JP2000119199A - Non-nucleotide connecting reagent for nucleotide probe - Google Patents

Abstract

PROBLEM TO BE SOLVED: To obtain a reagent capable of comfortably connecting single or many parts such as a label or an inserting agent to a nucleotide probe at an arbitrary specific selecting position and useful for producing a nucleotide/non- nucleotide polymer. SOLUTION: This non-nucleotide connecting reagent contains (A) a non- nucleotide monomer unit having a ligand selected from a chemical part and a linking arm connectable to the chemical part by activating under a non- unfitness condition and (B) a first and a second non-nucleotide connection groups connected to respective monomer unit. Preferably, the ligand is selected from a label, an inserting agent (an intercalation agent), a metallic chelating agent, a medical agent, a hormone, a protein, a peptide, hapten, a radical generating agent, a nucleic acid decomposing agent, a protein decomposing agent, a catalyst, a specific bonding substance, a DNA transport modifier and a substance changing solubility of a nucleotide polymer and a connection functional group connectable to one of the chemical part.

Description

Description: FIELD OF THE INVENTION The present invention relates to non-nucleotide reagents that can conveniently link a single or multiple moieties, such as labels or intercalators, to nucleotide probes at any particular selected position. It is.

Overview of the Technology In clinical research and diagnostics, known techniques for measuring the presence of specific nucleotide sequences (referred to as “target nucleotide sequences” or simply as “target sequences”) in RNA or DNA are known as nucleic acid hybridization assays. It is an implementation. In this assay, a nucleotide multimer probe (typically an oligonucleotide) having a nucleotide sequence complementary to at least a portion of the target sequence is selected. Typically, the probe is labeled, ie, attached to an atom or group whose presence is readily detectable. When the labeled probe is exposed to a sample suspected of containing the target nucleotide sequence under hybridization conditions, the target will hybridize to such a labeled probe. The presence of the target sequence in the sample
Typically, qualitative or quantitative measurements can be made by separating the hybridizing and non-hybridizing probes and then measuring the presence of the label in the probe hybrid or by measuring the amount of label in the non-hybridizing probe. it can. Historically, radioactive labels have been used. However, handling difficulties led to the later development of non-radioactive labels. Such labels include those whose presence is determined directly or indirectly. Examples of direct labels include labels that can be measured for chemiluminescence, phosphorescence, fluorescence or spectroscopy. Examples of indirect labels include compounds such as biotin and antigens detectable by proteins conjugated to a suitable detectable label. One conventional method of attaching labels to nucleotide probes is typically based on linking a label to a nucleotide and then incorporating one or more of the above nucleotides into the probe. For example, dUTP and UTP analogs containing a biotin moiety attached to the C5 position of the pyrimidine ring have been chemically synthesized and enzymatically incorporated into polynucleotides [P.
R. Langer et al., Proceeding of the National Academy of Sciences USA, 78, 6
633 (1981)]. This biotin-labeled nucleotide can be incorporated into a biological or synthetic nucleic acid probe by an enzymatic method. In addition, the use of the 5'-allylamine precursor of the aforementioned analogs is similarly used,
It has been proposed to result in the incorporation of a nucleophilic amine moiety into the probe that can be linked to a label by general methods. Other deoxynucleotide triphosphate analogs have been enzymatically incorporated into the probe. Specifically, bromo dUTP and iodine dUTP were incorporated and detected immunochemically [Boritoudo et al., Journal of Pathology, 148, 61 (1986).
Year)]. Furthermore, 4-thio UTP [H. Eshyaupoa et al., Nuclear Acids Research, Vol. 7, 1485
(1979)] was attached to the 3 'end of the DNA fragment, followed by labeling of the nucleophilic sulfhydryl moiety. Chien's International Application (International Publication No. WO86 / 000)
74, published on Jan. 3, 1986) describes a technique in which a seemingly random pyrimidine base nucleotide is depyrimidinized, the resulting sugar ring is opened, and an amine-carrying moiety is bound thereto. Labeling chemistry has also been proposed, which randomly attaches the label to some nucleotides in the nucleotide multimer. For example, N-acetoxy-N-acetylaminofluorene was bound to guanine residues of nucleic acids and then detected by immunochemical methods [P. Proceedings of the
National Academy of Sciences USA, 8
1: 3466 (1984)]. Another method of providing a nucleophilic amine group to which a label can be attached is bisulfite-catalyzed transamination at the C6 position of a cytosine residue of a nucleic acid probe [R. P. Journal of
Clinical Biology, vol. 23, p. 311 (1986)
Year)]. Neither of the above chemical or enzymatic methods are capable of specifically labeling a single nucleotide, or if the method modifies the exocyclic amine of a nucleotide base, thereby hindering hybrid formation. With the disadvantages of Other methods of attaching only one label to the 5 'or 3' end of nucleotide multimers, typically oligonucleotides, have also been reported. For example, such a method is described in C.I. F. Chu et al., Nucleic Acids Research, 11, 6513 (1983); Collett et al., Nucleic Acids Research, Vol. 13, 1
529 (1985). As a final step in solid-phase oligonucleotide synthesis, another convenient end labeling method by label attachment has been reported. For example, B. A. Connolly, Nucleic Acids Research, 13:44
85 (1985); Agrawal et al., Nucleic Acids Research, Vol. 14, p. 6227 (1986)
And Connolly, Nucleic Acids Research, Vol. 15, p. 3131 (1987). However, these end labeling methods are limited in that only one label can be attached to the end of the nucleotide multimer. Compounds have been proposed that can be used to insert primary amine-modified nucleotide residues at selected positions on synthetic oligonucleotides during the performance of standard automated synthesis methods. Such compounds include deoxythymidine, deoxyadenine,
Includes analogs of deoxyguanine and deoxytidine [G. B. Drying, etc., Proceedings of the National Academy of Sciences U
SA, 82, 968 (1985); L. Lass,
International application publication number WO84 / 03285, publication date 198
August 30, 4]. Theoretically, such a compound would
Place the labeled nucleotide at a few positions along the sequence,
The use of multiple labels could allow for increased detection sensitivity. However, using such labeled nucleotides on the probe, especially when multiple labels are present,
It has been shown to reduce the stability of the hybrid formed between the target sequence. Such a decrease in hybrid stability has been shown for biogenic nucleic acid probes with multiple biotin moieties attached to uridine, cytidine, or adenine bases [R. P. Visisi et al., Journal of Tarinical Microbiology, 23
311 (1986); Gebeev et al., Nucleic Acids Research, 15: 4513 (19
1987)]. Reduced hybrid stability has also been reported for modified uridine, a synthetic oligonucleotide with multiple fluorescein labels attached to residues [J. Hararan Bizis et al., Nucleic Acids Research, 15, 4857 (1987)]. Such instability was also demonstrated for synthetic oligonucleotides with biotin and fluorescein labels attached to the N-4 position of the cytidine base. Furthermore, in order to place one or more labels at any desired position in a synthetic nucleotide, all, ie, 8 different compounds (4 are deoxyribonucleic acid multimers, 4 are ribonucleic acid multimers) Is required. Furthermore, a phosphate-linked nucleotide derivative capable of labeling a nucleophilic moiety after incorporation into an oligonucleotide was reported [R. L. Letosinger and M.A. E. FIG. Shot, Journal of American Chemical Society (1981) 103, 7
Sugimoto, JP-A-61-44353, 61-5
No. 7595 and No. 61-44352, both of which are March 1986
Month]. However, said compounds based on nucleotide derivatives should exhibit at least some of the disadvantages associated with the nucleotide-based derivatives described above. Furthermore, the above examples of linking agents cannot be used in current standard solid phase synthesis methods without modification of the method itself.

[Definition] In the present specification and claims, terms are defined as follows.

Nucleotide: a nucleic acid subunit consisting of a phosphate group, pentose and a nitrogen-containing base. In RNA, pentose is ribose. In DNA, it is 2-deoxyribose. The term also includes analogs of these subunits.

Nucleotide multimer: a nucleotide chain or an analog thereof linked by a phosphoric diester bond.

Oligonucleotide: generally about 10 to about 10 in length
A nucleotide multimer of 0 nucleotides but a length of 1
It can be larger than 00 nucleotides. These are generally thought to be synthesized from nucleotide monomers, but can also be obtained by enzymatic methods.

Deoxyribooligonucleotide: an oligonucleotide comprising a deoxyribonucleotide monomer.

Polynucleotide—A nucleotide multimer generally about 100 nucleotides or more in length. These are usually of biological origin or obtained by enzymatic methods.

Nucleotide multimer probe—a second nucleotide multimer, usually a nucleotide multimer having a nucleotide sequence complementary to a target nucleotide sequence contained in a polynucleotide. Usually, the probes are selected to be completely complementary to the corresponding base in the target sequence. However, in some cases, it may be appropriate and desirable that one or more nucleotides in the probe not be complementary to the corresponding base in the target sequence. Typically, the probe is a labeled, non-nucleotide monomer unit--this is a monomer unit that does not significantly participate in the hybridization of the polymer. Such monomer units, for example, must not participate in significant hydrogen bonding of the nucleotides and exclude monomer units having one of the five nucleotide bases or an analog thereof as a component.

Nucleotide / non-nucleotide polymer: A polymer containing nucleotide and non-nucleotide monomer units. When used as a probe, they are typically labeled.

Oligonucleotide / non-nucleotide multimer--generally less than 100 nucleotides in synthetic but 200
Multimers that may exceed nucleotides and contain one or more non-nucleotide monomer units.

Monomer unit: A unit of a nucleotide reagent or a non-nucleotide reagent of the present invention provided by a reagent to a polymer.

Hybrid: A complex formed between two nucleotide multimers by Watson-Crick base pairing between complementary bases.

SUMMARY OF THE INVENTION The present invention comprises non-nucleotide monomer units that synthetically combine with specific nucleotide monomer units of a nucleotide reagent to form a well-defined polymer having a backbone containing nucleotide and non-nucleotide monomer units. And a non-nucleotide reagent. The non-nucleotide reagent can also be a linker arm moiety that can participate in a conjugation reaction when the linker arm is deprotected, or a side arm to which a useful chemical moiety of interest is attached prior to initiating polymer synthesis. It can have a ligand. In general, the technique for attaching a moiety to a linker arm is similar to the technique for attaching a label to a group on a protein. However, this method needs to be modified. Examples of useful chemical means include the reaction of an active ester, active imine, aryl fluoride or isothiocyanate with an alkylamine, and the reaction of maleimides, haloacetyls, and the like with thiols. M. Means and R.A. E. FIG. Feney, "Chemical Modification of Proteins", Holden-Day, Inc. (1
971); E. FIG. Feney, International Journal of Peptide Protein Research, 29 (1987), pages 145-161]. Suitable protecting groups that can be used to protect linker arm functional groups during polymer formation are similar to those used in protein chemistry [see, for example, "The Peptide Analysis Synthesis Biology", Vol. . Gross and J.M.
Mainhotsfer, Academic Press (1971)
Year)]. Based on the chemistry of the non-nucleotide reagent, it can be placed at any desired location in the backbone. This allows a wide range of properties to be designed for polymers containing nucleotide monomers. Among them,
(1) The attachment of a specific chemical moiety to any desired position in the polymer. Such moieties include (but are not limited to) detectable labels, intercalating agents (intercalating agents), chelating agents, drugs, hormones, proteins, peptides, haptens, radical generators, nucleolytic agents , Proteolytic agents, catalysts, receptor binding agents and other binding agents of biological interest, as well as agents that modify DNA transport across biological barriers (eg, membranes), and alter the solubility of nucleotide multimers. Modifying substances may be included. This means that such labels and intercalating agents can be located adjacent to any nucleotide of interest. (2) The ability to immobilize a well-defined sequence on a solid support using linker arms for attachment to chemical moieties of the support, for example to construct a nucleotide affinity support. (3) Ability to attach multiple chemical moieties to the polymer via linker arms by incorporating multiple non-nucleotide monomer units into the polymer.
(4) The ability to construct polymers that differ from natural polynucleotides in that their activity is altered by enzymes and proteins that act on the polynucleotide. For example, positioning non-nucleotide monomer units on the 3 'end of a pure polynucleotide results in resistance to degradation by snake venom phosphodiesterase. Such non-nucleotide monomer units can create specific cleavage sites for other nucleases.
(5) Ability to construct a hybridization probe by interspersing hybridizable nucleotide monomer units and non-nucleotide monomer units. For example, a mixed block synthesis of nucleotide and non-nucleotide monomers can be performed, wherein a well-defined sequence of nucleotide monomers is synthesized, and then one or more non-nucleotide monomer units are extended to form a second well-defined sequence of nucleotide monomers. You may continue the block. (6) Ability to construct synthetic probes that can simultaneously detect target nucleotide multimers with one or more different base pairs. This is accomplished by replacing the nucleotides in the probe with non-nucleotide monomer units using the non-nucleotide reagents described herein at the site where differences occur in the nucleotide sequences of the various target nucleotide multimers. In a preferred aspect of the invention, the labeled hybridization probes are constructed from defined sequences including nucleotide and non-nucleotide monomers. In another preferred aspect of the invention, non-nucleotide monomer units are used to link nucleotide multimers of two or more defined sequences, wherein the non-nucleotide monomer units are chemically used for hybridization reactions. Be labeled. In yet another preferred embodiment, the non-nucleotides are constructed such that they can be added stepwise to produce a mixed nucleotide / non-nucleotide polymer using one of the current methods of DNA synthesis. Such nucleotide and non-nucleotide reagents are typically added in steps so as to couple the corresponding monomer units to the developing oligonucleotide chain, which is covalently immobilized on a solid support. Typically, the first nucleotide is attached to the carrier using a cleavable ester bond before the start of synthesis. The gradual extension of the oligonucleotide chain is usually 3 '
To the 5 'direction. Standard DNA and RN
As for the A synthesis method, for example, “Synthesis and application of DNA and RNA”,
S. A. Narang, Academic Press (1987)
Year), and M. J. Get, "Oligonucleotide Synthesis", IRL Press, Washington, USA (19
1984). After the completion of the synthesis, the polymer is cleaved from the carrier by hydrolysis of the ester bond, and the nucleotide first bound to the carrier becomes the 3 ′ end of the generated oligomer. As a similar method, another method of introducing a non-nucleotide monomer unit is to similarly bind to a DNA synthesis carrier before the start of DNA synthesis. In a preferred embodiment, the non-nucleotide monomer units are linked to the DNA synthesis carrier by an ester bond formed using the free alcohol form of the non-nucleotide monomer. Thus, the present invention provides reagents for making a polymer comprising a mixture of nucleotide and non-nucleotide monomer units. The non-nucleotide monomer further comprises one or more protected linker arms, or one or more linker arms conjugated to a chemical moiety of interest, such as a label or intercalating agent. Such non-nucleotide monomers have two or more coupling groups so that they can be further incorporated into the polymer of nucleotides and non-nucleotide monomer units. The first of the above coupling groups has a property capable of effectively binding to the terminal of the growing monomer unit chain. The second of the coupling groups has the ability to stepwise extend the growing mixed nucleotide and non-nucleotide monomer chains. This means that the first coupling group can be deactivated during attachment so that the second coupling group is substantially unattached, and then activated to attach non-nucleotide monomer units. I need. "Inactivation" preferably employs a protecting group for the second coupling group so that when removed, the second coupling group can be activated. However, such "inactivation" and "activation" can be achieved simply by altering the reaction conditions (e.g., changing the pH, temperature, concentration of other components of the reaction system), wherein the second coupling group It is within the scope of this invention to provide a suitable chemical structure to aid in inactivation and activation by such techniques. The coupling group allows adjacent nucleotide or non-nucleotide monomer units to be attached. In a preferred embodiment, the coupling groups are manipulated by coupling and deprotection reactions that are compatible with one of the standard DNA synthesis methods. Such a method involves a non-directional synthesis, and the fact that all coupling cleavage and deprotection steps are performed under "undesirable" conditions, i.e., that they comprise a polymer backbone and its sugars, bases, linkers. It needs to have no substantial adverse effect on the arm and labeling components as well as the monomeric reagents. Those skilled in the art can easily determine functional groups, coupling methods, deprotection methods and cleavage conditions that satisfy these conditions (see, for example, the above-cited reference of Get). The non-nucleotide monomer preferably has a skeleton having a coupling group connected to the terminal. The skeleton is preferably an acyclic chain of 1-20 atom chains, preferably an acyclic hydrocarbon chain of 1-20 carbon atoms. In one embodiment of the present invention, the reagent is selected from one of the following compounds (I) or (II).

