identical amino acids are in shaded boxes. The RT motif is extended in some cases to include other adjacent constant or conserved amino acids. The sequence of the expressed tag AA281296 is underlined.

FIG. R of telomerase subunits HEST2, p123 and Est2p
Alignment of T motifs 1-6 with a2-Sc and a1-Sc of Saccharomyces cerevisiae group II intron-encoded RT. The consensus sequence for each RT motif is shown (h = hydrophobic, p = small polarity, c = charged). Amino acids invariant within the telomerase and RT consensus are in open boxes. Boxes identify highly conserved residues that are unique to either telomerase or non-telomerase RT. Asterisks indicate amino acids essential for polymerase catalytic function.

FIG. Myc activation of telomerase in HMEC cells. Empty vector (rows 1-5), E6 (rows 6-10), c-myc (rows 11-15) or dc in HMEC cells at passage 12
Infected with the virus of d25A (lanes 16-20). Two breast cancer cell lines BT549 (lanes 21-25) and T47D (lanes 26-30) were included for comparison. These cells were lysed and 10,000 cells (rows 2,6,7,11,12,17,21,22,26 and 27), 1,000 cells (rows 3,8,13,18,23 and 28) , 100 cells (rows 4, 9, 14, 19, 24 and 29), or 1
TRAP assays were performed using extracts corresponding to 0 cells (rows 5, 10, 15, 20, 25 and 30). By adding RNase A prior to the telomerase assay,
Telomerase activity was shown to be sensitive to RNase ("-" indicates RNa
excluding se A; "+" includes RNase A). To exclude the presence of inhibitors in apparently negative lysates, the rows labeled "Mix" (rows 1 and 16) were from 10,000 positive (c-myc expressing) cells. 10,000 mixed with lysate
Assays containing lysates from cells indicated by.

FIG. Myc activation of telomerase in IMR90 fibroblasts. 14 passage IM
Empty vector in R90 (columns 1-5), c-myc (columns 6-10) and E6 (columns 11-15)
Infected with the virus. HT1080 cells (rows 15-20) were included for comparison. TRAP assays were performed on 10,000 cells (rows 2,6,7,12,16 and 17), 1,000 cells (rows 3,8,13 and 18), 100 cells (rows 4,9,14 and 19) or 10 cells (row 5
, 10,15 and 20). The addition of RNase A prior to the elongation reaction indicated that telomerase activity was sensitive to RNase ("-" indicates R
Not including Nase A; "+" includes RNase A). The "Mix" column (columns 1 and 16) is 10,000
Assay containing lysates from 10,000 indicated cells mixed with lysates from 0 positive (c-myc expressing) cells.

FIG. E6 increases c-myc protein levels in HMEC. A. m
The level of yc protein was determined by Western blotting using a polyclonal myc antibody. E6 (row 1) and vector (row 2) Cell lysates from infected IMR90 cells and c-myc (row 3), E6 (row 4) and vector (row
5) Lysates from infected HMEC cells were analyzed. For comparison, the tumor cell lines HT1080 (row 6), HBL100 (row 7), BT549 (row 8) and T47D (row 9) were included. Loading was normalized using TFIIB expression. B. A. Total RNA prepared simultaneously with the protein extract used in the above was used for Northern blot to determine myc mRNA levels. As shown, equal amounts of total RNA were probed with human c-myc cDNA.

FIGS. 6 and 7. Telomerase activation extends telomere length and cell longevity. A. Total RNA was prepared from HMEC infected with myc retrovirus and normal HMEC. hEST2 transcripts were visualized in equal amounts of RNA (10 μg) using a probe derived from hEST2 cDNA. B. HMEC and IMR90 cells were transferred to empty vector (lanes 1-5 and 11-15) or hEST2 (lanes).
6-10 and 16-20). The TRAP assay was
000 cells (rows 2,6,7,12,16 and 17), 1,000 cells (rows 3,8,13 and 18), 100
Of cells (rows 4, 9, 14, and 19) or 10 cells (rows 5, 10, 15, and 20). By adding RNase A prior to the assay,
Telomerase activity was shown to be sensitive to RNase ("-" indicates RNa
excluding se A; "+" includes RNase A). To exclude the presence of inhibitors in apparently negative lysates, the row labeled "Mix" (rows 1 and 16) contains the lysate from 10,000 positive (HT1080) cells. Assay containing lysates from 10,000 indicated cells mixed. C. Early passage HME
C (12 passages, row 1), late passage HMEC (22 passages, row 2), HMEC / hEST2
(Cells infected with hEST2 at passage 12 and subsequently cultured for another 10 passages,
Genomic DNA from row 3) and the HMEC / vector (cells infected with the empty vector at passage 12 and then further cultured for 10 passages, row 4) were cut with RsaI and Hinfl. Fragments were separated on 0.8% agarose gel, the telomeres restriction fragment was visualized using ³² P- labeled human telomeric sequence (TTAGGG) ₃ as a probe. 7. HMEC cells are transformed into an empty vector, c-Myc or hES.
Transduced at 12 passages with any of the T2 retroviruses (as shown)
. These cells were continuously subcultured once a week at a density of 4-5 × 10 ⁵ cells per 100 cm ² . After 12 passages from transduction, vector-infected cells are no longer
Subculture was not possible at this frequency and was recognized as a traditional senescent phenotype. In contrast, cells expressing myc and hEST2 continued to proliferate, indicating that there was indeed no senescent cells in the population.

FIG. 8. 2 shows the MarxII vector containing the coding sequence for hEST2. The long terminal repeat (LTR), not shown, contains a recombinase site such that upon treatment of cells into which the MarxII-hEST2 vector has been integrated, the proviral vector containing the hEST2 coding sequence is excised.

[0021] DETAILED DESCRIPTION medium normal mammalian diploid cells disposed in the invention has a finite growth life is characterized by altered gene expression, non-dividing state called senescence Enter (Ha
yflick et al. (1961) Exp.Cell Res. 25: 585; Wright et al. (1989) Mol.Cell
.Biol. 9: 3088; Goldstein, (1990) Science 249: 112; Campisi, (1996) Cell 8
4: 497; Campisi (1997) Eur.J. Cancer 33: 703; Faragher et al. (1997) Drug D
iscovery Today 2:64). Replicative senescence depends on cumulative mitosis rather than calendar or metabolic time, indicating that growth is limited by the "mitotic clock" (
Dell'Orco et al. (1973) Exp.Cell Res. 77: 356; Hadey et al. (1987) J. Cell
.Physiol. 97: 509). Reduction in the ability of cells to proliferate from aged suppliers and patients with early aging syndrome (Martin et al. (1970) Lab. Invest 23:86; Schne
ider et al. (1976) PNAS 73: 3584; Schneider et al. (1972) Proc.Soc.Exp.Bi
ol. Med. 141: 1092; Elmore et al. (1976) Cell Physiol. 87: 229), and the in vivo accumulation of senescent cells with altered gene expression patterns (Stanulis-Praeger e.
t al. (1987) Mech.Aging Dev. 38: 1; and Dimri et al. (1995) PNAS 92: 9363.
) Implies cellular senescence in aging and age-related pathology (Hayflick e)
t al. (1961) Exp.Cell Res. 25: 585; Wright et al. (1989) Mol.Cell.Biol. 9
: 3088; Goldstein, (1990) Science 249: 112; Campisi, (1996) Cell 84: 497; C
ampisi (1997) Eur.J. Cancer 33: 703; Faragher et al. (1997) Drug Discovery
Today 2:64).

[0022] It is believed that the loss of terminal granules controls entry into aging. The human telomere consists of a repetitive sequence of the sequence TTAGGG / CCCTAA at the chromosome end. These repeats are synthesized by the ribonucleoprotein enzyme telomerase.
Telomerase is active in germline cells, and in humans, telomerase in these cells is maintained at about 15 kilobase pairs (kbp). In contrast, telomerase is not expressed in most human somatic cells and telomeres are significantly shorter in length. The telomere hypothesis of cell aging suggests that the cells age when the telomere length reaches a threshold due to progressive telomere shortening during each division.

The human telomerase reverse transcriptase subunit (hTRT) has been cloned. Nakamura et al., (1997) Science 277: 955; Meyerson et al., (1997) Cell
90:78; and Kilian et al., (1997) Hum. Mol. Genet. 6: 2011. Recently, it has been shown that telomerase activity can be reconstituted by transient expression of hTRT in normal human diploid cells, which express the template RNA component of telomerase (hTR) but not hTRT. For example, Wang et al. (1998) Genes Dev
12: 1769; and Weinrich et al., (1997) Nature Genet. 17: 498.
This provided the opportunity to manipulate the length of the terminal granules and test the hypothesis that shortening of the terminal granules results in cellular senescence.

[0024] The reported results suggest that telomere loss in the absence of telomerase is an intrinsic timing mechanism that controls the number of cell assays before senescence.
The long-term effects of exogenous telomerase expression on the maintenance of telomeres and the longevity of these cells have not been determined in longer term studies.

[0025] Tranular homeostasis appears to result from a balance between elongation and shortening activities. Very low levels of telomerase activity are clearly insufficient to prevent truncation of the terminal granules. This is consistent with the observation that stem cells have low but detectable telomerase activity and still continue to show shortening of their terminal granules over their lifespan. Thus, a threshold level of telomerase activity appears to be necessary for prolonging lifespan.

Cell senescence is believed to contribute to a number of situations in the elderly that can be treated primarily by extending the lifespan of the cells in situ. Such examples include atrophy of the skin due to loss of extracellular matrix homeostasis in fibroblasts of the skin; age-related macular degeneration caused by down-regulation of nerve survival factors and accumulation of lipofuscin in RPE cells; Atherosclerosis caused by overexpression of hypertensive and thrombotic factors and loss of proliferative capacity.

Extended life cells also have potential uses ex vivo. In studies of the biochemical and physiological aspects of growth and differentiation, cloned normal 2
Diploid cells can replace established tumor cell lines, long-lived normal human cells can be used for the production of normal or engineered biotechnology products, normal or engineered An expanded population of neoplastic cells can be used for autologous or allogeneic cells and gene therapy. Thus, the ability to extend the lifespan of cells while maintaining the diploid state, growth characteristics, and gene expression patterns typical of young normal cells is important for biological research, the pharmaceutical industry, and drugs Has a significant effect.

(I) Overview One aspect of the invention relates to methods and reagents for extending the life of a cell, for example, increasing the number of mitosis. In a preferred embodiment,
The cells are isolated in culture for at least part of the treatment.

[0029] In general, the invention relates to the step of contacting a metazoan cell, preferably a mammalian cell, more preferably a normal mammalian cell, with a reagent that activates telomerase activity in the cell. To provide a method for increasing the amount. In one embodiment, the method of the invention consists in the ectopic expression of the telomerase catalytic subunit EST2 or a biologically active fragment thereof. "Ectopic expression" means that a cell is less than normal than when it is normal for a particular starting phenotype, for example, by expression of a heterologous or endogenous gene or by cellular permeation of a protein. This means that high levels of EST2 can be expressed.

In another embodiment, the method of the present invention provides a method for activating telomerase activity, such as the myc gene product of papillomavirus E6 protein (herein collectively referred to as “telomerase activators”). It can be performed by ectopic expression. In a preferred embodiment, wherein the ectopic expression of telomerase or telomerase activator comprises a recombinant gene, expression of the gene in the host cell can be induced (otherwise conditionally regulated) and / or Genetic constructs can be easily removed from the host cell.

In yet another embodiment, the method of the present invention inhibits the degradation of a EST2 protein or telomerase activator (ubiquitin-dependent or independent) to increase the cell longevity of the protein. It can be carried out by contacting with a reagent. For example, in the method of the present invention, ubiquitination (ubiquitin
ation) or a reagent that increases its cell life. For example,
The method of the present invention may employ a reagent that inhibits ubiquitination of myc, thereby increasing the cell concentration of myc. In a preferred embodiment, such reagents are small organic molecules that have a molecular weight of, for example, less than 5000 atomic mass units (amu) (more preferably, less than 1000 atomic mass units) and are membrane permeable. .

[0032] In yet another embodiment, the ability of the cells to proliferate is the myc of
It can be increased by contacting the cell with a reagent that removes or otherwise suppresses a signal that antagonizes the triggered activation, eg, a small molecule. For example, reagents that disrupt the protein-protein interaction involved in the suppression of myc activity, eg, by the mad-max heterodimer, can be used.

The methods of the present invention are useful both in vivo, ex vivo and in situ. Illustrative applications include, for purposes of illustration only, extension of stem or progenitor cell cultures or implants, extension of skin or other epithelial cell cultures or grafts, extension of mesenchymal cell cultures or grafts, and cartilage Extension of cells or bone cells or grafts. Examples of stem and progenitor cells that can be extended by the methods of the present invention include neural cells, hematopoietic cells, pancreatic cells, and hepatic stem and progenitor cells.

An important feature of certain preferred embodiments of the method of the present invention is the reversibility of activation of telomerase activity, rather than constitutive activation. For example, if a vector is used to ectopically express the EST2 protein or telomerase activator, the vector can be formed to be excised from the cell. Thus, for ex vivo treatment, cells are transferred to the telomerase activator ES
The T2-encoding vector can be treated ex vivo, and prior to transplantation, the vector can be excised to suppress recombinant expression of the construct in vivo.
In a preferred embodiment, the vector can be excised with little or no heterologous nucleic acid sequence in the host cell.

Another aspect of the present invention relates to the in vitro preparation of cells to be treated by the method of the present invention. Such a cell composition can be used, for example, to produce a drug for implantation in an animal.

(Ii) Definitions For convenience, certain terms used herein are defined as follows.

As used herein, the term “fusion protein” is art-recognized and was at least initially expressed as a single-chain protein comprising amino acid sequences derived from two or more different proteins. Refers to a chimeric protein.
For example, a fusion protein is the gene product of a fusion gene.

The term “fusion gene” refers to the fusion of two or more genes, resulting in one open reading frame encoding two or more proteins joined by one or more peptide bonds. Called nucleic acid.

