JP2001095588A - Gene of desaturase for omega-3 fatty acid of green alga and its use - Google Patents

Abstract

PROBLEM TO BE SOLVED: To obtain a gene of desaturase for an omega-3 fatty acid and the like usable for a technique artificially controlling an expression amount or an activity of the desaturase for the omega-3 fatty acid of a plant or the like by a gene manipulation technology or the like. SOLUTION: This invention provides a DNA or the like encoding a protein having an amino acid sequence displaying an amino acid identity of 70% and more to amino acid sequences shown by sequence numbers 1, 3, 6 or 9 and formability of an omega-3 unsaturated fatty acid by forming an unsaturated bond between the omega-3 position and the omega-4 position of an unsaturated fatty acid.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

[0001] The present invention relates to a ω3 fatty acid desaturase gene and the like which can be obtained from algae such as green algae.

[0002]

BACKGROUND OF THE INVENTION The physiological and nutritional properties of plant-derived lipids depend on the fatty acid composition. For example, linoleic acid, an unsaturated fatty acid, is an essential fatty acid in mammals including humans, and edible oils rich in linoleic acid have high nutritional value. Several enzymes are involved in the biosynthesis of plant lipids, one of which is ω3 fatty acid desaturase, which unsaturates ω3
A protein having an ability to generate an ω3 unsaturated fatty acid by forming an unsaturated bond between the 3 position and the ω4 position, for example, forming a double bond between carbon positions 15 and 16 of linoleic acid. Catalyze to produce α-linoleic acid.

[0003]

Therefore, in order to change the amount of ω3 unsaturated fatty acids such as α-linoleic acid in plants, the expression level and activity of ω3 fatty acid desaturase in plants are determined by genetic manipulation or the like. The development of technology for artificial control is eagerly desired. However, the types of ω3 fatty acid desaturase genes that can be used in such techniques are not necessarily sufficient.

[0004]

Under these circumstances, the present inventors have made intensive efforts and, as a result, have succeeded in isolating DNA encoding ω3 fatty acid desaturase from green algae, which led to the present invention. Was. That is, the present invention provides: 1) an amino acid sequence showing 70% or more amino acid identity to the amino acid sequence shown in SEQ ID NO: 1, 3, 6, or 9, and ω3 position and ω4 position of unsaturated fatty acid. DNA encoding a protein having the ability to form an unsaturated bond between the protein and the ω3 unsaturated fatty acid (hereinafter referred to as the DNA of the present invention); 2) SEQ ID NO: 1, 3, 6, or 9 Has an amino acid sequence showing 90% or more amino acid identity to the amino acid sequence, and has the ability to form an unsaturated bond between the ω3 and ω4 positions of unsaturated fatty acids to generate ω3 unsaturated fatty acids. A DNA encoding a protein, 3) a DNA derived from green algae, the DNA according to the above 1) or 2), 4) a 7th to 426th amino acid sequence of the amino acid sequence represented by SEQ ID NO: 1. An amino acid sequence consisting of amino acids, an amino acid sequence represented by SEQ ID NO: 3, an amino acid sequence represented by SEQ ID NO: 6, or an amino acid sequence represented by SEQ ID NO: 9; Encoding a protein capable of forming an unsaturated bond between the ω-position and the ω4 position to generate ω3-unsaturated fatty acids; 5) From the 21st to the 1280th nucleotides in the base sequence represented by SEQ ID NO: 2 SEQ ID NO: 4
A base sequence represented by SEQ ID NO: 5,
The nucleotide sequence represented by SEQ ID NO: 7, the nucleotide sequence represented by SEQ ID NO: 8, the nucleotide sequence represented by SEQ ID NO: 10, or
A DNA having any one of the nucleotide sequences of SEQ ID NO: 11, wherein ω3 position and ω4
DNA encoding a protein having the ability to form an unsaturated bond with the position to generate an ω3 unsaturated fatty acid; 6) a DNA having a partial nucleotide sequence of the DNA described in 1) to 5) above (hereinafter referred to as the present invention) 7) having a DNA encoding a protein capable of forming an unsaturated bond between the ω3 position and the ω4 position of the unsaturated fatty acid to produce ω3 unsaturated fatty acid, or a partial base sequence thereof; A method for detecting DNA, the method comprising: hybridizing a DNA-labeled probe according to any one of 1) to 6) with DNA to specifically bind the probe;
(Hereinafter referred to as the hybridization detection method of the present invention). 8) Ability to form an unsaturated bond between ω3 and ω4 positions of unsaturated fatty acids to generate ω3 unsaturated fatty acids 6. A method for detecting a DNA encoding a protein having the following sequence or a DNA having a partial nucleotide sequence thereof,
A method comprising a step of amplifying DNA by a polymerase chain reaction using NA as a primer and detecting the amplified DNA (hereinafter referred to as the PCR detection method of the present invention); 9) the ω3 position and the ω4 position of the unsaturated fatty acid; A method for obtaining a DNA encoding a protein having an ability to form an unsaturated bond between to generate ω3 unsaturated fatty acids, wherein the DNA is detected by the method described in the above item 7) or 8),
A method comprising a step of recovering the detected DNA; 10) encoding a protein capable of forming an unsaturated bond between the ω3 and ω4 positions of the unsaturated fatty acid to generate ω3 unsaturated fatty acid; ) DNA obtained by the method described in 11), 11) DNA exhibiting promoter activity in host cells
And 1), 2), 3), 4), 5), 6) or 1
DNA which is ligated to the DNA described in 0) (hereinafter referred to as the chimeric DNA of the present invention), 12) 1), 2), 3), 4), 5), 6), 1)
0) or a vector containing the DNA according to 11), 13) the above item 1), 2), 3), 4), 5), 6), 1
A transformant obtained by introducing the DNA according to 0) or 11) or the vector according to 12) into a host cell; 14) culturing the transformant according to 13), and ω3 and ω4 of unsaturated fatty acids; To form an unsaturated bond between
A method for producing a ω3 fatty acid desaturase, characterized by producing a protein having an ability to produce 3 unsaturated fatty acids; 15) the above items 1), 2), 3), 4), 5), 6), 1
Introducing the DNA according to 0) or 11) into a host cell,
A metabolic modification method for changing the content of ω3 unsaturated fatty acids in the host cell before and after the introduction of the DNA; 16) ω3 having an amino acid sequence consisting of the 7th to 426th amino acids in the amino acid sequence shown in SEQ ID NO: 1 Fatty acid desaturase, 17) has the ability to form an unsaturated bond between the ω3 and ω4 positions of unsaturated fatty acids to produce ω3 unsaturated fatty acids from an organism cultured at a temperature lower than the optimal growth temperature. RNA containing RNA corresponding to DNA encoding the protein
And using the extracted RNA as a template, 5 bases to 40 bases
A single-stranded cDNA is synthesized by performing a reverse transcription reaction using DNA consisting of bases as a primer,
DN encoding the protein using NA as a template
D encoding the protein by a polymerase chain reaction using DNA recognizing A as a primer
An object of the present invention is to provide a method for obtaining a ω3 fatty acid desaturase gene, which comprises the steps of amplifying NA, detecting amplified DNA, and recovering the detected DNA.

[0005]

BEST MODE FOR CARRYING OUT THE INVENTION Hereinafter, the present invention will be described in detail. The genetic engineering method described below is described, for example, in "Molecular Cloning: A Laboratory Manual 2nd
edition '' (1989), Cold Spring Harbor Laboratory Pr
ess, ISBN 0-87969-309-6, `` Current Protocols in Mo
lecular Biology "(1987), John Wiley & Sons, Inc. I
It can be carried out according to the usual method described in SBN 0-471-50338-X and the like.

In the present invention, “a protein having the ability to desaturate the ω3 position of unsaturated fatty acids to produce ω3 unsaturated fatty acids” refers to the third carbon and the fourth carbon from the methyl terminal side of unsaturated fatty acids. Carbon (for example, the 13th carbon and 14th carbon from the carbonyl group side in a fatty acyl chain having a carbon length of 16; the 15th carbon and 16th carbon from the carbonyl group side in a fatty acyl chain having a carbon length of 18; (In a fatty acyl chain having a carbon length of 20, it corresponds to the 17th carbon and 18th carbon from the carbonyl group side.)
A protein capable of producing ω3 unsaturated fatty acids by generating a double bond between
Sometimes referred to as fatty acid desaturase. Specifically, for example, it is a protein having the ability to catalyze the formation of a double bond between the 15th carbon and the 16th carbon from the carbonyl group side of linoleic acid to generate α-linolenic acid.

The DNA of the present invention "has an amino acid sequence showing 70% or more amino acid identity to the amino acid sequence represented by SEQ ID NO: 1, 3, 6, or 9; And a DNA encoding a protein capable of forming an unsaturated bond to produce ω3 unsaturated fatty acids, and more specifically, the amino acid represented by SEQ ID NO: 1, 3, 6, or 9. 9 for an array
Having an amino acid sequence showing 0% or more amino acid identity,
And a DNA encoding a protein capable of forming an unsaturated bond between the ω3 position and the ω4 position of the unsaturated fatty acid to generate a ω3 unsaturated fatty acid ”,“ 7th amino acid sequence of SEQ ID NO: 1 ” An amino acid sequence consisting of the amino acids from the 2nd to the 426th amino acid, an amino acid sequence represented by SEQ ID NO: 3, an amino acid sequence represented by SEQ ID NO: 6,
Alternatively, it has any of the amino acid sequences of the amino acid sequences represented by SEQ ID NO: 9, and has ω3 position and ω
DN encoding a protein capable of forming an unsaturated bond with position 4 and producing ω3 unsaturated fatty acids
A "," A nucleotide sequence consisting of the 21st to 1280th nucleotides of the nucleotide sequence represented by SEQ ID NO: 2, a nucleotide sequence represented by SEQ ID NO: 4, a nucleotide sequence represented by SEQ ID NO: 5, SEQ ID NO: 7 A DNA having any one of the base sequence represented by SEQ ID NO: 8, the base sequence represented by SEQ ID NO: 8, the base sequence represented by SEQ ID NO: 10, or the base sequence represented by SEQ ID NO: 11; Encoding a protein capable of forming an unsaturated bond between the ω3 and ω4 positions to produce ω3 unsaturated fatty acids
A "and the like. The DNA of the present invention has a GC content of about 60.
% Or more, and a nucleotide sequence encoding an amino acid sequence showing 70% or more amino acid identity with the amino acid sequence represented by SEQ ID NO: 1 in a region corresponding to a length of about 400 amino acid residues or more. It is preferred to have.

The DNA of the present invention includes, for example, algae such as green algae,
Specifically, Chlorella, Chlamydomonas, Ohigemawa
, Donariella, Senedesmus, etc.
it can. Here, green algae is a true algae belonging to Chlorophyceae.
Nuclear algae, for example, Chlorella, Chlamydomonas
Genus, bearded sunflower, chlorocockum, senedesm
Algae, such as the genus Solanum and the genus Genus, can be mentioned. Book
The method for obtaining the invention DNA is described below. For example, foundation
Chlorella spp. Preserved by the Research Institute of Innovative Technology for the Earth
Algae such as the MK201 strain can be used, for example, in a TAP medium (400 mg / l NH_FourCl, 1
00mg / l MgSO_Four・ 7H_TwoO, 50mg / lCaCl_Two・ 2H_TwoO, 108mg / l K_TwoHPO
_Four, 56mg / l KH_TwoPO_Four, 1ml acetic anhydride, 50mg / l Na_TwoEDTA, 22m
g / l ZnSO_Four・ 7H_TwoO, 11.4mg / l H_ThreeBO_Four, 5.06mg / l MnCl_Two・ 4H_Two
O, 4.99mg / l FeSO_Four・ 7H_TwoO, 1.61mg / l CoCl_Two・ 6H_TwoO, 1.57m
g / l CuSO_Four・ 5H_TwoO, 1.1mg / l (NH_Four)₆Mo₇O_{twenty four}・ 4H_TwoO, 16mg / l
KOH, 2.42 g / l Tris, pH 7.0), C medium (Ca (NO_Three)_Two・ 4H_TwoO
150mg / l, KNO_Three100mg / l, MgSO_Four・ 7H_TwoO 40mg / l, β-glyce
Sodium lophosphate 50mg, vitamin B ₁₂ 0.1 μg / l,
Otin 0.1μg / l, vitamin B₁ 10 μg / l, Tris aminomet
hane 500mg / l, PIV metals 3ml / l, pH7.5), MBM medium
(KNO_Three250mg / l, MgSO_Four・ 7H_TwoO 75mg / l, K_TwoHPO_Four 75mg / l,
KH_TwoPO_Four 175mg / l, NaCl 25mg / l, CaCl_Two・ 2H_TwoO 10mg / l, Fe
-solution 1ml / l, A5-solution 1ml / l, pH6.0)
After culturing, for example, centrifugation is performed to collect algal cells.
I do. Honjo et al., Plant Cell Physiolo
gy, 36, 85-93 (1995), etc.
Extract. For the extraction operation, use a commercially available RNA extraction kit.
Can be used. And from the obtained RNA extract
Collect the total RNA by ethanol precipitation. Collected
The total RNA can be used as is for the next cDNA synthesis operation.
And from the total RNA, "Molecular Cloning: A Labora
tory Manual 2nd edition '' (1989), Cold Spring Harbo
r Laboratory Press, ISBN 0-87969-309-6, `` Current
Protocols in Molecular Biology '' (1987), John Wiley
 & Sons, Inc. ISBN 0-471-50338-X
To obtain RNA having poly A and combine it with the next cDNA
It may be used for forming operation. For fractionation of RNA containing poly A
Can use a commercially available Oligo dT column. all
From RNA or RNA having poly A, `` Molecular Cloning:
A Laboratory Manual 2nd edition '' (1989), Cold Spri
ng Harbor Laboratory Press, ISBN 0-87969-309-6,
`` Current Protocols in Molecular Biology '' (1987),
John Wiley & Sons, Inc. ISBN 0-471-50338-X etc.
CDNA is synthesized according to the method described. The synthesis operation includes:
A commercially available cDNA synthesis kit can be used. next,
For example, Chlorella sp.MK201 strain obtained as described above
Using algae-derived cDNA as a template,
Polymer using primer 1 and primer 2
Performing the ose chain reaction (hereinafter referred to as PCR)
From the DNA of the present invention, the amino acid represented by SEQ ID NO: 1
7th to 426th amino acids in the acid sequence
Having an amino acid sequence consisting of
Bond between ω4 and ω4 to form ω3 unsaturated fat
Encodes a protein capable of producing fatty acids
DNA ", more specifically," the base represented by SEQ ID NO: 2 "
Starting from the 21st to 1280th bases in the sequence
DNA having a base sequence of
Ω3 unsaturated by forming an unsaturated bond between 3rd and ω4
Encodes a protein capable of producing fatty acids
DNA ", and more specifically, represented by SEQ ID NO: 2.
Consists of the 1st to 2061st bases in the base sequence
DNA that has a base sequence can be obtained by amplification
You. Primers used for such PCR are
Accordingly, a design was made based on the base sequence represented by SEQ ID NO: 2.
Can be achieved. Such PCR is performed under the following conditions, for example.
Are repeated. First denaturation
As a step, for example, about 90 ° C to about 95 ° C, preferably
About 94 ° C. to about 95 ° C., for about 20 seconds to about 3 minutes, preferably
Is kept for about 30 seconds to about 2 minutes. Next,
For example, from about 40 ° C.
65 ° C, preferably 45 ° C to 60 ° C, about 1 minute to about 3 minutes
The incubation is performed for a period of time, preferably from about 1 minute to about 2 minutes.
Furthermore, as an extension step with DNA polymerase,
About 70 ° C to about 75 ° C, preferably about 72 ° C to about 73 ° C
About 1 minute to about 5 minutes, preferably about 2 minutes to about 3 minutes.
A minute of warming is performed. Amplification cycle consisting of these three steps
About 20 to about 50 times, preferably about 25 to about 40 times
Do. PCR is a two-step amplification system under the following conditions.
It can also be done with a kuru. First, as a denaturation step,
About 90 ° C to about 95 ° C, preferably about 94 ° C to about 95 ° C
At about 20 seconds to about 3 minutes, preferably about 30 seconds to about
Incubation is performed for 2 minutes. Next, primer annealing
In the step of elongation with DNA polymerase and DNA polymerase,
For example, from about 50 ° C to about 75 ° C, preferably from about 65 ° C to about
At 70 ° C. for about 1 minute to about 5 minutes, preferably about 2 minutes
The heat is kept for about 3 minutes. This two-step amplification
Cycles from about 20 to about 50, preferably from about 25
Do about 40 times.