Regardless of whether compound (I) or (II) is selected, the groups described are:

(I) R ² = non-nucleotide skeleton (ii) group Is a first coupling group, wherein X ² = halogen or substituted amino X ⁴ = halogen, amino or ^{O - R 3} = alkyl, alkoxy or phenoxy R ⁵ = alkyl, alkoxy or aryloxy, or ^X 4,, = It can be H only in the case of O ⁻ .

(Iii) R ¹ -X ¹ -is a protected second coupling group, wherein X ¹ ＯO, S, NH, or HN ＝ N—R ¹ = cleavage under coupling group deprotection conditions. A protecting group capable of regenerating a second coupling group HX ^1- (iv) n is an integer (v) R ⁴ -X ³ -is a ligand. It is preferably selected from a functional moiety or from a protected linking arm which can be deprotected under appropriate conditions and linked to the functional moiety (again under appropriate conditions). In the latter case, X ³ is a linking arm and R ⁴ is a protecting group. More preferably, some of the above groups are as follows. X ² = Cl or secondary amino (preferably selected from dialkylamino, and heterocyclic N- amines), ^{R 3} = methoxy, ethoxy, chlorophenoxy,
Or ^{beta-cyanoethoxy, X 3 -O, S, NH} , or terminate at HNN-, preferably extend from ^{R 2} 1 to 2
X ⁴ = Cl, secondary amino or O ^— R5 = methoxy, ethoxy, monochlorophenoxy or beta cyanoethoxy having 5 atom chains or H X ² only when X 4 is O, more preferably diisopropylamino, dimethyl Amino or morpholino. R ¹ is more preferably triphenylmethyl, which includes derivatives thereof, typically including dimethoxytriphenylmethyl, and X
¹ is O. R ² is preferably a ^second group attached to -O-
It has a grade carbon. This allows the use of secondary alcohols during the synthesis, which has the advantage of producing reagents protected from alcohol in higher yields. Methods for making nucleotide / non-nucleotide polymers are also described. This method involves the use of a non-nucleotide monomer unit and a ligand attached thereto (as described above), and a non-nucleotide under non- disadvantageous conditions for the first monomer unit and for one of the second separate monomer units or the solid support. Includes coupling of monomer units. At least one of the other monomer units described above is a nucleotide monomer unit. When choosing another monomer unit from a non-nucleotide reagent, of course, further monomer units can be coupled to other non-nucleotide monomer units,
It is possible to continue further. In a typical case, the above-described coupling is such that the first coupling group, which is attached to the non-nucleotide monomer unit, and the protected second
By a coupling group of That is, a non-nucleotide monomer unit is first attached to a first nucleotide monomer unit by a first coupling group, and then the second coupling group is deprotected to convert the non-nucleotide monomer unit to a second nucleotide or another nucleotide. Couple to either one of the reagent non-nucleotide monomer units. Preferred reagent chemical compositions that can be used in this method are those described above. The products obtained from the above reagents and their preparation are also described. Also described is a polymeric probe comprising a plurality of nucleotide and non-nucleotide monomer units, and typically comprising at least one acridinium ester label moiety, which serves as a label and is linked to the corresponding monomer unit of the probe. Preferably, the acridinium ester moiety is a chemiluminescent acridinium ester label. Also described is a method for producing the above-described probe, comprising linking at least one of the above-described acridinium ester moieties to a corresponding monomer unit of a polymer having a plurality of nucleotide monomer units. Specific examples of FIGS present invention will be described by the reaction equation. 1 illustrates the production of the reagent of the present invention, FIG. 2 illustrates the production of another reagent of the present invention, and FIG. 3 illustrates the production of another reagent of the present invention. FIG. 4-8 illustrates the production of yet another reagent of the present invention. DETAILED DESCRIPTION OF EMBODIMENTS OF THE INVENTION The synthesis of three different "linker" reagents of the present invention is described in detail in Examples 1-3 below. Example 4 below
Describes a method of preparing the substituted nucleotides of the present invention, especially oligonucleotides, which has a bone nucleus of a reagent that binds to various specific preselected sites on the oligonucleotide. Example 5 illustrates the linking of a label to a linking group in a substituted nucleotide of the present invention, while Example 6 demonstrates the advantage obtained with the substituted nucleotide of the present invention, ie, against phosphodiesterase-catalyzed hydrolysis. It shows the advantage of resisting. Example 1 : 2- (3-aminopropyl) -1,3-dihydroxypropane linker reagent The reaction scheme for this synthesis is shown in FIG. 1 and outlined below.

(A) 2- (Nitrilepropyl) -diethyl malonate (1): The method used was Adam et al., Organic Synthesis, Vol. 1, pp. 250-251.

Reagents: diethyl malonate, 3-bromopropionitrile and sodium ethoxide (21% ethanol solution) were obtained from Aldrich Chemical Company (Milwaukee, Wis.). Absolute alcohol (200 proof) is available from U.S.A. S. Obtained from Industrial Chemicals.

Method: Dilute sodium ethoxide (0.1 mol) with absolute ethanol to a final volume of 100 ml. A solution of diethyl malonate (0.1 mol) in 50 ml of absolute ethanol is added dropwise with stirring. The reactor is sealed off with a CaCl ₂ drying tube. Stirring is continued for 1 hour at room temperature. Then a solution of 3-bromonitrile in 50 ml of absolute ethanol is added dropwise with stirring and the mixture is stirred overnight at room temperature.
The solution obtained is filtered to remove the precipitated sodium bromide, concentrated and extracted with diethyl ether (50 ml). The solution is then extracted with water (50ml), dried over anhydrous sodium sulfate and concentrated to an oil. Thin layer chromatography on silica plate using chloroform as the mobile phase and color development with iodine vapor reveals three spots: Rf 0.58, 0.51 and 0.38, each of which is malonic acid Diethyl, 2- (nitrilepropyl) -diethyl malonate and 2,2-di-
(Nitrilepropyl) malonate. After refrigeration for several days, the crystals were separated from the crude oil by filtration, dissolved in toluene (10 ml) and recrystallized by adding hexane to give 3.28 g (yield: 12%) of a white solid; Chromatography (as above), Rf 0.3
8. The structure of this compound is ¹ H NMR (CDCl ₃ )
Identified 2,2-di- (nitrylpropyl) malonate (6): δ 1.30 (t, 6H), 2.2
6 (t, 4H), 2.47 (t, 4H), 4.27
(Q, 4H). The filtered oil is distilled under vacuum to obtain the target compound (1). (Bp 99-103 ° C, 0.3m
mHg), ^20% yield; 1 HNMR (CDCl ₃₎ analysis: δ1.24 (t, 6H), 2.19 (q, 2H),
2.47 (t, 2H), 3.46 (t, 1H), 4.1
8 (q, 4H).

(B) Synthesis of 2- (3-aminopropyl) -1,3-dihydroxypropane (2) Reagents: In addition to those described in (1), lithium aluminum hydride (0.1 M solution in diethyl ether) is Aldrich. Obtained from the company.

Method: 2- (3) in anhydrous diethyl ether (50 ml)
-Nitrilepropyl) -diethylmalonate (1,3.
21 g, 15.1 mmol) are added dropwise to a stirred solution of lithium aluminum hydride (0.1 mol in 100 ml of diethyl ether) in a stream of nitrogen. The resulting mixture is refluxed for 2 hours and then stirred at room temperature overnight. Next, sodium hydroxide 2.5m in water (10ml)
M solution is added slowly to inactivate unreacted hydride. The mixture is stirred for 2 hours and the ether layer is decanted and discarded. (The product remains in the aqueous layer). The white gelatinous solid was removed from the aqueous layer by centrifugation, washed with water,
The aqueous supernatant and the washings are combined and evaporated under vacuum to give a syrup. Thin layer chromatography (Analtech reverse plate, water mobile phase, ninhydrin color reagent) gives the desired compound (2) identified as the major spot;
f 0.48, and the side spots are considered to be condensation by-products; Rf. 0.29. The target compound (2) was subjected to cation exchange chromatography (Dowex 50 ×
8, 0.5 M HCl mobile phase) to give a final yield of 5
It was 0%. ¹ H NMR analysis (D ₂ O): δ 1.3
6 (clear quartet, 2H), 1.68 (m, 3
H), 2.97 (t, 2H), 3.57 (d, 4H).

(C) 2- (3-N-trifluoroacetylaminopropyl) -1,3-dihydroxypropane (3): The method is incorporated herein by reference. The gold finger method in page 317 is adopted.

Reagents: (in addition to the above) S-ethyl-trifluorothioacetate was obtained from Aldrich.

Method: Dissolve 2- (3-aminopropyl) -1,3-dihydroxypropane (2) (3 mmol) in water (25 ml). The pH of the solution is brought below 9.5 by dropwise addition of 6N HCl. The following reactions are performed in the hood:
S-Ethyl trifluoroacetate (2 ml) is added dropwise to the vigorously stirred solution; 6 NKOH is added dropwise, maintaining pH 9.5-10.0. 30 minutes later, pH
While maintaining the same as above, add the same volume ml of S-ethyltrifluoroacetate. The mixture is stirred for a further 45 minutes. The pH is then adjusted to 7 using 6N KOH and the mixture is concentrated to dryness on a rotary evaporator under vacuum. Stir the residue with acetone (20 ml),
Filter to remove potassium acetate precipitate. The filtrate is concentrated to a syrup, redissolved in acetone (2 ml) and subjected to flash chromatography containing 40 g of silica gel (from Baker Chemical Company (Vilsburg, NJ, USA); average particle diameter 40 μm). . The column was eluted with a 50:50 (v / v) solution of methylene chloride / acetone (500 ml),
Fractionate 25 ml each. Each fraction was placed on a silica gel plate for 2 hours.
Spot each μl, spray with 10% aqueous piperidine, leave for 15 minutes, dry with heat gun, then treat with ninhydrin reagent and analyze the product contained. Neglecting the piperidine spray treatment prevents confirmation of the primary amine trifluoroacetone by the color reaction with ninhydrin. In this method, the product is fraction 13-1
These fractions were collected and concentrated on a rotary evaporator to give a colorless oil. Rf0.4
(Silica gel thin layer chromatography using the same solvent system and the same color development method as above).

(D) 1-0- (dimethoxytrityl) -2- (3-N
Synthesis of -trifluoroacetylaminopropyl-1,3-dihydroxypropane (4): Reagents: (in addition to those listed above), dimethoxytrityl chloride was obtained from Aldrich (USA). Reflux the methylene chloride, distill it with CaH ₂ and fill a 4 Å (4A) molecular sieve. Pyridine is distilled by adding potassium hydroxide granules and paratoluenesulfonate and stored in dry nitrogen gas.

Method: 2- (3-N-trifluoroacetylaminopropyl) -1,3-dihydroxypropane (3) (362)
mg, 1.58 mmol) are dried several times with dry pyridine under reduced pressure and then further dried under full vacuum for several hours.
The residue was then dried in a stream of dry nitrogen in 10 ml of dry pyridine.
Dissolve in. Dimethoxytrityl chloride (401 mg, 1.18 mmol) in dry methylene chloride (1.5 ml) is added with stirring and the resulting solution is stirred at room temperature for 1 hour. The solvent is removed under reduced pressure and the residue is dissolved in chloroform (50ml). The solution is extracted three times with a 5% aqueous sodium hydrogen carbonate solution, and then dried over anhydrous magnesium sulfate. Concentrate the resulting solution to obtain an oil. Redissolved in 2 ml of chloroform, and chloroform / ethyl acetate / pyridine (95: 5: 0.2
v / v / v) and fractionation by flash chromatography as above. Each fraction is analyzed by thin layer chromatography on a silica gel plate using the same solvent system. The spots were developed with fuming HCl and the Rf values 0.27, 0.87, 0.93 were 1- (dimethoxytrityl product (4), dimethoxytritanol and 1,3-di- (dimethoxytrityl), respectively. The latter substance was confirmed to be a by-product, and the latter substance was shaken with a mixed solution of 4% dichloroacetic acid in a saturated aqueous solution of methylene chloride and hydrolyzed to obtain the target substance (4). Is separated from the corresponding fractions by evaporation of the solvent and dried under full vacuum to give a foam (370 mg, 44%).

(E) 1-0- (dimethoxytrityl) -2- (3-N
-Trifluoroacetylaminopropyl) -3-0-
(Methyl-N, N-diisopropylphosphoramide)-
Synthesis of 1,3-dihydroxypropane (5) Reagents: (in addition to those listed above) N, N-diisopropylethylamine and N, N-diisopropylmethylphosphoramidic chloride were obtained from Aldrich (US)
A). Dimethylformamide is refluxed,
The mixture was added with CaH and distilled, and the mixture was filled into a 4A molecular sieve.

Method: 1-0- (dimethoxytrityl) -2- (3-trifluoroacetylaminopropyl) -1,3-dihydroxypropane (4,300 mg, 0.56 mmol)
Are dried several times with dry pyridine and dissolved in 10 ml of dry dimethylformamide. The following reaction is carried out in a stream of dry nitrogen: N, N-diisopropylethylamine (2
45 μl, 1.3 mmol) were added with stirring and then N, N-diisopropylmethyl phosphoramidick.
Chloride (140 μl, 0.7 mmol) is added.
The reaction mixture is stirred for 2 hours. Then the mixture is concentrated under reduced pressure and dissolved in methylene chloride (50 ml). This solution is extracted three times with a 5% aqueous sodium hydrogen carbonate solution, dried over anhydrous magnesium sulfate, and concentrated under reduced pressure to obtain an oily substance. Conversion of the starting material (4) to the corresponding phosphoramide was confirmed by ³¹ P NMR (CDCl ₃ , trimethyl phosphate, high purity): δ147.9. Purity is estimated to be greater than 70%.