As used herein, the term “nucleic acid” refers to deoxyribonucleic acid (DNA),
And where appropriate, polynucleotides such as ribonucleic acids (RNA). The term is used as an equivalent to analogs of RNA or DNA generated from nucleotide analogs, as well as single-stranded (such as sense or antisense) and, as applicable to the described embodiments. It should be understood to include double-stranded polynucleotides.

As used herein, the term “gene” or “recombinant gene” refers to a nucleic acid comprising an open reading frame encoding a polypeptide, including both exon sequences and (optionally) intron sequences. . The gene according to the invention can be in the form of a transcribed DNA construct or a directly translatable RNA construct. An exemplary recombinant gene encoding the EST2 protein of the present invention is shown by SEQ ID NO: 1.

As used herein, the term “transfection” refers to the introduction of a heterologous nucleic acid, eg, an expression vector, into a recipient cell by nucleic acid-mediated gene transfer. "Transformation," as used herein with respect to transferred nucleic acid, refers to a change in the genotype of a cell as a result of cellular uptake of exogenous DNA or RNA, and, for example, when the transformed cell is EST2 or myc. Refers to the process of expressing a recombinant form of a polypeptide.

An “expression vector” encodes a desired protein and has a regulatory role in gene expression operably linked to a sequence (2) encoding a desired protein (eg, EST2 or myc protein). Used to express genes containing genetic elements (1), e.g., promoters, operators, or enhancers, and (3) transcription units, optionally containing appropriate transcription and translation initiation and termination sequence assemblies. Refers to a replicable nucleic acid construct. The choice of promoter and other regulatory elements will generally vary according to the intended host cell. In general, expression vectors useful in recombinant techniques are often in the form of "plasmids", which in those forms of the vector refer to circular double-stranded DNA loops that are not linked to chromosomes. As used herein, "plasmid" and "vector" are used interchangeably as the plasmid is the most commonly used form of vector. However, the present invention is intended to perform equivalent functions and include other forms of expression vectors previously known in the art.

In the expression vector, the regulatory elements that control transcription or translation can generally be derived from mammalian, microbial, viral or insect genes. The ability to replicate in a host, usually conferred by an origin of replication, and a selection gene that facilitates the recognition of transformants may be additionally included. Retrovirus,
A virus-derived vector such as an adenovirus may be used.

“Transcriptional regulatory sequence” is used throughout this specification to refer to nucleic acid sequences, such as initiation signals, enhancers, promoters, etc., that trigger or control the transcription of an operably linked protein coding sequence. Genetic term used.
In a preferred embodiment, transcription of the EST2 or other telomerase activator gene is under the control of a promoter sequence (or other transcription regulatory sequence) that controls the expression of the recombinant gene in the cell type in which expression is intended. It is in. It will also be appreciated that the recombinant genes can be under the control of transcriptional regulatory sequences that are the same or different from those sequences that control transcription of one of the naturally occurring forms of the protein.

As used herein, the term “tissue-specific promoter” refers to a promoter that functions as a promoter, ie, regulates the expression of a selected DNA sequence operably linked to the promoter, and A DNA sequence that directs the expression of a selected DNA sequence in a particular cell of a tissue, such as a cell of genital origin, eg, a kidney cell, or a cell of neural origin, eg, a nerve cell. The term is also mainly
Also encompasses so-called "leaky" promoters that regulate the expression of a selected DNA in one tissue, but also cause expression in another.

“Operably linked” when describing the relationship between two DNA regions, means that the regions are functionally related to each other. For example,
A promoter or other transcription control sequence is operably linked to a coding sequence if it controls the transcription of the coding sequence.

The terms “EST2 protein” and “EST2 polypeptide” refer to the catalytic subunit of telomerase, preferably mammalian telomerase, more preferably human telomerase. An exemplary EST2 protein is encoded by the nucleic acid of SEQ ID NO: 1, or a nucleic acid that hybridizes thereto.
Accordingly, the EST2 protein useful in the method of the present invention comprises the human EST2 of SEQ ID NO: 2.
At least 60%, 65%, 70%, 75%, 80%, 85%, 90% of ST2, or a fragment thereof that reconstitutes telomerase elongase in a host cell (such as a human cell).
%, Or at least 95% may be the same. For example, a variety of different techniques are available in the art for assessing the activity of a particular EST2 polypeptide, which may differ in sequence and / or length relative to SEQ ID NO: 1.

The term “telomerase-activating therapeutic agent” refers to any reagent used to activate telomerase activity in a cell, eg, a mammalian cell. For example,
The reagents include expression vectors encoding EST2, myc, E6, etc., blends of such polypeptides, small molecule activators of endogenous telomerase activator gene expression, to name just a few. And telomerase activator degradation inhibitors.

The term “EST2 therapeutic” refers to any telomerase-activating therapeutic that can be used to effect ectopic expression of an EST2 polypeptide in a cell. For example, the therapeutic agents are EST2 expression vectors, E-
Formulations of ST2 polypeptides and small molecule activators of endogenous EST2 gene expression.

The term “releasing myc suppression” refers to the ability of a reagent to overcome the antagonism of myc, eg, its ability prevents myc's mad / max inactivation,
Thereby, myc may be activated.

The term “progenitor cell” is in turn producing a more progenitor cell capable of producing a large number of mother cells capable of producing differentiated or differentiable daughter cells,
Refers to undifferentiated cells that can proliferate. As used herein, the term "progenitor cell" is also intended to include cells that are sometimes referred to in the art as "stem cells." In a preferred embodiment, the term "progenitor cells" refers to the progeny (progeny) whose progeny (progeny) are often differentiated in different directions, as occurs in the progressive diversification of embryonic cells and tissues, for example, by completely distinct features. Refers to a generalized mother cell that specializes.

As used herein, with respect to progenitor cells, the term “substantially pure” refers to at least about 75%, preferably at least about 85%, more preferably about progenitor cells that make up the whole cell population. Refers to a population of progenitor cells that is at least about 90%, most preferably, at least about 95% pure. In other words, the term "substantially pure" refers to less than about 20%, more preferably less than about 10%, of the original non-amplified isolated population prior to subsequent culture and amplification. Most preferably refers to a population of progenitor cells of the invention containing less than about 5% of lineage committed cells.

The term “cosmetic preparation” refers to a form of a pharmaceutical preparation formulated for topical administration.

As used herein, the term “cell composition” refers to a preparation of cells, which, in addition to the cells, comprises non-cellular components such as cell culture media, eg, proteins, amino acids , Nucleic acids, nucleotides, coenzymes, antioxidants, metals and the like. In addition, the cell composition does not affect the growth or viability of the cellular components, but the components used to provide the cells in a particular format, e.g., as a polymer matrix or pharmaceutical preparation for encapsulation. You can have it.

As used herein, the term “animal” refers to a mammal, preferably a mammal such as a human. Similarly, a "patient" or "patient" to be treated by the method of the present invention.
"Subject" can mean either a human or non-human animal.

(Iii) Embodiment (A) Illustrative Telomerase Activator In certain embodiments, the present invention provides for administration of an expression vector encoding an EST2 polypeptide or other telomerase activator polypeptide. Including.

The isolation of the gene representing the yeast homolog EST2 and the ciliate gene encoding the telomerase catalytic subunit has recently been reported. Meyerson, et al. (1997)
Cell 90: 785; and Nakamura et al. (1997) Science 277: 955.

The predicted 127 kDa protein shares long sequence similarity with the entire sequence of the Euprotes and yeast telomerase subunits and extends beyond the amino and carboxy termini of these proteins. BLAST studies have shown that the probability by which these similarities occur by chance is 1.3 × 10 ^-18 and 3 × 10 ^-13 , respectively. For comparison, the probability of similarity between yeast telomerase and Euprotes telomerase in protein BLAST studies is 6.9 × 10 ^-6 . The human gene hEST2 (human ES
T2 homolog) and describes the first of these genes. EST2 is
It was named for the phenotype of the Ever Shortening Telomerase catalytic subunit (Counter et al. (1997) supra; Lingner et al. (1997)).

Like yeast and ciliate telomerase proteins, hEST2 is a member of the reverse transcriptase (RT) family of enzymes (FIGS. 1 and 2). Some conserved sequence motifs that define the polymerase region of these enzymes are otherwise shared among highly divergent RT families (Poch et al. (1989) EMBO J 8: 3867-3874). ; Xiong
and Eickbush (1990) EMBO J 9: 3353-3362). P123 and Est2p most commonly share six of these motifs with the a2-Sc enzyme, the RT encoded in the second intron of the yeast COX1 gene (Kennell et al.
l. (1993) Cell 133-146). Contains invariant aspartate residues known to be required for telomerase enzyme function (Counter et al. (1997) supra; Lingner
et al., supra), these six motifs were found at the appropriate positions in the predicted sequence of hEST2 (FIGS. 1 and 2). Thus, the proposed human telomerase catalytic subunit, like its yeast and ciliate counterparts, belongs to the RT superfamily of enzymes.

[0060] Exemplary human EST coding sequences and proteins for use in the methods of the present invention are provided in GenBank accession numbers AF018167, AF043739 and AF015950. Exemplary EST constructs are described in PCT Application Publication No. WO 98/14593 and Ulaner et al. (1998) Cancer Res 58: 4168-72, Counter et al. (1998) Onco.
gene 161217-22, and Vaziri et al. (1998) Curr Biol 8: 279-82. In a preferred embodiment, the EST construct comprises an EST coding sequence that hybridizes to SEQ ID NO: 1 under stringent conditions, or a coding sequence set forth in Gene Bank Accession Numbers AF018167, AF043739 or AF015950. This EST coding sequence maintains the EST protein, or telomerase activity, and has SEQ ID NO: 2 or Genebank accession numbers AF018167, AF043739 or AF01.
It can encode a fragment thereof that is at least, for example, 60, 70, 80, 85, 90, 95, or 98 percent identical to the sequence of 5950, or is identical to one of the listed sequences.

In another embodiment, telomerase activation can be achieved by ectopic expression of a myc protein, eg, c-myc. An exemplary human myc coding sequence is provided in the SWISS-PROT locus MYC_HUMAN, accession number P01106. In a preferred embodiment, the myc construct comprises a myc coding sequence that hybridizes under stringent conditions to the coding sequence set forth in SWISS-PROT locus MYC_HUMAN, accession number P01106. This my
The c coding sequence retains the ability to activate myc protein, or telomerase activity, and is at least, for example, 60, 70, 80, 85, 90 with the protein sequence described in SWISS-PROT locus MYC_HUMAN, accession number P01106. , 95 or 98 percent identical, or a fragment thereof that is identical thereto.

In yet another embodiment, the activation of telomerase is papillomavirus E
6 proteins, preferably E6 protein from human papillomavirus (HPV), more preferably high-risk HPV (eg, HPV-16 or -18)
By expressing the E6 protein from E. coli. It may be desirable to use an E6 protein that has been mutated so that it cannot undergo p53 degradation. In a preferred embodiment, the E6 construct, under stringent conditions,
A06324, which includes an E6 coding sequence that hybridizes to the coding sequence set forth in accession number A06324. This E6 coding sequence retains the ability to activate E6 protein, or telomerase activity, and has at least, for example, 60, 70, 80, 85, 90 , 95 or 98
A fragment thereof that is percent identical or identical thereto can be encoded.

According to the methods of the present invention, the expression constructs of the polypeptides of the present invention can effectively transfect any biologically effective carrier, eg, a cell, in vitro or in vivo with a recombinant gene. It may be administered in any formulation or composition. Approaches include recombinant retroviruses, adenoviruses,
Insertion of the EST2 or telomerase activator gene of the invention in adeno-associated virus, and herpes simplex virus type I, or viral vectors, including recombinant bacteria or eukaryotic plasmids. Viral vectors can be used to transfect cells directly. Plasmid DNA can be used, for example, with the aid of cationic liposomes (lipofectin) or derivatized (eg, conjugated antibodies), polylysine conjugates, gramacidin S, artificial virus envelopes or other such intercellular carriers, as well as of gene constructs. It can be supplied by direct injection or by CaPO ₄ precipitation performed in vivo. Since transduction of appropriate target cells represents an important first step in gene therapy, the choice of a particular gene delivery system depends on the phenotype of the intended target and the route of administration, e.g.,
It will be appreciated that it depends on factors such as local or whole body.

A preferred approach for introducing a nucleic acid encoding a telomerase activator into a cell is by using a viral vector containing a nucleic acid encoding a gene product, eg, a cDNA. Infecting cells with a viral vector has the advantage that the majority of targeted cells can accept the nucleic acid.
Furthermore, a molecule encoded in the viral vector, for example, a cDNA contained in the viral vector, is efficiently expressed in cells that have absorbed the viral vector nucleic acid.

[0065] Retroviral vectors and adeno-associated viral vectors are generally considered to be the primary recombinant gene delivery system for transferring exogenous genes in vivo, particularly into humans. These vectors efficiently deliver genes into cells, and the transferred nucleic acid is stably integrated into the chromosomal DNA of the host.
A major prerequisite for using retroviruses is to ensure the safety of their use, especially with respect to the potential for wild-type virus to spread into cell populations. With the development of specialized cell lines that produce only growth-defective retroviruses (referred to as "packaging cells"), the use of retroviruses in gene therapy has increased, and defective retroviruses have a gene for gene therapy purposes. It has been specifically characterized for use in transfer (see Miller, AD (1990) Blood 76: 271). Therefore, part of the retroviral coding sequence (gag, pol, env)
Can be replaced, for example, by a nucleic acid encoding an EST2 or myc polypeptide to form a recombinant retrovirus in which the retrovirus has become growth defective. This growth defective retrovirus is then packaged into viral particles that can be used to infect target cells by using a helper virus by standard techniques. A protocol for producing recombinant retroviruses and infecting cells in vitro or in vivo with such viruses is Cu
rrent Protocols in Molecular Biology, Ausubel, FM et al. (eds.) Greene
See Publishing Associates, (1989), Sections 9.10-9.14 and other standard laboratory manuals. Examples of suitable retroviruses include pLJ, pZIP, pWE and pEM well known to those skilled in the art. Examples of suitable packaging virus strains for preparing both ecotropic and amphotropic retroviruses include ΨCrip, ΨCre, Ψ2 and ΨAm. Retroviruses are used to introduce various genes in vitro and / or in vivo into many different types of cells, including neurons, epithelial cells, endothelial cells, lymphocytes, myoblasts, hepatocytes, bone marrow cells. (Eg, Eglitis et al. (1985) Science 230: 1395-1398; Danos and Mulligan (1988)
Proc. Natl. Acad. Sci. USA 85: 6460-6464; Wilson et al. (1988) Proc. Natl. Ac
ad.Sci. USA 85: 3014-3018; Armentano et al. (1990) Proc.Natl.Acad.Sci. US
A 87: 6141-6145; Huber et al. (1991) Proc.Natl.Acad.Sci. USA 88: 8039-8043
; Ferry et al. (1991) Proc. Natl. Acad. Sci. USA 88: 8377-8381; Chowdhury et.
al. (1991) Science 254: 1802-1805; van Beusechem et al. (1992) Proc. Natl
.Acad.Sci. USA 89: 7640-7644; Kay et al. (1992) Human Gene Therapy 3: 641-
647; Dai et al. (1992) Proc. Natl. Acad. Sci. USA 89: 10892-10895; Hwu et al.
(1993) J. Immunol. 150: 4104-4115; U.S. Pat.No. 4,868,116; U.S. Pat.
0,286; PCT Application Publication No. WO89 / 07136; PCT Application Publication No. WO89 / 02468; PCT Application Publication No. WO89 / 05345; PCT Application Publication No. WO92 / 07573).