(List 1) Primer for isolation of DNA of the present invention derived from MK201 strain Primer 1 TGCTTTGCGGTCAGGAAACGATGGCAGCAA 30mer Primer 2 GTGATAGTGCACAATTACAGGGGAGCGCTC 30mer

The DNA amplified as described above is called "Mol
ecular Cloning: A Laboratory Manual 2nd edition ''
(1989), Cold Spring Harbor Laboratory Press, `` Cur
rentProtocols In Molecular Biology '' (1987), John W
It can be cloned into a vector according to the method of gene cloning described in iley & Sons, Inc. ISBN0-471-50338-X. Specifically, for example, TA of Invitrogen
Cloning kit (registered trademark) or pBlu from Stratagene
It can be cloned using a plasmid vector such as escriptII (registered trademark). Confirmation of the nucleotide sequence of the cloned DNA was performed by F. Sanger, S. Nicklen, AR Co.
ulson, Proceedings of National Academy of Scienc
e USA. (1977), 74, 5463, pp. 5467, and the like. For preparation of a sample for nucleotide sequence confirmation, for example, commercially available PerkinElmer's ABI PRISM Dye Terminator Cycle
It is preferable to use Sequencing Ready Reaction Kit (registered trademark) or the like.

The DNA of the present invention can also be obtained by the following method. Using a cDNA derived from algae such as the obtained Chlorella sp.MK201 strain as a template, for example, using a primer having a nucleotide sequence represented by SEQ ID NO: 15 and a primer having a nucleotide sequence represented by SEQ ID NO: 17, for example, Perform PCR under the same conditions, DNA amplified by the PCR
Is separated by, for example, agarose gel electrophoresis and recovered, thereby obtaining a DNA of about 700 base pairs. Obtained DNA
Is cloned into a vector in the same manner as described above, and the nucleotide sequence of the cloned DNA is confirmed. Thus, for example, SEQ ID NO: 1 which is a partial base sequence of the DNA of the present invention
DNA consisting of the nucleotide sequence represented by 3 can be obtained. Based on the nucleotide sequence of the obtained DNA, 5 ′
For analysis of the base sequence upstream of the terminal, for example, a primer having the base sequence of SEQ ID NO: 20 or SEQ ID NO: 21; for analysis of the base sequence downstream of the 3 ′ end of the DNA, for example, A primer having a nucleotide sequence represented by SEQ ID NO: 18 or SEQ ID NO: 19 was synthesized, and using these primers, for example, Clonte
By performing the RACE method using a commercially available kit such as Marathon Kit (registered trademark) of Ch., a longer nucleotide sequence of the DNA of the present invention can be identified.

[0012] The protein encoded by the DNA of the present invention is:
The ability to form an unsaturated bond between the ω3 position and the ω4 position of the unsaturated fatty acid to generate a ω3 unsaturated fatty acid can be confirmed, for example, as follows.
DN containing open reading frame of DNA of the present invention
A is amplified by PCR to include a translation initiation codon,
The amplified DNA is cloned into a budding yeast expression vector such as pYES2 (registered trademark of Invitrotrogen). Then, budding yeast is transformed with this vector. For example, when pYES2 is used as a vector, a uracil-requiring strain such as budding yeast INVScI (registered trademark) may be used for transformation. The budding yeast transformed with the budding yeast expression vector containing the DNA of the present invention is, for example, SD-U medium (Yeast N) supplemented with 0.01-1% linoleic acid.
itrogen Base w / o Amino Acid 6.7g / L, casamino acid 5
g / L, glucose 20 g / L) for 6 to 72 hours. After culturing, α-linolenic acid is extracted from the budding yeast by, for example, extracting fatty acids according to the method described in Examples described below and analyzing the fatty acid components using an instrumental analysis method such as gas chromatography. The formation of acid can be confirmed. As described above, the protein encoded by the DNA of the present invention is expressed by “ω3 position and ω4
Having the ability to form an unsaturated bond with the octane group to produce ω3 unsaturated fatty acids.

The partial DNA of the present invention refers to a DNA having a partial nucleotide sequence of the DNA of the present invention. Specifically, for example, a DNA having a partial nucleotide sequence of the nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO: 1 And a DNA having a partial nucleotide sequence of the nucleotide sequence shown in SEQ ID NO: 2.
The partial DNA of the present invention as described above can be prepared, for example, by cleaving the DNA of the present invention using a restriction enzyme and collecting the obtained DNA, and performing PCR using the DNA of the present invention as a template. It can also be prepared by amplifying a DNA corresponding to a part of the DNA of the present invention. Furthermore, it can be directly isolated from algae such as green algae, or can be chemically synthesized. These partial DNAs of the present invention are useful as probes in hybridization and primers in PCR. Primers in PCR should have a large number of bases in order to ensure the specificity of annealing.The primers themselves can easily adopt higher-order structures, which may result in poor annealing efficiency. It is better not to have too many bases from the point that a complicated operation is required, and a single-stranded DNA consisting of 15 to 50 bases is preferable.

By labeling the DNA of the present invention or the partial DNA of the present invention and using it as a probe in hybridization, the DNA is hybridized with the DNA and the DNA to which the probe specifically binds is detected, whereby various gene libraries can be detected. From the rally, ω3 and ω4 of unsaturated fatty acids
DNA encoding a protein having the ability to form an unsaturated bond with the position to produce ω3 unsaturated fatty acids, specifically, for example, acts on linoleic acid to cause a reaction between the carbon at position 15 and the carbon at position 16 thereof. It is possible to detect a DNA encoding a protein capable of generating α-linolenic acid by catalyzing the double bond formation of DNA, or a DNA having a partial base sequence thereof. Examples of the DNA to be hybridized with the probe include, for example, genomes derived from algae such as green algae.
A DNA library, a cDNA library, or the like can be used. Also, `` Molecular Cloning: A Laboratory
Manual 2nd edition '' (1989), Cold Spring Harbor Lab
oratory Press and `` Current Protocols In Molecular Bi
ology '' (1987), John Wiley & Sons, Inc. ISBN 0-471-5033
Various DNA libraries prepared according to the library preparation method described in 8-X and the like can also be used. Examples of the hybridization method include a plaque hybridization method and a colony hybridization method, and the method may be selected according to the type of the vector used for preparing the DNA library. Specifically, when the DNA library to be used is constructed by a phage vector, first, an appropriate host microorganism and phage are mixed under conditions capable of infecting, and then mixed with a soft agar medium, and then mixed on an agar medium. Sprinkle. Thereafter, the cells are cultured at 37 ° C. until plaques of an appropriate size appear. When the DNA library to be used is constructed by a plasmid vector, first, an appropriate host microorganism is transformed to obtain a transformant. The obtained transformant is appropriately diluted, plated on an agar medium, and grown until an appropriately sized colony appears.
Culture at ℃. After culturing any of the DNA libraries, a membrane filter is placed on the surface of the agar medium used for the culturing, and phages and transformants are transferred to the membrane. The membrane is denatured with an alkali and then neutralized. For example, in the case of a nylon membrane, the membrane is irradiated with ultraviolet rays to fix the DNA to the membrane. Next, regarding this membrane, for example, “DNA cloning, a” edited by DM Glover
practical approach. "IRL PRESS (1985) ISBN 0-94
A hybridization method is performed using the DNA of the present invention or the partial DNA of the present invention labeled by the method described in 7946-18-7 or the like as a probe. There are many types of reagents and temperature conditions used for such a hybridization method.For example, pre-hybridization is performed using 6 × SSC
(0.9M NaCl, 0.09M citric acid), 0.1% -1% SDS, 100 μg / ml
A solution consisting of denatured salmon testis DNA is added to the above membrane and incubated at 65 ° C. for 1 hour. Next, the labeled partial DNA of the present invention is added as a probe to the above solution, mixed, and incubated at 42 ° C. to 68 ° C. for 4 hours to 16 hours to perform hybridization. Then remove the membrane, wash it with 2xSSC, 0.1% -1% SDS,
After further rinsing with 0.2 × SSC, 0% -0.1% SDS, the membrane is dried. The membrane is analyzed by, for example, autoradiography, and the position of the labeled probe on the membrane is detected, thereby detecting the position of the DNA having a base sequence homologous to the probe used on the membrane. In this way, the desired DN on the membrane
A can be detected. In addition, by identifying the clone corresponding to the position on the membrane of the DNA thus detected on the original agar medium and picking this,
The clone having the DNA can be isolated, and the clone having the DNA can be purified by repeating the same detection operation. Also, commercially available GibcoB
RL's GENE TRAPPER cDNA Positive Selection System
A detection method such as a kit (registered trademark) can also be used. In this method, first, a biotinylated DNA of the present invention or a partial DNA of the present invention to be used as a probe is single-stranded.
After hybridization with the DNA library, streptavidin-bound magnet beads were added thereto and mixed, and the streptavidin-bound magnet beads were recovered from the mixture with a magnet, whereby the DNA of the present invention or the portion of the present invention used as a probe was obtained. DNA, biotin,
Further, DNA bound to the magnet beads via streptavidin, that is, single-stranded DNA having a base sequence homologous to the base sequence of the DNA used as the probe is recovered and detected. Thus, the target DNA can be detected. The recovered single-stranded DNA can be double-stranded by reacting a DNA polymerase with the oligonucleotide as a primer.

[0015] The hybridization detection method of the present invention may be used for analysis of genotypes and the like of algae such as green algae. Specifically, genomic DNA of algae such as green algae was prepared, for example, according to a conventional method using commercially available ISOGEN (registered trademark of Nippon Gene Co., Ltd.), cut with at least several types of restriction enzymes, and subjected to electrophoresis. And then electrophoresed D
The NA is blotted on the filter according to the usual method. For this filter, hybridization is carried out, for example, as described above using a probe prepared from the DNA of the present invention or the partial DNA of the present invention by an ordinary method, and DNA to which the probe hybridizes is detected.
The length of the detected DNA is compared for different genera, species or strains of a specific plant species, and the difference in length is used to analyze differences in the phenotypic traits associated with the expression of the omega-3 fatty acid desaturase gene between the genera, species or strain be able to. This method is, for example, supervised by Isao Shimamoto and Takuji Sasaki: "Plant PCR experiment protocol",
RFLP (Restriction Fragment Length Polymorph) described in Shujunsha, Tokyo (1995), ISBN 4-87962-144-7, pp. 90-94.
can be performed according to the ism) method.