Example 2: 2,2-di- (3-aminopropyl) 1,3
-Synthesis of Dihydroxypropane Linker Reagent This example includes a monomer for attachment to the phosphodiester backbone of a synthetic oligonucleotide having two aminopropyl linkers for multiple label attachment. FIG. 2 shows the theoretical reaction formula.

Reagents: The same as those described in Example 1 unless otherwise specified.

(A) 2,2-di- (3-aminopropyl) -1,3-
Synthesis of dihydroxypropane (7): The following steps are a summary of the method described in Example 1 (b) above. 2,2-
Di- (nitrilopropyl) -diethyl malonate (6)
(2.00 g, 7.51 mmol) (this synthesis is described in Example (1) (a)) in anhydrous diethyl ether (80 m
Dissolve in 1). The resulting solution is added dropwise to a stirred solution of lithium aluminum hydride in diethyl ether (100 ml) and after 15 minutes the mixture is heated under reflux for 2 hours and then stirred at room temperature overnight. The treatment and recovery of the crude product are performed in the same manner as in Example 1 (b). A main spot (Rf: about 0.2) is obtained by the same thin layer chromatography as described in Example 1 (b).

(B) Synthesis of 2,2-di- (3-trifluoroacetylaminopropyl) -1,3-dihydroxypropane (8): 2,2-di- (3-aminopropyl) -1,3-dihydroxypropane (7) (3.7 mmol) in 25 ml of water
And adjust the pH to about 10 with 6N HCl. S
1.0 ml of ethyl trifluorothioacetate are added with vigorous stirring; the pH is kept between 9.5-10.0 with the dropwise addition of 6 NKOH. Further, 1.0 ml of ethyl trifluorothioacetate is similarly added twice at 30 minute intervals. The mixture was concentrated under reduced pressure to give an oil, which was then dissolved in acetone (30 ml). The precipitate, potassium acetate, is removed by filtration. The product (8) was transferred to a mobile phase methylene chloride / acetone (50:50).
Purify by flash chromatography on silica gel using v / v) as described in Example 1 (C). The purified material gives a single spot (Rf 0.7) by silica gel thin-layer chromatography using the same solvent system, by piperidine as described in Example 1 (c) followed by ninhydrin treatment. . Yield 510mg
(1.48 mmol).

(C) 1-0- (dimethoxytrityl) -2,2-di-
Synthesis of (trifluoroacetylaminopropyl) -1,3-dihydroxypropane (9): 2,2-di- (3-
Trifluoroacetylaminopropyl) -1,3-dihydroxypropane (8) (510 mg, 1.48 mmol) is dried in dry pyridine under reduced pressure and then dissolved in 5 ml of dry pyridine in a stream of nitrogen. Impression Dimethoxytrityl chloride (3 ml) in methylene chloride (1.5 ml)
(76 mg, 1.11 mmol) are added with stirring in a stream of nitrogen and the mixture is stirred for 1 hour. The mixture is concentrated under reduced pressure and dissolved in chloroform (50 ml). The solution is extracted three times with a saturated aqueous sodium hydrogen carbonate solution and once with a saturated saline solution. The solution is then dried over anhydrous magnesium sulfate and concentrated in vacuo to give an oil. Next, the oily substance is dissolved in 2 ml of chloroform, and fractionated by silica gel flash chromatography using chloroform / ethyl acetate / pyridine (80: 20: 0.2 (v / v / v)) in the same manner as described above. The product (9) was purified by thin-layer chromatography on silica gel using the same solvent system.
Identify by coloring with Cl (Rf: 0.3); concentrate under reduced pressure and dry under full vacuum to give a yellow foam (5
17 mg, 52%).

(D) 1-0- (dimethoxytrityl) -2,2-di-
(3-trifluoroacetylaminopropyl) -3-0
-(Methyl-N, N-dicisopropylphosphoramide)
Synthesis of -1,3-dihydroxypropane (10): Method: 1-0- (dimethoxytrityl) -2,2-di-
(Trifluorocetylaminopropyl) -1,3-dihydroxypropane (9) (136 mg, 0.2 mmol) is co-distilled with dry pyridine (3 ml) three times and dried. The residue obtained is dissolved in dry methylene chloride (1.5 ml) in a stream of argon and N, N-diisopropylethylamine (175 μl, 1.0 mmol) is added with stirring. Next, N, N-diisopropylmethylphosphoramidic chloride (80 μl, 0.4 mmol) is added and the reaction is stirred for 1 hour. The resulting mixture was treated with ethyl acetate / triethylamine (98.2) (50
ml), and diluted with saturated aqueous sodium hydrogen carbonate solution (25
ml) twice. Dry the organic layer over anhydrous MgSO ₄ to give an oil (240 mg). Conversion to phosphoramide (10) was confirmed by ³¹ P NMR (CDCl ₃ , trimethoxy phosphate, external standard: δ145.5, purity estimated to be greater than 60%.

Example 3: Synthesis of a 3-amino-1,2-propanediol-based linker reagent The synthetic method is illustrated in FIG. 3 and described below.

(A) 3- (trifluoroacetylamino) -1,2-
Synthesis of propanediol (11): Reagents: 3-amino-1,2-propanediol and S
-Ethyl trifluoroacetate was purchased from Aldrich (U.S.A.).
SA).

Method: S-ethyl trifluoroacetate (5.13m
l, 45 mmol) with 3-amino-1,2-propanediol (2.32 ml) and ethyl acetate (5.0 m).
Add to the mixture of l) with rapid stirring. After a few minutes, the mixture becomes homogeneous. After 1 hour, the reaction solution is shaken with petroleum ether (100 ml), separated and concentrated in vacuo to give an oil. This material is analyzed by thin layer chromatography on a silica plate using ethyl acetate / methylene chloride (2.1) as mobile phase. When the lamella is first developed with ninhydrin, it shows a discoloration of a trace amount of unreacted amine starting material at the starting point. The plate is then sprayed with a 10% aqueous piperidine solution to develop color, dried with a heat gun for 15 minutes and treated with a ninhydrin reagent. In the latter case, the major spots that are estimated to contain more than 95% of the total material are identified (R
f0.28). Purification of substance (11), which appears to be the major spot, is performed by preparative scale thin layer chromatography.

(B) 3- (trifluoroacetylamino) -1-0-
(Dimethoxytrityl) 1,2-propanediol (1
Synthesis of 2): Reagents and methods are described in Example 1 (d) above. 3- (trifluoroacetylamino) -1,2
-Dihydroxypropane (11) (1.87 g, 10 mmol) is dried by co-evaporation three times with dry pyridine (10 ml) under reduced pressure. This material is then dried in dry pyridine (1
0 ml). Then dry pyridine (10m
1) dimethoxytrityl chloride in 3.73 g, 11
(Mmol) solution is added dropwise with stirring in a stream of nitrogen. After about one hour, methanol (0.2 ml) is added. The resulting solution was diluted with ethyl acetate (80 ml),
Extract twice with saturated aqueous sodium bicarbonate (30 ml) and twice with water (20 ml). The organic layer is dried over anhydrous magnesium sulfate and concentrated under reduced pressure to obtain 6 g of a crude oil. 1.1 g of crude material are fractionated by flash chromatography on silica gel as above using methylene chloride / ethyl acetate / pyridine (10: 1: 0.01 v / v / v). Each fraction is analyzed by thin layer chromatography on a silica gel plate with the same solvent system. When the spot was developed with fuming HCl, it showed two minor components with Rf values of 0.94 and 0.87 and a major component of Rf 0.53, each of which was 1,2-di- (dimethoxytrityl) minor. The product, dimethoxytritanol and expected product (12) were fixed. The fractions with Rf 0.53 from the same thin layer chromatography as above were collected and evaporated to 0.7
2 g of (12) were obtained and the structure was confirmed by ¹ H NMR. Final yield of (12) was 80% based on yield from flash column.

(C) 3- (trifluoroacetylamino) -1-O-
(Dimethoxytrityl) -2-O- (methyl-N, N-
Synthesis of diisopropylphosphoramido) -1,2-propanediol (13): The synthesis reagents are the same as in Example 1 above. 3- (trifluoroacetylamino) -1-O
-(Dimethoxytrityl) -1,2-propanediol (12) (196 mg, 0.4 mmol) is dissolved in dry methylene chloride (1.5 ml) containing diisopropylethylamine (348 μl, 2 mmol). N,
N-diisopropylmethylphosphoramidic chloride (200 μl, 1 mmol) was stirred in an argon stream,
Add while dropping. After 1 hour, ethyl acetate containing 1% triethylamine is added (50 ml) and the resulting solution is extracted three times with a saturated aqueous sodium hydrogen carbonate solution. The organic layer is dried over anhydrous magnesium sulfate and concentrated under reduced pressure to obtain an oil. The purity of this material was ³¹ P NMR (CD
₃ CN, trimethoxy phosphite Holic acid, is estimated to be higher than 95% by external reference): δ147.
5. This substance was placed in a toluene / hexane mixed solvent at -78 ° C.
Attempted recrystallization with no success. Therefore, the crude sample is used directly for linker addition.

Example 3 (a): Synthesis of a linker reagent based on -amino-1,2-hexanediol The reaction scheme is shown in FIG. 4 and described below.

(A) Synthesis of 1,2- (isopropylidene) -1,2,6-trihydroxyhexane (14): Reagents: 1,2,6-trihydroxyhexane and 2,2-dimethoxypropane were obtained from Aldrich (US
Purchased from A).

Method: 1,2,6-trihydroxyhexane (1.0
0 g, 7.45 mmol), dry acetone (10 ml)
And concentrated sulfuric acid (μl) are added to a 50 ml round bottom flask equipped with a magnetic stirrer. The flask is filled with nitrogen, capped with a rubber septum, and shut off moisture. next,
2,2-dimethoxypropane (3.00 ml, 24.4
Mmol) is added slowly via syringe over 30 minutes into the stirred solution. Stirring is continued for 2 hours. Anhydrous sodium carbonate (150 mg) was added to terminate the reaction,
The contents are then stirred overnight. Finally, the solution is filtered and concentrated under reduced pressure to give a pale yellow syrup (1.
6g). Use this material in the next step without purification.

(B) Synthesis of 1.2- (isopropylidene) -6- (p-toluenesulfonyl) -1,2,6-trihydroxyhexane (15) Reagent: p-toluenesulfonyl chloride was purchased from Aldrich (USA) did.

Method: The crude isopropylidene material (14, about 7.45 mmol) obtained in the previous step was treated with dry acetone (15 m
1) dissolved in Next, p-toluenesulfonyl chloride (2.8 g, 14.9 mmol) and dry pyridine (5 ml) are added and the contents are stirred at room temperature for 3 hours while keeping the moisture away. Then, the solvent is removed under reduced pressure, the residue is taken up in methylene chloride (25 ml), dried over anhydrous magnesium sulfate, filtered and concentrated under reduced pressure to obtain solid crystals (15, 2.8 g). The crude product is purified by flash chromatography on silica gel as above using chloroform as mobile phase. Each fraction is analyzed by thin layer chromatography on fluorescent silica gel plates using the same solvent system. The spot is caused to emit light by a fluorescent lamp. Product containing fraction (R, 0.5
0) was collected and concentrated under reduced pressure to give a final yield of 96.9% oil (15, 2.37 g).

(C) 1.2- (isopropylidene) -6-azido-
Synthesis of 1,2-dihydrohexane (16): Method: Tosyl form of the previous step (15, 2.37 g, 7.
22 mmol) in dry dimethylformamide (30 m
Dissolve in 1). Sodium azide (1.64
g, 25.2 mmol) via a magnetic stirrer bar, and attach a reflux condenser and a CaCl ₂ drying tube. The mixture is then placed in a water bath at 60-65 ° C for 3 hours.
Stir with. Stirring is continued at room temperature overnight. Then
The sediment is removed by centrifugation and the resulting solution is concentrated under reduced pressure to give a final volume of about 5 ml. The concentrate is taken up in chloroform (50 ml) and water (15 ml).
Further, the organic layer was washed with water (15 ml) and dried over anhydrous Mg.
Dry over SO ₄ , filter and concentrate under reduced pressure to give an amber oil (16). The crude product is then used in the next step without further purification.

(D) 6-amino-1,2-dihydroxyhexane (1
Synthesis of 7): Reagents: Lithium aluminum chloride in water in diethyl ether (1.0 M) was purchased from Aldrich (USA).

Method: anhydrous diethyl ether (10 ml) and lithium aluminum hydride in diethyl ether (1.0
M) is added in a stream of argon into a 250 ml round bottom flask. A solution of the crude azide from the previous step (16, about 7 mmol) in anhydrous diethyl ether is added from a dropping funnel with stirring in a stream of argon. After all additions, stir in argon. After all the addition, the mixture was refluxed for 90
Stir for a minute. The obtained slurry was mixed with diethyl ether (2
5 ml) and the following solutions are added in the stated order with stirring: water (1 ml), 5N NaOH (1 ml).
And water (1 ml). The mixture is then filtered on a glass filter. The filtrate is concentrated by distillation under high vacuum at room temperature to give a pale yellow oil. Next, water (10.8 ml)
And 88% formic acid (14.2 ml) are added. The resulting mixture was allowed to stand at room temperature overnight, then for 2 hours at 70-7.
Heat to 5 ° C. The solution was concentrated under reduced pressure to give a syrup, which was then dissolved in water (50 ml),
Cation exchange column containing 50W-X8 resin (H type, 5 type)
0 ml bed capacity, Biolabs, Richmond, CA, USA). Column is 1N HCl
Eluted at The amine product is spotted on a silica gel TLC plate, sprayed with a ninhydrin reagent to develop color, and heated as above. The fractions containing the product were collected and concentrated under reduced pressure to obtain a syrup, which was co-distilled with methanol to obtain a pale yellow needle (1).
7, as hydrochloride).

(E) 6-N- (9-fluorenylmethoxycarbonyl) -amino-1,2-dihydroxypropane (1
8): Reagent: 9-Fluorenylmethylsuccinimidyl carbonate (Fmoc-NHS) was purchased from Bahem, Inc. (Torrance, CA, USA).