In selecting a retroviral vector as a gene delivery system for the telomerase activator protein of the present invention, the essential condition for successful infection of target cells by most retroviruses and, therefore, for stable transfer of recombinant genes is It is important to note that this is what the target cell must be dividing. In general, this requirement does not preclude the use of retroviruses to supply the genetic constructs of the present invention.

Further, it has been shown that altering the viral packaging protein on the surface of a viral particle can limit the infection spectrum of retroviruses and, consequently, retrovirus-based vectors (eg, PC
See T Application Publication Nos. WO93 / 25234, WO94 / 06920, and WO94 / 11524). For example, a strategy for altering the infection spectrum of a retroviral vector involves attaching an antibody specific to a cell surface antigen to the viral env protein (Roux et al. (1989) PNAS 86: 9079-9083; Julan et al. (1992) J. Gen Vi
rol 73: 3251-3255; and Goud et al. (1983) Virology 163: 251-254); or binding a cell surface ligand to the viral env protein (Neda et al.
(1991) J Biol Chem 266: 14143-14146). The linkage may be in the form of a chemical crosslink to the protein or other type (eg, lactose, which converts the env protein to asialoglycoprotein), as well as to the fusion protein (eg, single-chain antibody / env fusion protein). It can also be produced. While this technique is useful for limiting the infection to certain tissue types and in other ways, it can also be used to convert ecotropic vectors to amphotropic vectors. Can be.

In addition, the use of retroviral gene delivery can be further increased by using tissue or cell-specific transcriptional regulatory sequences that control the expression of the recombinant gene in the retroviral vector.

[0069] Another viral gene delivery system useful in the present invention uses an adenovirus-derived vector. The adenovirus genome can be engineered such that the genome encodes the gene product of interest but is inactive with respect to its ability to grow during the normal lytic virus life cycle (see, eg, Berkner et al. (1988). ) Bio Te
chniques 6: 616; Rosenfeld et al. (1991) Science 252: 431-434; and Rosenfe
ld et al. (1992) Cell 68: 143-155). Adenovirus strain Ad type 5 dl324 or other strains of adenovirus (eg, Ad2, Ad3, A
Suitable adenoviral vectors from d7 etc.) are well known to those skilled in the art. Recombinant adenoviruses are unable to infect non-dividing cells,
USA et al. (1992) Proc. Natl. Acad. Sci. USA 89: 6482-6486) and smooth muscle cells (Quantin et al. (1992) Proc. Natl. Acad. Sci. USA 89: 2581-2584) May be beneficial in certain circumstances in that they can be used to infect a variety of cell types, including In addition, viral particles are relatively stable and resistant to purification and concentration, and can be modified to affect the spectrum of infectivity, as described above. Further, the introduced adenoviral DNA (and the heterologous DNA contained therein) does not integrate into the genome of the host cell, but remains episomal, thereby transforming the introduced DNA into the host genome (eg, Potential problems that may arise as a result of insertional mutagenesis in situations where they are incorporated into retroviral DNA) are avoided. In addition, the carrying capacity of the adenovirus genome for heterologous DNA is large (up to 8 kilobases) relative to other gene delivery vectors (Berkner et al. Supra; Haj-Ahmand and Graham (1986) J. Virol.
57: 267). Most growth-defective adenovirus vectors currently in use and therefore preferred by the present invention lack all or part of the viral E1 and E3 genes, but make up as much as 80% of the adenovirus genetic material. (Eg, Jones et al. (1979) Cell 16: 683; Berkner et al., Supra; and
Graham et al. In Methods in Molecular Biology, EJMurray, Ed. (Humana,
Clifton, NJ, 1991) vol.7.pp.109-127). The expression of the inserted gene can be determined by, for example, E1A promoter, major late promoter:
MLP) and related leader sequences, the E3 promoter, or an exogenously added promoter sequence.

[0070] Yet another viral vector system useful for providing the telomerase activator component of the present invention is the adeno-associated virus (AAV). Adeno-associated virus is a naturally occurring defective virus that requires another virus, such as adenovirus or herpes virus, as a helper virus for efficient growth and a productive life cycle (Muzyczka et al. Curr .Topics in Micro. And Immunol. (19
92) 158: 97-129). This virus is one of the few viruses that may integrate its DNA into non-dividing cells and exhibits a high frequency of stable integration (eg, Flotte et al. (1992) Am. J. Respir. Cell.Mol.Biol. 7:34
9-356; Samulski et al. (1989) J. Virol. 63: 3822-3828; and McLaughlin et a
l. (1989) J. Virol. 62: 1963-1973). AA as small as 300 base pairs
Vectors containing V can be packaged and integrated. Extrinsic DN
The space in A is limited to 4.5 kb. Tratschin et al. (1985) Mol.Cell.Bi
ol. 5: 3251-3260, the DNA can be introduced into cells using an AAV vector. Various nucleic acids have been introduced into different cell types using AAV vectors (see, for example, Hermonat et al. (1984) Proc. Natl. Aca
d.Sci. USA 81: 6466-6470; Tratschin et al. (1985) Mol.Cell.Biol. 4: 2072-2
081; Wondisford et al. (1988) Mol.Endocrinol. 2: 32-39; Tratschin et al.
(1984) J. Virol. 51: 611-619; and Flotte et al. (1993) J. Biol. Chem. 268: 37
81-3790).

Other viral vector systems that may have use in gene therapy are derived from herpes virus, vaccinia virus, and some RNA viruses.
In particular, herpesvirus vectors will provide a unique strategy for continuous expression of telomerase activator proteins of the invention in cells of the central nervous system, such as neural stem cells, and ocular tissues (Pepose et al. . (1994) Invest Ophthalmol Vis
Sci 35: 2662-2666).

In addition to the viral transfer methods described above, non-viral methods can be used to express the proteins of the invention in animal tissues. Most non-viral methods of transferring genes are due to the normal mechanisms used in mammalian cells for absorption and intracellular transport of macromolecules. In a preferred embodiment,
The non-viral gene supply system of the present invention relies on a phagocytic pathway for gene uptake by target cells. Exemplary gene delivery systems of this type include liposome-derived systems, polylysine conjugates, and artificial virus envelopes.

In one embodiment, the genes encoding one of the proteins of the invention are liposomes carrying a positive charge on their surface (eg, lipofectin), optionally ) Antibodies to cell surface antigens of the target tissue may be confined within liposomes with attached (Mizuno et al. (1992) N
o Shinkei Geka 20: 547-551; PCT Application Publication No. WO 91/06309; Japanese Patent Application No. 1047381; and European Patent Application Publication No. EP-A-43075). For example, lipofection of glioma cells can be performed using liposomes with monoclonal antibodies directed against glioma-associated antigens (Mizuno et al. (1992)
Neurol. Med. Chir. 32: 873-876).

In yet another embodiment, the gene delivery system comprises an antibody or cell surface ligand cross-linked by a gene binding agent such as polylysine (eg, PCT Application Publication Nos. WO 93/04701, WO 92/04). No. 22635, No.WO92 / 20316, No.WO92 / 19749
And WO92 / 06180). For example, the gene constructs of the present invention can be used to transfer hepatocytes in vivo using a soluble polynucleotide carrier containing a polycation, such as asialoglycoprotein conjugated to polylysine (US Patent No. 5,166,320). It will be appreciated that the efficient delivery of the nucleic acid constructs of the invention by receptor-mediated phagocytosis can be improved using reagents that enhance the escape of genes from endosomal structures. For example, fusogenic peptides of the influenza HA gene product or whole adenovirus can be used as part of a supply system to induce efficient disruption of DNA-containing endosomes (Mulligan et al. (1993) Science Two
60-926; Wagner et al. (1992) PNAS 89: 7934; and Christiano et al. (1993)
PNAS 90: 2122).

For example, repair of telomeres by activating telomerase activity can be sufficient to extend the proliferative capacity of the cell, especially if the activation is sustained, if the transformation event (eg, (Which results in the division and development of cancer cells). Accordingly, in one aspect, the present invention is a method of increasing the growth potential of a cell, particularly a normal cell, wherein the gene construct is capable of selectively and reversibly activating telomerase activity in the cell. Providing a method.

In one embodiment, the telomerase activator coding sequence is provided as part of a vector that can be partially or completely excised from a host cell in an inducible manner. For example, the vector comprises: (i) one or more transposable elements for integrating the vector into the chromosomal DNA of a eukaryotic host cell; (ii) a coding sequence for a telomerase activator; and (iii) Excision element that removes all or at least a portion of the vector from the chromosomal DNA in such a way that contact of the cell with the excision reagent) abolishes the function of the heterologous telomerase activator. For example, the excision element may be flanked by only a portion of the coding sequence such that the sequence obtained after excision does not encode a function activator, or the telomerase activity may be such that the resulting construct does not express a telomerase activator. May be provided in the vector adjacent to a sufficient portion of the transcriptional regulatory sequence of the activator, but at least adjacent to the coding sequence of the telomerase activator.

In a preferred embodiment, the excision element is such that excision of the integrated form of the vector leaves any or substantially no (eg, less than 50 nucleotides) of the vector DNA in the chromosomal DNA of the host cell. Placed in the vector so that it is not

In a preferred embodiment, the transposable element is a viral transposable element, such as that provided when the vector is a replication defective virus, for example, a retroviral or lentiviral transposable element.

In a preferred embodiment, the excision element comprises an enzyme-assisted site-specific integration sequence. For example, the excision element may include a recombinase target site, such as a Cre recombinase, a Flp recombinase, a Pin recombinase, a lambda integrase or an R recombinase target site. The excision element may be a restriction enzyme site.

In a preferred embodiment, the vector is such that its recombinase site is such that excision of the proviral sequence is performed, for example, such that the viral vector is completely or almost completely excised from the chromosomal DNA of the host cell. Retroviral vector located in the LTR.

The vector may include other elements such as transcriptional regulatory sequences that direct transcription of the telomerase activator core coding sequence; packaging signals for packaging the vector into infectious viral particles. Absent.

Illustrative vectors of this type, for example, which can be easily excised, are described in the accompanying Examples and in PCT Publication No. WO 98/12339. The advantage that some of these vectors have, for example, substantially resectable, embodiments in which the method is part of an ex vivo treatment can be practiced. In such embodiments, cells can be treated with the composition ex vivo. Prior to implantation into a host, the cells are treated with a reagent, such as a recombinase, which excise the vector from the genomic DNA of the host cells. Thus, the transplanted cells are no longer genetically engineered. In such an embodiment, for example, F
It may be desirable to include one or more detectable genes (markers) on the vector so that cells that still maintain the vector can be identified by ACS sorting, affinity purification, or other techniques.

The reversibility of telomerase activation can be produced by using an expression system that is inducible due to the presence of inducible transcriptional regulatory sequences that control the expression of the EST or telomerase activator coding sequence. it can. Inducible promoters are promoters that initiate increased levels of transcription from DNA under their control in response to changes in culture conditions, such as the presence or absence of nutrients or changes in temperature. If the cells are to be transplanted into a patient, the inducible promoter is preferably one that is regulated by small molecules or other factors that are not endogenous to the host animal.

Exemplary regulatable promoters include, for example, Gossen et al. (1992) P
NAS 89: 5547-5551; and Pescini et al., (1994) Biochem.Biophys.Res.Comm. 2
02: 1664-1667.

In another embodiment, the method of the present invention employs multimerization originally developed by Schreiber and Crabtree. This technique allows for the assembly of small molecules "dimerizers" to assemble transcriptionally active complexes.
)) Can be used to regulate the expression of an endogenous or heterologous gene, in this case, an EST or telomerase activator coding sequence. For example, PCT Publication Nos.WO96 / 12796, WO95 / 05389, WO95 / 02684, WO94 / 18317, WO96 / 06097, and WO96 / 0
See No. 6110. In addition, a number of techniques have recently been developed that allow the recruitment of endogenous DNA binding and activation regions to transcription regulatory sequences by using artificial dimerization molecules. See, for example, PCT Publication No. WO 96/13613.

In another embodiment, reversibility of telomerase activation can be achieved by using a conditionally active (conditionally inactive) form of an EST or telomerase activator. For example, temperature-sensitive mutants of telomerase or myc can be used in the methods of the invention. In embodiments where the cells are to be implanted into an animal, the ts mutant is inactive at body temperature (non-permissive temperature) and can be active at lower or higher cell culture temperatures.