The DNA is amplified by PCR using a DNA having a partial base sequence of the DNA of the present invention as a primer, and the amplified DNA is detected to obtain an unsaturated bond between the ω3 and ω4 positions of the unsaturated fatty acid. Encoding a protein capable of forming ω3 unsaturated fatty acids by forming
A, specifically, for example, by acting on linoleic acid,
It is possible to detect DNA encoding a protein that has the ability to catalyze the formation of a double bond between the carbon at position 16 and the carbon at position 16 to produce α-linolenic acid. Specifically, for example, an oligonucleotide having a partial base sequence having a length of 15 bases or more and 50 bases or less of the DNA of the present invention on the 3′-terminal side is chemically synthesized by an ordinary synthesis method. At this time, 1
Using a mixture of several bases to synthesize a residue at a specific position of a primer, depending on the codon variation that can encode one amino acid, and synthesizing a mixed primer in which the residue is a variation of several bases Can also. Further, for example, a base such as inosine that can be paired with a plurality of bases can be used instead of the mixture of several bases as described above. Specifically, for example,
An oligonucleotide having the nucleotide sequence represented by SEQ ID NO: 14, 15, 16, 17, 18, 19, 20 or 21 can be synthesized and used as a primer. Hereinafter, an oligonucleotide having the same nucleotide sequence as the coding strand of the DNA of the present invention composed of double-stranded DNA is referred to as a sense primer, and an oligonucleotide having a nucleotide sequence complementary to the coding strand is referred to as an antisense primer. A combination of a sense primer having a base sequence of the coding strand of the DNA of the present invention and an antisense primer having a base sequence complementary to a base sequence 3 ′ downstream of the base sequence of the DNA of the present invention having the sense primer. PCR is performed using various DNAs as templates.
Such PCR is performed, for example, by repeating a three-step amplification cycle under the following conditions. First, as a denaturation step, for example, about 90 ° C. to about 95 ° C., preferably about 94 ° C. to about 95 ° C.
For about 20 seconds to about 3 minutes, preferably about 30 seconds to about 2 minutes. Next, as a primer annealing step, for example, about 40 to 65 ° C., preferably
45 ° C to 60 ° C for about 1 minute to about 3 minutes, preferably about 1 minute
The heat is kept for about 2 minutes to 2 minutes. Further, as an extension step by DNA polymerase, for example, about 70 ° C. to about 75 ° C.
° C, preferably from about 72 ° C to about 73 ° C, from about 1 minute to about 5 ° C.
Incubation is carried out for a minute, preferably for about 2 to about 3 minutes. The amplification cycle consisting of these three steps is reduced from about 20 times to about
This is performed 50 times, preferably about 25 to about 40 times. PCR can also be performed in a two-step amplification cycle under the following conditions. First, as a denaturation step, for example, from about 90 ° C. to about 95
° C, preferably about 94 ° C to about 95 ° C, for about 20 seconds to about 3 ° C.
The incubation is carried out for a period of minutes, preferably from about 30 seconds to about 2 minutes. The steps of primer annealing and extension by DNA polymerase include, for example, about 50 ° C. to about 75 ° C., preferably about 65 ° C. to about 70 ° C., for about 1 minute to about 5 minutes, preferably about 2 minutes to about 3 minutes. A minute of warming is performed. About 20 to about 50, preferably about 25 to about 40, two-step amplification cycles are performed. Examples of the DNA used as a template include, for example, genomic DNA libraries and cDNA libraries derived from algae such as green algae.
Libraries can be used. Also, "Molecu
lar Cloning: A Laboratory Manual 2nd edition '' (198
9), Cold Spring Harbor Laboratory Press or `` Current
Protocols In Molecular Biology '' (1987), John Wiley
& Sons, Inc., Inc. ISBN0-471-50338-X, etc., and various DNA libraries prepared according to the library preparation method can also be used. In addition, genomic DNA or cDNA derived from various organisms, specifically, genomic cDNA or cDNA prepared from algae such as green algae can be used as a template. The amplified DNA can be detected by ordinary electrophoresis, and it is possible to confirm the identity of the target DNA by clarifying a restriction enzyme map of the DNA or determining the base sequence. it can. Specifically, for example, using a primer designed based on the amino acid sequence represented by SEQ ID NO: 1, Chlorella vulgaris IAM C-27 strain (stored in a state that can be distributed at the Institute for Molecular and Cellular Biology at the University of Tokyo) Genomic DNA or cDN
By performing the above-described PCR detection method of the present invention using A as a template, a partial DNA of the present invention having the nucleotide sequence of SEQ ID NO: 4 or a partial DNA of the present invention having the nucleotide sequence of SEQ ID NO: 5 is detected, respectively. can do.
Further, by performing the above-described PCR detection method of the present invention using a genomic DNA or a cDNA derived from Chlorella vulgaris strain UTEX259 (stored in a distributable state at Texas State University in the United States) as a template, The partial DNA of the present invention having the base sequence of SEQ ID NO: 7 or the partial DNA of the present invention having the base sequence of SEQ ID NO: 8 can be detected. Further, by performing the above-described PCR detection method of the present invention using a genomic DNA or cDNA from Chlorella solokiniana UTEX1230 strain (stored in a state distributable at Texas State University in the United States) as a template, each of SEQ ID NO: 10 Or the present invention having the base sequence of SEQ ID NO: 11 can be detected.

The PCR detection method of the present invention may be used for analyzing genes of algae such as green algae. Specifically, for example, PCR is performed as described above using genomic DNA prepared from algae of different genera, species or strains as a template to amplify the DNA. The amplified DNA is mixed with a formaldehyde solution, heat-denatured at 85 ° C. for 5 minutes, and then quenched on ice. This sample is subjected to electrophoresis using, for example, a 6% polyacrylamide gel (which may contain 10% glycerol). For this electrophoresis, commercially available SSCP (Singl
An electrophoresis apparatus for e-Strand Conformation Polymorphism) can be used. For example, electrophoresis is performed while maintaining the gel temperature at 5 ° C., 25 ° C., 37 ° C., or the like. DNA is detected from the electrophoresed gel by, for example, a silver staining method using a commercially available reagent. Detects mutations in the ω3 fatty acid desaturase gene from differences between genera, species or strains in the behavior of the detected DNA in electrophoresis, and expresses the expression associated with the expression of the ω3 fatty acid desaturase gene generated based on the mutation. Analyze differences in traits between genera, species or strains. This method is, for example, supervised by Isao Shimamoto and Takuji Sasaki: "Plant PCR Experiment Protocol", Shujunsha, Tokyo (1995), ISBN4-87962-14
It can be performed according to the SSCP method described on pages 4-7 and 141-146.

According to the hybridization detection method of the present invention or the PCR detection method of the present invention, ω3
Encoding a protein capable of forming an unsaturated bond between the ω4 and ω4 positions to produce ω3 unsaturated fatty acids
Of the present invention by recovering the detected DNA
You can also get NA. For example, by the hybridization detection method of the present invention as described above, a DNA library derived from algae such as green algae and a probe comprising the DNA of the present invention or the partial DNA of the present invention were hybridized, and the probe was specifically bound. The DNA is detected, and a DNA having a base sequence homologous to the base sequence of the DNA used as the probe is specified. Next, the clone having the specified DNA is purified, and the plasmid or phage DNA is isolated and purified from the purified clone. Thus, DNA encoding ω3 fatty acid desaturase or DNA encoding a part of ω3 fatty acid desaturase can be obtained. Further, when the obtained DNA is a DNA encoding a part of the ω3 fatty acid desaturase, the DNA library is further screened by the hybridization detection method of the present invention using the DNA as a probe to obtain a full-length DNA library. DNA encoding ω3 fatty acid desaturase can be obtained. Also,
For example, as described above, according to the PCR detection method of the present invention, PCR using a primer having the nucleotide sequence of the partial DNA of the present invention
The reaction is performed, the DNA is amplified using DNA derived from algae such as green algae as a template, and the amplified DNA is detected and recovered.
By clarifying a restriction enzyme map or determining the nucleotide sequence of the DNA, it is possible to confirm a DNA encoding the ω3 fatty acid desaturase or a DNA encoding a part of the ω3 fatty acid desaturase. it can. further,
Based on the base sequence of the obtained DNA, an antisense primer is synthesized for analysis of the base sequence upstream from the 5 ′ end of the DNA, and a sense primer is synthesized for analysis of the base sequence upstream of the 3 ′ end. By using these primers and performing a RACE method using a commercially available kit such as Marathon Kit (registered trademark) of Clontech, for example, a longer nucleotide sequence encoding ω3 fatty acid desaturase is revealed. be able to. A new primer is synthesized based on the base sequences at both ends of the base sequence thus identified, and a DNA encoding the full-length ω3 fatty acid desaturase is obtained by repeating the PCR detection method of the present invention. can do.

The chimeric DNA of the present invention can be prepared by ligating a DNA exhibiting promoter activity in a host cell to the DNA of the present invention or the partial DNA of the present invention using a conventional genetic engineering method. The DNA exhibiting a promoter activity in a host cell is a DNA capable of functioning as a promoter in a transformed host cell. For example, when the host cell is a cell derived from an algae such as green algae, for example, RuBisCO DNA is used. Green alga-derived promoters such as a subunit promoter, a petD gene promoter, a nitrate reductase gene promoter, and an α-tubulin gene promoter can be mentioned. When the host cell is a cell of Escherichia coli, for example, a promoter of the lactose operon of Escherichia coli, a promoter of the tryptophan operon of Escherichia coli, a synthetic promoter capable of functioning in Escherichia coli such as a tac promoter, and the like can be used. In the case of yeast cells, for example, yeast alcohol dehydrogenase gene (ADH)
When the host cell is a cell derived from an animal, examples thereof include an adenovirus major rate (Ad.ML) promoter, an early promoter of SV40, and a baculovirus promoter. When the host cell is a cell derived from a higher plant, for example, a constitutive promoter derived from T-DNA such as a nopaline synthase gene (NOS) promoter, an octopine synthase gene (OCS) promoter, a cauliflower mosaic virus ( (CaMV) derived plant virus-derived promoters such as 19S and 35S promoters, phenylalanine ammonia lyase (PAL) gene promoter, chalcone synthase (CHS) gene promoter, Pathogene
Examples include inducible promoters such as the promoter of the sis-related protein (PR) gene. In addition, a promoter specifically expressed in cells of a specific plant tissue, for example, a promoter of a soybean-derived seed storage protein glycinin gene (Japanese Patent Application Laid-Open No. 06-189777) and the like can also be mentioned.

A transformant can be obtained by introducing the DNA of the present invention, the partial DNA of the present invention or the chimeric DNA of the present invention into a host cell according to a conventional genetic engineering method. If necessary, the DNA may be introduced into a vector having an appropriate selection marker gene or the like, and then introduced, depending on the transformation method for introduction into the host cell. Examples of the vector to be used include a plasmid, a phage, a phagemid and the like which can be amplified in cells derived from Escherichia coli, yeast, algae, plants, animals and the like. Specifically, for example, a pUC-based plasmid [pUC118, pUC119
(Takara Shuzo), pSC101 plasmid, Ti-plasmid [pBI101, pBI121 (CLONTECH), etc.], Bluescript phagemid [pBluescript SK (+/-) (STRATAGEN
E13), M13 phage [mp10, mp11 (Amersham), etc.], λ phage [λgt10, gt11 (Amersham, etc.)], cosmids [SuperCosI (STRATAGENE), etc.] and the like. Further, a DNA having a terminator function may be linked to the chimeric DNA of the present invention. In this case, it is generally good to ligate the DNA so that the terminator is located downstream of the DNA encoding the ω3 fatty acid desaturase. The terminator used is not particularly limited as long as it is a DNA capable of functioning in the host cell to be transformed.For example, when the host cell is a cell derived from green algae, for example, RuBisCO large subunit terminator, petD gene Examples of the terminator include a terminator derived from green algae such as a terminator, a nitrate reductase gene terminator, and an α-tubulin gene terminator. Furthermore, when the host cell is a cell derived from a higher plant, for example,
TD such as nopaline synthase gene (NOS) terminator
Constitutive terminator derived from NA, garlic virus GV
1, terminators derived from plants such as GV2 terminators.

To prepare a transformant, the DNA of the present invention,
The partial DNA of the present invention, the chimeric DNA of the present invention, or a vector containing these DNAs is introduced into a host cell. For example, when the host cell is a cell derived from a green alga, for example, used when introduced into Chlamydomonas chloroplasts, Boynton JE (1989) Science, 240, 1534-1538, K
indle KL (1989) J. Cell Biol., 109, 2589-2601, Dawson H
N (1997) Current Microbiology, 35, 356-362 and the like. That is, cells of a green alga in the growth phase are collected, suspended in a TAP medium, and plated on a 1% agar TAP medium containing 50 mg / ml ampicillin and 0.1% glucose. Fine gold particles or fine tungsten particles having a diameter of 1 μm or less, which are previously coated with DNA to be introduced by a calcium chloride-spermidine method, are implanted into the cells using a particle gun device. After allowing the cells to stand on the above-mentioned medium overnight, transferring them to a 1% agar TAP medium containing 150 mg / ml spectinomycin, 50 mg / ml ampicillin, and 0.1 glucose, culturing the cells, and obtaining a transformant by forming colonies. Can be. When the host cell is a microorganism cell, the DNA of the present invention, the partial DNA of the present invention or the chimeric DNA of the present invention, or a vector containing these DNAs,
`` Molecular Cloning: A Laboratory Manual 2nd editio
n '' (1989), Cold Spring Harbor Laboratory Press and `` Current Protocols In Molecular Biology '' (1987),
John Wiley & Sons, Inc.ISBN0-471-50338-X etc. can be introduced into host cells by the method described, etc., cells transformed thereby, the antibiotic resistance contained in the introduced DNA, Selection can be based on the phenotype of the marker gene such as auxotrophy. When the host cell is a cell derived from a higher plant, the DNA of the present invention, the partial DNA of the present invention or the chimeric DNA of the present invention, or a vector containing these DNAs may be used in an Agrobacterium infection method (Japanese Patent Publication No. 2-58917). And JP-A-60-70080), an electroporation method for protoplasts (JP-A-60-25).
1887 and JP-A-5-68575), or by a particle gun method (JP-A-5-508316 and JP-A-63-258525), and the like. Selection can be performed based on the phenotype of a marker gene such as antibiotic resistance contained in the obtained DNA. From the cells transformed in this way,
For example, according to the method described in Uchimiya, `` Plant Gene Manipulation Manual (How to Make Transgenic Plants) '' 1990, Kodansha Scientific (ISBN4-06-153513-7), pages 27-55, etc. , A plant containing the transformed cells (hereinafter referred to as a transformed plant) can be obtained. Further, by obtaining seeds from the obtained transformant plant, the transformant plant can be propagated. In addition, progeny plants having the characteristics of the transformed plant can be produced by crossing the obtained transformed plant with the non-transformed plant.