Method: Amount of 6-amino- according to the yield obtained in the previous step
1,2-Dihydroxyhexane hydrochloride (17) is dissolved in water (10 ml) and the final pH is adjusted to 8.7 with 5N NaOH. Sodium hydrogen carbonate (588 mg,
7 mmol), Fmoc-NHS (2.76 g, 7 mmol) and acetone (10 ml) are added. After all Fmoc-NHS has been added to the solution, the suspension is stirred overnight at room temperature. The reaction mixture is concentrated under reduced pressure to remove acetone. 1N HCl (50 ml) and ethyl acetate (150 ml) are added and the mixture is transferred to a separatory funnel. Separate the organic layer and wash with 0.1 N HCl (50 ml) followed by water (2 × 50 ml). Next, the organic layer is dried over anhydrous MgSO ₄ , filtered and concentrated to give an oil. Using the product as a mobile phase, chloroform / acetone (5
0:50) by flash chromatography on silica gel. The fractions are analyzed by thin layer chromatography on fluorescent silica gel plates using the same solvent system. The spot is caused to emit light by a fluorescent lamp. The fractions containing the product (R, 0.25) are collected and evaporated to give white solid crystals (18, 1.20 g). Starting materials,
Based on 1,2,6-trihydroxyhexane, the final yield is 45%.

(F) 1-O- (dimethoxytrityl) -6-N- (9
-Fluorenylmethoxycarbonyl) amino-1,2-
Synthesis of dihydroxyhexane (19): Method: The product of the previous step (18, 0.5 g, 1.41)
Mmol) was co-evaporated with dry pyridine (3 × 3 m
l) and then dissolved in dry pyridine (8 ml) in argon. A solution of dimethoxytrityl chloride (0.5736 g, 1.69 mmol) in methylene chloride (2 ml) is added via syringe over a few minutes while stirring. Stirring is continued for 2 hours at room temperature, after which the reaction is stopped by adding methanol. The solvent is removed under reduced pressure, and the residue is dissolved in chloroform (100 ml). The obtained solution was transferred to a separating funnel, and a saturated sodium hydrogen carbonate solution (3 × 20 m
1) Then wash with 5M NaCl. The organic layer is dried over anhydrous MgSO ₄ , filtered, and concentrated under reduced pressure to obtain an oil. The product is purified by flash chromatography on silica gel as above using a solvent system of methylene chloride / ethyl acetate / triethylamine (95: 5: 0.5). The fractions are analyzed by thin layer chromatography on silica gel plates using the same solvent; the plates are treated with fuming HCl to develop spots. The fractions containing the product (19, R, 0.35) are collected and evaporated under reduced pressure to give a foam (910 mg, 100% theoretical yield).

(G) 1-O- (dimethoxytrityl) -6-N- (fluorenylmethoxycarbonyl) -2-O- (methyl-
Synthesis of (N, N-diisopropylphosphoramido) -6-amino-1,2-dihydroxyhexane (20) Reagents: The raw materials are the same as those described in the preceding Examples.

Method: N, N-diisopropyl-methoxyphosphinyl chloride (102 μl, 0.513 mmol) was treated with 19 (225 mg,
0.34 mmol) and a stirred solution of N, N-diisopropylethylamine (236 μl, 1.36 mmol). After 90 minutes, the reaction mixture was reduced to 2%
Diluted in ethyl acetate containing triethylamine (50 ml) and saturated aqueous sodium bicarbonate (2 x 25m
Wash in 1). The organic layer was dried over anhydrous MgSO _4, filtered, evaporated to dryness under reduced pressure. The residue was dissolved in toluene (2
ml) and added dropwise to petroleum ether at -20 ° C with rapid stirring. The resulting mixture is then left at -20 ° C for 16 hours. Then warm to room temperature and decant the supernatant. The precipitated product (20)
Is dried under reduced pressure: yield = 160 mg (58% yield).
Purification of this material is accomplished by thin layer chromatography on silica gel plates using a solvent system of methylene chloride / ethyl acetate / triethylamine (10: 1: 0.1) and is illuminated by UV irradiation (R0. R, 0.9 compared to 25). Further, Example 3 (a) described above.
Analogues of the described linker reagents were also synthesized. The structures of these analogs are illustrated in FIG. 5 (21-24). The preparation of these analogs is described in the Examples below.

Example 3 (b) Synthesis of 3-N- (glycinoyl) -amino-1,2-propanediol-based linker reagent (21) FIG. 6 outlines the formula for this synthesis.

(A) Synthesis of 3-N- [N- (9-fluorenylmethoxycarbonylglycinoyl) -amino-1,2-propanediol (25).

[Raw materials] Baychem Inc. (Trans,
N- (Fluorenylmethoxycarbonyl) -glycine-N-hydroxysuccinimide (Fmoc-glycine-NHS) was purchased from California, USA. Other reagents have been described above.

[Method] 3-Amino-1,2-propanediol (91
mg, 1 mmol) in acetone (7 ml).
Added to a solution containing c-glycine-NHS (394 mg, 1 mmol). To this solution was added a solution of sodium bicarbonate (84 mg, 1 mmol) in water (5 ml). The reaction mixture was stirred at room temperature for 16 hours. Silica gel plate and methylene chloride / methanol / acetic acid (2
0: 2: 0.1) Thin layer chromatography using a solvent system indicated that the reaction was complete. Product (25)
Formed as a precipitate in the flask, which was filtered and dried under vacuum over P ₂ O ₅ for 2 days. Yield 310
mg (84%).

(B) 1-O- (dimethoxytrityl) -3-N-
Synthesis of [N- (fluorenylmethoxycarbonyl) -glycinoyl] -amino-1,2-propanediol (26).

[Raw materials] Raw materials are described in the above-mentioned Examples.

[Method] Compound 25 (185 mg, 0.5 mmol) was dried by concentrating with dry pyridine (3 × 3 ml). Thereafter, it was dissolved in dry pyridine (3 × 3 ml) and then a solution containing dimethoxytrityl chloride in a mixture of methylene chloride / pyridine 1: 1 (4 ml) was added dropwise with stirring. Stirring was continued for 1.5 hours, after which the reaction was monitored by silica gel thin layer chromatography using a methylene chloride / methanol (8: 1) solvent system. The reaction was terminated by the addition of methanol (0.2 ml) and stirring was continued for 10 minutes. Pyridine was concentrated under vacuum. The residue was treated with methylene chloride (1
(50 ml), washed with a saturated sodium hydrogen carbonate solution (2 × 50 ml), and washed with water (50 ml). After drying over anhydrous MgSO ₄ , the methylene chloride solution was concentrated to dryness under vacuum. The residue was purified by flash chromatography on silica gel using a methylene chloride / ethyl acetate (11: 5) solvent system containing 0.1% pyridine according to the method described above. Product containing fractions were identified by silica gel thin layer chromatography as described above. These fractions were saved, concentrated to dryness and 250 mg of (2
6) was obtained. (75% yield).

(C) 1-O- (dimethoxytrityl) -2-O-
Synthesis of (N, N-diisopropylamino-methoxyphosphinamide) -3-N- [N- (fluorenylmethoxycarbonyl) -glycinoyl] -amino-1,2-propanediol (21).

[Raw materials] Raw materials are described in the above-mentioned Examples.

[Method] ₁ Compound 26 (235 mg, 0.35 mmol) was dried by concentrating with dry pyridine (2 × 3 ml). Thereafter, it was dissolved in dry pyridine chloride (2 ml) and N, N-diisopropylethylamine (244 ul, 1.4 mmol) was added. Subsequently, N, N-diisopropylamino-chloromethoxyphosphine (105 ul) 0.53 mmol)
Was added dropwise with stirring under an argon atmosphere. Methylene chloride / ethyl acetate / triethylamine (10:
5: 0.5) Thin layer chromatography on silica gel using a solvent system indicated that the reaction was complete after 20 minutes. The reaction mixture was then diluted into ethyl acetate using a saturated sodium bicarbonate solution (2 × 25 ml). After drying over anhydrous MgSO _4, the ethyl acetate layer was concentrated under vacuum. The residue was redissolved in ethyl acetate (3 ml) and poured into hexane (150 ml) at -25 degrees (C). The precipitate was filtered and dried under vacuum to give 210 mg of (21) (72% yield). ³¹ P-NMR (CD
Ppm corresponding to Cl ₃ , trimethyl phosphate
At) 147.5 (d). ^The structure was also confirmed by ¹ H-NMR analysis.

Example 3 (c) 3-N- (4-aminobutyryl) -amino-1,2-propanediol and 3-N- (6-aminocaproyl) -amino-1,2-propanediol basic linker reagents Production of (22, 23). The stages of synthesis that are specific to this embodiment are illustrated in FIG. 7 and described below.

(A) Synthesis of N-fluorenylmethoxycarbonyl protected forms of 4-aminobutyric acid and 6-aminocaproic acid.

[Raw materials] 4 from Aldrich Chemical Corporation (Milwaukee, Michigan, USA)
-Aminobutyric acid and 6-aminocaproic acid were purchased.
Fmoc-NHS was described in Example 3 (a).

[Method] These compounds were synthesized as described in the method of A. Park (Canadian Journal of Chemistry, 1982, 60, 976).

(B) N-Fmoc-4-aminobutyric acid and N-Fmoc- using 3-amino-1,2-propanediol
Each coupling of 6-aminocaproic acid.

[Raw Materials] Trimethylacetyl chloride was purchased from Aldrich Chemical Corporation (Milwaukee, Michigan, USA). Other reagents have been described above.

[Method] First, each of compounds 27 and 28 (1 mmol) was dried by concentrating together with pyridine (2 × 3 ml). Then dry dimethylformamide (3m
The residue was dissolved in a mixture of 1) and dry tetrahydrofuran (3 ml). After cooling the resulting solution in an ice bath, N, N-diisopropylethylamine (1 mmol) was added and trimethylacetyl chloride (1 mmol) was added slowly with stirring. Stirring was continued in the ice bath for 45 minutes. Then, a solution containing 3-amino-1,2-propanediol (1.2 mmol) in dry dimethylformamide (3 mmol) was added, and the resulting mixture was warmed to room temperature and stirred for 1 hour. The reaction was monitored by thin layer chromatography using a methylene chloride / methanol / acetic acid (10: 1: 0.1) solvent system. Based on this analysis, the reaction was determined to be approximately 90% complete. The reaction mixture was then concentrated under vacuum, diluted with ethyl acetate (100ml) and transferred to another container. Saturated sodium bicarbonate solution (2 × 50
ml) and water (50 ml) to wash the organic solution. After drying over anhydrous MgSO ₄ , the organic layer was concentrated to dryness. Generally, the resulting product was determined to be above 95% pure and was used in the next step without further purification. However, if purification is required, methylene chloride /
Performed by flash chromatography on silica gel using a methanol (40: 1) solvent system. (2
9) and (30) The purity was confirmed by ¹ H-NMR analysis.

(C) 1-O-dimethoxytritylation of (29) and (30) The starting materials and method for this synthesis are described in Example 3 (b).
This is the same as described in (b). The purity of these raw materials was confirmed by H-NMR.

(D) Corresponding 2-O- of the compound described in part (c) above
Conversion to (N, N-diisopropylethyl) -phosphoramidites (22) and (23): The raw materials and method for this synthesis are as described in Example 3 (b) (c). . The purity of these raw materials was confirmed by P-NMR.

Example 3 (d) 3-N- (6-aminocaproyl) -amino-1,2-
Synthesis of further extended analogs of the propanediol basic linker reagent. The steps specific to this synthesis are illustrated in FIG. 8 and described below.

(A) 1-O- (dimethoxytrityl) -3-N-
Synthesis of (6-aminocaproyl) -amino-1,2-dihydroxypropane (32).

[Raw Materials] Compound (31) was produced as described in (c) of Example 3 (c).

[Method] Concentrated ammonium hydroxide and pyrazine (10 m
l) using compound (31) (0.89 g,
1.1 mmol) was ammonolysed. An appropriate amount of the reaction product was spotted on a silica gel TLC plate, treated with a ninhydrin reagent, and deprotection of the primary amine was observed. Then the reaction mixture is evaporated to dryness under vacuum and the resulting residue (32)
Used for next step without purification.

(B) Coupling of compound (32) using compound (28).

[Raw materials] Compound (28) was produced as described in (a) of Example 3 (c).

[Method] According to the method described in (b) of Example 3 (c), N-Fmoc-aminocaproic acid (28,
1.1 mmol) with trimethylacetyl chloride (1.
1 mmol). Then, also in this case, a solution containing compound (32) (1.1 mmol) in dry dimethylformamide was added by the method described in (b) of Example 3 (c) above. The resulting addition product (33) was purified by flash chromatography on silica gel using a chloroform / methanol (30: 1) solvent system as described in the previous example. Product yield was 250 mg (23%).

(C) 2-O- (N, N-diisopropylamino) -methoxyphosphoramidite (2) corresponding to compound (33)
Conversion to 4).

[Method] The method is basically the same as that described in (c) of Example 3 (b). That is, compound (3) was prepared in dry methylene chloride containing N, N-diisopropylethylamine (198 ul, 1.14 mmol).
3) (240 mg, 0.285 mmol) was added to N, N-diisopropylamino-chloromethoxyphosphine (73
ul, 0.371 mmol). The reaction was diluted with 2% triethylamine in ethyl acetate (50 ml) and saturated aqueous sodium bicarbonate (25 ml)
And extracted with water (25 ml). The resulting organic layer was dried over anhydrous sodium sulfate and concentrated. The residue was dissolved in a few milliliters of ethyl acetate as described in the previous example and then precipitated with hexanes (150 ml). (3
The yield of 2) was 200 mg and its purity was H- and ³²
Confirmed by P-NMR spectroscopy.

Example 4 Automatic coupling of a synthetic oligonucleotide with a linker based on 2- (3-aminopropyl) -1,3-dihydroxypropane. The linker reagent described in Example 1 (hereinafter referred to as “L
1 ". ) And various synthetic oligonucleotides are described.

(A) The "L1" reagent was attached to the 5'-end of the deoxyoligonucleotide. The sequence "5'-GCTCGTTGCGGGACTTA" on a porous glass control support by a model 380A DNA synthesizer (Applied Biosystems, Inc.) using standard phosphoramide (phosphamidite) chemistry.
A deoxyoligonucleotide having "ACCCAACAT-3 '" was synthesized. The 5′-dimethoxytrityl group was removed, and “L1” in a dry acetonitrile solution (0.1
M) was coupled twice using a standard coupling cycle. By measuring the absorbance at 498 nm of the dimethoxytrityl released at the end of each binding cycle,
The percent coupling of the first and second addition of "L1" was quantified relative to the amount of full-length deoxyoligonucleotide. These values are 29% and 42%, respectively.
Was measured. By gel electrophoresis using 20% polyacrylamide gel containing 7M urea, 5 ′-(L
1)-and 5 '-(L1)-(L1) -oligonucleotides were purified. The corresponding bands were visualized by ultraviolet shadowing and were evaluated to migrate slowly over the gel with a spacing approximately 1.5 times that of the corresponding additional nucleotides. These bands were excised and linker-modified deoxynucleotides were recovered and purified by standard methods.