For illustration purposes, one strategy for producing temperature-sensitive ESTs or myc mutants that does not require a search for ts mutants in the gene of interest is a portable heat-induced Based on N-degron. N-degron is an intracellular degradation signal whose essential determinant is the "destabilizing" N-terminal residue of proteins. A series of N-degrons containing different destabilizing residues,
Expressed as an N-terminal rule, whereby the in vivo half-life of the protein is
Associated with the identification of its N-terminal residue. In eukaryotic cells, N-degron is
At least two determinants: the destabilized N-terminal residue and the specific internal Lys of the substrate
Consists of residues (multiple residues). Lys residue is multiubiquitin
The site of attachment of the chain. Ubiquitin is a protein whose covalent binding to other proteins plays a role in many cellular processes, primarily through pathways involving proteolysis. For a description of heat-inducible N-degron modules as examples that can be applied to generate conditional mutants of EST, myc or other telomerase activators, see U.S. Patent Nos. 5,705,387 and 5,538,862, And Dohm
See en et al. (1994) Science 263: 1273-6.

In yet another embodiment, the multimerization techniques described above can be used to produce small molecule-induced forms of ESTs or telomerase activators. To illustrate, the DNA binding region of myc (and, optionally, the oligomer-forming region)
And a first gene construct encoding a fusion protein comprising a ligand binding region that binds to a small organic molecule, eg, a region that binds to a dimer forming agent. A second gene construct encoding a fusion protein comprising an activation region, eg, a VP16 activation region, and a ligand binding region that also binds to a dimer forming agent when already bound to the first fusion protein Is also provided. By expressing these two fusion proteins in a host cell in the absence of a dimer forming agent, telomerase is not activated. Upon addition of the dimer, the fusion protein binds and activates transcription of the gene containing the myc response element, thereby activating telomerase activity.

In yet another embodiment, the ectopic expression of EST2 or other telomerase activator alters the transcriptional regulatory sequence of the endogenous telomerase activator gene by homologous recombination with genomic DNA. It may be due to the "activation" composition. For example, the gene activation construct may be a heterologous promoter, such as one that results in constitutive expression of the EST2 gene or that results in inducible expression of the gene under conditions that are different from the normal expression pattern of the gene. Can be replaced by A variety of different forms of the gene activation construct are also available. For example, Transkaryotic Therapies, Inc.
rapies, Inc) PCT Publication Nos.WO93 / 09222, WO95 / 31560, WO96 / 29411
No. WO95 / 31560 and WO94 / 12650.

In a preferred embodiment, the nucleotide sequence used as a gene activating component comprises: DNA and (2) Gene Activation The heterologous transcriptional regulatory sequence to be ligated to the coding sequence of the genomic gene upon recombination of the construct. The construct may include a reporter gene that detects a knockout construct in the cell.

The gene activation construct is inserted into the cell and, for example, the genome D of the cell is placed in a position that provides a heterologous regulatory sequence operably linked to the native EST2 gene.
Integrate with NA. Such insertions result from homologous recombination, ie, the recombination region of the activating construct homologous to the endogenous EST2 gene sequence hybridizes to the genomic DNA and the construct integrates into the corresponding position in the genomic DNA. To be recombined with the genomic sequence.

The term “recombination region” or “target sequence” refers to, for example, the 5
'Refers to a segment (ie, a portion) of a gene activation construct having a sequence that is substantially identical or substantially complementary to a genomic gene sequence, including flanking sequences; Homologous recombination can be promoted.

As used herein, the term “substitution region” refers to the part of the activation construct that becomes integrated at an endogenous chromosomal location after homologous recombination between the recombination region and the genomic sequence. Name.

For example, a heterologous regulatory sequence provided in a replacement region may be a promoter (such as a constitutive or inducible promoter), an enhancer, a negative regulatory element, a locus control region, a transcription factor binding site, or a combination thereof. And may include one or more of a variety of elements. Promoters / enhancers that may be used to control target gene expression in vivo include, but are not limited to, cytomegalovirus (CMV) promoter / enhancer (Karasuyama et al., 1989, J
.Exp.Med. 169: 13), human β-actin promoter (Gunning et al. (1987) PNAS
84: 4831-4835), a glucocorticoid-inducible promoter present in the mouse mammary tumor virus long terminal repeat (MMTVLTR) (Klessig et al. (1984) Mol. Cell
Biol. 4: 1354-1362), Moloney murine leukemia virus (MuLVLTR) (We
iss et al. (1985) RNA Tumor Viruses, Cold Spring Harbor Laboratory, Cold
Spring Harbor, New York), SV40 early or late region promoter (Bernoi)
st et al. (1981) Nature 290: 304-310; Templeton et al. (1984) Mol. Cell Bi
and Sprague et al. (1983) J. Virol., 45: 773), a promoter contained in the 3 'long terminal repeat of chicken sarcoma virus (RSV) (Yamamoto et al.
., 1980, Cell, 22: 787-797), herpes simplex virus (HSV) thymidine kinase promoter / enhancer (Wagner et al. (1981) PNAS 82: 3567-71), and herpes simplex virus LAT promoter (Wolfe et al. (1992) Nature Gen
etics, 1: 379-384).

In yet another embodiment, the replacement region simply deletes the negative transcription control element of the native gene, for example, to activate expression.

In yet another embodiment, a membrane permeable agent (eg, preferably a small organic molecule) that activates expression of the endogenous EST2 gene can be identified. In view of the utility of the genomic EST2 gene, a reporter construct can be produced in which the reporter gene is operably linked to a transcriptional regulatory sequence of the EST2 gene. Use the resulting cells in a cell-based approach to identify such compounds when transferred into cells that have the appropriate intracellular machinery to activate the reporter construct with EST2 regulatory sequences be able to.

In embodiments where the cells are treated in culture, RNA encoding EST2, myc or another telomerase activator can be introduced directly into the cells, for example, from RNA produced by in vitro transcription. In a preferred embodiment, the RNA is preferably a modified polynucleotide that is resistant to an endogenous nuclease, such as an exonuclease and / or an endonuclease.
Exemplary nucleic acid modifications that can be used to produce such RNA include phosphoramidate, phosphothioate and methylphosphonate analogs of nucleic acids (US Pat. Nos. 5,176,996; 5,264,564; No. 5,256,775), or peptide nucleic acid (PNA).

[0098] In yet another embodiment of the method of the present invention, the telomerase activator polypeptide is subjected to conditions under which the protein is absorbed, eg, internalized, by the cell without the need for recombinant expression in the cell. Can be contacted with the cells underneath. For example,
When the method of the present invention is applied to skin, mucous membranes, etc., various techniques have been developed for supplying ectopically added proteins through cells.

In one embodiment, EST2 or m for transmucosal or transdermal delivery
A yc protein is provided. For such administration, penetrators appropriate for the barrier to be permeated are used in combination with the polypeptide. Such penetrating cysts are generally known in the art and include, for example, for transmucosal administration, bile salts and fusidic acid derivatives. Further, a detergent may be used to promote penetration. Transmucosal administration may be through nasal sprays or using suppositories. For topical administration, the proteins of the invention are formulated into salves, ointments, gels, or creams as generally known in the art. For example, Chien et al. (1989) J. Pharm. Sci. 78: 376-383 describes direct iontophoretic transdermal delivery of peptide and protein drugs. Srinivasan et
al., (1989) J. of Pharm. Sci. 78: 370-375 describes transdermal iontophoretic drug delivery: mechanical analysis and use for polypeptide delivery. U.S. Patent No.
See also 4,940,456.

US Pat. No. 5,459,127 describes the use of cationic lipids for intracellular delivery of biologically active molecules.

US Pat. No. 5,190,762 describes a method of administering a protein to living skin cells.

In another embodiment, the polypeptide is a heterologous peptide sequence that drives translocation of the extracellular form of the therapeutic polypeptide sequence across the cell membrane to promote intracellular localization of the therapeutic polypeptide. ("Localized peptides"). In this regard, therapeutic polypeptide sequences are those that are intracellularly active, such as tumor suppressor polypeptides, transcription factors, and the like. The localized peptide itself can cross the cell membrane at a relatively high rate, for example, by cell penetration. The localized peptide is conjugated to the telomerase activator polypeptide, for example, as a fusion protein. The resulting chimeric polypeptide is transported into the cell at a rapid rate relative to the activating polypeptide alone, thereby, for example, to improve local application of the EST2 polypeptide, into the cell to which it is administered. Means are provided to improve the introduction of

[0103] In one embodiment, the localized peptide is derived from a Drosophila antepennepedia protein, or a homolog thereof. The 60 amino acid long homeoregion of the homeoprotein Antepenediapedia has been shown to translocate across biofilms and can facilitate translocation of heterologous polypeptides to which it binds. For example, Derossi
et al. (1994) J Biol Chem 269: 10444-10450; and Perez et al. (1992) J Cel
l See Sci 102: 717-722. Recently, fragments as small as 16 amino acids in length of this protein have been shown to be sufficient to drive localization. Derossi et al. (19
94) See J Biol Chem 271: 18188-18193. The present invention provides for at least one EST2 or myc polypeptide sequence and, for EST2 or myc polypeptide, sufficient antepenepedia protein (or its (Analogs).

Another example of an endogenous peptide is the HIV transactivator (TA
T) It is a protein. This protein appears to be able to be divided into four regions (Kuppuswamy et al. (1989) Nucl. Acids Res. 17: 3551-3561). Purified TAT protein is absorbed by cells in tissue culture (Frankel and Pabo, (198
9) Cell 55: 1189-1193), a peptide such as a fragment corresponding to residues 37-62 of TAT is rapidly absorbed by cells in vitro (Green and Loewenstein, (1989)).
Cell 55: 1179-1188). Hyperbasic regions affect the localization and targeting of the nucleus to the nucleus. CFITKALGISYGRKKRRQRRRPPQGS
Peptides or analogs containing sequences present in highly basic regions, such as
Conjugated to T2 or myc to help internalize and target these proteins to intracellular milles.

Another example of an intracellular or extracellular polypeptide is mastparan (T. Higa
(Shjima et al., (1990) J. Biol. Chem. 265: 14176) to increase transmembrane transport of the chimeric protein.

Without intending to be bound by any particular theory, it is possible to bind or conjugate the hydrophilic polypeptide to a transportable peptide capable of crossing a membrane by receptor-mediated cell penetration. Note that doing so may result in physiological transport across the membrane barrier. Suitable endogenous peptides of this type are
For example, produced by using all or part of histone, insulin, transferrin, basic albumin, prolactin and insulin-like growth factor I (IGF-I), insulin-like growth factor II (IGF-II) or other growth factors. it can. For example, insulin fragments that show an affinity for the insulin receptor on capillary cells and are not as effective in reducing blood glucose as insulin can carry out transmembrane transport by receptor-mediated cells, and thus, the cell penetration of the present invention. It has been found that it can function as an endogenous peptide for the polypeptide. Preferred endogenous growth factor-derived peptides include CMHIESLDSYTC and CMYIEA
Peptides derived from EGF (epidermal growth factor) such as LDKYAC; peptides derived from TGFbeta (transforming growth factor beta); peptides derived from PDGF (platelet-derived growth factor) or PDGF-2; IGF-I (insulin-like growth factor) Or a peptide derived from IGF-II; and a peptide derived from FGF (fibroblast growth factor).

Another group of translocation / endogenous peptides exhibit pH-dependent membrane binding.
For an endogenous peptide that adopts a helical structure at acidic pH, the endogenous peptide gains amphiphilic properties, eg, the peptide has both a hydrophobic and a hydrophilic interface. More specifically, within the pH range of about 5.0-5.5, the endogenous peptide forms an alpha helical amphipathic structure that facilitates insertion of said moiety into the target membrane. For example, in a low pH environment present within cellular endosomes, an alpha helix-induced acidic pH environment may be found. Such endogenous peptides can be used to facilitate the transport of telomerase activator polypeptides from the endosomal compartment to the cytoplasm, which are absorbed by phagocytosis mechanisms.

Examples of preferred pH-dependent membrane-bound integral peptides include high proportions of helix-forming residues such as glutamate, methionine, alanine and leucine.
In addition, preferred endogenous peptide sequences include ionizable residues with a pKa in the range of pH 5-7, so that a sufficient uncharged membrane binding region is present in the peptide at pH 5, and the target cell membrane Insertion into it becomes possible.

In this regard, a particularly preferred pH-dependent membrane-bound integral peptide is Subbarao e
aal-aa2-aa3-EAALA (EALA) 4-EALEALAA-amide, representing a modification of the peptide sequence of T. al. (Biochemistry 26: 2964, 1987). Within this peptide sequence, the first amino acid residue (aa1) is preferably a unique residue, such as cysteine or lysine, that facilitates chemical conjugation of the endogenous peptide to the target protein conjugate. Amino acid residues 2-3 may be selected to modulate the affinity of the endogenous peptide for different membranes. For example, both residues 2
When and 3 are lys or arg, this endogenous peptide has the ability to bind to lipid membranes or moieties with a negative surface charge. If residues 2-3 are neutral amino acids, the endogenous peptide is inserted into the neutral membrane.

Still other preferred endogenous peptides include apolipoproteins A-1 and B
Peptide toxins such as melittin, bombolittin, delta hemolysin and pardaxins; antibiotic peptides such as alamethicin; calcitonin, corticotropin releasing factor, beta endorphin, glucagon, Parathyroid hormone, peptide hormones such as pancreatic polypeptides; and peptides corresponding to the signal sequences of a number of secreted proteins. In addition, the exemplary endogenous peptides may be modified by the attachment of substituents that enhance the alpha helical properties of the endogenous peptide at acidic pH.

[0111] Yet another group of endogenous peptides suitable for use in the present invention is that at physiological pH "
It contains a "hidden" but hydrophobic region that is exposed in the low pH environment of target cell endosomes. Upon exposure of this hydrophobic region and pH-induced development, the moiety binds to the lipid bilayer and effects translocation of the covalently bound polypeptide into the cytoplasm of the cell. Such endogenous peptides may be designed, for example, after the sequence has been identified in Pseudomonas exotoxin A, clathrin, or diphtheria toxin.

A pore forming protein or peptide will also function as an endogenous peptide herein. The pore forming protein or peptide may be obtained or derived from, for example, a C9 complement protein, a cytolytic T cell molecule or an NK cell molecule. These moieties can form a ring structure within the membrane, which allows the attached polypeptide to be transported across the membrane and into the interior of the cell.