The DNA of the present invention, the partial DNA of the present invention or the chimeric DNA of the present invention is introduced into a host cell, and ω3
The unsaturated fatty acid content can be changed before and after the introduction of the DNA. As such a method, for example, constructing a chimeric DNA of the present invention in which a DNA of the present invention and a promoter are linked in a direction in which a gene encoded by the DNA of the present invention is originally transcribed and translated and expressed as a protein, By introducing this into a host cell according to a conventional genetic engineering method, a method of modifying metabolism so as to increase the ω3 unsaturated fatty acid content of the host cell can be mentioned. For example, when the host cell is a cell derived from a green alga, the α-linolenic acid content of the transformed cell is higher than that of a normal green alga cell. Increase. Further, the DNA encoding the DNA of the present invention may be reversely transcribed / translated and expressed as a protein.
And the promoter are linked to construct the chimeric DNA of the present invention, and by introducing this into a host cell according to a conventional genetic engineering method, the metabolism is modified so as to reduce the ω3 unsaturated fatty acid content of the host cell. There is also a method to make it.
For example, when the host cell is a cell derived from a higher plant, the thus-transformed cell has a lower α-linolenic acid content than a cell derived from a normal higher plant. Edible oils produced from cells or transformed plants containing the cells are less likely to be oxidized and have a longer edible period.

In the present invention, an unsaturated bond between the ω3 position and the ω4 position of the unsaturated fatty acid is formed from an organism cultured at a temperature lower than the optimal growth temperature, for example, an organism cultured at 0 ° C. to 15 ° C. RNA containing RNA corresponding to a DNA encoding a protein having the ability to form and generate ω3 unsaturated fatty acids is extracted, and the extracted RNA is used as a template to extract RNA containing 5 to 4 RNAs.
A single-stranded cDNA is synthesized by performing a reverse transcription reaction using a DNA primer of 0 bases, and a DNA encoding the protein is obtained by PCR using the cDNA as a template and a DNA recognizing the DNA encoding the protein as a primer. And amplified DNA
The present invention also provides a method for obtaining a fatty acid desaturase gene, which comprises the steps of: here,
"Optimum growth temperature" means the temperature at which the amount or growth rate of an organism becomes 70% or more of its maximum value when the organism is cultured at a temperature in the range of 0C to 95C. As a detailed operation method, a method according to the method used in the above-described other invention can be used.

[0024]

The present invention will be described in more detail with reference to the following examples, but the present invention is not limited to the following examples. Example 1 (partial c from Chlorella sp. MK201 strain by RT-PCR
DNA isolation) Chlorella MK20 isolated by the National Institute of Advanced Industrial Science and Technology
1 share (stored by the Research Institute of Innovative Technology for the Earth)
Using a 100 ml flat flask, in TAP medium, initial cell volume 10 ^-3 ml PCV / ml, 200 μE / m ² / s, CO ₂ concentration 1% (aeration volume
0.5 vvm) at 25 ° C for 4 days. Four days after the culture, the culture temperature was lowered to 10 ° C., and the culture was further performed for 24 hours, and then the alga bodies were collected. Total RNA was extracted from the collected alga bodies using the RNA extraction kit ISOGEN (Nippon Gene®) according to the method described in the kit. First-Strand cDNA Synthesis Kit
Using (Pharmacia Biotech), single-stranded cDNA was synthesized from 2 μg of RNA by the method described in the kit using random primers. Next, using the synthesized cDNA as a template, a primer having the nucleotide sequence of SEQ ID NO: 15 and a primer having the nucleotide sequence of SEQ ID NO: 17, 94 ° C. for 30 seconds, then 48 ° C. for 30 seconds, and further 72 ° C. A PCR consisting of 40 cycles was carried out with the heat retention of 90 seconds as one cycle. The DNA amplified by the PCR was analyzed by agarose gel electrophoresis. As a result, about 700 base pairs of DNA were obtained. This DNA is used in a TA cloning kit (Invitrog
was cloned into the cloning vector pCRII (registered trademark of Invitrogen) using the method described in the kit and introduced into E. coli strain JM109. Plasmid DNA was prepared from the obtained clone using FlexPrep (Pharmacia Biotech). Using the plasmid DNA, ABI PRISM DyeTerminator Cyl
A sequence sample was prepared using the ce Sequencing Ready Reaction Kit (Perkin Elmer Japan registered trademark), and this was subjected to a sequencer Model 373 (Perkin Elmer Japan) to analyze the nucleotide sequence. The nucleotide sequence obtained as a result is shown in SEQ ID NO: 13. The cloned DNA had 662 base pairs, and had a base sequence represented by SEQ ID NO: 15 and a base sequence complementary to the base sequence represented by SEQ ID NO: 17 at both ends. A homology search by BLASTN (http://www.blast.genome.ad.jp/) based on the nucleotide sequence of the DNA revealed that the homology of the chloroplast ω3 fatty acid desaturase from wheat was The highest, amino acid identity was about 60%.

Example 2 (Induction of DNA Expression by Low Temperature) Chlorella sp. MK201 was cultured under the same culture conditions as in Example 1 for 25 minutes.
After culturing at 0 ° C, the culture temperature was shifted to 10 ° C. After the temperature shift, the alga bodies after further culturing for 0, 1, 3, 6, and 24 hours were sampled. From each, all RNs were obtained as in Example 1.
A is prepared, and the obtained total RNA is used as a template to perform a reverse transcription reaction using a random primer to obtain a single-stranded cD
NA was synthesized. Using the synthesized cDNA as a template, SEQ ID NO:
Using a primer having a base sequence represented by 14 and a primer having a base sequence represented by SEQ ID NO: 16,
PCR consisting of 40 cycles was carried out with one cycle of incubation at 94 ° C for 30 seconds and then at 48 ° C for 30 seconds and further at 72 ° C for 90 seconds. Subsequently, using a primer having the base sequence of SEQ ID NO: 18 and a primer having the base sequence of SEQ ID NO: 20, 94 ° C. for 30 seconds, then 55 ° C. for 30 seconds, and further 72 ° C.
PC consisting of 30 cycles with 90 seconds of heat retention as one cycle
R performed. If the DNA encoding the ω3 fatty acid desaturase is expressed in Chlorella sp. Strain MK201, about 320 base pairs of DNA are amplified in the second PCR. The PCR
Was amplified by agarose gel electrophoresis. As a result, almost no band was detected at the position of 320 base pairs 0 hour after the culture temperature was shifted to 10 ° C. One or three hours after the shift, a slight band was detected. The band is the darkest after 6 hours, 2
After 4 hours it became slightly thinner. As a result, the culture temperature was reduced to 1
It was found that the expression of the ω3 fatty acid desaturase gene was induced around 6 hours after the temperature was shifted to 0 ° C., and the amount of transcript accumulation increased.

Example 3 (5'-RAC of MK201 strain-derived gene)
E, 3'-RACE: Isolation of full-length cDNA) Based on the nucleotide sequence analyzed in Example 1, Clontech
Using the Marathon cDNA Amplification Kit (registered trademark), the nucleotide sequences of the 5'-end region and the 3'-end region of the cDNA were analyzed. Chlorella sp.MK201 strain prepared in Example 1 total RNA 2μg
Is used to synthesize a single-stranded DNA by the method described in the kit, and then to synthesize a double-stranded DNA by the method described in the kit,
Furthermore, adapter ligation was performed by the method described in the kit to obtain a double-stranded DNA with an adapter. Using the double-stranded DNA with the adapter as a template, 5'-RA
In CE, as an internal primer for 5'-RACE, SEQ ID NO: 20
A primer having a base sequence represented by
Using primers having a nucleotide sequence represented by 21, PCR conditions described in the kit (94 ° C. for 1 minute, then 94 ° C. for 30 seconds.
This is 5 cycles with 1 cycle of incubation at 72 ° C for 4 minutes.
The PCR reaction was carried out at 94 ° C for 30 seconds and then at 70 ° C for 4 minutes as one cycle, followed by 5 cycles, and at 94 ° C for 20 seconds and then at 68 ° C as one cycle, followed by 25 cycles. Did not happen at all. Therefore, the PCR conditions were changed to 94 ° C. for 1 minute, 94 ° C. for 30 seconds,
PCR was performed by changing the incubation at 8 ° C. for 4 minutes as one cycle to 40 cycles (PCR condition RACE2), and the PCR product was analyzed by agarose gel electrophoresis. As a result, a clear band was detected. These bands were cut out, cloned into pCRII by a method similar to that described in Example 1, and sequenced. Also, 3'-RAC
In E, a primer having the base sequence of SEQ ID NO: 18 and a primer having SEQ ID NO: 19 as an internal primer for 3′-RACE using the double-stranded DNA with the adapter as a template,
Using a primer having a nucleotide sequence represented by
PCR was performed under PCR condition RACE2, and the PCR product was analyzed by agarose gel electrophoresis. As a result, a clear band was detected. These bands were cut out, cloned into pCRII by a method similar to that described in Example 1, and sequenced. As a result, the base sequence represented by SEQ ID NO: 2 was finally clarified. The GC content of the nucleotide sequence represented by SEQ ID NO: 2 was 63%. SEQ ID NO: 2
Was cloned into a plasmid, and the plasmid was named pMKFAD7 (FIG. 1). E. coli JM10 transformed with pMKFAD7
Nine strains have accession number FERM BP-6557 (acceptance date:
It is stored as an international deposit under the Budapest Treaty at the Institute of Biotechnology and Industrial Technology of the Ministry of International Trade and Industry of Japan, November 2, 1998).

Example 4 (Amplification of cDNAs derived from various Chlorella) Chlorella sp.
1 share (stored by the Research Institute of Innovative Technology for the Environment),
Chlorella vulgaris IAM C-27 strain (stored at the University of Tokyo Institute for Molecular and Cellular Biology) and Chlorella vulgaris strain UTX259 (stored at Texas State University in the US) 25) and 25 each of Chlorella Sorokiniana UTX1230 (stored at Texas State University in the US)
After culturing at 0 ° C., the culture temperature was shifted to 10 ° C., and further cultivation was performed, and algal cells were sampled 0 and 24 hours after the temperature shift. PCR was performed on these samples by the method described in Example 2. As a result, a band was detected at a position of about 320 base pairs under any of the conditions.
At 24 hours after the shift, a darker band was obtained than at 0 hours. Subsequently, each amplified DNA was cloned and sequenced according to the method of Example 1. As a result, the nucleotide sequence of the DNA isolated from Chlorella sp.UK001 strain is from the 226th position in the DNA sequence encoding the ω3 fatty acid desaturase from Chlorella sp.MK201 strain shown in SEQ ID NO: 13. It completely matched the base sequence consisting of the 543rd base (315 base pairs). It was also found that 315 base pair DNA consisting of the nucleotide sequence of SEQ ID NO: 4 was isolated from Chlorella vulgaris IAM C-27 strain. From the Chlorella vulgaris UTEX259 strain,
315 base pair DNA consisting of the base sequence represented by SEQ ID NO: 7
Was found to be isolated. Chlorella vulgaris IA
DNA isolated from strain MC-27 and Chlorella vulgaris UTE
Although the nucleotide sequence at three positions was different from the DNA isolated from strain X259, the amino acid sequences were completely identical. on the other hand,
SEQ ID NO: 10 from the Chlorella solokiniana strain UTX1230
It was found that a 315 base pair DNA consisting of the nucleotide sequence represented by was isolated. Based on the base sequence obtained here,
A synthetic DNA primer was prepared and Clontec
Analysis using h's Marathon Kit revealed that the 5'-end and 3'-end of the DNA encoding ω3 fatty acid desaturase
Obtain the base sequence of the terminal region.

Example 5 (Amplification of Genomic DNA from Various Chlorella) Chlorella vulgaris IAM C-27 strain, Chlorella vulgaris strain UEX259, and Chlorella vulgaris UTX123
0 strains were each used in a 100 ml flat flask and in a TAP medium in an initial cell volume of 10 ⁻³ ml PCV / ml, 200 μE / m ² / s, CO ₂
The cells were cultured at a concentration of 1% (aeration rate of 0.5 vvm) at 25 ° C for 4 days. Collect the algal cells and DNA of ISOPLANT (Nippon Gene registered trademark)
Genomic DNA was prepared using an extraction kit. Using these genomic DNAs as templates, PCR was performed using a primer having the nucleotide sequence of SEQ ID NO: 18 and a primer having the nucleotide sequence of SEQ ID NO: 20.
As a result, from Chlorella vulgaris IAM C-27 strain, about 55
0 bp DNA, about 560 bp DNA from Chlorella vulgaris UTX259 strain, Chlorella solokiniana UTX1
About 650 base pairs of DNA were amplified from 230 strains. These D
Each of the NAs was cloned into a pCRII vector in the same manner as in Example 1 and sequenced. as a result,
When genomic DNA of Chlorella vulgaris IAM C-27 strain was used as a template, a DNA of 545 base pairs consisting of the nucleotide sequence represented by SEQ ID NO: 5
When 259 genomic DNAs were used as a template, it was found that 559 base pairs of DNA consisting of the nucleotide sequence represented by SEQ ID NO: 8 was amplified. From the comparison with the cDNA sequence,
A also contained one intron sequence. chlorella·
In the intron of the DNA derived from the Bulgaris UTEX259 strain, CA repetition was added six times to the intron end position of the DNA derived from the Chlorella vulgaris IAM C-27 strain. When the genomic DNA of Chlorella solokiniana UTEX1230 was used as a template, 651 base pair DNA consisting of the nucleotide sequence represented by SEQ ID NO: 11 was amplified. Comparison with the cDNA sequence showed that it contained two intron sequences. The position of the second intron coincided with the start position of each intron of the DNA derived from the Chlorella vulgaris IAM C-27 strain and the DNA derived from the UTEX259 strain.