(B) The "L1" reagent was attached to the 3'-end of the deoxyoligonucleotide. In this synthesis, a Teflon oxidizable solid support (Molecular Biosystems, Inc., Cat. # OSS-01, San Diego, USA) was used. When the deoxyribonucleotide is cleaved from this support, the compound used during the first binding cycle remains at the 3'-end together with the 3'-terminal phosphate group. "L1" in dry acetonitrile (0.2 M) was coupled to the support using three coupling cycles with standard phosphoramidite chemistry on a Model 380A DNA synthesizer from Applied Biosystems, Inc. Next, a deoxyoligonucleotide sequence identical to the sequence shown in (a) above was added using the same coupling chemistry. The percent initial coupling with the "L1" reagent was determined as described above and was 40%, 63% and 63% for the first, second and third couplings, respectively.
%Met. After removing the terminal dimethoxytrityl group from the resulting trimer, a deoxyoligonucleotide having the same sequence as in 4 (a) was attached by standard phosphoramidite chemistry. Next, the support material was removed from the synthesizer and treated with concentrated ammonium hydroxide at 55 ° C. for 16 hours. The support was then washed three times with water and treated with 50 mM NaIO ₄ in 20 mM sodium phosphate buffer (pH 7.4) for 2.5 hours at room temperature. Finally, the support was washed several times with water and treated with a 10% aqueous solution of n-propylamine at 55 ° C. for 3 hours. The resulting solution was applied to a 20% polyacrylamide gel containing 7M urea and electrophoresed. The corresponding 3 '-(L1)-(L
1)-(L1) deoxyoligonucleotide was recovered as described above.

(C) The sequence "5'-AAATAACGAACCCTTG
"AG" at the 3'-end of the deoxyoligonucleotide having CAGGTCCTTTCAACTTTGAT-3 '.
1 "was bound. This synthesis method is the same as the method described in item (b), except that the biosearch model 875 is used.
A 0 DNA synthesizer was used.

(D) The sequence "5'-CAGTCAAACTCTAGCC
"L" is added to the 3'-end of the deoxyoligonucleotide having "ATTACCTGTCTAAAGTCATTT-3 '".
1 "was bound. Again, the method described in (b) was used, except that the automation part of the synthesis was performed on a Biosearch Model 8750 DNA synthesizer.

(E) a synthetic deoxyoligonucleotide containing a 2- (3-aminopropyl-1,3-dihydroxypropane linker ("L1") inserted between nucleotide bases;
Probe hybridization and melting point (T
m). Starting material : Two L1-derivatives of 33-mer deoxyoligonucleotide probe were synthesized by a method similar to the above. “L1-insert” is nucleotide residue 2
With L1 inserted between 1 and 22 (counting from the 5'-end). “L1-substituted” has L1 between nucleotide residues 20 and 22 as a substitution at residue 21. Both probes have a sequence complementary to the ribosomal RNA from Chlamydia trachomatis ("Target rRN").
A "). These probes were labeled with ¹²⁵ I according to a standard protocol developed by Gen-Probe, Inc. "Hydroxyapatite" (HA
P) was obtained from Bering Diagnostic, Calbiochem Division (La Jolla, CA). Sodium dodecyl sulfate (SDS), sodium phosphate (mono and dibasic salts) and hydrochloric acid were reagent products of Fisher Scientific Corporation. Beta gel (liquid scintillation cocktail) was obtained from Westchem (San Diego, CA). All other materials were reagent products. Unless otherwise noted, operations were performed in 1.5 ml screw-cap polypropylene eppendorf tubes. Hybridization was performed as follows. 48 μl of 1 M sodium phosphate (pH 6.
8) 10 μl of 1% SDS (v / v), 10 μl
¹²⁵ I-labeled probe (about 200000 CPM), 2
9.5 μl water and 2.5 μl rRNA solution (0.
5 μg, “target”) or 2.5 μl water (“control”)
Was mixed and incubated at 60 ° C. for 1 hour. Next, a 10 μl aliquot was added to 1 ml of 0.12 M sodium phosphate (pH 6.8) /0.02% SDS / 0.02%
Diluted in sodium azide and vortexed for 5 seconds. The diluted aliquot was incubated in a water bath and heated from room temperature to 80 ° C. Aliquots were removed at that temperature and stored on ice. Then, 0.12 M sodium phosphate (pH 6.8) /0.02% SDS / 0.02
The sample was passed through a small column of hydroxyapatite equilibrated with 5% sodium azide and the eluent was counted by scintillation using standard methods. (The count remaining attached to the column corresponds to the hybridized probe). The Tm value was calculated as the temperature at which 50% of the initially formed hybrids heat denatured to single strands. Results: Probe Tm L1- = insertion 69 ° C. L1-substitution 66 ° C. The above data show that both probes hybridized to the target rRNA as expected and that the Tm of the “inserted” probe was about 3 degrees higher than the Tm of the “substituted” probe. Indicates that

Example 5 It was demonstrated that "L1" modified deoxyoligonucleotides can be labeled with biotin and fluorescein.

(A) 5 ′-(L1)-and 5 ′-(L1)-(L1) -modified deoxyoligonucleotides described in Example 4 (a) above (“5′-L1-GCTCGTTGCGGGGA
CTTAACCCAACAT-3 'and "5'-L1
-L1-GCTCGTTGCCCCACTTAACCC
AACAT-3 '") was labeled with P-32. Ingredients : Alpha-32p-adenosine triphosphate was purchased from New England Nuclear (Dupont, Boston, Mass., USA). Terminal deoxynucleotidyl transferase (TdT)
And 5X tailing buffer are available from Bethesda Research
Laboratories (Gaithersburg, Maryland, USA). 20 picomoles of 5'-
(L1)-(L1) modified oligonucleotide at 37 ° C.
For 1 hour with 16.5 picomoles of alpha-P-32 adenosine triphosphate (specific activity 3000 Ci / mmol) and 40 units of TdT in 20 μl of 1 × tailing buffer. The resulting P-32 labeled oligonucleotide was applied to a Nensorb-20 (TM) column (New England Nuclear, Dupont Corporation, Boston, Mass., USA) according to the manufacturer's procedure (which is incorporated herein by reference). Purified).

(B) P-32-labeled 5 '-(L1)-(L1) -oligonucleotide was converted to biotin-E-aminocaproic acid N-
Hydroxysuccinimide (“Bio-X-NHS”,
(Calbiochem-Bering Corporation, San Diego, California, USA). Streptavidin-agarose was purchased from Bethesda Research Laboratories (Gaithersburg, MD, USA) and D (+) biotin was purchased from Calbiochem-Bering Corporation (San Diego, CA, USA). One picomole of each of the above modified oligonucleotides was
2.5 mmol Bio-X-N in 125 mmol borate buffer (pH 9) containing 2.5% dimethyl sulfoxide
The mixture was reacted with HS for 1.5 hours. A small aliquot of the resulting reaction mixture is then aliquoted to 50 mM sodium phosphate (pH 7.4) in the presence ("non-specific binding") or absence ("specific binding") of 0.2 mg / ml D (+) biotin.
The binding to streptavidin-agarose in / 2 mmol EDTA / 0.5 NaCl was tested. Bound material was quantified by scintillation counting.

Binding of these L1-modified oligomers to biotin was also confirmed by electrophoresis of an aliquot of the reaction mixture on a 20% polyacrylamide / 7M urea gel. Visualization of a representative band by autoradiography showed an almost quantitative conversion to the biotinylated form, which migrated more slowly than the non-biotinylated control.

(C) 3′-L1-modified deoxyoligonucleotide described in Example 4 (c, d) (“5′-AAATAACGA
ACCCTTGCAGGTCCTTTCAACTTTG
AT-L1-3 '"and"5'-CAGTCAAAAC"
TCTAGCCATTACCTGCTAAAGTCAT
TT-L1-3 ′ ”) were labeled with fluorescein isothiocyanate and biotin-X-NHS, respectively. First, the method of Maxam and Gilbert (Proceedings of the National Academy.
Of Sciences of the USA,
The oligonucleotides were kinased by ^{- [32} P gamma] adenosine triphosphate 1977,74 Volume 560 pp., Using a by reference as part of the description) in accordance with T4- polynucleotide kinase this. Fluorescein isothiocyanate (F
ITC, Sigma Chemical Company, St. Louis, Missouri, USA). Forty picomoles of this oligomer are combined with 90% DMSO in 0.1 M
90 mmol of FITC and 1 in borate buffer (pH 9)
The reaction was performed for 2 hours. The reaction mixture was then electrophoresed on a 20% polyacrylamide / 7M urea gel.
Bands were visualized by autoradiography. The top band was cut off from each lane, and the FITC-labeled oligomer was recovered from the gel and purified. The binding of the oligonucleotide to fluorescein was confirmed using a binding assay to an anti-FITC antibody derivatized solid support. Advanced anti-FITC magnetic microsphere
Magnetics, Inc. (Cambridge, Mass., USA, Catalog #
4310). Aliquots of the purified ³² P-labeled FITC-modified oligonucleotide were added to 0.5 μl containing 20 μl of anti-FITC microspheres in the presence (“non-specific binding”) or absence (“specific binding”) of 20 mM hydrolyzed FITC. Buffer (50 mmol sodium phosphate, pH 7.4 / 2 mmol EDTA / 0.5 mol Na
Cl). After one hour, the microspheres were removed by magnetic separation and the supernatant was counted by Zerenkov radiation to determine the amount of bound material: Percent non-specific binding: 0.1% Percent specific binding: 80.2% Second modification The oligonucleotide was reacted with biotin-X-NHS. Forty picomoles of this oligomer are converted to 20% D
Treated with 10 mmol of biotin-X-NHS in 0.1 M borate buffer (pH 9) containing MSO for 1 hour.
The resulting biotinylated oligomer was purified by the above-mentioned polyacrylamide gel electrophoresis. The presence of biotin bound to the oligonucleotide was confirmed by binding analysis on streptavidin-agarose as described above in this example.

Percent non-specific binding: 0.3% Percent specific binding: 87.4% Example 6 Resistance of 3'-L1-modified deoxyoligonucleotides to phosphodiesterase-catalyzed hydrolysis. Ingredients : Phosphodiesterase from Crotalus-Durissus was purchased from Boehringer-Mannheim Biochemicals (Indianapolis, Indiana, USA). This enzyme has the 3'-
Exonucleolytic cleavage from the end was catalyzed.
"5'-AAATAACGAACCCTTG on an Applied Biosystems model 380A DNA synthesizer using standard phosphoramidite chemistry
A synthetic deoxyoligonucleotide having the sequence "CAGGTCCTTTCAACTTTGAT-3 '" was synthesized. According to the method described in Example 4, a probe having the same sequence but having a 3′-L1 linker bound thereto was synthesized. Both oligonucleotides were prepared according to the method described in Example 5.
^It was kinased with ³² P. Each labeled oligonucleotide about 350000CPM, 3 × 10- ⁵ or 3 ×
Buffer (0.1M Tris-HCl, pH 8.0 / 20 mM MgCl ₂₎ containing a phosphodiesterase 10 ⁶ units were reacted in 10 [mu] l. 1.5 μl aliquots were removed at 5, 10, 15 and 30 minute intervals. The reaction was quenched by adding 3 μl of 0.1 N NaOH. Next, 5 μl of 90% formaldehyde containing bromophenyl blue and xylanol XCFF dye was added to each aliquot and the resulting samples were electrophoresed on a 20% polyacrylamide / 7M urea gel. The gel was then analyzed by autoradiography. The 3'-L1 modified oligonucleotide was found to exhibit greater than 95% resistance to phosphodiesterase-catalyzed hydrolysis after 30 minutes with both concentrations of the test enzyme. There was essentially no visible full-length unmodified oligonucleotide on the gel, but it has been shown that this enzyme usually cleaves oligomers without a 3'-L1 group.

Example 7 Automatic incorporation of ligation reagents based on 2,2-di- (3-aminopropyl) -1,3-dihydroxypropane into synthetic oligonucleotides. The incorporation of the ligation reagent (hereinafter referred to as “L2”) described in Example 2 is due to insertion of a synthetic oligonucleotide between bases, and the sequence “5 ′”
-CGTTACTCGGATGCCCAAAT (L2)
ATCGCCACATTCG-3 '"was generated. The method used was similar to the method described in Example 4 (a), except that the "L" in the thirteenth combined cycle was not the final combined cycle described in Example 4 (a).
2 "(0.1 M) in acetonitrile). As estimated from the amount of dimethoxytrityl released, the binding efficiency with “L2” was about 30% (see Example 4 (a)).

Example 8 Automatic incorporation of ligation reagents based on 3-amino-1,2-propanediol into synthetic oligonucleotides. The sequence "5'-CCCGCACGTCCTATT (L3) A
The incorporation of this ligation reagent (hereinafter, referred to as “L3”) into the synthetic oligonucleotide having ATCATTACGATGG-3 ′ was performed according to the method described in Example 4 (a). In this example, a solution of “L3” (0.3
M, in dry acetonitrile) were reacted in the 15th binding cycle. As assessed from dimethoxytrityl release (see Example 4 (a)), the coupling efficiency at this stage was about 60%.

Example 8 (a) Ligation reagents 20, 21, 2 to synthetic oligonucleotides
Automatic integration of 2, 23 and 24. Linking reagent 20-
24 (this synthesis was performed in Example 3 (a) -3).
(D)) and in the manner described in Example 4 (a). The corresponding linkers combining these reagents are hereinafter referred to as “L4”, “L5”, “L6”,
Called "L7" and "L8". That is, in a specific embodiment corresponding to the use of one of the aforementioned reagents, a 0.12-0.2 M solution of the reagents (in dry acetonitrile)
To Applied Biosystems Model 380A
Ranked # 6 on a DNA synthesizer (Foster City, California, USA). Incorporation of reagents into the oligonucleotide polymer was performed according to a standard phosphoramidite coupling protocol. A series of oligonucleotides, 17-35 bases in length, with linkers L4-L8 inserted at various positions in the sequence, respectively, was prepared. Trityl release was measured at the end of the conjugation cycle, with conjugation efficiencies associated with these reagents ranging from 75% to 98%.