[0113] Mere membrane insertion of an endogenous peptide can be accomplished by transducing a polypeptide across the cell membrane, eg, ES
Sufficient for T2 or myc translocation. However, translocation will be improved by attaching a substrate for an intracellular enzyme (ie, an "accessory peptide") to the endogenous peptide. It is preferable to attach a sub-peptide to a part of the endogenous peptide that protrudes to the cytoplasmic surface through the cell membrane. The secondary peptide is conveniently attached to one end of the translocation / endogenous moiety or attachment peptide. A sub-portion of the invention may include one or more amino acid residues. In some embodiments, the sub-part is:
A substrate for the cell phosphorylation reaction may be provided (eg, the minor peptide may include a tyrosine residue).

An example secondary site in this regard is a peptide substrate for an N-myristoyltransferase such as GNAAAARR (Eubanks et al., In: Peptides
.Chemistry and Biology, Garland Marshall (ed.), ESCOM, Leiden, 1988, pp.
566-69). In this construct, the N-terminal glycine is attached to the C-terminus of the minor peptide because it is essential for minor site activity. This hybrid peptide is
Upon attaching to the EST2 or myc polypeptide at the C-terminus, it is N-myristylated and further attached to the target cell membrane, eg, the peptide functions to increase the local concentration of the polypeptide at the cell membrane.

To further illustrate the use of a minor peptide, a phosphorylatable minor peptide is first covalently attached to the C-terminus of an endogenous peptide and then incorporated into a fusion protein with an EST2 or myc polypeptide. The peptide component of the fusion protein is inserted into the target cell plasma membrane, so that the minor peptide is translocated across the membrane and protrudes into the target cell cytoplasm. On the cytoplasmic side of the plasma membrane, the minor peptide is phosphorylated by cellular kinases at neutral pH. Once phosphorylated, the minor peptide functions to irreversibly attach the fusion protein to the membrane. Localization to the cell surface membrane can improve translocation of the polypeptide into the cytoplasm of the cell.

Examples of suitable secondary peptides include peptides that are kinase substrates, peptides with one positive charge, and peptides with sequences glycosylated by membrane-bound glycotransferase. A minor peptide glycosylated by a membrane-bound glycotransferase may include the sequence x-NLT-x, where "x" is, for example, another peptide, amino acid, binding agent, or hydrophobic molecule. You may. When this hydrophobic tripeptide is incubated in microsomal vesicles, it crosses the vesicle membrane, is luminally glycosylated, and is trapped within the vesicle due to its hydrophilicity (C. Hirschberg). et al., (
1987) Ann. Rev. Biochem. 56: 63-87). Thus, a sub-peptide containing the sequence x-NLT-x improves target cell retention of the corresponding polypeptide.

In another embodiment of this aspect of the invention, a secondary peptide can be used to enhance the interaction of the telomerase activator polypeptide with the target cell. Examples of minor peptides in this regard include peptides derived from a cell adhesion protein containing the sequence "RGD" or peptides derived from laminin containing the sequence CDPGYIGSRC. Extracellular matrix glycoproteins such as fibronectin and laminin bind to the cell surface through a receptor-mediated process. The tripeptide sequence RGD has been recognized as being required for binding to cell surface receptors. This sequence is found in fibronectin, vitronectin, complement C3bi, von Willebrand factor, EGF receptor, transforming growth factor beta, type I collagen, E. coli lambda receptor, fibrinogen and Sindbis coat proteins. Present (E. Ruoslahti, Ann. Rev. Biochem. 57: 375-413, 1988). RGD
Cell surface receptors that recognize sequences have been classified in the superfamily of related proteins called "integrins." Binding of the "RGD peptide" to cell surface integrins promotes cell surface retention and ultimately translocation of the polypeptide.

As mentioned above, the endogenous peptide and the sub-peptide can each independently be added to the EST2 or myc polypeptide either by chemical crosslinking or in the form of a fusion protein. In an example of a fusion protein, a non-constitutive polypeptide linker can be included between each of the peptide moieties.

Generally, the endogenous peptide is sufficient to direct the transport of the polypeptide.
However, where a minor peptide such as an RGD sequence is provided, it may be necessary to include a secretory signal sequence that directs export of the fusion protein from the host cell. In a preferred embodiment, the secretory signal sequence is extreme (extreme).
) Located at the N-terminus and (optionally) adjacent to the proteolytic site between the secretion signal and the rest of the fusion protein.

[0120] In one embodiment, the EST2 or myc polypeptide is Nde1-
EcoR1 fragment:

Embedded image Engineered to include an integrin-binding RGD peptide / SV40 nuclear localization signal as encoded by (see, eg, Hart SL et al., 1994; J. Biol. Chem., 269: 12468-12474). This is the RGD / SV40 nucleotide sequence:

Embedded image Code. In another embodiment, the protein is, for example, Nde1
-EcoRl fragment:

Embedded image Can be manipulated with respect to the HIV-1 tat (1-72) polypeptide, as provided by the HIV-1 tat (1-72) peptide sequence:

Embedded image Code. In yet another embodiment, the fusion protein is Nde1-
EcoR1 fragment:

Embedded image HSV-1 VP22 polypeptide as provided by Elliott G., O '
Hare P (1997) Cell, 88: 223-233), which comprises the sequence:

Embedded image Encodes the HSV-1 VP22 peptide having

In yet another embodiment, the fusion protein is, for example, a nucleotide sequence (Nde1-EcoR1 fragment):

Embedded image From the VP22 (C-terminal region) peptide sequence:

Embedded image Code.

In an embodiment of the present invention, the method of the present invention may comprise, for example, a small organic molecule having a molecular weight of less than 5000 atomic mass units, more preferably less than 1000 atomic mass units, even more preferably less than 500 atomic mass units. Is used. Further, such compounds are preferably, for example, when added directly to cultured cells or cells in whole blood.
A membrane permeant that can be dispersed in host cells across cell membranes.

In this regard, the art provides examples of assays that identify reagents that can activate telomerase activity. See, for example, U.S. Patent Nos. 5,837,453, 5,830,644, 5,804,380 and 5,686,245.

In yet another embodiment, to an appropriate extent, the intracellular level of TRT or telomerase activator (protein) may be upregulated by suppressing its natural turnover rate. it can. For example, ectopic expression of a protein can be performed using inhibitors of ubiquitin-dependent or independent degradation of the protein, in the sense that the concentration of the protein in cells can be artificially increased. For example, assays that detect inhibitors of ubiquitination, which are readily applicable to detect inhibitors of ubiquitination of myc or other telomerase activators, include, for example, U.S. Patent Nos. 5,744,343, 5,847,094, No. 5,847,076, No. 5,834,487, No. 5,187,494, No. 5,780,454 and No. 5,766,927
It is described in literatures such as Similarly, to the extent that other post-translational modifications, such as phosphorylation, affect the stability of the protein, the present invention provides, where appropriate, inhibitors of such modifications, including kinase or phosphatase inhibitors. Consider using it.

In yet other embodiments, the ability of the cells to proliferate is determined by measuring the telomerase activity
It is increased by contacting the cell with a reagent, such as a small molecule, that removes or otherwise inhibits a signal that antagonizes the triggered activation. For example, a reagent that interferes with the protein-protein interaction involved in the inhibition of myc activity by, for example, a mad-max heterodimer may be used.

(B) Conjoint Uses Another aspect of the invention provides for a co-therapy in which one or more other therapeutic agents are administered with a telomerase-activating therapeutic. Such conjoint treatment may be achieved by way of the simultaneous, sequential or separate dosing of the individual components employed in the treatment. For example,
The telomerase-activating therapeutic can be co-administered with growth factors and other fission reagents. As used herein, division reagent refers to any compound or composition, including peptides, proteins, and glycoproteins, that can stimulate the growth of a target cell population. For example, a telomerase-activating therapeutic agent is a lectin, such as
It can be co-administered with a T cell division reagent such as concanavalin A or phytohemagglutinin. Examples of other fission reagents include insulin-like growth factor (IGF), platelet-derived growth factor (PDGF), fibroblast growth factor (FGF
), And some of the transforming growth factors (TGFs).

In one embodiment, a telomerase-activating therapeutic of the invention is administered with a reagent that eliminates “capping” inhibition of EST2 rescue. The inventor has noticed that EST2 does not extend the lifespan of late passage HMEC cells and certain other cell lines, such as fibroblasts, nor the length of telomeres. Without intending to be bound by any particular theory, the inability to extend such terminal granules in such cells may be the result of kinetics. For example, telomere binding proteins such as TRF (TTAGGG repeat binding factor) are enriched in association with telomere sequences. When such proteins are heavily loaded into telomeres, ectopic EST2-induced elongation is inhibited. Such relative abundance of protein relative to telomere may be due, for example, to a constant concentration of the relevant protein, increased expression (or stability) of the relevant protein, or a terminal to a combination thereof. It may be the result of a decrease in the number of granule arrays. To mitigate such kinetic inhibition of EST2 activity, it competes with telomeres for binding of telomere binding proteins (eg,
The cells can be treated with the oligonucleotide (as a decoy). See, for example, Wright et al. (1996) EMBO J 15: 1734. In another embodiment, a major negative mutant of a telomere binding protein can be introduced into a cell to inhibit the formation of inhibitory protein complexes with telomere sequences. For example, Bianchi et al. (1997) EMBO J 16: 1785-94; Broccoli et al. (1997) Hum
Mol Genet 6: 69-76; Smith et al. (1997) Trends Genet 13: 21-26; Zhong et a
l, (1992) Mol. Cell. Biol. 12: 4834-4843; Chong et al. (1995) Science 270: 1
See 63-166. In yet other embodiments, the reagent can be a small molecule inhibitor of gene transcription or an inhibitor of the expression of terminal granule binding proteins such as antisense. In yet other embodiments, such reagents, especially small molecules, can be identified by their ability to directly inhibit the formation of a terminal granule complex that includes a terminal granule binding protein.

(C) Exemplary Uses of the Methods of the Invention The methods of the invention can be used to increase the proliferative capacity of cells as part of in vivo, in vitro and ex vivo protocols. Although the method of the present invention can be applied to any normal cell type, the method is preferably performed using normal cells that express low levels of telomerase activity. For the purposes of the present invention,
The term "normal" refers to cells other than tumor cells, cancer cells, or transformed cells. Exemplary cells are embryonic stem cells as disclosed in Thomson et al. (1998) Science 282: 1145 and Shamblott et al. (1998) PNAS 95: 13726. Particularly preferred cells for use in the methods of the present invention include embryonic, fetal, neonatal, and adult stem cells of any organ, and adult pluripotent hematopoietic stem cells.

[0129] In one embodiment, the cells are stem and / or progenitor cells. These cells include, for example, hematopoietic stem cells derived from bone marrow, mobilized peripheral blood cells, or cord blood. In another embodiment, the cell is pancreatic tissue,
It is a progenitor cell for liver tissue or other tissues from gastrulation. In yet another embodiment, the stem cells are neural stem cells such as neural crests that can be used to form neural cells or smooth muscle cells.

In another embodiment, the cells are not stem cells or progenitor cells. For example, they can be pancreatic β cells, smooth muscle cells (or muscle cells), fibroblasts, lymphocyte cells, such as B or T cells, bone cells or chondrocytes, to name just a few. Such committed cells.

Although the methods of the present invention can be used in vitro or in vivo, the present invention has particular use in culturing cells ex vivo, where the cells are cultured ex vivo and then transferred to the host. It offers particularly important benefits to the therapy being introduced. For example, the methods of the present invention can be used to increase the proliferative capacity of cells that have been harvested or otherwise isolated in culture that are to be transplanted into a patient.

Such a protocol may be used in accordance with the present invention in which bone marrow or isolated hematopoietic progenitor cells are treated according to the present invention, where telomerase activation and Rb inactivation are reverted to a wild-type phenotype before or immediately after transplantation. It has found use in bone marrow transplantation.

The methods of the present invention can also be used to extend the life span of T cells in HIV or Down syndrome patients.

The methods of the invention also find use in protocols for forming artificial tissues, such as prosthetic devices, for example, from stem cells or related cells. Examples of tissues include pancreas,
Examples include liver, nerve, muscle cells, cartilage and bone tissue.

By way of illustration, the methods of the invention can be used to extend the life of hematopoietic cells and hematopoietic stem / progenitor cells. As used herein, the term "hematopoietic cells" refers to fully differentiated myeloid cells such as red blood cells, megakaryocytes, mononuclear cells, granulocytes, and eosinophils, and to B and T lymphocytes. Completely differentiated lymphoid cells. Therefore, examples of hematopoietic stem / progenitor cells include BFU-E (burst-forming units-erythroid), CFU-E (colony forming unit-erythroid), CFU-Meg ( Colony forming unit-megakaryocyte, CFU-GM (colony forming unit-granulocyte-mono)
cyte), CFU-Eo (colony forming unit-eosino
phil), and CFU-GEMM (colony forming unit-granulocyte-erythrocyte-megakaryocyte-mo)
nocyte), and various hematopoietic progenitor cells from which these differentiated cells develop.

In another embodiment, the methods of the invention can be used to extend the life of pancreatic cells and pancreatic stem / progenitor cells. The term "pancreatic progenitor cells" refers to cells that can differentiate into cells of the pancreatic lineage, for example, cells that can produce hormones or enzymes normally produced by pancreatic cells. For example, pancreatic progenitor cells are at least partially alpha,
β, δ, or φ islet cells or cells of exocrine fate may be differentiated.
The pancreatic progenitor cells of the invention can also be cultured prior to administration to a subject under conditions that promote cell proliferation and differentiation. These conditions include culturing the cells to form pseudo-islet aggregates or clusters and allowing the cells to grow and confluent in vitro in a time that allows the cells to be produced to secrete insulin, glucagon, and somatostatin. .