Example 6 (Construction of Escherichia coli expression vector) ω3 fatty acid desaturase cDNA derived from Chlorella sp. Strain MK201
A vector for expressing E. coli in E. coli was constructed. Using pMKFAD7 obtained in Example 3 as a template, a primer having the nucleotide sequence of SEQ ID NO: 22 and a primer having the nucleotide sequence of SEQ ID NO: 23, Clontech
Using the Advantage-GC cDNA PCR Kit (registered trademark) of the company, the cycle was performed at 94 ° C. for 1 minute, then at 94 ° C. for 30 seconds, and further at 68 ° C. for 3 minutes as one cycle.
PCR was performed under the condition of keeping the temperature at 8 ° C. for 3 minutes, and the obtained reaction solution was analyzed by agarose gel electrophoresis. as a result,
A clear band was detected at about 1.1 kb. Cut out the gel in this band and use QIA Quick Gel Extraction K
DNA was extracted and purified from the gel using it (registered trademark of Qiagen) by the method described in the kit. Thereafter, the obtained DNA was digested with a restriction enzyme EcoRI (Takara Shuzo), and the DNA was digested.
Was ligated to the EcoRI site of Escherichia coli expression vector pKK223-3 (commercially available from Amersham Pharmacia) using DNA Ligation Kit ver2 (registered trademark) of Takara Shuzo Co., Ltd. by the method described in the kit. The DNA inserted into the plasmid thus obtained was pKK223-3
Was confirmed by nucleotide sequence analysis to be linked to the Tac promoter of
Named 03. In Escherichia coli, following the translation initiation amino acid Met, the amino acid (Gln) to amino acid 410 to amino acid (Gln) to amino acid 410 in the amino acid sequence represented by SEQ ID NO: 1
The amino acid sequence up to he) is designed to be translated.

Example 7 (Measurement of fatty acid desaturase activity) Escherichia coli transformed with pEM003 or pKK223-3 was
After culturing overnight at 37 ° C. in 1 ml of L medium (1% tryptone, 0.5% yeast extract, 1% sodium chloride) supplemented with μg / L ampicillin, the total amount of the culture was added to 100 μg / L ampicillin.
100 ml of L medium supplemented with 1 mM IPTG was inoculated and cultured at 25 ° C. overnight. The culture was centrifuged to collect the respective Escherichia coli, each of which was 50 mM MOPS-NaOH (pH 7.5), 10 mM
M magnesium chloride, 300mM mannitol, 10ng DNase
I, suspended in a solution containing 10,000U catalase. This suspension was subjected to ultrasonic crushing while cooling with ice, and the treated liquid was cooled to 1800.
The supernatant (E. coli homogenate) was collected by centrifugation at xg for 5 minutes. E. coli homogenate containing 500 ng-1 μg protein, 100 mM Tricine-KOH (pH 8.0), 10 mM magnesium chloride, 100 μg ferredoxin, 5 mM NADPH, 5000
0U catalase, 200mUFd-NaDP + oxidoreductase, 1mM
The solution containing linoleic acid (1 ml in total) was kept at 25 ° C. for 30 minutes. Subsequently, 10 ml of methanol saturated with hydrogen chloride was added to the solution, and the mixture was allowed to stand at 80 ° C. for 1 hour. The mixture was extracted three times with 10 ml of hexane. The hexane layer was collected and evaporated to dryness. Was dissolved. 1 μl of this was transferred to a capillary gas chromatograph system (H
P6890, manufactured by Hewlett-Packard Co.). At this time, the column conditions were changed to HP-INNOWax Polyethylene
Glycol, length 30m, inner diameter 250μm, film thickness 0.25μm, hold the temperature condition at 150 ° C for 1 minute, raise it to 225 ° C at 15 ° C per minute, hold at 225 ° C for 7 minutes, and use FID for the detector. Was used. As a result, in the homogenate of E. coli transformed with pEM003, a peak of α-linolenic acid was detected at a retention time of 10.1 minutes, whereas in E. coli transformed with pKK223-3, the peak was found at that position. No peak was detected.

Example 8 (Construction of plant expression vector) ω3 fatty acid desaturase cDNA derived from Chlorella sp. Strain MK201
Constructs a vector for expressing in a higher plant. First, pMKFAD7 obtained in Example 3 was cleaved with a restriction enzyme EcoRI, separated into a vector portion and an inserted gene portion by electrophoresis, the inserted gene portion was cut out, and plasmid p
BamHI of Bluescript II SK (+) (registered trademark of STRATAGENE)
Insert into the site. At this time, the XbaI of the multicloning site of pBluescript II SK (+) was present on the 5 ′ side of the inserted gene portion cut out from pMKFAD7, and pBluescrip was on the 3 ′ side.
A plasmid having a structure in which ClaI of the multicloning site of t II SK (+) is located is referred to as pMKFAD7F. Also, at this time, 5 ′ of the inserted gene portion cut out from pMKFAD7
A plasmid having a structure in which the ClaI of the pBluescript II SK (+) multicloning site is located on the side and the XbaI of the pBluescript II SK (+) multicloning site is located on the 3 ′ side is referred to as pMKFAD7R. Next, pMKFAD7F or pMKFAD
After each 7R is cleaved with the restriction enzyme ClaI, it is treated with T4 polymerase to make the ends blunt. Then cut with XbaI,
Separation into the vector part and the inserted gene part by electrophoresis, cutting out the inserted gene part, BioTechniques, 9, p.
The inserted gene portion is recovered by an adsorption method using a glass matrix according to the method described in 92-99 (1990) (hereinafter referred to as pM
The inserted gene portion from KFAD7F is referred to as cMKFAD7F, and the inserted gene portion from pMKFAD7R is referred to as cMKFAD7R. ). On the other hand, pBI121 (purchased from CLONTECH), which is a binary vector having a kanamycin resistance gene (NPTII) as a marker gene, is cut with a restriction enzyme SacI, and then treated with T4 polymerase to blunt-end. Thereafter, the fragment was cut with XbaI, separated into a vector portion and an inserted gene portion by electrophoresis, the vector portion was cut out, and BioTechniques, 9, p.92-99 (1
The vector portion is recovered by an adsorption method using a glass matrix according to the method described in 990). The vector portion of the binary vector pBI121 prepared above is ligated to cMKFAD7F or cMKFAD7R to construct plasmid p35S-MKFAD7F or plasmid p35S-MKFAD7R, respectively.

Example 9 (Introduction of p35S-MKFAD7F into mustard) The p35S-MKFAD7F obtained in Example 8 was electroporated into Agrobacterium tumefaciens strain LBA4404 (conditions: resistance 200 ohms, electric capacity 25 μF, voltage) 2.5k
V). The transformed Agrobacterium tumefaciens was transformed into an L medium containing 50 mg / l kanamycin (bacto-trypton 10 g, using the drug resistance to kanamycin conferred by the kanamycin resistance gene (NPTII) of the introduced plasmid. yeast extr
act 5g, NaCl 5g, water 1L (pH7.0)). Transformed Agrobacterium tumefaciens at 30 ° C. in L medium containing 20 mg / l kanamycin,
After overnight culture, the resulting bacterial solution is used for transformation of Brassica juncea by the method described below.
Linnmaier and Skoog (LS) medium (Physiol.
100-127 (1965)), 3% sucrose, 1% agar, aseptically seeding mustard seeds. One week later, the cotyledons and petiole of the germinated plant were cut off with a scalpel, and LS medium, 3% sucrose, 0.7% agar,
Transfer to 4.5 μM BA, 0.05 μM 2.4-D, 3.3 μM AgNO ₃ medium and pre-culture for 1 day. The precultured cotyledons and petiole are transferred to a 1000-fold dilution of the above Agrobacterium culture solution, and left for 5 minutes. The cotyledons and petiole are then transferred again to the same medium as in the preculture and cultured for 3 to 4 days. Cultured cotyledons and petiole were LS medium, 3% sucrose, 4.5 μM BA, 0.05
Transfer to a liquid medium of μM 2.4-D, 3.3 μM AgNO ₃ , 500 mg / l cefotaxim, and remove bacteria while shaking for 1 day. Eradicated cotyledons and petiole are LS medium, 3% sucrose, 0.7% agar, 4.5 μM B
A, 0.05 μM 2.4-D, 3.3 μM AgNO ₃ , 100 mg / l cefotaxi
Culture in a medium containing 20 mg / l kanamycin. 3 weeks to 4
After a week, the cotyledons and petiole were grown on LS medium, 3% sucrose, 0.7% aga
r, 4.5 μM BA, 0.05 μM 2.4-D, 100 mg / l cefotaxim, 20
Transfer to mg / l kanamycin medium. Every three to four weeks, the cells are subcultured to a new medium and the seedlings are regenerated. In the regenerated seedlings, the green color was maintained and the individuals with good growth were judged as kanamycin-resistant transformants,
This is subcultured in LS medium, 3% sucrose, 0.7% agar, 20 mg / l kanamycin, and cultured for 3 to 4 weeks. A genomic DNA is extracted from leaves of the transformant selected in the culture bottle using an ISOPLANT (Nippon Gene (registered trademark)) DNA extraction kit, and the plant of the gene is subjected to PCR using primers 1 and 2 described in List 1 above. Confirm insertion into the genome. PCR is performed using the Advantage KlenTaq cDNA Kit (Clontech
(Registered trademark) using PerkinElmer's Gene Amp P
Performed with CR Systems 2400 and DNA Thermal Cycler Model 480 (registered trademark of PerkinElmer). Reaction at 94 ° C
For 40 cycles, one cycle consists of keeping the temperature at 55 ° C for 1 minute and then at 72 ° C for 3 minutes for 5 seconds. This confirms the insertion of the ω3-fatty acid desaturase gene from Chlorella sp. MK201 into the mustard chromosome. Then, the rooted transformant of mustard was transferred to vermiculite and kept at 21 ° C to 22 ° C.
12 hours / 12 hours = Day / Night for 3-7 days, cover with clear plastic cups and acclimatize. The survived plants are transplanted into a pot appropriately containing culture soil, and after cultivation for 2 to 3 months, a next-generation self-fertilized seed is obtained.

Example 10 (Introduction of p35S-MKFAD7R into soybean) The recombinant E. coli clone containing the p35S-MKFAD7R plasmid obtained in Example 8 was transformed into an L medium (bacto-trypton 10g, yeast extract) containing 50 mg / l of kanamycin. 5g, NaCl 5g,
The cells are shake-cultured at 37 ° C. overnight in 2 ml of water (1 L (pH 7.0)) to prepare a preculture solution. Kanamycin 50m in 500ml triangular corben
Add 100 ml of L medium containing g / l, add 0.5 ml of preculture and add 37 ml.
Incubate with shaking at ℃ overnight. This culture solution is transferred to a 300 ml centrifugal bottle, and centrifuged at 8000 rpm for 10 minutes to collect the cells.
This is treated using a QIAGEN plasmid purification kit (registered trademark of QIAGEN) to purify plasmid DNA contained in the cells. On the other hand, from immature seeds of soybean variety "Fayette", Finer J. and Nagasawa A. (Plant Cell, Tissue a
nd Organ Culture, 15, 125-136, 1988) to induce and proliferate somatic embryo culture cells. Wet weight about 500mgF
The cultured somatic embryo cells corresponding to W are arranged in a single layer in the center of a 6 cm diameter agar plate and in a 20 mm diameter circumference. The plasmid p35S-MKFAD7R purified by the above method was added to the cultured somatic embryo cells using a gene gun (CMParticle G) of Morikawa et al.
un System, Rhebock shoko Co.), direct introduction method (Yang NS, edited by Christou P, Particle Bombardment Te
chnology for Gene Transfer, W.C. H. Freeman and Co.
Publishers, New York, pp. 52-59).
Introduce according to the method described in 91501. That is, plasmid p35S-MKFAD7F, tissue culture, 20, p.323-327 (199
4) Glucuronidase (GUS) / hygromycin resistance gene (HPT) co-expression vector pSUM-G for selection described in 4)
H: Mix with NotI. These mixed plasmids are transfected into the soybean somatic embryo using a particle gun (800 mg / coated gold particles 200 μg / shot, projectile stopper / sample distance 100 mm). After the introduction, MS modified growth liquid medium containing 25 to 50 mg / l of hygromycin (Sig
(Ma Co., Ltd.), and rotated at 25 ° C. for 16 hours under illumination to select transformed somatic embryos. About 3 months later, genomic DNA was extracted from the selected hygromycin-resistant soybean adventitious embryos that retained the proliferative ability in yellow-green using an ISOPLANT (Nippon Gene®) DNA extraction kit. Confirm the insertion of the gene into the plant genome by PCR using PCR No. 2. PCR Advantage
Using the KlenTaq cDNA Kit (registered trademark of Clontech), Gene Amp PCR Systems 2400 of PerkinElmer and DNA T
Performed with hermal Cycler Model 480 (trademark of PerkinElmer). The reaction is performed at 94 ° C. for 5 seconds, then at 40 ° C. for 1 minute at 55 ° C. and 3 minutes at 72 ° C. This allows the Chlorella sp.
Confirm insertion of the ω3-fatty acid desaturase gene from the strain. Regeneration of a plant individual from the obtained somatic embryo,
A transformant soybean using the ω3-fatty acid desaturase gene is obtained.

[0034]

According to the present invention, there is provided a ω3 fatty acid desaturase gene or the like which can be used for a technique for artificially controlling the expression level and activity of ω3 fatty acid desaturase in plants and the like by genetic manipulation and the like. It is possible to do.