Example 9 Labeling of an amine linker-arm probe with acridinium ester and subsequent purification. 25 mM stock solution of acridinium ester (for composition, Weeks et al., "Clinical Chemistry", vol. 29,
1474, (1983)) was prepared in distilled DMSO. The desired amount of polymer produced in Examples 4, 7 or 8 (a) was concentrated to dryness in a 1.5 ml conical polypropylene tube. The following cocktail was constructed by sequentially adding the components listed below: 3 μl H ₂ O 1 μl 1 M HEPES (8.0) 4 μl DMSO (distilled) 2 μl 25 mM acridinium ester, DMSO
(Distillation) The mixture was swirled during the
Spin for 2 seconds (collect the contents at the bottom of the tube) and incubate at 37 ° C. for 20 minutes. At that time, the components listed below were added to the reaction cocktail in order: 3 μl 25 mM acridinium ester, DMSO
1.5 μl H ₂ O (distilled) 0.5 μl 1 M HEPES (8.0) Again the cocktail was swirled, spun and incubated at 37 ° C. for a further 20 minutes. 0.1M HEP
ES (8.0), 5 μl of 0.125 in 50% DMSO
Unreacted label was quenched with a 5-fold excess of lysine by adding M-lysine and incubated for 5 minutes at room temperature. At that time, the acridinium ester-labeled oligomer was purified by the following method. To 20 μl of the quenched reaction mixture, add 30 μl of 3M naOA
c (5.0), 245 μl of H ₂ O and 5 μl of glycogen were added as carriers (glycogen was pretreated to remove all nuclease activity). The sample was swirled briefly and 640 μl absolute EtOH was added. The sample is swirled briefly and incubated on ice for 5-10 minutes, then 15000 rpm in a small centrifuge.
Centrifuged at pm for 5 minutes. The supernatant was carefully removed and the precipitate was washed with 2071 0.1 M NaOSc (5.0),
Redissolved in 0.1% SDS. The sample was further purified by ion exchange high performance liquid chromatography (HPLC) as follows. 20 μl of the redissolved precipitate was injected onto a Nucleogen-DEAE 60-7 ion exchange HPLC column mounted on an IBM9533 HLPC system. All buffers used in this method were prepared by HPLC water acetonitrile _(CH 3 CN) and sodium acetate (NaOAc), and reagent grade glacial acetic acid (HOAc) and LiCl. In addition, all buffers were filtered through a 0.45-μm pore size nylon-66 filter before use. Total 26 monomer units (of which 1
In embodiments of nucleotide / non-nucleotide multimers having only non-nucleotide monomer units), the following elution protocol was used. Buffer A
Is 20 mmol NaOAc, pH 5.5, 20% CH
₃ CN. Buffer B contains 20 mM NaOAc
(PH 5.5), 20% CH ₃ CN and 1 mol LiC
l. 30% from 55% buffer A, 45% buffer B
Flow rate 1 by linear gradient to% buffer A, 70% buffer B
Eluted at 25 ml / min for 25 minutes. The absorbance at 260 nm was monitored during the elution. 0.5 ml fractions were collected in 1.5 ml conical polypropylene tubes. Immediately after elution, 5 μl of 10% SDS was added to each tube, and then each tube was swirled (this was done to ensure that the acridinium ester-labeled probe was not attached to the tube wall. ). 0.5 μl aliquots in fraction 2
Removed from 1-42 and added to 200 μl water in a 12 × 78 mm tube (a separate pipette tip was used for each aliquot to avoid carryover problems). next,
200 μl of 0. 0 in Bertoid clinyl mat.
After auto-injecting 25N HNO ₃ , 0.1% H ₂ O ₂ , then 200 μl 1N NaOH with a 1 second delay,
The chemiluminescence of each aliquot was measured by reading the chemiluminescence for seconds. 5 µ each in fractions 29-33
of glycogen, each vortexed, 1 ml of EtOH added to each vortex, incubated on ice for 5-10 minutes, 15000 rpm in small centrifuge
They were EtOH precipitated by centrifugation at for 5 minutes. Carefully remove each supernatant and remove 20 μl of each precipitate.
Redissolved in 1 l of 0.1 M NaOAc, pH 5, 0.1% SDS, and the separated fractions were pooled. The examples above have demonstrated that the reagents of the invention can be prepared as each having a non-nucleotide backbone, first and second binding groups and ligands, all as described above in the Summary of the Invention. In particular, the reagent (5)
A non-nucleotide propyl backbone to which the first linking group of methyl-N, N-diisopropylphosphamide is attached;
It has a 1-hydroxy second linking group protected by dimethoxytrityl (DMT), and a ligand in the form of an aminopropyl-linked art protected by trifluoroacetyl. Reagent (10) is substantially the same as reagent (5), except that in the latter case two identical ligands (2
There are two protective linking arm forms (trifluoroacetylaminopropyl). Also, reagent (13) is similar to reagent (5), except that the non-nucleotide backbone is ethyl rather than propyl, the linking arm is short, and only trifluoroacetyl protected methylamine is used. Aminopropyl is not. Also, as demonstrated above, the use of a single reagent of the invention provides a linking arm specifically only at a pre-selected position (s) of a nucleotide multimer without introducing unwanted nucleotides. be able to. Also, as already described, by linking the backbone to nucleotides and another backbone,
(This is then linked to another backbone, resulting in a chain). The reagents of the invention introduce a series of adjacent ligands (eg, labels or linking arms to which labels can be attached) into the nucleotide multimer. It can be done. That is,
By linking multiple adjacent labels to a probe, the sensitivity of a hybridization assay using the probe can be increased. Furthermore, by additionally using one of the non-nucleotide backbones of the present invention or a series of non-nucleotide backbones linked in succession between the two nucleotide sequences of the probe complementary to the corresponding sequence of the target nucleotide multimer. Can be bridged and cross-linked by a single different nucleotide or different sequence in the sample. That is, the target nucleotide multimer may actually be a group of two or more nucleotide multimers consisting of a consensus nucleotide sequence of interest, which may be a single different nucleotide of interest or one another Crosslinked by different nucleotide sequences. Even where a single target sequence is of interest, it is possible to produce a probe with a complementary sequence having a non-nucleotide monomer unit with a label group attached between any two nucleotides. In that case, the probe will hybridize to the target nucleotide sequence in the usual manner, but the monomer units bearing the labeling group will tend to be arranged in a manner that does not interfere with the aforementioned hybridization (ie, it will “loop out” from the hybrid structure). It's easy to do). This arrangement is based on the use of the insertion (intercalation) effect (procedures of the National Academy of Sciences of the USA, vol. 81,
3297-3301), for example, perhaps in situations where improved probe specificity is desired. Of course, the fact that the present invention uses non-nucleotide monomer units, together with prior probes using nucleotide monomer units, significantly reduces the aforementioned types of interference. As described in the “Summary of the Invention”,
Compounds (4), (9) and (12) can be attached to the solid phase synthesis support via their primary hydroxyl groups (see the texts of Gaith and Salang, supra, for techniques compatible with the application). These derivatized supports were used for additional polymer synthesis, resulting in the attachment of non-nucleotide monomer units to the 3'-end of the resulting nucleotide / non-nucleotide polymer. Many modifications can be made to the above invention. For example,
Ligands may in fact be labels or intercalators (intercalators) incorporated into the reagents of the invention before they are linked to the nucleotides of the nucleotide multimer. Further, as mentioned in the Summary, various other protecting groups can be used in addition to the protecting groups of the specific examples above. However, the use of either one of the trifluoroacetyl and 9-fluorenylmethoxycarbonylamino protecting groups is particularly preferred. It is the conditions used for deprotection of exocyclic nucleotide amines in known standard oligonucleotide synthesis (typically at
濃 13 hours using concentrated NH ₄ OH) under the same alkaline conditions to deprotect the amine. Similarly,
The dimethoxytrityl 5 'hydroxy protection, methyl or beta-cyanoethyl phosphite O protection and the use of N, N-diisopropyl as the phosphite leaving group in the linkage all make the reagents sufficiently compatible with current standard oligonucleotide solid phase synthesis techniques. As such, the need for additional special steps is minimized. Other variations and alternatives to aspects of the invention will be readily apparent to those skilled in the art. Accordingly, the invention is not limited to those embodiments described in detail above.

[Procedure amendment]

[Submission date] July 8, 1999 (1999.7.8)

[Procedure amendment 2]

[Document name to be amended] Statement

[Correction target item name] Name of invention

[Correction method] Change

[Correction contents]

[Title of the Invention] Non-nucleotide ligation reagent for nucleotide probe

[Procedure amendment 3]

[Document name to be amended] Statement

[Correction target item name] Claims

[Correction method] Added

[Correction contents]

[Claims]

[Procedure amendment 4]

[Document name to be amended] Statement

[Correction target item name] Detailed description of the invention

[Correction method] Added

[Correction contents]

DETAILED DESCRIPTION OF THE INVENTION

[0001]

FIELD OF THE INVENTION The present invention relates to non-nucleotide reagents that can conveniently link a single or multiple moieties, such as labels or intercalators, to nucleotide probes at any particular selected location.

[0002]

BACKGROUND OF THE INVENTION In clinical research and diagnosis, known techniques for measuring the presence of specific nucleotide sequences (referred to as "target nucleotide sequences" or simply as "target sequences") in RNA or DNA are known as nucleic acid hybridization assays. It is an implementation. In this assay, a nucleotide multimer probe (typically an oligonucleotide) having a nucleotide sequence complementary to at least a portion of the target sequence is selected. Typically, the probe is labeled, ie, attached to an atom or group whose presence is readily detectable. When the labeled probe is exposed to a sample suspected of containing the target nucleotide sequence under hybridization conditions, the target will hybridize to such a labeled probe. The presence of the target sequence in the sample is usually qualitatively determined by separating the hybridizing and non-hybridizing probes and then measuring the presence of the label in the probe hybrid or by measuring the amount of label in the non-hybridizing probe. Can be measured quantitatively or quantitatively.

[0003] Historically, radioactive labels have been used. However, handling difficulties led to the later development of non-radioactive labels. Such labels include those whose presence is determined directly or indirectly. Examples of direct labels include labels that can be measured for chemiluminescence, phosphorescence, fluorescence or spectroscopy. Examples of indirect labels include compounds such as biotin and antigens detectable by proteins conjugated to a suitable detectable label.

[0004] Some conventional methods of attaching labels to nucleotide probes are typically based on linking a label to a nucleotide and then incorporating one or more of the above nucleotides into the probe. It is. For example, dUTP and UTP analogs containing a biotin moiety attached to the C5 position of the pyrimidine ring have been chemically synthesized and enzymatically incorporated into polynucleotides [P. R. Proceeding of the
National Academy of Sciences USA, 7
8, 6633 (1981)]. This biotin-labeled nucleotide can be incorporated into a biological or synthetic nucleic acid probe by an enzymatic method. In addition, the use of a 5'-allylamine precursor of the aforementioned analog has been proposed, as well, to be used to result in the incorporation of a nucleophilic amine moiety into a probe that can be linked to a label by conventional methods. Other deoxynucleotide triphosphate analogs have been enzymatically incorporated into the probe. Specifically, bromo dUTP and iodine dUTP were incorporated and detected immunochemically [Britwood et al., Journal of Pathology, 148, 61 (1986).
Year)]. Furthermore, 4-thio UTP [H. Eschyaupore et al., Nucleic Acids Research, Vol. 7, 1485
(1979)] was attached to the 3'-end of the DNA fragment, followed by labeling of the nucleophilic sulfhydryl moiety. Chien International Application (International Publication Number WO86 / 00)
074, published January 3, 1986) describes a technique in which a seemingly random pyrimidine base nucleotide is depyrimidinized, the resulting sugar ring is opened, and an amine-carrying moiety is attached thereto.

[0005] Labeling chemistry has also been proposed, which randomly attaches the label to some nucleotides in the nucleotide multimer. For example, N-acetoxy-
N-acetylaminofluorene was bound to guanine residues of nucleic acids and then detected by immunochemical methods [P. Proceedings of the National Academy of Sciences USA, 81, 3466 (1984)]. Another method of providing a nucleophilic amine group to which a label can be attached is bisulfite-catalyzed transamination at the C6 position of a cytosine residue of a nucleic acid probe [R. P. Visisi et al., Journal of Clinical Biology, 23, 311 (1986)
Year)]. Neither of the above chemical or enzymatic methods are capable of specifically labeling a single nucleotide, or if the method modifies the exocyclic amine of a nucleotide base, thereby preventing hybridization. With the disadvantages of

Other methods of attaching only one label to the nucleotide multimer, typically the 5'- or 3'-end of the oligonucleotide, have been reported. For example, such a method is described in C.I. F. Chu et al., Nucleic Acids Research, 11, 6513 (1983); Nucleic Acids Research, such as colette,
13, page 1529 (1985). As a final step in solid-phase oligonucleotide synthesis, another convenient end labeling method by label attachment has been reported. For example, B.
A. Connori, Nucleic Acids Research, 1
3, 4485 (1985); See Agrawar et al., Nucleic Acids Research, Vol. 14, p. 6227 (1986) and Connolly, Nucleic Acids Research, Vol. 15, pp. 3131 (1987).
However, these end labeling methods are limited in that only one label can be attached to the end of the nucleotide multimer.

Compounds have been proposed that can be used to insert primary amine-modified nucleotide residues at selected positions on synthetic oligonucleotides during the performance of standard automated synthesis methods. Such compounds include deoxythymidine, deoxyadenine, deoxyguanine and analogs of deoxythidine [G. B. See Drying et al., Proceedings of the National Academy of Sciences USA, 82, 968 (1985); L. Russ, International Application Publication No. WO84 / 03285, Publication Date 1
August 30, 984]. Theoretically, such compounds could have labeled nucleotides at some number of positions along the sequence, allowing the use of multiple labels to increase detection sensitivity. However, the use of such labeled nucleotides on the probe has been shown to reduce the stability of hybrids formed with the target sequence, especially when multiple labels are present. Such a decrease in hybrid stability has been shown for biogenic nucleic acid probes with multiple biotin moieties attached to uridine, cytidine, or adenine bases [R. P. Journal of Clinical Microbiology, such as Visisi,
23, 311 (1986); Gebeev et al., Nucleic Acids Research, 15, 4513 (1987)]. The decrease in hybrid stability also
Modified uridine, a synthetic oligonucleotide with multiple fluorescein labels attached to residues, has also been reported [J. Nucleic Acids
Research, 15: 4857 (1987)]. Such instability was also demonstrated for synthetic oligonucleotides with biotin and fluorescein labels attached to the N-4 position of the cytidine base. Furthermore, in order to place one or more labels at any desired position in a synthetic nucleotide, all or eight different compounds (4
Species are deoxyribonucleic acid multimers, and 4 are ribonucleic acid multimers)
It is necessary to have

Furthermore, a phosphate-linked nucleotide derivative capable of labeling a nucleophilic moiety after incorporation into an oligonucleotide has been reported [R. L. Letosinger and M.A.
E. FIG. Shot, Journal of American Chemical Society (1981) 103, 7394,
Sugimoto, JP-A-61-44353 and 61-57595
Nos., 61-44352, March 1986].
However, said compounds based on nucleotide derivatives should exhibit at least some of the disadvantages associated with the nucleotide-based derivatives described above. Furthermore, the above examples of linking agents cannot be used in current standard solid phase synthesis methods without modification of the method itself.