The endocrine part of the pancreas consists of the islets of Langerhans. The islets of Langerhans appear as round clusters of cells embedded within the exocrine pancreas. Four different types of cells, α, β, δ, and φ, are identified in the islet. α cells are
It makes up about 20% of the cells found in islets and produces the hormone glucagon. Glucagon acts on some tissues to produce energy that can be used at intervals between feedings. In the liver, glucagon breaks down glycogen,
Promotes gluconeogenesis from amino acid precursors. Delta cells produce somatostatin in the pancreas that functions to inhibit glucagon release and reduce pancreatic exocrine secretion. The hormone pancreatic peptide is produced in φ cells. This hormone is
Inhibits pancreatic exocrine secretion of bicarbonate and enzymes, relaxes the gallbladder, and reduces bile secretion. The most abundant cells in the islets, which make up 60-80% of the cells, are the insulin-producing β cells. Insulin is known to store excess nutrients that occur during or shortly after feeding. The primary target organs for insulin are the fatty organs, which are specialized for liver, muscle, and energy storage.

In certain embodiments, the telomerase-activating therapeutics of the invention are used to extend the life of transplanted pancreatic cells, eg, transplanted β-islet cells. Recently, tissue engineering approaches to treatment have focused on transplantation of islets, usually encapsulated in a membrane to avoid immune rejection. Many methods for encapsulating cells are known in the art. For example, a source of insulin producing beta islet cells is encapsulated within implantable hollow fibers. Such fibers can be pre-spun and then packed with beta islet cells (Aebischer et al. U.S. Pat. No. 4,892,5
No. 38; Aebischer et al. U.S. Patent No. 5,106,627; Hoffman et al. (1990) Expt
.Neurobiol. 110: 39-44; Jaeger et al. (1990) Prog. Brain Res. 82: 41-46; an
d Aebischer et al. (1991) J. Biomech. Eng. 113: 178-183), or can be extruded with a polymer that functions to form a polymer coat around β-islet cells (Lim US Pat. No. 4,391,909). ; Sefton U.S. Patent No. 4,353,888; Sug
amori et al. (1989) Trans.Am.Artif.Intern.Organs 35: 791-799; Sefton et a
l. (1987) Biotehnol. Bioeng. 29: 1135-1143; and Aebischer et al. (1991) Bi.
omaterials 12: 50-55).

In any of the above-described embodiments, pancreatic cells can be treated by the method of the present invention ex vivo and / or by subsequent administration of a therapeutic agent to the animal in which the device is implanted. Can be processed by the method. Such cells have the ability to differentiate into cells of the pancreatic lineage, for example, β-islet cells, and thus can be used in the treatment of diabetes. The pancreatic cells of the invention can further be cultured in vitro under conditions that induce differentiation of these cells into mature pancreatic cells, or can undergo differentiation in vivo once introduced into a subject.

Furthermore, in addition to providing a source of transplantable cells, either in the form of a population of progenitor cells or their differentiated progeny, the method of the present invention provides for the production of secreted factors and It can be used to extend the life of normal pancreatic cells used to produce the purification media. For example, the cultured cells can be provided as a source of insulin. Similarly, exocrine cultures can be provided as a source of pancreatin.

In yet another embodiment, the methods of the invention can be used to extend the life of hepatocytes and hepatic stem cells. As used herein, the term "hepatic progenitor cell" refers to a cell capable of differentiating into a hepatic lineage cell, such as a hepatocyte, such as a hepatocyte. Hepatocytes are some of the most versatile cells in the body. Hepatocytes have both endocrine and exocrine functions, synthesize and accumulate certain substances, detoxify other substances, secrete other substances, and have enzymatic, transport, or hormonal activities. Fulfill. The primary activities of hepatocytes include the regulation of bile secretion, carbohydrate, lipid, and protein metabolism, storage of metabolically important substances, degradation and secretion of hormones, and transformation and excretion of drugs and toxins. The methods of the invention can be used to promote long-term culture of hepatocytes and liver progenitor cells, either in vitro or after transplantation.

[0142] In yet another embodiment, the methods of the invention can be used to extend the life of a "feeding" cell layer for cell co-culture.

In another embodiment, the method of the invention enhances the presence of fetal fibroblasts that are actively dividing for nuclear transport, such as for large-scale cloning of non-human animals. Can be used to improve.

Previous studies in nuclear transfer have shown that the cell cycle stage of the donor cells affects the degree of embryo development after nuclear transport. When the donor cell is fused to an acceptor oocyte that is committed in the second metaphase of meiosis, the nuclear envelope breaks down and the chromosome condenses until the oocyte is activated. This condensed phase is DNA
It has been shown to cause chromosomal defects in recipient cells undergoing synthesis. However, receptors cells in the G ₁ phase of the cell cycle (before DNA synthesis) is normally condensed to support the high speed of early development.

The rationale for the present inventors in selecting the best donor cell for nuclear transfer is that the cells, as an indicator of a relatively undifferentiated state, are rapidly growing during early embryo development. It should have not stopped dividing to be consistent with cell division (in the case of G ₀ ), but it was actively dividing. Cells by any of selecting the type of cells with the cell cycle or artificially restrained, or unique long G ₁ phase, should be within the G _1.

The method of the present invention can be applied to general cell culture techniques. For example, the method of the present invention can be used to increase the replication capacity of a hybrid between an immortal human cell and a lethal human cell, such as a hybrid between human B lymphocytes and myeloma, for example, to produce a human hybridoma. Can be used to increase the replication ability of the antibody.

More generally, the methods of the present invention can be used to increase the replication capacity of cultured cells that have been engineered to produce recombinant protein. Indeed, the method of the present invention allows the use of “normal” cells as recombinant cells, and thus the problems that may arise with the use of immortal cells (such as differences in post-translational modifications) are particularly It can be avoided for protein production.

In another aspect, the present invention provides agents and methods for controlling the growth of epithelial-derived tissue using telomerase-activated healing as an active ingredient. The present invention also relates to a method for controlling the growth of epithelial-derived tissue using the agent of the present invention. To illustrate this, the telomerase-activating therapeutics of the invention can be used to treat diseases of the skin and skin organs; cornea, lens and other ocular tissues; mucous membranes; and epithelial tissues such as periodontal epithelium, or surgery or It may be used as part of a regimen in beauty restoration. The methods and compositions disclosed herein are provided for the treatment and prevention of various damaged epithelial and mucosal tissues. For example, the methods of the present invention can be used to control the wound healing process as desired for any surgery involving epithelial tissue, such as from skin surgery or periodontal surgery. Surgical repairs, where the use of telomerase-activating therapeutics is a candidate for treatment include severe tanning and skin regeneration, skin transplantation, bedsores, skin ulcers, fissures, reduction of post-operative scarring, And ulcerative colitis.

In another aspect of the invention, a telomerase-activating therapeutic is used for hair growth, such as in the treatment of alopecia, thereby increasing or otherwise prolonging hair growth. be able to.

[0150] Yet another aspect of the invention provides a method of extending the life of epithelial tissue in tissue culture.

The terms “epithelial”, “epithelial” and “epithelial” refer to the inner and outer body surface, including epithelial cells of the gland and other structures derived therefrom, such as the cornea, esophagus, epidermis, and hair follicles (Skin, mucus and serum). Other examples of epithelial tissues include: olfactory epithelium, a multi-row epithelium that covers the olfactory area of the nasal cavity and contains olfactory receptors; gland epithelium, which refers to epithelium consisting of secretory cells; Squamous epithelium. The term epithelium refers to transitional epithelium that has been characterized as being an inner hollow organ that is subject to large mechanical changes due to contraction and expansion, for example, tissue that migrates between stratified squamous epithelium and columnar epithelium. Sometimes called.

The term “epithelialization” refers to the healing of epithelial cells that grows on the exfoliated surface.

The term “skin” refers to the outer protective covering of the body, consisting of the dermis and epidermis, and is understood to include sweat and sebaceous glands, as well as hair follicle structures. Throughout this application, the adjective "skin" may be used, which generally refers to skin attributes as appropriate to the context in which the term is used.

The term “epidermis” refers to the subcutaneous outermost non-vessel layer varying from 0.07-1.4 mm in thickness from the embryonic ectoderm. On the palm side and sole side,
Epidermis, basal layer composed of columnar cells arranged vertically outward; spiny cell layer or stratum corneum composed of flat multifaceted cells with short protrusions or spines; granular layer composed of flat granule cells; nuclei identified Consisting of a transparent layer consisting of several layers of transparent cells not included or included; and a stratum corneum consisting of flat keratinous non-nucleated cells. In a normal body surface epidermis, there is usually no transparent layer.

“Dermis” refers to a layer of skin that consists of a dense layer of tissue connected to blood vessels and extends to the epidermis, which contains nerve and sensory terminal organs. The hair root, and the sebaceous and sweat glands are structures of the epidermis that are deeply embedded within the dermis.

The term “hair” refers to a thread-like structure, in particular a special epidermal structure composed of keratins, produced from the dermal papilla buried in the dermis, which is produced exclusively by mammals and is characteristic of a group of animals. Name. Such a collection of hair is also referred to. "Hair follicle" refers to the tubular invagination of the epidermis surrounding hair, from which hair grows, and "hair follicle epidermal cells"
Refers to epidermal cells surrounding the dermal papilla in the hair follicle, such as stem cells, outer root sheath cells, stromal cells, and inner root sheath cells. Such cells may be normal non-malignant cells or transformed / non-lethal cells.

"Resected wounds" include ruptures, abrasions, cuts, punctures or lacerations in the epithelial layer of the skin, and may extend into the dermis layer and further into or below the subcutaneous fat. A resected wound may result from a surgical procedure or accidental penetration of the skin.

“Burn” refers to the removal or loss of a large surface area of skin from an individual due to heat and / or chemical reagents.

“Skin ulcer” refers to a trauma to the skin caused by loss of superficial tissue, usually due to inflammation. Skin ulcers that can be treated by the method of the present invention include pressure ulcers, diabetic ulcers, venous stasis ulcers and arterial ulcers. Pressure ulcer wounds refer to chronic ulcers resulting from the pressure exerted on an area of skin over an extended period of time. This type of wound is often referred to as bedsore or pressure sore. Venous stasis Ulcers result from the congestion of blood or other fluids from defective veins. Arterial ulcer refers to necrotic skin in the area around an artery with poor blood flow.

“Tooth tissue” refers to tissue in the mouth that resembles epidermal tissue, for example, gingival tissue. The method of the present invention is useful for treating periodontal disease.

“Internal epithelial tissue” refers to tissue in the body that has properties similar to the epithelial layer of the skin.
Examples include the lining of the intestine. The methods of the present invention are useful for promoting the healing of certain internal wounds, for example, wounds caused by surgery.

“Wounds to ocular tissue” refers to severe dry eye syndrome, corneal ulcers and abrasions, and ophthalmic surgery wounds.

The methods of the present invention have a wide range of uses for treating or preventing diseases affecting epithelial tissue, as well as for cosmetic use. In general, the methods of the invention can be characterized as including contacting the cells, in vitro or in vivo, with a telomerase-activating therapeutic agent in an amount sufficient to alter the longevity of the epithelial tissue being treated. . For in vivo use, the mode of administration and dosage formulation will depend on the epithelial tissue to be treated. For example, where the tissue to be treated is an epithelial tissue such as a dermal or mucosal tissue, a topical formulation is preferred.

By the “promoting wound healing” method, the wound heals as a result of the treatment much faster than a similar wound would heal without treatment. "Promoting wound healing" refers to the above-described method, in particular, that the proliferative and growth phases of keratinocytes are prolonged, or that the wound has less scar, less wound contraction, less collagen deposition, It may also mean healing with low surface area. In some cases, “promoting wound healing” means that certain methods of wound healing have improved success rates (eg, skin graft survival rates) when used with the methods of the present invention. There is also.

A wound that is not completely healed and remains open is always at risk of complications. Most wounds heal quickly without treatment, but some types of wounds resist healing. Wounds covering large surface areas will remain open for extended periods of time. In certain embodiments of the invention, the invention is used to improve and / or otherwise accelerate the healing of wounds containing epithelial tissue, such as those resulting from surgery, burns, inflammation or irritability. Can be. The telomerase-activating therapeutic agent of the present invention can be applied prophylactically, for example, in the form of a cosmetic preparation, to improve the process of skin, hair and / or nail tissue regeneration.

[0166] Full or partial thickness burns are often an example of a type of wound that covers a large surface area and therefore require a long period of time to heal. The result is often life-threatening complications such as infections and fluid damage. In addition, the healing in burns is often chaotic, resulting in scarring or ugliness. In some cases, contraction of the wound due to excessive collagen deposition reduces the mobility of muscles near the wound. The compositions and methods of the present invention can be used to enhance the healing of burns, improve cosmetic outcomes, and enhance the healing process with less wound contraction and scarring.

Severe burns covering large areas are often treated by autologous transplantation of skin taken from undamaged areas of the patient's body. The method of the present invention can be used in conjunction with skin transplantation to improve graft performance and longevity in culture and to enhance the growth of both the transplanted skin and the patient's skin in close proximity to the graft. The survival rate of the pieces can also be improved.

A dermal tumor is yet another example of a wound that is amenable to treatment by the methods of the present invention, for example, to treat the tumor and / or prevent the ulcer from becoming a chronic wound. For example, one out of every seven patients with diabetes develops a dermal tumor on the susceptible limb. Patients infected with diabetic tumors often require hospitalization, intensive care, expensive antibiotics, and, in some cases, amputation. Dermal ulcers, such as those resulting from venous disease (venous stasis ulcers), overpressure (pressure ulcers) and arterial ulcers also resist healing. Conventional treatment is generally limited to protecting the wound, being free of infection, and in some cases restoring blood flow by vascular surgery. According to the method of the present invention, the diseased area of the skin is promoted by epithelialization of the wound,
For example, it can be treated by a therapy containing a telomerase-activating therapeutic agent that accelerates the rate of healing of a skin tumor.

In another embodiment, there is provided a method of the invention for treating or preventing a disease of the digestive system. Briefly, a variety of diseases, including chemotherapy-induced and radiation therapy-induced enteritis (ie, enterotoxicity) and mucositis, peptic ulcer disease, gastroenteritis and colitis, villous atrophy, etc. Various diseases are associated with disruption of the gastrointestinal epithelium or villi. For example, chemotherapeutics and radiation therapy used to treat bone marrow transplants and cancer have a rapid effect on the growth of cells inside both hematopoietic tissue and the small intestine, and are severe and often dose-limited. It is led to. Damage to the mucosal barrier of the small intestine results in significant complications of bleeding and sepsis. The methods of the present invention can be used to promote the growth of gastrointestinal epithelium, thereby increasing the acceptable dose of radiation and chemotherapeutic agents. Effective treatment of diseases of the gastrointestinal system will be determined by several criteria, including the enteritis score, other tests well known in the art.