(Sequence listing free text) SEQ ID NO: 14 Oligonucleotide primer designed to amplify a DNA fragment having a partial base sequence of ω3 fatty acid desaturase gene SEQ ID NO: 15 Part of ω3 fatty acid desaturase gene Oligonucleotide primer designed to amplify DNA fragment having base sequence SEQ ID NO: 16 Oligonucleotide primer designed to amplify DNA fragment having partial base sequence of ω3 fatty acid desaturase gene SEQ ID NO: 17 ω3 Oligonucleotide primer designed to amplify DNA fragment having partial nucleotide sequence of fatty acid desaturase gene SEQ ID NO: 18 Designed to amplify DNA fragment having partial nucleotide sequence of ω3 fatty acid desaturase gene Oligonucleotide ply SEQ ID NO: 19 Oligonucleotide primer designed to amplify DNA fragment having partial base sequence of ω3 fatty acid desaturase gene SEQ ID NO: 20 Amplify DNA fragment having partial base sequence of ω3 fatty acid desaturase gene SEQ ID NO: 21 Oligonucleotide primer designed to amplify a DNA fragment having a partial base sequence of ω3 fatty acid desaturase gene SEQ ID NO: 22 Part of ω3 fatty acid desaturase gene Oligonucleotide primer designed to amplify DNA fragment having base sequence SEQ ID NO: 23 Oligonucleotide primer designed to amplify DNA fragment having partial base sequence of ω3 fatty acid desaturase gene

[0036]