In the present specification and claims, terms are defined as follows. Nucleotide: a nucleic acid subunit consisting of a phosphate group, pentose and a nitrogen-containing base. In RNA, pentose is ribose. In DNA, it is 2-deoxyribose. The term also includes analogs of these subunits. Nucleotide multimer: a nucleotide chain or an analog thereof linked by a phosphoric diester bond. Oligonucleotide: generally about 10 to about 10 in length
A nucleotide multimer of 0 nucleotides but a length of 1
It can be larger than 00 nucleotides. These are generally thought to be synthesized from nucleotide monomers, but can also be obtained by enzymatic methods. Deoxyribooligonucleotide: an oligonucleotide comprising a deoxyribonucleotide monomer. Polynucleotide—A nucleotide multimer generally about 100 nucleotides or more in length. These are usually of biological origin or obtained by enzymatic methods. Nucleotide multimer probe—a second nucleotide multimer, usually a nucleotide multimer having a nucleotide sequence complementary to a target nucleotide sequence contained in a polynucleotide. Usually, the probes are selected to be completely complementary to the corresponding base in the target sequence. However, in some cases, it may be appropriate and desirable that one or more nucleotides in the probe not be complementary to the corresponding base in the target sequence. Typically, the probe is labeled. Non-nucleotide monomer units-these are monomer units that are not significantly involved in polymer hybridization. Such monomer units, for example, must not participate in significant hydrogen bonding of the nucleotides and exclude monomer units having one of the five nucleotide bases or an analog thereof as a component. Nucleotide / non-nucleotide polymer: A polymer containing nucleotide and non-nucleotide monomer units. When used as a probe, they are typically labeled. Oligonucleotide / non-nucleotide multimer--generally less than 100 nucleotides in synthetic but 200
Multimers that may exceed nucleotides and contain one or more non-nucleotide monomer units. Monomer unit: A unit of a nucleotide reagent or a non-nucleotide reagent of the present invention provided by a reagent to a polymer. Hybrid: A complex formed between two nucleotide multimers by Watson-Crick base pairing between complementary bases.

[0010]

SUMMARY OF THE INVENTION The present invention is directed to non-nucleotides that synthetically combine with specific nucleotide monomer units of a nucleotide reagent to form a well-defined polymer having a backbone containing nucleotide and non-nucleotide monomer units. The present invention provides a non-nucleotide reagent having a monomer unit. The non-nucleotide reagent may also be a linker arm moiety that can participate in a conjugation reaction when the linker arm is deprotected, or a sidearm to which a useful chemical moiety useful prior to initiating polymer synthesis is attached. Can have a ligand.
In general, the technique for attaching a moiety to a linker arm is similar to the technique for attaching a label to a group on a protein. However, this method needs to be modified. Examples of useful chemical means include the reaction of an active ester, active imine, aryl fluoride or isothiocyanate with an alkylamine, and the reaction of maleimides, haloacetyls, and the like with thiols. M. Means and R.A. E. FIG. Feney, "Chemical Modification of Proteins", Holden-Day, Inc. (1971), R.A. E. FIG. Feney, International Journal of Peptad Protein Research, 29 (1987) 145-16
See page 1]. Suitable protecting groups that can be used to protect the functional groups of the linker arm during polymer formation are similar to those used in protein chemistry [see, for example, "The Peptide Analysis Synthesis Biology", Vol. Gross and J.M. Mainhoffer, Academic Press (1971)]. Based on the chemistry of the non-nucleotide reagent, it can be placed at any desired location in the backbone. This allows a wide range of properties to be designed for polymers containing nucleotide monomers.

[0011] Among them, there are the following. (1) The attachment of a specific chemical moiety to any desired position in the polymer. Such moieties include (but are not limited to) detectable labels, intercalating agents (intercalating agents), chelating agents, drugs, hormones, proteins, peptides, haptens, radical generators, nucleolytic agents , Proteolytic agents, catalysts, receptor binding agents and other binding agents of biological interest, as well as agents that modify DNA transport across biological barriers (eg, membranes), and alter the solubility of nucleotide multimers. Modifying substances may be included. This means that such labels and intercalating agents can be located adjacent to any nucleotide of interest. (2) The ability to immobilize a well-defined sequence on a solid support using linker arms for attachment to chemical moieties of the support, for example to construct a nucleotide affinity support. (3) Ability to attach multiple chemical moieties to the polymer via linker arms by incorporating multiple non-nucleotide monomer units into the polymer.

(4) Ability to construct a polymer different from a natural polynucleotide in that the activity is changed by enzymes and proteins acting on the polynucleotide. For example, positioning non-nucleotide monomer units on the 3 'end of a pure polynucleotide results in resistance to degradation by snake venom phosphodiesterase. Such non-nucleotide monomer units can create specific cleavage sites for other nucleases. (5) Ability to construct a hybridization probe by interspersing hybridizable nucleotide monomer units and non-nucleotide monomer units. For example, a mixed block synthesis of nucleotide and non-nucleotide monomers can be performed, wherein a well-defined sequence of nucleotide monomers is synthesized, and then one or more non-nucleotide monomer units are extended to form a second well-defined sequence of nucleotide monomers. You may continue the block. (6) Ability to construct synthetic probes that can simultaneously detect target nucleotide multimers with one or more different base pairs. This is accomplished by replacing the nucleotides in the probe with non-nucleotide monomer units using the non-nucleotide reagents described herein at the site where differences occur in the nucleotide sequences of the various target nucleotide multimers.

In a preferred aspect of the invention, the labeled hybridization probes are constructed from defined sequences including nucleotide and non-nucleotide monomers. In another preferred aspect of the invention, non-nucleotide monomer units are used to link nucleotide multimers of two or more defined sequences, wherein the non-nucleotide monomer units are chemically used for hybridization reactions. Be labeled.

In yet another preferred embodiment, the non-nucleotides are constructed such that they can be added stepwise to produce a mixed nucleotide / non-nucleotide polymer using one of the current methods of DNA synthesis. . Such nucleotide and non-nucleotide reagents are typically added in steps so as to couple the corresponding monomer units to the developing oligonucleotide chain, which is covalently immobilized on a solid support. Typically, the first nucleotide is attached to the carrier using a cleavable ester bond before the start of synthesis. The gradual extension of the oligonucleotide chain is usually
Performed in the 3 'to 5' direction. For standard DNA and RNA synthesis methods, see, for example, "Synthesis and Application of DNA and RN".
A ", S.A. A. Narang, Academic Press (1
987); J. Get, "Oligonucleotide Synthesis", IRL Press, Washington, US
A (1984). After completion of the synthesis, the polymer is cleaved from the carrier by hydrolysis of the ester bond,
The nucleotide initially bound to the carrier becomes the 3'-end of the resulting oligomer.

[0015] In a similar manner, an alternative to introducing non-nucleotide monomer units is to add the DNA before the start of DNA synthesis.
There is a method of similarly binding to a synthetic carrier. In a preferred embodiment, the non-nucleotide monomer units are linked to the DNA synthesis carrier by an ester bond formed using the free alcohol form of the non-nucleotide monomer. Thus, the present invention provides reagents for making a polymer comprising a mixture of nucleotide and non-nucleotide monomer units. The non-nucleotide monomer further comprises 1
It contains one or more protected linker arms or one or more linker arms conjugated to a chemical moiety of interest, such as a label or intercalating agent.

Such non-nucleotide monomers have two or more coupling groups so that they can be further incorporated into the polymer of nucleotide and non-nucleotide monomer units. The first of the above coupling groups has a property capable of effectively binding to the terminal of the growing monomer unit chain. The second of the coupling groups has the ability to stepwise extend the growing mixed nucleotide and non-nucleotide monomer chains. This means that the first coupling group can be deactivated during attachment so that the second coupling group is substantially unattached, and then activated to attach non-nucleotide monomer units. I need. "Inactivation" preferably employs a protecting group for the second coupling group so that when removed, the second coupling group can be activated. However, such "inactivation"
And "activation" is achieved simply by altering the reaction conditions (eg, changing the pH, temperature, concentration of other components of the reaction system), wherein the second coupling group has an appropriate chemical structure, Assisting with inactivation and activation by technology is also within the scope of this invention. The coupling group allows adjacent nucleotide or non-nucleotide monomer units to be attached.
In a preferred embodiment, the coupling group is a standard D
It operates by coupling and deprotection reactions that are compatible with one of the NA synthesis methods.

[0017] Such a method involves the fact that the synthesis takes place in a non-directional manner and that all coupling cleavage and deprotection steps are carried out under “undesirable” conditions, ie that they are made up of a polymer backbone and its sugar, It needs to have no substantial adverse effect on the base, the linker arm and the labeling component as well as the monomeric reagent. Those skilled in the art can easily determine functional groups, coupling methods, deprotection methods and cleavage conditions that satisfy these conditions (see, for example, the above-cited reference of Get).

The non-nucleotide monomer preferably has a skeleton having a coupling group connected to the terminal. The skeleton is preferably an acyclic chain of 1 to 20 atom chains,
Acyclic hydrocarbon chains of 0 carbon atoms are preferred.

In one embodiment of the present invention, the reagent is selected from one of the following compounds (1) or (II). and

Any one of compounds (1) and (II) is selected
Nevertheless, the groups described are: (■) R²Is a non-nucleotide skeleton, (■) groupand Is a first coupling group, wherein X is²Is halogen
Or substituted amino, X⁴Is halogen, amino or
O⁻, R³Is alkyl, alkoxy, or phenoxy
Si, R⁵Is an alkyl, alkoxy, or aryl
Kishi or X⁴= O⁻Can be H only if¹-X¹-Is a protected second coupling group
Where X¹Is O, S, NH, or HN =
NR¹Is cleaved under coupling group deprotection conditions to give a second
Coupling group HX ¹-A protecting group capable of regenerating-(■) n is an integer (■) R⁴-X³-Is a ligand. This is preferably sensory
Deprotection from moieties or under appropriate conditions to functional moieties
Can be linked (again, under appropriate conditions).
Selected from a protected linking arm. The latter
If X³Is R in the linking arm⁴Is a protecting group.

More preferably, some of the above groups are as follows: X ² is C1 or secondary amino (preferably selected from dialkylamino, and heterocyclic N- amines), ^{R 3} is methoxy, ethoxy, chlorophenoxy, or ^{beta-cyanoethoxy,} X 3 -O, S, N
H, or terminate at HNN-, preferably having 1 to 25 atoms chain extending from ^{R 2, X 4} is, C1, secondary amino or ^O - ^{R 5} are methoxy, ethoxy, monochloro phenoxy or beta Only when cyanoethoxy or X ⁴ is O, H, X ² is more preferably diisopropylamino,
It is dimethylamino or morpholino. R ¹ is more preferably triphenylmethyl (this is a derivative thereof,
Typically includes dimethoxytriphenylmethyl) and X ¹ is O. R ² preferably has a secondary carbon attached to -O-. This allows the use of secondary alcohols during the synthesis, which has the advantage of producing reagents protected from alcohol in higher yields.

A method for preparing nucleotide / non-nucleotide polymers is also described. This method comprises the use of a non-nucleotide monomer unit and a ligand as described above attached thereto, and a non-nucleotide monomer unit under non- disadvantageous conditions for the first monomer unit and for one of the second separate monomer units or the solid support. Including coupling. At least one of the other monomer units described above is a nucleotide monomer unit. When choosing another monomer unit from the non-nucleotide reagent, it is, of course, possible to couple the monomer unit to another non-nucleotide monomer unit and continue. In a typical case,
The coupling described above is performed by a first coupling group and a protected second coupling group, both linked to a non-nucleotide monomer unit. That is,
The non-nucleotide monomer unit is first attached to the first nucleotide monomer unit by a first coupling group, and then the second coupling group is deprotected to convert the non-nucleotide monomer unit to a second nucleotide or another reagent. Couple to either one of the nucleotide monomer units. Preferred reagent chemical compositions that can be used in this method are those described above.

The products obtained from the above reagents and their preparation are also described. Also described is a polymeric probe comprising a plurality of nucleotide and non-nucleotide monomer units, and typically comprising at least one acridinium ester label moiety, which serves as a label and is linked to the corresponding monomer unit of the probe. Preferably, the acridinium ester moiety is a chemiluminescent acridinium ester label. Also described is a method for producing the above-described probe, comprising linking at least one of the above-described acridinium ester moieties to a corresponding monomer unit of a polymer having a plurality of nucleotide monomer units.

[0024]

EXAMPLES The synthesis of three different "linker" reagents of the present invention is described in detail in Examples 1-3 below. Example 4 below illustrates a method of making the substituted nucleotides of the present invention (particularly oligonucleotides), which has a skeleton of a reagent that binds to various specific preselected sites on the oligonucleotide. Example 5 illustrates the linking of a label to a linking group in a substituted nucleotide of the present invention, while Example 6 demonstrates the advantage obtained with the substituted nucleotide of the present invention, ie, against phosphodiesterase-catalyzed hydrolysis. It shows the advantage of resisting.

Example 1 2- (3-aminopropyl)-
1,3-Dihydroxypropane linker reagent The reaction scheme for this synthesis is shown in FIG. 1 and outlined below. (A) 2- (Nitrilepropyl) -diethyl malonate (1): The method used was Adam et al., Organic Synthesis, Vol. 1, pp. 250-251. Reagents: diethyl malonate, 3-bromopropionitrile and sodium ethoxide (21% ethanol solution)
Was obtained from Aldrich Chemical Company (Milwaukee, Wis.). Absolute alcohol (200 proof) is available from U.S.A. S. Obtained from Industrial Chemicals. Method: Dilute sodium ethoxide (0.1 mol) with absolute ethanol to a final volume of 100 ml. A solution of diethyl malonate (0.1 mol) in 50 ml of absolute ethanol is added dropwise with stirring. The reactor is sealed off with a CaCl ₂ drying tube. Stirring is continued for 1 hour at room temperature. Then a solution of 3-bromonitrile in 50 ml of absolute ethanol is added dropwise with stirring and the mixture is stirred overnight at room temperature.
The solution obtained is filtered to remove the precipitated sodium bromide, concentrated and extracted with diethyl ether (50 ml). The solution is then extracted with water (50ml), dried over anhydrous sodium sulfate and concentrated to an oil. Thin layer chromatography on silica plate using chloroform as the mobile phase and color development with iodine vapor reveals three spots: Rf 0.58, 0.51 and 0.38, each of which is malonic acid Diethyl, 2- (nitrilepropyl) -diethyl malonate and 2,2-di-
(Nitrilepropyl) malonate. After refrigeration for several days, the crystals were separated from the crude oil by filtration, dissolved in toluene (10 ml) and recrystallized by adding hexane to give 3.28 g (yield: 12%) of a white solid; Chromatography (as above), Rf 0.38.
The structure of this compound was confirmed by ¹ H-NMR (CDCl ₃ ) to be 2,2-di- (nitrylpropyl) malonate (6): δ 1.30 (t, 6H), 2.26 (t, 4H). , 2.47
(t, 4H), 4.27 (q, 4H). The filtered oil is distilled under vacuum to obtain the target compound (1). (Bp 99-103 ° C, 0.3
mmHg), yield 20%; ¹ H-NMR (CDCl ₃ ) analysis: δ 1.24. (t, 6H), 2.19
(q, 2H), 2.47 (t, 2H), 3.46 (t, 1H), 4.18 (q, 4H).