With age, the epidermis becomes thinner and the skin appendages atrophy. Hair is reduced and sebum secretion is reduced, resulting in dryness, cracking and cracking. The dermis decreases with the loss of elastic collagen fibers. In addition, keratinocyte proliferation (representing skin thickness and skin growth potential) decreases with age. It is believed that increased or sustained rate of keratinocyte proliferation moderates skin aging, ie, wrinkles, thickness, elasticity and repair. According to the present invention, telomerase-activating therapeutics can be used either therapeutically or cosmetically to at least temporarily mitigate the effects of skin aging.

The methods of the present invention can be used to treat wounds on cancerous tissue. In general, damage to corneal tissue, whether due to disease, surgery, or injury, can affect epithelial and / or endothelial cells, depending on the nature of the wound. Corneal epithelial cells are non-keratinized epithelial cells that cover the outer surface of the cornea and provide a protective barrier to the external environment. Healing of horny wounds is of interest to both clinicians and researchers. Ophthalmologists often face corneal dystrophy and problematic disorders that result in persistent and frequent epithelial erosion, often leading to permanent endothelial loss.
Telomerase-activating therapeutics can be used in these examples to promote epithelialization of affected corneal tissue. To further illustrate, certain diseases commonly associated with epithelial cell damage in the eye and for which the methods of the present invention can provide beneficial treatment include persistent corneal epithelial defects, frequent erosion, Corneal tumors, keratoconjunctivitis sicca, microbial corneal tumors, viral corneal tumors and the like. In addition, chips, surface erosion,
Epithelial cells may be lost due to superficial wounds such as inflammation and the like. According to the present invention, the corneal epithelium is contacted with an effective amount of a telomerase-activating therapeutic agent to enhance the proliferation of corneal epithelial cells to properly heal the wound.

Ex vivo maintenance of tissues and organs is also highly desirable. Tissue replacement therapy is well established in the treatment of human disease. For example, in 1996, more than 40,000 corneal transplants were performed in the United States. Human epidermal cells can be grown in vitro and used to implant burn sites and chronic skin tumors and other skin wounds. The method of the present invention enhances the longevity of epithelial tissue in vitro,
It can also be used to enhance the transplantation of cultured epithelial tissue into animal hosts.

The methods of the present invention can be used to improve the survival rate of skin grafts. If the graft survives too long, the epithelial tissue graft will blister or crack and the autograft will "engraft", i.e., adhere to the wound and beneath The tendency to form granular tissue and basement membrane is reduced. The engraftment rate can be increased by improving keratinocyte proliferation by the method of the present invention. The method of increasing engraftment rate is effective for wound healing as described in Methods for promoting skin healing and methods for promoting keratinocyte growth and proliferation, as described above. Contacting the telomerase-activating therapeutic agent with an appropriate amount.

Skin equivalents have many uses, not only as replacements for human or animal skin for skin transplantation, but also as test skins to determine the efficacy of therapeutic substances and cosmetics on the skin. A major drawback in pharmaceutical, chemical and cosmetic testing is that it is difficult to determine the efficacy and safety of the product on the skin. One of the advantages of the skin equivalent of the present invention is its use as an indicator of the effect produced by such substances by in vitro tests on test skin.

Thus, the methods of the present invention can be used in certain embodiments, for example, as part of a protocol for skin grafting of exfoliated areas, granulation injury and burns. The use of telomerase-activating therapeutic agents can enhance transplantation techniques such as mesenchymal and epidermal autotransplantation (cultured autologous keratinocytes) and epidermal allograft (cultivated allogeneic keratinocytes). In the allograft example, using the method of the invention to enhance the formation of skin equivalents in culture means that the patient is coated in a single step with a material that can cause permanent healing As such, it helps provide / maintain an easy supply of such implants (eg, in a tissue bank).

In this regard, the invention also relates to the living skin equivalent of a complex comprising the epidermal layer of cultured keratinocyte cells expanded in the presence of a telomerase-activating therapeutic. The method of the present invention can be used as part of a method for preparing a living skin equivalent of a complex. In certain embodiments, such a method comprises obtaining a sample of skin; enzymatically treating the skin sample to separate epidermis from dermis; treating the epidermis enzymatically to reduce keratinocyte cells. Culturing epidermal keratinocytes, in parallel or separately, in the presence of a telomerase-activating therapeutic agent, until confluence; enzymatically treating the dermis to release fibroblasts; Culturing the fibroblasts until sub-confluence; inoculating the cultured fibroblasts into a porous cross-linked collagen sponge membrane; incubating the inoculated collagen sponge on its surface, Proliferating the fibroblasts throughout the collagen sponge; then inoculating the sponges with cultured keratinocyte cells; peeling the complex in the presence of a telomerase-activating therapeutic agent to increase the lifespan of the cells. Each step of incubating the skin equivalent complex.

In another embodiment, a skin sheet containing both epithelial and mesenchymal layers can be isolated in media and expanded with media supplemented with a telomerase-activating therapeutic.

Any skin sample that is capable of performing cell culture techniques can be used in the present invention. The skin sample may be self or the like.

In another aspect of the invention, the methods of the invention can be used with various periodontal steps where it is desirable to control the growth of epithelial cells in or around periodontal tissue. In certain embodiments, proliferative forms of hedgehog and ptc treatment can be used to enhance reepithelialization around natural teeth and dentures, for example, to promote gingival tissue formation .

In yet another embodiment, the methods of the present invention can be used to help control induced tissue regeneration, such as when used with a bioresorptable material. For example, incorporating a periodontal implant, such as a denture, can be facilitated by the method of the present invention. Tooth reattachment involves both the formation of connective tissue fibers and the formation of epithelium of the tooth sac. The treatment according to the method of the invention can be used to improve tissue reattachment by controlling the mitotic capacity of basal epithelial cells during wound healing.

[0181] EXAMPLES The present invention described broadly herein are included solely for the purpose of illustrating certain aspects and embodiments of the present invention, the following examples which are not intended to limit the present invention It will be more easily understood by reference.

The maintenance of telomeres has been proposed as an essential prerequisite for human tumor development. Although the telomerase enzyme is itself a specific marker of tumor cells, the genetic alteration that activates it during malignant transformation has not been explained. Amplification of the myc oncogene is widely observed in a broad spectrum of human tumors. Here we show that myc induces telomerase in both normal human mammary epithelial cells (HMEC) and in normal human diploid fibroblasts. my
c is hEST2, a catalytic subunit of telomerase (hEST / TP2)
Increase the expression of Since hEST2 limits enzyme activity in normal cells,
yc will control telomerase only by regulating hEST2 levels. Activation of telomerase by hEST2 is sufficient in normal human mammary epithelial cells to increase the average length of telomeres and extend their lifespan. myc
Can also extend the lifespan of these cells, so activation of telomerase may be one of the mechanisms by which myc contributes to tumorigenesis.

Telomerase activity is minimal in somatic cells in vivo and normal human cells in culture ¹ . As these cells proliferate, terminal globular repeats are progressively lost due to incomplete replication of chromosomal ends during each division cycle ^2-5 . Truncated terminals have been proposed as a mitotic clock that characterizes the course of cells towards the end of their replication life. According of this model, ⁶ erosion of chromosome ends that triggers aging cells. By bypassing senescence by counteracting tumor suppressor gene (eg, p53 and Rb / p16) pathways, growth is continued and terminal granule sequences are lost ^5,7 . The uncertain growth telomere is not maintained, for telomere is completely lost, will chromosome instability ^8. This probably contradicts survival, so cells with a medium life span must ^adopt a strategy of ^telomere preservation ^1,9,10 .

Stabilization of telomere repeats has been proposed as a prerequisite for tumorigenesis ¹¹ .
^Additional support for this view comes from the observation that telomerase is activated in high rates of late-stage human tumors. The possibility that the maintenance of telomeres may be an essential component of the oncogenic genotype has led the applicant to investigate known oncogenes for their ability to activate telomerase enzymes.

Normal human mammary epithelial cells lack telomerase, while lethal HME
C derivative and breast cancer cell lines are almost invariably telomerase positive ^{13-1 5.} The introduction of the HPV-16 E6 protein into the HMEC stimulates telomerase activity, suggesting that a single genetic event can increase the enzyme in these cells ^16,17 ( (Fig. 3). Therefore, HMEC was used to investigate oncogenes. Ectopic expression of mdm-2 failed to induce telomerase, consistent with the observation that activation of telomerase by E6 can be distinguished from the ability of E6 to promote p53 degradation ¹⁶ ( Data not shown). Several other cell and viral oncogenes, including E7, are ras (V12) and all cdc25 isoforms (iso
form) and failed to induce telomerase (FIG. 3, data not shown). However, the introduction of the c-myc expression cassette revealed telomerase activity in HMEC (FIG. 3). The enzyme was detectable within one passage after transduction of HMEC with a retrovirus that directs myc expression. After drug selection of infected cells, the myc expressing population contained activity similar to the level of telomerase activity found in random samples of breast cancer cell lines (FIG. 3; egT47D).

Transfection of E6 into normal human diploid fibroblasts fails to activate telomerase ^16,17 (FIG. 4). Similar results were observed after transformation of either the activated ras or the dominant negative p53 allele (data not shown). However, telomerase was induced by transduction of either IMR-90 (FIG. 4) or WI-38 (not shown) with a retrovirus that directs myc expression. For HMEC, the activity is evident immediately after infection,
After secretion of the yc-expressing population, telomerase reached levels comparable to those found in the telomerase-positive fibrosarcoma cell line HT1080 (FIG. 4).
.

A recent report suggests that E6 can activate the myc promoter ¹⁸ . This prompted the applicant to ask whether E6 regulates telomerase by affecting myc expression. In HMECs, expression of E6 induced myc to levels approaching those achieved upon transduction of HMECs with a retrovirus that directs myc expression (FIG. 5A). Surprisingly,
E6-induced denaturation in the myc protein did not reflect changes in abundant myc mRNA (FIG. 5B), suggesting that regulation of myc expression by E6 must occur at the post-transcriptional level. In contrast, myc levels remained unmodified after expression of E6 in IMR-90 cells where E6 cannot activate telomerase (FIG. 5A). This result shows that by denaturing abundant myc, E6
Is consistent with a model that regulates telomerase in HMEC.

Existence of mRNA encoding hEST2, a catalytic subunit of telomerase
Location is strictly correlated with telomerase activity. mRN for hEST2
A is not detectable in normal tissues and cell lines, but hEST2
Present in lethal and tumor-derived cell lines^19-21. Furthermore, hEST2 expression and telomerase are concomitantly suppressed when cells are induced to differentiate. ²⁰ . As expected, hEST2 mRNA is absent from normal HMEC. Only
HEST2, on the other hand, does not undergo HMEC cell transduction after transduction with the myc retrovirus.
Vesicles (FIG. 6A). Increased hEST2 expression in myc
To determine if it was sufficient to cause telomerase activation by
In addition, Applicants direct HMEC and IMR-90 to direct hEST2 expression.
Infected with retrovirus. The hEST2 supply provides both cell types
Telomerase was clearly induced (Fig. 6B). Considering each other, these
The result is that myc regulates the expression of the restricted telomerase subunit
Regulates telomerase. myc improves the expression of response genes
Transcription factor. Therefore, myc directly controls the hEST2 promoter.
By contact stimulation, hEST2 expression could be increased. Ah
Alternatively, alterations in hEST2 expression may alter the ability of myc to regulate other genes.
It may be a secondary consequence.

The length of the terminal granules is regulated at two different levels. First, preserving ^{telomere repeats} requires activation of either the telomerase enzyme or another pathway for ^{telomere maintenance 1,9,10,14,22} . ²³ Second, the the telomeres length can be controlled by telomere-binding proteins. To determine whether activation of telomerase in HMEC cells is sufficient to stabilize telomere length, when HMECs were passaged in either the presence or absence of telomerase activity, The terminal small restriction fragment (TRF) was tracked. In normal HMECs, telomere length decreased slightly when cells experienced multiple divisions (FIG. 6C).
). Activation of telomerase by expression of hEST2 not only prevented telomere contraction, but also increased the average TRF length than was observed in early passage cells (FIG. 6C).

[0190] Terrain length has been proposed as a counting mechanism to determine the growth life of cells.
Early passage normal H that received either hEST2 or myc expression cassette
MECs show an extended life span compared to vector transduced cells (FIG. 7).
This indicates the notion that terminal granule length is one of the criteria used by cells to calculate their proliferative capacity.

Here, we show that ectopic expression of myc can induce telomerase in both normal epithelial cells and normal fibroblasts and prolong the lifespan of HMEC amplification. The myc oncogene is activated by gene amplification and possibly by mutations in a variety of different tumor ^types24,25 . Increased myc activity would be responsible for the presence of telomerase in many late-stage tumors because myc can elevate telomerase to levels close to those observed in tumor cell lines. In this regard, 100 neuroblastoma studies showed that up to 20% (16/100) had very high telomerase activity. Of these, 11 showed amplification of N-myc locus ^26. Thus, in this case, telomerase levels are clearly correlated with myc activation. myc
Oncogene, might induce telomerase a high percentage of the tumor, the enzyme may be regulated by other routes ^27.

Promoting cell growth and oncogene transformation with myc probably requires the induction of a number of different target genes ²⁸ . Telomerase activation may be an essential component of myc's ability to promote tumorigenesis, as maintenance of telomeres may contribute to the potential for long-term growth of tumor cells.