[Sequence List] SEQUENCE LISTING <110> Research Institute of Innovative Technology for the Earth <110> Sumitomo Chemical Company Limited <120> ω3 Fatty Acid Desaturase Genes <130> P150911 <150> JP 10/345585 <151> 1998-12- 04 <150> JP 11/215232 <151> 1999-07-29 <160> 23 <210> 1 <211> 426 <212> PRT <213> Chlorella sp.MK201 <400> 1 Leu Cys Gly Gln Glu Thr Met Ala Ala Thr Leu Lys Ala Thr Thr Met 1 5 10 15 Leu Gly Ala Ala Val Ser Gly Ala Arg Pro Ser Gly Leu Lys Ala Ala 20 25 30 Leu Pro Ile Arg Arg Arg Ala Gly Val Val Arg Val Ala Asn Ile Ala 35 40 45 Ala Pro Ala Glu Glu Leu Leu Gly Asn Gln Pro Gln Ser Thr Gln Pro 50 55 60 Arg Phe Glu Gly Gly Arg Lys Leu Ala Asn Pro Pro Pro Phe Thr Leu 65 70 75 80 Gln Asp Leu Arg Asn Ala Ile Pro Asn Glu Cys Phe Glu Lys Asp Thr 85 90 95 Phe Arg Ser Val Ala His Leu Ala Leu Asp Val Gly Val Val Ala Ala 100 105 110 Leu Ala Ile Ala Ala Tyr His Ile Asp Asn Pro Leu Val Trp Pro Leu 115 120 125 Tyr Trp Phe Ala Gln Gly Thr Met Phe Trp Ala Leu Phe Val Val Gly 130 135 1 40 His Asp Cys Gly His Gln Ser Phe Ser Asn Asp Lys Ala Leu Asn Asp 145 150 155 160 Phe Val Gly Asn Ile Val His Ser Ser Ile Met Val Pro Tyr His Gly 165 170 175 Trp Arg Ile Ser His Arg Thr His His Ala Asn His Gly Asn Val Glu 180 185 190 Thr Asp Glu Ser Trp Tyr Pro Thr Thr Lys Ser Asn Tyr Glu Lys Met 195 200 205 Asp Lys Trp Ser Lys Leu Gly Arg Leu Leu Phe Pro Phe Pro Leu Phe 210 215 220 Ala Tyr Pro Phe Tyr Leu Leu Asn Arg Ser Pro Gly Arg Glu Gly Ser 225 230 235 240 His Phe Asp Pro Lys Ser Pro Leu Phe Thr Glu Asn Glu Gly Pro Met 245 250 255 Ile Glu Thr Ser Asn Lys Phe Gln Cys Ala Trp Leu Gly Phe Leu Ala 260 265 270 Gly Cys Thr Val Ala Leu Gly Pro Leu Val Met Leu Asn Leu Tyr Val 275 280 285 Leu Pro Tyr Trp Val Phe Val Met Trp Leu Asp Leu Val Thr Leu Leu 290 295 300 His His His Gly Pro Ser Asp Pro Glu Glu Glu Met Pro Trp Phe Arg 305 310 315 320 Gly Glu Glu Trp Ser Tyr Phe Arg Gly Gly Leu Thr Thr Ile Asp Arg 325 330 335 Asp Tyr Gly Ile Phe Asn Lys Ile His His Asp Ile Gly Thr His Val 340 345 Three 50 Val His His Leu Phe Pro Gln Ile Pro His Tyr His Leu Glu Lys Ala 355 360 365 Thr Glu Ala Val Lys Pro Val Met Gly Glu Tyr Tyr Arg Glu Pro Glu 370 375 380 Pro Ser Pro Gly Trp Phe Pro Thr His Leu Ile Ala Pro Leu Val Arg 385 390 395 400 400 Ser Phe Gly Lys Asp His Tyr Val Glu Asp Glu Gly Asn Val Val Phe 405 410 415 Tyr Lys Lys Asp Asp Ser Leu Lys Leu Phe 420 425 426 <210> 2 <211> 2090 < 212> DNA <213> Chlorella sp.MK201 <220> <221> CDS <222> (3) ... (1280) <400> 2 tg ctt tgc ggt cag gaa acg atg gca gca acc ctg aag gcc acc acg 47 Leu Cys Gly Gln Glu Thr Met Ala Ala Thr Leu Lys Ala Thr Thr 1 5 10 15 atg ctt ggc gcc gcc gtc tcc ggc gcc cgc ccc tct ggc ctg aag gcg 95 Met Leu Gly Ala Ala Val Ser Gly Ala Arg Pro Ser Gly Leu Lys Ala 20 25 30 gcc ctg cca att cgt cgg cgc gcc gga gtg gtt cgg gtg gcc aac atc 143 Ala Leu Pro Ile Arg Arg Arg Ala Gly Val Val Arg Val Ala Asn Ile 35 40 45 gct gct ccc gct gag gag ctg ggc aac cag ccc cag tcc acc cag 191 Ala Ala Pro Ala Glu Glu Leu Leu Gly Asn Gln Pro Gln Se r Thr Gln 50 55 60 ccc cgt ttt gag ggc ggc cgc aag ctg gcc aac ccc cct ccc ttc acc 239 Pro Arg Phe Glu Gly Gly Arg Lys Leu Ala Asn Pro Pro Pro Phe Thr 65 70 75 ctg caa gac ctg cgc aac gcc atc ccc aac gag tgc ttc gag aag gac 287 Leu Gln Asp Leu Arg Asn Ala Ile Pro Asn Glu Cys Phe Glu Lys Asp 80 85 90 95 acc ttc cgc tcc gtg gcc cac ctg gcc ctg gat gtg ggc gtt gtg gcg Thr 335 Val Ala His Leu Ala Leu Asp Val Gly Val Val Ala 100 105 110 gcc ctg gcc atc gcc gcc tac cac att gac aac ccc ctg gtc tgg cct 383 Ala Leu Ala Ile Ala Ala Tyr His Ile Asp Asn Pro Leu Val Trp Pro 115 120 125 ctg tac tgg ttt gcc cag ggc acc atg ttc tgg gct ctg ttc gtg gtg 431 Leu Tyr Trp Phe Ala Gln Gly Thr Met Phe Trp Ala Leu Phe Val Val 130 135 140 ggc cac gac tgc ggc cac cag tcc gcc acc gcc ctg aac 479 Gly His Asp Cys Gly His Gln Ser Phe Ser Asn Asp Lys Ala Leu Asn 145 150 155 gac ttt gtg ggc aac atc gtg cac tcc tcc atc atg gtg ccc tat cac 527 Asp Phe Val Gly Asn Ile Val His Ser Ser Ile Met Val Pro Tyr His 160 165 170 175 gga tgg cgc atc agc cac cgc acc cac cac gcc aac cac ggc aac gtg 575 Gly Trp Arg Ile Ser His Arg Thr His His Ala Asn His Gly Asn Val 180 185 190 gag acc gac gag agc tgg tac ccc acc acc aag tcc aac tac gag aag 623 Glu Thr Asp Glu Ser Trp Tyr Pro Thr Thr Lys Ser Asn Tyr Glu Lys 195 200 205 atg gac aag tgg agc aag ctg ggc cgc ctg ctc ttc ccc ttc ccc ctg 671 Met Asp Lys Ser Lys Leu Gly Arg Leu Leu Phe Pro Phe Pro Leu 210 215 220 ttc gcc tac ccc ttc tac ctg ctc aac cgc tcc ccc ggc cgc gag ggc 719 Phe Ala Tyr Pro Phe Tyr Leu Leu Asn Arg Ser Pro Gly Arg Glu Gly 235 tcc cac ttt gac ccc aag tcc ccg ctg ttc acc gag aac gag ggc ccc 767 Ser His Phe Asp Pro Lys Ser Pro Leu Phe Thr Glu Asn Glu Gly Pro 240 245 250 255 atg atc gag acc tcc aac aag ttc cag tgc gcc tgg ctg ggc ttc ctg 815 Met Ile Glu Thr Ser Asn Lys Phe Gln Cys Ala Trp Leu Gly Phe Leu 260 265 270 gcg ggc tgc acc gtg gct ctg ggc ccc ctg gtc atg ctc aac ctc tac 863 Ala Gly Aly Gly Leu Val Met Leu Asn Leu Tyr 275 280 285 gtc ctg ccc tac tgg gtg ttt gtg atg tgg ctg gac ttg gtg acc cta 911 Val Leu Pro Tyr Trp Val Phe Val Met Trp Leu Asp Leu Val Thr Leu 290 295 300 ctg cac c ggc ccc agc gac ccc gag gag gag atg ccc tgg ttc 959 Leu His His Gly Pro Ser Asp Pro Glu Glu Glu Met Pro Trp Phe 305 310 315 cgc ggc gag gag tgg agc tac ttc cgc ggc ggc ctg acc acctgac Gly Glu Glu Trp Ser Tyr Phe Arg Gly Gly Leu Thr Thr Ile Asp 320 325 330 335 cgc gac tac ggc atc ttc aac aag atc cac cac gac atc ggc acc cac 1055 Arg Asp Tyr Gly Ile Phe Asn Lys Ile His His Asp Ile Gly Thr His 340 345 350 gtg gtg cac cac ctg ttc ccc cag atc ccc cac tac cac ctg gag aag 1103 Val Val His His Leu Phe Pro Gln Ile Pro His Tyr His Leu Glu Lys 355 360 365 gca acc gag gcg gtc aag ccg gtg atg ggc gag tac tac cgc gag ccg 1151 Ala Thr Glu Ala Val Lys Pro Val Met Gly Glu Tyr Tyr Arg Glu Pro 370 375 380 gag ccc tcc ccc ggc tgg ttc ccc acc cac ctg atc gcc ccc ctg gtg 1199 Glu Pro Ser Pro Gl y Trp Phe Pro Thr His Leu Ile Ala Pro Leu Val 385 390 395 cgc tcc ttt ggc aag gac cac tac gtg gag gac gag ggc aac gtg gtg 1247 Arg Ser Phe Gly Lys Asp His Tyr Val Glu Asp Glu Gly Asn Val Val 400 405 410 415 ttc tac aag aag gac gac agc ctg aag ctc ttc tga gctggcggcc gccgcc 1299 Phe Tyr Lys Lys Asp Asp Ser Leu Lys Leu Phe 420 425 ccctgtagcg tagcgtgccg gcgccttgtg actggctttc aacctcgaac tctcagcgtg 1359 tggcttcccc cgccggcagc ggcgcagcgt gccctcatct tcgggcccct cacatacctc 1419 ttctccggcg tgtcaggccc actgcatgag cacacgcaag gccgccctcg gagccaatgg 1479 cgaaccgctg ccggccgcca ggcgtgagct ggttgtcatt ggtgcccagt gcaccgtgcc 1539 gtcgatccct tttctagcgc agctgcctgt ttcatatgcc cgctgttccc ccccggccat 1599 tggtttcttt tttctaacaa tccgttccat ttcatcgcag ccgcccaacc tggcggtgca 1659 gcgtgcgttc gccgccacgc ggcgtggcgc ggcgccccct ttcaagggcg gccgcctgca 1719 gcactgccaa tctcgccatc tgcttgcact gtgcaatagc tcgcgcgaaa ttatttccgc 1779 cgtgctcaat cctgcgcctg cgcagcggcg cggcttgcgt ttagctgccc tgccgcgccc 1839 acacgcagcg ctcaagtgcc ctccgccgc c ctcctcctga ttgtgttggt gtgtctcccc 1899 tgctcccgcc attccctccc aagcgctaca attcttttcc accctgcaat caaacaaacg 1959 agccgctgcc acccctgacg cgtccaacaa tgtgtttgca aggccgttct gtgctgccac 2019 tcggatgtgg cagagcgctc ccctgtaatt gtgcactatc acaaaaaaaa aaaaaaaaaa 2079 aaaaaaaaaa a 2090 <210> 3 <211> 105 <212> PRT <213> Chlorella vulgaris C-27 < 400> 3 Arg Leu Leu Phe Pro Phe Pro Leu Phe Ala Tyr Pro Phe Tyr Leu Leu 1 5 10 15 Asn Arg Ser Pro Gly Lys Asn Gly Ser His Tyr Asp Pro Lys Ser Asp 20 25 30 Leu Phe Thr Ala Ser Glu Gly Pro Leu Val Glu Thr Ser Asn Lys Phe 35 40 45 Gln Cys Ala Trp Ile Gly Phe Leu Ala Gly Cys Thr Val Ala Leu Gly 50 55 60 Pro Leu Ala Met Leu Asn Leu Tyr Val Leu Pro Tyr Trp Val Phe Val 65 70 75 80 Val Trp Leu Asp Val Val Thr Tyr Leu His His His Gly Pro Ser Asp 85 90 95 Pro Glu Glu Glu Met Pro Trp Phe Arg 100 105 <210> 4 <211> 315 <212> DNA <213> Chlorella vulgaris C-27 <220> <221> CDS <222> (1) ... (315) <400> 4 cgc ctg ctc ttc ccc ttc ccc ctg ttc gcc tac ccc ttc tac ctg ctc 48 Arg Leu Le u Phe Pro Phe Pro Leu Phe Ala Tyr Pro Phe Tyr Leu Leu 1 5 10 15 aac cgc tct ccc ggc aag aac ggc tcc cac tac gat ccc aag aggc gac 96 Asn Arg Ser Pro Gly Lys Asn Gly Ser His Tyr Asp Pro Lys Ser Asp 20 25 30 ttg ttc acc gcc agc gag ggc cca ctg gtt gag acc agc aac aag ttc 144 Leu Phe Thr Ala Ser Glu Gly Pro Leu Val Glu Thr Ser Asn Lys Phe 35 40 45 cag tgc gcg tgg atc ggc ttc ctg gcc gg tgc acc gtg gcg ctg ggt 192 Gln Cys Ala Trp Ile Gly Phe Leu Ala Gly Cys Thr Val Ala Leu Gly 50 55 60 ccc ctg gcc atg ctc aac ctc tat gtg ctg cct tac tgg gtg ttt gtg 240 Pro Leu Ala Met Le Tyr Val Leu Pro Tyr Trp Val Phe Val 65 70 75 80 gtg tgg ctg gat gtg gtg acc tac ctg cac cac cac ggc ccc tct gac 288 Val Trp Leu Asp Val Val Thr Tyr Leu His His His Gly Pro Ser Asp 85 90 95 cca gag gag gag atg ccc tgg ttc cgc 315 Pro Glu Glu Glu Met Pro Trp Phe Arg 100 105 <210> 5 <211> 545 <212> DNA <213> Chlorella vulgaris C-27 <220> <221> intron <222> (227) ... (456) <400> 5 cgc ctg ctc ttc ccc ttc ccc ctg ttc gcc tac ccc ttc tac ctg ctc 48 Arg Leu Leu Phe Pro Phe Pro Leu Phe Ala Tyr Pro Phe Tyr Leu Leu 1 5 10 15 aac cgc tct ccc ggc aag aac ggc tcc cac tac gat ccc aag agc gac 96 Asn Arg Ser Pro Gly Lys Asn Gly Ser His Tyr Asp Pro Lys Ser Asp 20 25 30 ttg ttc acc gcc agc gag ggc cca ctg gtt gag acc agc aac aag ttc 144 Leu Phe Thr Ala Ser Glu Gly Pro Leu Val Glu Thr Ser Asn Lys Phe 35 40 45 cag tgc gcg tgg atc ggc ttc ctg gcc ggc tgc acc gtg gcg ctg ggt 192 Gln Cys Ala Trp Ile Gly Phe Leu Ala Gly Cys Thr Val Ala Leu Gly 50 55 60 ccc ctg gcc atg ctc aac ctc gt c gt c gt gt c gt c gt c gt c gt gt g Pro Leu Ala Met Leu Asn Leu Tyr Val Leu Pro 65 70 75 ggctcttggt cagcagggtg cctgcggcgg cagtacatgg cagctggcgg ctggtacaca 304 cagccgcagc aaagccactc tgaaccggct gtgctgatgc gcttgaggca agccaatttc 364 aaacctcaac atggctcaac tattcttagc atccctcgcc tcactcctgc gctgccctcg 424 ctccccgctc ctccttcctt cccccccccc ag ac tgg gtg ttt gtg gtg tgg 476 Tyr Trp Val Phe Val Val Trp 80 ctg gat gtg gtg acc tac ctg cac cac cac ggc c cc tct gac cca gag 524 Leu Asp Val Val Thr Tyr Leu His His His Gly Pro Ser Asp Pro Glu 85 90 95 gag gag atg ccc tgg ttc cgc 545 Glu Glu Met Pro Trp Phe Arg 100 105 <210> 6 <211> 105 <212> PRT <213> Chlorella vulgaris UTEX259 <400> 6 Arg Leu Leu Phe Pro Phe Pro Leu Phe Ala Tyr Pro Phe Tyr Leu Leu 1 5 10 15 Asn Arg Ser Pro Gly Lys Asn Gly Ser His Tyr Asp Pro Lys Ser Asp 20 25 30 Leu Phe Thr Ala Ser Glu Gly Pro Leu Val Glu Thr Ser Asn Lys Phe 35 40 45 Gln Cys Ala Trp Ile Gly Phe Leu Ala Gly Cys Thr Val Ala Leu Gly 50 55 60 Pro Leu Ala Met Leu Asn Leu Tyr Val Leu Pro Tyr Trp Val Phe Val 65 70 75 80 Val Trp Leu Asp Val Val Thr Tyr Leu His His His Gly Pro Ser Asp 85 90 95 Pro Glu Glu Glu Met Pro Trp Phe Arg 100 105 <210> 7 <211> 315 < 212> DNA <213> Chlorella vulgaris UTEX259 <220> <221> CDS <222> (1) ... (315) <400> 7 cgc ctg ctc ttc ccc ttc ccc ctg ttt gcc tat ccc ttc tac ctg ctc 48 Arg Leu Leu Phe Pro Phe Pro Leu Phe Ala Tyr Pro Phe Tyr Leu Leu 1 5 10 15 aac cgc tct ccc ggc aag aac ggg tcc cac tac gac ccc aag agc gac 96 Asn Arg Ser Pro Gly Lys Asn Gly Ser His Tyr Asp Pro Lys Ser Asp 20 25 30 ttg ttc acc gcc agc gag ggc cct ctg gtt gag acc agc aac aag ttc 144 Leu Phe Thr Ala Ser Glu Gly Pro Leu Val Glu Thr Ser Asn Lys Phe 35 40 45 cag tgc gcg tgg atc ggc ttc ctg gcc ggc tgc acc gtg gcg ctg ggg 192 Gln Cys Ala Trp Ile Gly Phe Leu Ala Gly Cys Thr Val Ala Leu Gly 50 55 60cc ctg gcc atg ctc aac ctc tat gtg ctg cct tac tgg gtg ttt gtg 240 Pro Leu Ala Met Leu Asn Leu Tyr Val Leu Pro Tyr Trp Val Phe Val 65 70 75 80 gtg tgg ctg gat gtg gtg acc tac ctg cac cac cac tct gac 288 Val Trp Leu Asp Val Val Thr Tyr Leu His His His Gly Pro Ser Asp 85 90 95 cca gag gag gag atg ccc tgg ttc cgc 315 Pro Glu Glu Glu Met Pro Trp Phe Arg 100 105 <210> 8 <211> 559 <212> DNA <213> Chlorella vulgaris UTEX259 <220> <221> intron <222> (227) ... (470) <400> 8 cgc ctg ctc ttc ccc ttc ccc ctg ttt gcc tat ccc ttc tac ctg ctc 48 Arg Leu Leu Phe Pro Phe Pro Leu Phe Ala Tyr Pro Phe Tyr Leu Leu 1 5 10 15 aac cgc tct ccc ggc aag aac ggg tcc cac tac gac ccc aag agc gac 96 Asn Arg Ser Pro Gly Lys Asn Gly Ser His Tyr Asp Pro Lys Ser Asp 20 25 30 ttg ttc acc gcc agc gag ggc cct ctg gtt gag acc agc aac aag ttc 144 Leu Phe Thr Ala Ser Glu Gly Pro Leu Val Glu Thr Ser Asn Lys Phe 35 40 45 cag tgc gcg tgg atc ggc ttc ctg gcc ggc tgc acc gtg gcg ctg ggg 192 Gln Cys Ala Trp Ile Gly Phe Leu Ala Cys Thr Val Ala Leu Gly 50 55 60 ccc ctg gcc atg ctc aac ctc tat gtg ctg cct t gtgagtttgg cgttgctg 244 Pro Leu Ala Met Leu Asn Leu Tyr Val Leu Pro 65 70 75 ggctcttggt cagcagggtg ctcgcggcgg cagtacacgg cagctggcgg ctggtacaca 304 cagccgcagc caagccgctc tgaagcggct gtgctgatgc gctggaggca agccaatttc 364 aaacctcaac atggctcaac tatttttagc atcccttgcc tcactcctgc gctgccctcg 424 ctccccgctc ctccttcctc cccccccccc cacacacaca caccac ac tgg gtg ttt 481 Tyr Trp Val Phe gtg gtg tgg ctg gat gtg gtg acc tac ctg cac cac cac ggc ccc tct 529 Val Val Trp Leu Asp Val Val Thr Tyr Leu His His His Gly Pro Ser 80 85 90 95 gac cca gag gag gag atg ccc tgg ttc cgc 559 Asp Pro Glu Glu Glu Met Pro Trp Phe Arg 100 105 <210> 9 <211> 105 <212> PRT <213> Chlorella sorokiniana UTEX1230 <400> 9 Arg Leu Leu Phe Pro Phe Pro Leu Phe Ala Tyr Pro Phe Tyr Leu Phe 1 5 10 15 Asn Arg Ser Pro Gly Lys Asp Gly Ser His Phe Asp Pro Asn Ser Pro 20 25 30 Leu Phe Thr Pro Gln Glu Gly Pro Met Ile Glu Thr Ser Asn Lys Phe 35 40 45 Gln Cys Ala Trp Ile Gly Phe Leu Ala Gly Cys Thr Val Ala Leu Gly 50 55 60 Pro Met Ala Met Leu Asn Leu Tyr Val Leu Pro Tyr Trp Met Phe Val 65 70 75 80 Val Trp Leu Asp Val Val Thr Tyr Leu His His His Gly Pro Ser Asp 85 90 95 Pro Glu Glu Glu Met Pro Trp Phe Arg 100 105 <210> 10 <211> 315 <212> DNA <213> Chlorella sorokiniana UTEX1230 <220> <221> CDS <222> (1) ... (315) <400> 10 cgc ctg ctc ttc ccc ttc ccc ctg ttt gcc tac ccc ttc tac ctc ttc 48 Arg Leu Leu Phe Pro Phe Pro Leu Phe Ala Tyr Pro Phe Tyr Leu Phe 1 5 10 15 aac cgc tcc ccc ggc aag gac ggc tcc cac ttc gac ccc aac tcc ccg 96 Asn Arg Ser Pro Gly Lys Asp Gly Ser His Ph e Asp Pro Asn Ser Pro 20 25 30 ctg ttc acg ccc cag gag ggc ccc atg att gag acc tcc aac aag ttc 144 Leu Phe Thr Pro Gln Glu Gly Pro Met Ile Glu Thr Ser Asn Lys Phe 35 40 45 cag tgc gcg tgg att ggc ttc ctg gcg ggc tgc acc gtg gcg ctg ggc 192 Gln Cys Ala Trp Ile Gly Phe Leu Ala Gly Cys Thr Val Ala Leu Gly 50 55 60 ccc atg gcc atg ctc aac ctg tac gtc ctg ccc tac tg atg gcc Ala Met Leu Asn Leu Tyr Val Leu Pro Tyr Trp Met Phe Val 65 70 75 80 gtg tgg ctg gac gtg gtg acc tac ctg cac cac cac ggc ccc agc gac 288 Val Trp Leu Asp Val Val Thr Tyr Leu His His His Gly Pro Ser Asp 85 90 95 ccc gag gag gag atg ccc tgg ttc cgc 315 Pro Glu Glu Glu Met Pro Trp Phe Arg 100 105 <210> 11 <211> 651 <212> DNA <213> Chlorella sorokiniana UTEX1230 <220> <221> intron <222> (109) ... (281) <220> <221> intron <222> (400) ... (562) <400> 11 cgc ctg ctc ttc ccc ttc ccc ctg ttt gcc tac ccc ttc tac ctc ttc 48 Arg Leu Leu Phe Pro Phe Pro Leu Phe Ala Tyr Pro Phe Tyr Leu Phe 1 5 10 15 aac cgc tcc ccc ggc aag gac ggc tcc cac ttc gac ccc aac tcc ccg 96 Asn Arg Ser Pro Gly Lys Asp Gly Ser His Phe Asp Pro Asn Ser Pro 20 25 30 ctg ttc acg ccc caggtgcgtg cgctgtgacg ggctgtgagg ggctggcgc ctgctcg ctgctg c ctgctg c ctgctg c ctgct gc gg caggatgctg 213 cccctgccat ccccagccac atgcgtgctg atcgtgggtg cgcctggacc tgcgcccgcc 273 gccccctg cag gag ggc ccc atg att gag acc tcc aac aag ttc cag tgc 323 Gln Gg Gly Gl Get Gc Gt Gc Gt Gc Gc Gc Gc Ggg tgc acc gtg gcg ctg ggc ccc atg 371 Ala Trp Ile Gly Phe Leu Ala Gly Cys Thr Val Ala Leu Gly Pro Met 55 60 65 gcc atg ctc aac ctg tac gtc ctg ccc t gtgagtgccg gtactgaggc Legt Alu Ala M Pro 70 75 tcgtgctgca tgttagctgc tgcgctggtc gcctagcggg tctcctgccg ttagcctgat 484 gcagattcga ggcagctgtc cataccttgc cgtccctcct tctcacccct gctgccactt 544 cctctccctg gt gt g atg gt gt g atg gt gt g atg gt gt g atg g cac cac cac ggc ccc agc gac ccc gag gag gag atg ccc 642 Thr Tyr Leu His His Gly Pro Ser Asp Pro Glu Glu Glu Met Pro 90 95 100 tgg ttc cgc 651 Trp Phe Arg 105 <210> 12 <211> 220 <212> PRT <213> Chlorella sp.MK201 <400> 12 Phe Val Leu Gly His Asn Cys Gly His Gln Ser Phe Ser Asn Asp Lys 1 5 10 15 Ala Leu Asn Asp Phe Val Gly Asn Ile Val His Ser Ser Ile Met Val 20 25 30 Pro Tyr His Gly Trp Arg Ile Ser His Arg Thr His His Ala Asn His 35 40 45 Gly Asn Val Glu Thr Asp Lys Ser Trp Tyr Pro Thr Thr Asn Ser Asn 50 55 60 Tyr Lys Lys Met Asp Lys Trp Ser Lys Leu Gly Arg Leu Leu Phe Pro 65 70 75 80 Phe Pro Leu Phe Ala Tyr Pro Phe Tyr Leu Leu Asn Arg Ser Pro Gly 85 90 95 Arg Glu Gly Ser His Phe Asp Pro Lys Ser Pro Leu Phe Thr Glu Asn 100 105 110 Lys Gly Pro Met Ile Glu Thr Ser Asn Lys Phe Gln Cys Ala Trp Leu 115 120 125 Gly Phe Leu Ala Gly Cys Thr Val Ala Leu Gly Pro Leu Val Met Leu 130 135 140 Asn Leu Tyr Val Leu Pro Tyr Trp Val Phe Val Met Trp Leu Asp Leu 145 150 155 160 Val Thr Tyr Leu Leu H is His His Gly Pro Ser Asp Pro Glu Glu Glu 165 170 175 Met Pro Trp Phe Arg Gly Glu Glu Trp Ser Tyr Phe Arg Gly Gly Leu 180 185 190 Thr Thr Ile Asp Arg Asp Tyr Gly Ile Phe Asn Lys Ile His His Asp 195 200 205 Ile Gly Thr His Val Ile His His Leu Phe Pro Gln 210 215 220 <210> 13 <211> 662 <212> DNA <213> Chlorella sp.MK201 <220> <221> CDS <222> (1). .. (660) <400> 13 ttc gtg ctc ggc cac aac tgt ggc cac cag tcc ttc tcc aac gac aag 48 Phe Val Leu Gly His Asn Cys Gly His Gln Ser Phe Ser Asn Asp Lys 1 5 10 15 gcc ctg aac gac ttt gtg ggc aac atc gtg cac tcc tcc atc atg gtg 96 Ala Leu Asn Asp Phe Val Gly Asn Ile Val His Ser Ser Ile Met Val 20 25 30 ccc tat cac gga tgg cgc atc agc cac cgc acc cac cac gcc aac cac 144 Pro Tyr His Gly Trp Arg Ile Ser His Arg Thr His His Ala Asn His 35 40 45 ggc aac gtg gag acc gac aag agc tgg tac ccc acc acc aat tcc aac 192 Gly Asn Val Glu Thr Asp Lys Ser Trp Tyr Pro Thr Thr Asn Ser Asn 50 55 60 tac aag aag atg gac aag tgg agc aag ctg ggc cgc ctg ctc ttc ccc 240 Tyr Lys Lys Met Asp Lys Trp Ser Lys Leu Gly Arg Leu Leu Phe Pro 65 70 75 80 ttc ccc ctg ttc gcc tac ccc ttc tac ctg ctc ac cgc tcc ccc ggc 288 Phe Pro Leu Phe Ala Tyr Pro Phe Tyr Leu Leu Asg Arg Pro Gly 85 90 95 cgc gag ggc tcc cac ttt gac ccc aag tcc ccg ctg ttc acc gag aac 336 Arg Glu Gly Ser His Phe Asp Pro Lys Ser Pro Leu Phe Thr Glu Asn 100 105 110 aag ggc ccc atg atc gag acc tcc aac aag ttc cag tgc gcc tgg ctg 384 Lys Gly Pro Met Ile Glu Thr Ser Asn Lys Phe Gln Cys Ala Trp Leu 115 120 125 ggc ttc ctg gcg ggc tgc acc gtg gct ctg ggc ccc ctg gtc atg cyc Aly Gly Thr Val Ala Leu Gly Pro Leu Val Met Leu 130 135 140 aac ctc tac gtc ctg ccc tac tgg gtg ttt gtg atg tgg ctg gac ttg 480 Asn Leu Tyr Val Leu Pro Tyr Trp Val Phe Val Met Trp Leu Asp Leu 145 150 155 160 gtg acc tac cta ctg cac cac cac ggc ccc agc gac ccc gag gag gag 528 Val Thr Tyr Leu Leu His His His Gly Pro Ser Asp Pro Glu Glu Glu 165 170 175 atg ccc tgg ttc cgc ggc gag gag tgg agc tac ttcc ggc ct g 576 Met Pro Trp Phe Arg Gly Glu Glu Trp Ser Tyr Phe Arg Gly Gly Leu 180 185 190 acc acc att gac cgc gac tac ggc atc ttc aac aag atc cac cac gac 624 Thr Thr Ile Asp Arg Asp Tyr Gly Ile Phe Asn Lys Ile His His Asp 195 200 205 atc ggc acc cac gtg atc cac cac ctg ttc ccg cag at 662 Ile Gly Thr His Val Ile His His Leu Phe Pro Gln 210 215 220 <210> 14 <211> 29 <212> DNA <213 > Artificial Sequence <220> <223> Designed oligonucleotide primer to amplify DNA fragment having partial sequence of ω3 fatty acid desaturase gene <400> 14 tgggcbctst tcgtsctsgg ycacgaytg 29 <210> 15 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> Designed oligonucleotide primer to amplify DNA fragment having partial sequence of ω3 fatty acid desaturase gene <400> 15 ttcgtsctsg gycacgaytg yggycacgg 29 <210> 16 <211> 30 <212> DNA <213> Artificial Sequence < 220> <223> Designed oligonucleotide primer to amplify DNA fragment having partial sequence of ω3 fatty acid desaturase gene <400> 16 gtagtgsggr atctgsgg ga asaggtggtg 30 <210> 17 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> Designed oligonucleotide primer to amplify DNA fragment having partial sequence of ω3 fatty acid desaturase gene <400> 17 atctgsggga asaggtggtg ratsacgtg 29 <210> 18 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Designed oligonucleotide primer to amplify DNA fragment having partial sequence of ω3 fatty acid desaturase gene <400> 18 cgcctgctct tccccttccc cctgtt 26 < 210> 19 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Designed oligonucleotide primer to amplify DNA fragment having partial sequence of ω3 fatty acid desaturase gene <400> 19 tttgacccca agtccccgct gttcac 26 <210> 20 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Designed oligonucleotide primer to amplify DNA fragment having partial sequence of ω3 fatty acid desaturase gene <400> 20 gcggaaccag ggcatctcct cctc 24 <210> 21 < 211> 25 <212> DNA <213> Artificial Sequence <220> <223> Designed oligonucleotide pri mer to amplify DNA fragment having partial sequence of ω3 fatty acid desaturase gene <400> 21 aggcgcactg gaacttgttg gaggt 25 <210> 22 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> Designed oligonucleotide primer to amplify DNA fragment having partial sequence of ω3 fatty acid desaturase gene <400> 22 gggaattcat gcagccccag tccacccagc ccgttttga 39 <210> 23 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> Designed oligonucleotide primer to amplify DNA fragment having partial sequence of ω3 fatty acid desaturase gene <400> 23 gggaattctc agaagagctt caggctgtcg tccttcttg 39