Methods Retroviral plasmid. The following viral plasmids were used for transfection: pBabe-piro ²⁹ , MarXII-hygro, mouse c-myc / MarXII-hygro
(A gift from Dr. P. Sun of CSHL), E6 / pBabe-puro, cdc2
5A / MarXII-hygro. The full-length hEST2 cDNA (a gift from Dr. R. Weinberg) was ligated at the EcoRI and SalI sites with the pBabe-puro vector.
Cloned in

Cell culture and retrovirus-mediated gene delivery. Human breast epithelial cells (HMEC184 helix K) were obtained from Dr. M. Stampher. Normal human diploid fibroblasts (IMR90 and WI38) and human breast cancer cell lines (
BT549, T47D and HBL100) were obtained from the ATCC. HT1080
Cells were a gift from G. Stark (Cleveland Clinic Foundation). An amphotropic packaging line, linX-A, was produced at our laboratory (LY.
X, D. B. And G. H. , Unpublished). HMECs were cultured in complete MEGM (Clonetics). Fibroblasts and LinX-A cells were transformed with 10% fetal bovine serum (
(FBS; Sigma) in DMEM (GIBCO). BT549, HBL
100 and T47D were held as indicated by the supplier. LinX-A
Cells were transfected by a calcium phosphate precipitation reaction with a mixture containing 15 μg of the retroviral plasmid and 15 μg of sonicated salmon sperm DNA. The transfected cells were incubated at 37 ° C. for 24 hours and then shifted to 30 ° C. for virus production. After 48 hours, the virus was collected and the virus-containing medium was filtered to remove the packaging cells (0.45 μm filter; Mill
ipore). Target cells were infected with virus supernatant supplemented with 4 μg / ml polybrene (Sigma) by centrifugation at 1000 g for 1 hour and overnight incubation at 30 ° C. Infected cells are treated with the appropriate drug (hygro
mycin, G418 or puromycin).

TRAP assay. The TRAP assay was performed ¹ substantially as described, with some modifications. Briefly, extracts were prepared in lysis buffer (10 mM Tris [pH 7.5], 1 mM MgCl ₂ , 1 mM EGTA, 10% glycerol) and centrifuged at 50,000 × g for 30 minutes. To make it transparent. Lysates corresponding to 10 to 10 ⁴ cells were used in this assay. Oligonucleotide TS (5 'AATCCGTCGA) was used in an extension reaction performed at 30 ° C for 1 hour.
GCAGAGTT3 ′). The extension product was amplified by polymerase chain reaction (PCR) in the presence of ³² P-dATP using TS in combination with a downstream anchor primer (5′GCGCGGCTAACCCTACACCTAACC3 ′).
Amplified by Five microliters from each reaction were analyzed on a 6% acrylamide / 8M urea gel.

Northern blotting. Total RNA was isolated from subconfluent media using Trizol reagent (GIBCO BRL). Ten micrograms of total RNA were analyzed by electrophoresis and transferred to Hybond-N ⁺ membranes according to the manufacturer's instructions. hEST2 was visualized after hybridization with a labeled StuI fragment of hEST2 as described ²⁰ .

Western blotting. ³⁰ was carried out as essentially described Western blotting. Cells were washed with cold PBS and lysed in Laemmli loading buffer. The lysate was heated at 95 ° C. for 10 minutes. Samples were separated on an 8% SDS-PAGE gel and transferred to a nitrocellulose membrane (Schleicher & Schuell). Blots were incubated with either the c-myc rabbit polyclonal antibody (N-262; Santa Crutz) or the TFIIB rabbit polyclonal antibody (a gift from Dr. B. Tansey). Immune complexes were visualized by secondary incubation with 125 I-protein A (ICN).

TRF analysis. ²² accurately measured as described the telomere restriction fragment length previously.

All the documents and publications mentioned above are cited here.

Equivalents The skilled artisan will recognize, or will be able to ascertain using routine experimentation, many equivalents for the particular polypeptides, nucleic acids, methods, assays and reagents described herein. Such equivalents are considered to be within the scope of the present invention.

[Sequence list]

[Brief description of the drawings]

BRIEF DESCRIPTION OF THE FIGURES FIG. 1: Yeast Est2p and Euplotes p of the predicted amino acid sequence of HEST2.
Diagram showing matching with 123 homologs

FIG. 2 shows the alignment of the RT motifs 1-6 of the telomerase subunits HEST2, p123 and Est2p with the a2-Sc and a1-Sc of Saccharomyces cerevisiae group II intron-encoded RT.

FIG. 3 shows myc activation of telomerase in HMEC cells.

FIG. 4 shows myc activation of telomerase in IMR90 fibroblasts.

FIG. 5 shows c-myc protein levels in HMEC.

FIG. 6 shows the extension of telomere length and cell lifespan by telomerase activation.

FIG. 7. By empty vector, either c-Myc or hEST2 retrovirus
Diagram showing HMEC cells transduced at passage 12

FIG. 8 shows a MarxII vector containing the coding sequence for hEST2.

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat ゛ (Reference) A61K 38/00 A61K 48/00 45/00 A61P 17/02 48/00 29/00 A61P 17/02 43 / 00 107 29/00 111 43/00 107 C12N 5/00 E 111 A61K 37/02 C12N 15/09 C12N 15/00 A (31) Priority claim number 09 / 063,657 (32) Priority date 1998 1998 (21 April 1998) (33 April 1998) (33) Countries claiming priority US (US) (81) Designated States EP (AT, BE, CH, CY, DE, DK, ES, FI, FR, GB, GR, IE, IT, LU, MC, NL, PT, SE), OA (BF, BJ, CF, CG, CI, CM, GA, GN, GW, ML, MR, NE, SN, TD, TG), AP (GH, GM, E, LS, MW, SD, SZ, UG, ZW), EA (AM, AZ, BY, KG, KZ, MD, RU, TJ, TM), AL, AM, AT, AU, AZ, BA, BB, BG, BR, BY, CA, CH, CN, CU, CZ, DE, DK, EE, ES, FI, GB, GD, GE, GH, GM, HR, HU, ID, IL, IN, IS, JP , KE, KG, KP, KR, KZ, LC, LK, LR, LS, LT, LU, LV, MD, MG, MK, MN, MW, MX, NO, NZ, PL, PT, RO, RU, SD, SE, SG, SI, SK, SL, TJ, TM, TR, TT, UA, UG, US, UZ, VN, YU, ZW (72) Inventor One, Gin 11743 Huntington Lasco Street, New York United States 19 Ray (72) Inventor Beach, David Position United States, New York 11743 Huntington sound bay Dora Eve 10

Claims (53)

[Claims] 1. A method for increasing the proliferation capacity of a cell, comprising contacting the cell with a telomerase-activating therapeutic agent. 2. A method for increasing the number of mitosis that a cell can experience, comprising:
The cells are treated with (i) an expression construct encoding an EST2 polypeptide or other telomerase activator protein, (ii) a reagent that increases or activates expression of the endogenous EST2 gene, (iii) cell penetration. Selected from the group consisting of: a telomerase activator polypeptide formulated for uptake, (iv) a reagent that inhibits inactivation of endogenous EST2 protein or myc protein, and (v) a reagent that derepresses myc Contacting with a reagent that increases the level of the telomerase catalytic subunit in the cell. 3. The method of claim 2, wherein said EST2 polypeptide is equal to or homologous to SEQ ID NO: 2. 4. The method of claim 2, wherein said EST2 polypeptide is encoded by a nucleic acid that hybridizes to SEQ ID NO: 1 under stringent conditions. 5. The expression construct is a vector, comprising: (i) one or more transposable elements incorporating the vector into chromosomal DNA of a eukaryotic host cell; (ii) a coding sequence for a telomerase activator; 3. The method according to claim 2, wherein the vector comprises (iii) a excision element that inactivates expression of the coding sequence upon contact with an excision agent. 6. The method according to claim 5, wherein the vector is a retrovirus vector or a lentivirus vector. 7. The method according to claim 5, wherein the excision element is a recombinase recognition site. 8. The recombinase recognition site is present in the transposable element such that upon contact of the cell with the excision agent, all or substantially all of the vector is excised from the chromosome of the cell. The method of claim 7, wherein 9. The method according to claim 8, wherein the reagent encodes the telomerase activator.
3. The method according to claim 2, which is an A molecule. 10. The method according to claim 1, wherein the reagent inhibits inactivation of an endogenous EST2 protein or myc protein by inhibiting post-translational modification of the protein and / or inhibiting proteolysis of the protein. The method according to claim 2, wherein 11. The method of claim 10, wherein said reagent inhibits ubiquitin-mediated degradation of myc. 12. The method of claim 2, wherein said reagent inhibits mad-dependent antagonism of myc. 13. The method according to claim 2, wherein the reagent is a small organic molecule. 14. The method according to claim 2, wherein said cells are stem cells or progenitor cells. 15. The method of claim 14, wherein said cells are selected from the group consisting of neural cells, hematopoietic cells, pancreatic cells, and hepatic stem cells and hepatic progenitor cells. 16. The method according to claim 2, wherein said cells are epithelial cells. 17. The method according to claim 2, wherein said cells are mesenchymal cells. 18. The method according to claim 2, wherein said cells are chondrocytes or bone cells. 19. The method of any one of claims 1 to 18, wherein the cells are contacted with the reagent in a culture medium or ex vivo explant. 20. The method of claim 1, wherein said cells are contacted with said reagent in vivo. 21. The method according to claim 2, wherein said reagent is administered to a mammal.
0. The method of claim 0. 22. The method of claim 21, wherein said mammal is a human. 23. The method of claim 20, wherein said reagent is administered as a pharmaceutical preparation. 24. The method of claim 20, wherein said reagent is administered as a cosmetic preparation. 25. A pharmaceutical preparation comprising a telomerase-activating therapeutic agent as an active ingredient, and a pharmaceutically acceptable excipient. 26. A telomerase-activating therapeutic agent as an active ingredient in an amount suitable for promoting the proliferation of cells of the cortical layer when applied topically, and a pharmaceutically acceptable excipient for topical application A cosmetic preparation comprising an agent. 27. The preparation according to claim 25, wherein the therapeutic agent for telomerase activation is a nucleic acid encoding a telomerase activating peptide. 28. The preparation of claim 27, wherein said telomerase activating polypeptide comprises an EST2 amino acid sequence, a myc amino acid sequence or an E6 amino acid sequence. 29. The nucleic acid as a vector, comprising: (i) one or more transposable elements that integrate the vector into chromosomal DNA of a eukaryotic host cell; (ii) a telomerase activator coding sequence; and (iii) 28. A preparation according to claim 27, characterized in that it is a vector comprising: a excision element which inactivates the expression of the coding sequence upon contact with an excision agent. 30. The preparation according to claim 29, wherein the vector is a retrovirus vector or a lentivirus vector. 31. The preparation according to claim 29, wherein the excision element is a recombinase recognition site. 32. The recombinase recognition site is present in the translocation element such that upon contact of the cell with the excision agent, all or substantially all of the vector is excised from the chromosome of the cell. 32. The preparation according to claim 31, wherein the preparation comprises: 33. The preparation according to claim 25, wherein the telomerase-activating therapeutic agent is an RNA molecule encoding the telomerase-activating substance. 34. The telomerase-activating therapeutic agent inhibits endogenous EST2 or myc protein inactivation by inhibiting post-translational modification of the protein and / or inhibiting proteolysis of the protein. A preparation according to claim 25 or claim 26, characterized in that: 35. The preparation of claim 34, wherein said therapeutic agent inhibits ubiquitin-mediated degradation of myc. 36. The preparation according to claim 25, wherein the therapeutic agent suppresses mad-dependent antagonism. 37. The preparation according to claim 25, wherein the therapeutic agent is a small organic molecule. 38. A method of promoting wound healing, wherein the therapeutic agent activates telomerase, resulting in ectopic expression of a polypeptide comprising an EST2 amino acid sequence equal to or homologous to SEQ ID NO: 2 or a portion thereof. Contacting the wound site of the patient in an amount sufficient to induce cell proliferation. 39. The method of claim 38, wherein said wound site comprises epithelial tissue and said telomerase-activating therapeutic agent promotes the growth of said epithelial tissue. 40. The method of claim 38, wherein said wound results from surgery, burns, inflammation or irritation. 41. The method according to claim 38, wherein the therapeutic agent is applied prophylactically, such as in the form of a cosmetic preparation, for example, to improve the tissue regeneration process of the skin, hair and / or nails. the method of. 42. The method of claim 38, wherein said wound is a skin ulcer. 43. The method of claim 42, wherein the skin ulcer is the result of a venous disease (venous stasis tumor), overpressure (pressure ulcer) or an arterial ulcer. 44. A kit for co-administration, comprising (a) the preparation according to claim 25 or 26, and (b) a trophic factor. 45. A co-administration kit comprising (a) the preparation of claim 25 or 26, and (b) a stimulating factor. 46. A co-administration kit comprising (a) the preparation of claim 25 or 26, and (b) a stimulating factor. 47. A kit for co-administration comprising (a) the preparation of claim 25 or 26, and (b) a mitogen. 48. The mitogen, wherein the mitogen is lectin, insulin-like growth factor (
IGF), platelet-derived growth factor (PDGF), fibroblast growth factor (FGF),
49. The kit according to claim 47, which is a transforming growth factor (TGF). 49. The method of claim 2, wherein said reagent is administered with a second reagent that removes capping inhibition of EST2 rescue. 50. (a) the preparation of claim 25 or 26, and (b) EST
2. A kit for co-administration, comprising a second reagent for removing capping inhibition of rescue. 51. The second reagent inhibits the formation of an inhibitory protein complex with (a) an oligonucleotide that competes with terminal granules for binding of terminal granule binding protein, and (b) an oligonucleotide that competes with terminal granule sequences. A major negative mutant of the terminal bean binding protein,
51. The method according to claim 49, wherein the method is (c) an inhibitor of the expression of terminal granule binding protein, or the kit according to claim 50 or 50. 52. A method for ex vivo treatment comprising: (i) isolating a population of cells to be transplanted into a patient in a cell culture medium; Contacting said cells with an amount of a telomerase-activating therapeutic agent sufficient to increase the number of divisions, and (iii) transplanting said cells into said patient. 53. The method of claim 52, wherein said telomerase-activating therapeutic is removed or inactivated from said cells prior to transplanting said cells into said patient.