[Brief description of the drawings]

FIG. 1 a. FIG. 2 is a view showing the structure of a plasmid pMKFAD7 having a ω3 fatty acid desaturase gene derived from Chlorella sp. Strain MK201. MKFAD7 cDNA indicates an ω3 fatty acid desaturase gene, Ampicillin indicates an ampicillin resistance gene, Kanamycin indicates a kanamycin resistance gene, and ColE1 ori and F1 ori indicate replication origins capable of functioning in Escherichia coli. b. Chlorella MK possessed by plasmid pMKFAD7
It is a figure which shows the restriction map of the ω3 fatty acid desaturase gene derived from 201 strains.

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat ゛ (Reference) // (C12N 15/09 ZNA C12R 1:91) C12R 1:89) (C12N 9/88 (C12N 9 / 88 C12R 1:19) C12R 1:91) C12N 15/00 ZNAA (C12N 9/88 5/00 C C12R 1:19) C12R 1:89) (72) Inventor Jinichi Murakami 2 Nishishinbashi, Minato-ku, Tokyo 8th-11th, 7th Toyo Maritime Building 8F F-term in the Institute for Global Environmental Technology (Reference) 4B024 AA03 BA08 CA03 DA01 EA04 4B050 CC03 DD13 LL02 LL05 4B063 QA01 QA13 QA18 QQ42 QR08 QR32 QR55 QR62 QS25 QS34 QX01 4 AA84Y AA88X AB01 AC14 BA02 CA13 CA41

Claims (28)

[Claims] 1. An amino acid having an amino acid sequence showing 70% or more amino acid identity to the amino acid sequence represented by SEQ ID NO: 1, 3, 6, or 9, and ω3 and ω4 of unsaturated fatty acid.
DNA encoding a protein having an ability to form an unsaturated bond with a position to produce ω3 unsaturated fatty acids. 2. It has an amino acid sequence showing 90% or more amino acid identity to the amino acid sequence represented by SEQ ID NO: 1, 3, 6, or 9, and has ω3 and ω4 of unsaturated fatty acid.
DNA encoding a protein having an ability to form an unsaturated bond with a position to produce ω3 unsaturated fatty acids. 3. The DNA according to claim 1, which is a DNA derived from a green alga. 4. The DNA according to claim 3, wherein the green alga is a Chlorella green algae. 5. An amino acid sequence consisting of the 7th to 426th amino acids of the amino acid sequence represented by SEQ ID NO: 1, an amino acid sequence represented by SEQ ID NO: 3, an amino acid sequence represented by SEQ ID NO: 6, or Having any one of the amino acid sequences of SEQ ID NO: 9,
DNA encoding a protein capable of forming an unsaturated bond between the ω3 position and the ω4 position of the unsaturated fatty acid to generate ω3 unsaturated fatty acid. 6. The nucleotide sequence of SEQ ID NO: 2
A base sequence consisting of the first to 1280th bases, a base sequence represented by SEQ ID NO: 4, a base sequence represented by SEQ ID NO: 5, a base sequence represented by SEQ ID NO: 7, a base sequence represented by SEQ ID NO: 8, A base sequence represented by SEQ ID NO: 10,
Or a DNA having any one of the nucleotide sequences of SEQ ID NO: 11 and ω3
DNA encoding a protein capable of forming an unsaturated bond between the ω-position and the ω-position to generate ω3-unsaturated fatty acids. 7. A DNA having a partial nucleotide sequence of the DNA according to claim 1. 8. The DNA according to claim 7, which has 15 to 50 bases. 9. A method for detecting a DNA encoding a protein capable of forming an unsaturated bond between the ω3 and ω4 positions of an unsaturated fatty acid to generate ω3 unsaturated fatty acids, or a DNA having a partial base sequence thereof. And claim 1
The DNA was hybridized with the DNA-labeled probe and the DNA was specifically bound to the probe.
A method comprising the step of detecting DNA. 10. A DNA to be hybridized with a probe.
Is genomic DNA or cDNA derived from green algae. 11. A method for detecting a DNA encoding a protein having the ability to form an unsaturated bond between the ω3 and ω4 positions of unsaturated fatty acids to generate ω3 unsaturated fatty acids or a DNA having a partial base sequence thereof. A method comprising the steps of: amplifying DNA by a polymerase chain reaction using the DNA according to claim 7 or 8 as a primer, and detecting the amplified DNA. 12. As primers, SEQ ID NOs: 14, 1
The method according to claim 11, wherein a DNA having the nucleotide sequence represented by any one of 5, 18, and 19 and a DNA having the nucleotide sequence represented by any of SEQ ID NOs: 16, 17, 20, or 21 are used. 13. A genomic DNA or cDNA derived from a green alga as a template DNA in a polymerase chain reaction.
The method according to claim 11 or 12, wherein 14. A method for obtaining a DNA encoding a protein having the ability to form an unsaturated bond between the ω3 and ω4 positions of unsaturated fatty acids to generate ω3 unsaturated fatty acids. 14. A method comprising the steps of detecting the DNA by the method according to 13, and recovering the detected DNA. 15. A DNA encoding a protein having the ability to form an unsaturated bond between the ω3 and ω4 positions of unsaturated fatty acids to generate ω3 unsaturated fatty acids, and to be obtained by the method according to claim 14. . 16. A DNA obtained by ligating a DNA exhibiting promoter activity in a host cell with the DNA according to claim 1, 2, 3, 4, 5, 6, 7, 8, or 15. 17. The method of claim 1, 2, 3, 4, 5, 6, 7,
A vector containing the DNA according to 8, 15 or 16. 18. The method of claim 1, 2, 3, 4, 5, 6, 7,
A transformant obtained by introducing the DNA of 8, 15, or 16 into a host cell. 19. A transformant obtained by introducing the vector according to claim 17 into a host cell. 20. The transformant according to claim 18, wherein the host cell is a cell derived from a microorganism. 21. The transformant according to claim 18, wherein the host cell is a plant-derived cell. 22. The transformant according to claim 21, wherein the plant is algae. 23. The transformant according to claim 21, wherein the plant is a higher plant. 24. A transformant according to claim 18 which is cultured to obtain a protein capable of forming an unsaturated bond between the ω3 and ω4 positions of unsaturated fatty acids to produce ω3 unsaturated fatty acids. A method for producing an ω3 fatty acid desaturase, characterized by producing the enzyme. 25. The method of claim 1, 2, 3, 4, 5, 6, 7,
Introducing the DNA according to 8, 15 or 16 into a host cell,
A method for modifying metabolism in which the content of ω3 unsaturated fatty acids in a host cell is changed before and after introduction of the DNA. 26. An ω3 fatty acid desaturase having an amino acid sequence consisting of the 7th to 426th amino acids in the amino acid sequence represented by SEQ ID NO: 1. 27. A protein which has the ability to form an unsaturated bond between the ω3 and ω4 positions of unsaturated fatty acids to produce ω3 unsaturated fatty acids from an organism cultured at a temperature lower than the optimum growth temperature. RNA containing RNA corresponding to the DNA to be extracted is extracted, and a single-stranded cDNA is synthesized by performing a reverse transcription reaction using the extracted RNA as a template and a DNA consisting of 5 to 40 bases as a primer,
Amplifying the DNA encoding the protein by a polymerase chain reaction using the cDNA as a template and a DNA recognizing the DNA encoding the protein as a primer, detecting the amplified DNA, and collecting the detected DNA A method for obtaining a ω3 fatty acid desaturase gene comprising: 28. The method according to claim 27, wherein the organism is an organism cultured at 0 ° C. to 15 ° C.