(B) 2- (3-aminopropyl) -1,
Synthesis of 3-dihydroxypropane (2) Reagents: In addition to those described in (1), lithium aluminum hydride (0.1 M solution in diethyl ether) was obtained from Aldrich. Method: 2- (3-) in anhydrous diethyl ether (50 ml)
Nitrile propyl) -diethyl malonate (1, 3.2
1 g, 15.1 mmol) of lithium aluminum hydride (0.1 g in 100 ml of diethyl ether) in a stream of nitrogen.
(1 mol) is added dropwise to the stirred solution. The resulting mixture is refluxed for 2 hours and then stirred at room temperature overnight.
Next, sodium hydroxide 2.5 mM in water (100 ml)
The solution is added slowly to quench unreacted hydride. The mixture is stirred for 2 hours and the ether layer is decanted and discarded (the product remains in the aqueous phase). The white gelatinous solid was removed from the aqueous layer by centrifugation, washed with water,
The aqueous supernatant and the washings are combined and evaporated under vacuum to give a syrup. Thin layer chromatography (Analtech reverse plate, water mobile phase, ninhydrin color reagent) gives the desired compound (2) identified as the major spot;
f 0.48, and the side spots are considered to be condensation by-products: Rf. 0.29. The target compound (2) was subjected to cation exchange chromatography (Dowex 50 ×
8, 0.5M-HCl mobile phase) to give a final yield of 50%. ¹ H-NMR analysis (D ₂ O): δ 1.36 (clear quartet, 2H), 1.68 (m, 3H), 2.97 (t, 2H), 3.57 (d, 4H).

(C) 2- (3-N-trifluoroacetylaminopropyl) -1,3-dihydroxypropane (3): The method is described in Method in Entology, incorporated herein by reference. The method of Gold Finger in Vol. 11, page 317 is adopted. Reagents: (in addition to the above) S-ethyl-trifluorothioacetate was obtained from Aldrich. Method: Dissolve 2- (3-aminopropyl) -1,3-dihydroxypropane (2) (3 mmol) in water (25 ml). The pH of the solution is brought below 9.5 by dropwise addition of 6N HCl. The following reaction is carried out in a hood: S-ethyl trifluoroacetate (2 ml) is added dropwise to the vigorously stirred solution; 6 N KOH is added dropwise, maintaining the pH at 9.5 to 10.0. After 30 minutes, while maintaining the pH as above, add the same ml of S-ethyl trifluoroacetate. The mixture is stirred for a further 45 minutes. The pH is then adjusted to 7 with 6N KOH and the mixture is concentrated to dryness on a rotary evaporator under vacuum. The residue is stirred with acetone (20 ml) and filtered to remove the potassium acetate precipitate. The filtrate was concentrated to a syrup and again acetone (2 m
l) and dissolved in silica gel (Baker Chemical Company (Vilsburg, New Jersey, USA)
(Average particle diameter 40 μm). The column is eluted with a 50:50 (v / v) solution of methylene chloride / acetone (500 ml) and fractionated in 25 ml portions. Each fraction is spotted on a silica gel plate in 2 μl portions, sprayed with a 10% aqueous piperidine solution, left for 15 minutes, dried with a heat gun, and then treated with a ninhydrin reagent to analyze the contained products. Neglecting the piperidine spray treatment prevents confirmation of the primary amine trifluoroacetone by the color reaction with ninhydrin. In this method, the product is fraction 1
3-18, these fractions are collected and concentrated on a rotary evaporator to give a colorless oil. Rf
0.4 (silica gel thin layer chromatography using the same solvent system and the same color development method as above).

(D) 1-0- (dimethoxytrityl)-
2- (3-N-trifluoroacetylaminopropyl-
Synthesis of 1,3-dihydroxypropane (4): Reagents: (in addition to the above), dimethoxytrityl chloride was obtained from Aldrich (USA). Reflux the methylene chloride, distill it with CaH ₂ , and fill a 4 Å molecular sieve. Pyridine is distilled by adding potassium hydroxide granules and paratoluenesulfonate and stored in dry nitrogen gas. Method: 2- (3-N-trifluoroacetylaminopropyl) -1,3-dihydroxypropane (3) (362)
mg, 1.58 mmol) are dried several times with dry pyridine under reduced pressure and then further dried under full vacuum for several hours.
The residue was then dried in a stream of dry nitrogen in 10 ml of dry pyridine.
Dissolve in. Dimethoxytrityl chloride (401 mg, 1.18 mmol) in dry methylene chloride (1.5 ml) is added with stirring and the resulting solution is stirred at room temperature for 1 hour. The solvent is removed under reduced pressure and the residue is dissolved in chloroform (50ml). The solution is extracted three times with a 5% aqueous sodium hydrogen carbonate solution, and then dried over anhydrous magnesium sulfate. Concentrate the resulting solution to obtain an oil. Redissolved in 2 ml of chloroform, and chloroform / ethyl acetate / pyridine (95: 5: 0.2
v / v / v) and fractionation by flash chromatography as above. Each fraction is analyzed by thin layer chromatography on a silica gel plate using the same solvent system. The spots were developed with fuming HCl and the Rf values 0.27, 0.87, 0.93 corresponded to the 1-dimethoxytrityl product (4), dimethoxitritanol and 1,3-di- (dimethoxytrityl) The product was confirmed to be a product. The latter substance can be shaken with a mixed solution of 4% dichloroacetic acid in a saturated aqueous solution of methylene chloride and hydrolyzed to obtain the target substance (4). The product (4) is separated from the relevant fractions by evaporation of the solvent and dried under full vacuum to give a foam (370 mg, 44%).

(E) 1-O- (dimethoxytrityl)-
2- (3-N-trifluoroacetylaminopropyl)
Synthesis of -3-O- (methyl-N, N-diisopropylphosphoramido) -1,3-dihydroxypropane (5): Reagents: (in addition to those listed above) N, N-diisopropylethylamine and N, N-diisopropylethylamine N-diisopropylmethylphosphoramidic chloride is available from Aldrich (US
A). Dimethylformamide is refluxed,
CaH ₂ was added and distilled and filled into 4 Å molecular sieves. Force method: 1-0- (Dimethoxytrityl) -2- (3-trifluoroacetylaminopropyl) -1,3-dihydroxypropane (4300 mg, 0.56 mmol) was evaporated and dried several times with dry pyridine and dried dimethyl Dissolve in 10 ml of formamide. The following reaction is carried out in a stream of dry nitrogen: N, N-diisopropylethylamine (24
5 μl, 1.3 mmol) with stirring and then add N, N-diisopropylmethyl phosphoramidic
Chloride (140 μl, 0.7 mmol) is added.
The reaction mixture is stirred for 2 hours. Then the mixture is concentrated under reduced pressure and dissolved in methylene chloride (50 ml). This solution is extracted three times with a 5% aqueous sodium hydrogen carbonate solution, dried over anhydrous magnesium sulfate, and concentrated under reduced pressure to obtain an oily substance. Conversion of the starting material (4) to the corresponding phosphoramide was confirmed by ³¹ P-NMR (CDCl ₃ , trimethyl phosphate, high purity): δ147.9. Purity is estimated to be greater than 70%.

Example 2: Synthesis of 2,2-di- (3-aminopropyl) 1,3-dihydroxypropane linker reagent This example has two aminopropyl linkers for multiple label attachment. Includes monomers for attachment to the phosphodiester backbone of the synthetic oligonucleotide. FIG. 2 shows the theoretical reaction formula. Reagents: The same as those described in Example 1 unless otherwise specified. (A) 2,2-di- (3-aminopropyl) -1,3-
Synthesis of dihydroxypropane (7): The following steps are a summary of the method described in Example 1 (b) above. 2,2-
Di- (nitrilopropyl) -diethyl malonate (6)
(2.00 g, 7.51 mmol) (this synthesis is described in Example (1) (a)) in anhydrous diethyl ether (80 m
Dissolve in 1). The resulting solution is added dropwise to a stirred solution of lithium aluminum hydride in diethyl ether (100 ml) and after 15 minutes the mixture is heated under reflux for 2 hours and then stirred at room temperature overnight. The treatment and recovery of the crude product are performed in the same manner as in Example 1 (b). A main spot (Rf: about 0.2) is obtained by the same thin layer chromatography as described in Example 1 (b).

(B) Synthesis of 2,2-di- (3-trifluoroacetylaminopropyl) -1,3-dihydroxypropane (8): 2,2-di- (3-aminopropyl)
Dissolve 1,3-dihydroxypropane (7) (3.7 mmol) in 25 ml of water and adjust the pH to about 10 with 6N HCl. 1.0 ml of S-ethyltrifluorothioacetate are added with vigorous stirring;
-Keep between 9.5 and 10.0 while adding KOH dropwise. Further, ethyl trifluorothioacetate.
0 ml are likewise added twice at 30 minute intervals. The mixture was concentrated under reduced pressure to obtain an oil, and then acetone (30 m
Dissolve in 1). The precipitate, potassium acetate, is removed by filtration. The product (8) is purified by flash chromatography on silica gel as described in Example 1 (c) using a mobile phase methylene chloride / acetone (50:50 v / v). The purified material gives a single spot (Rf 0.7) by thin-layer chromatography on silica gel using the same solvent system, followed by color development by piperidine as described in Example 1 (c) followed by ninhydrin treatment. Yield 510 mg (1.48 mmol).

(C) 1-O- (dimethoxytrityl)-
2,2-di- (trifluoroacetylaminopropyl)
Synthesis of -1,3-dihydroxypropane (9): 2,2
-Di- (3-trifluoroacetylaminopropyl)-
1,3-dihydroxypropane (8) (510 mg,
(1.48 mmol) is dried in vacuo under reduced pressure with dry pyridine and then dissolved in 5 ml of dry pyridine in a stream of nitrogen. Dimethoxytrityl chloride (376 mg, 1.11 mmol) in dry methylene chloride (1.5 ml) is added with stirring under a stream of nitrogen and the mixture is stirred for 1 hour. The mixture is concentrated under reduced pressure and dissolved in chloroform (50 ml). The solution was washed with saturated aqueous sodium hydrogen carbonate solution 3
Extract once with saturated saline. The solution is then dried over anhydrous magnesium sulfate and concentrated in vacuo to give an oil. Next, the oily substance was dissolved in 2 ml of chloroform, and chloroform / ethyl acetate / pyridine (80: 20: 0.
Using 2 (v / v / v), fractionate by silica gel flash chromatography as above. The product (9) is identified by thin-layer chromatography on silica gel using the same solvent system and coloring with fuming HCl (R
f: 0.3); concentrate under reduced pressure and dry under full vacuum to give a yellow foam (517 mg, 52%).

(D) 1-O- (dimethoxytrityl)-
2,2-di- (3-trifluoroacetylaminopropyl) -3-O- (methyl-N, N-diisopropylphosphoramido) -1,3-dihydroxypropane (10)
Synthesis of: Method: 1-0- (dimethoxytrityl) -2,2-di-
(Trifluorocetylaminopropyl) -1,3-dihydroxypropane (9) (136 mg, 0.2 mmol) is co-distilled with dry pyridine (3 ml) three times and dried. The residue obtained is dissolved in dry methylene chloride (1.5 ml) in a stream of argon and N, N-diisopropylethylamine (175 μl, 1.0 mmol) is added with stirring. Next, N, N-diisopropylmethylphosphoramidic chloride (80 μl, 0.4 mmol) is added and the reaction is stirred for 1 hour. The resulting mixture was treated with ethyl acetate / triethylamine (98.2) (50
ml), and diluted with saturated aqueous sodium hydrogen carbonate solution (25
Extract twice with m1). Dry the organic layer over anhydrous MgSO ₄ to give an oil (240 mg). Conversion to phosphoramidite body (10) ^{is, 3 1 P-NMR (CDCl} 3, trimethoxy phosphate, was confirmed by external standard: Deruta145.15, purity is estimated to be greater than 60%.

Example 3 Synthesis of a Linker Reagent Based on 3-Amino-1,2-propanediol The synthesis method is illustrated in FIG. 3 and described below. (A) 3- (trifluoroacetylamino) -1,2-
Synthesis of propanediol (11): Reagents: 3-amino-1,2-propanediol and S
-Ethyl trifluoroacetate was purchased from Aldrich (U.S.A.).
SA). Method: S-ethyl trifluoroacetate (5.13m
l, 46 mmol) with 3-amino-1,2-propanediol (2.32 ml) and ethyl acetate (5.0 m).
Add to the mixture of l) with rapid stirring. After a few minutes, the mixture becomes homogeneous. After 1 hour, the reaction solution is shaken with petroleum ether (100 ml), separated and concentrated in vacuo to give an oil. This material is analyzed by thin layer chromatography on a silica plate using ethyl acetate / methylene chloride (2.1) as mobile phase. The lamellar plate, when first developed with ninhydrin, exhibits a discoloration of a trace of unreacted amine starting material at the starting point. The plate is then sprayed with a 10% aqueous piperidine solution to develop color, dried with a heat gun for 15 minutes and treated with a ninhydrin reagent. In the latter case, the major spots which are estimated to contain more than 95% of the total material are identified (Rf
0.28). Purification of substance (11), which appears to be the major spot, is performed by preparative scale thin layer chromatography.

(B) Synthesis of 3- (trifluoroacetylamino) -1-O- (dimethoxytrityl) 1,2-propanediol (12): The reagents and method are described in Example 1 (d) above. . 3- (trifluoroacetylamino) -1,2-dihydroxypropane (11) (1.
87 g, 10 mmol) were dried under reduced pressure in dry pyridine (10 m
Co-evaporate 3 times with 1) and dry. This material is then dissolved in dry pyridine (10 ml). Dimethoxytrityl chloride in dry pyridine (10 ml) (3.
(73 g, 11 mmol) solution is added dropwise with stirring in a stream of nitrogen. After about one hour, methanol (0.2 m
l) is added. The resulting solution was diluted with ethyl acetate (80 m
l) and diluted with saturated aqueous sodium hydrogen carbonate solution (30 m
Extract twice with 1) and twice with water (20 ml). The organic layer was dried over anhydrous magnesium sulfate and concentrated under reduced pressure to obtain a crude oil 6
g. 1.1 g of crude material are fractionated by flash chromatography on silica gel as above using methylene chloride / ethyl acetate / pyridine (10: 1: 0.01 v / v / v). Each fraction is analyzed by thin layer chromatography on a silica gel plate with the same solvent system. When the spot was developed with fuming HCl, it showed two minor components with Rf values of 0.94 and 0.87 and a major component of Rf 0.53, each of which was 1,2-di- (dimethoxytrityl).
By-product, dimethoxytritanol and expected product (12) were fixed. Fractions with an Rf of 0.53 by thin layer chromatography as above were collected and evaporated to give 0.72 g of (12), the structure of which was ¹ H-
Confirmed by NMR. The final yield of (12) was 80% based on the yield from the flash column.

(C) 3- (trifluoroacetylamino) -1-0- (dimethoxytrityl) -2-0- (methyl-N, N-diisopropylphosphoramide) -1,
Synthesis of 2-propanediol (13): The synthesis reagents are the same as in Example 1 above. 3- (trifluoroacetylamino) -1-0- (dimethoxytrityl) -1,2-propanediol (12) (196 mg, 0.4 mmol) in dry methylene chloride containing diisopropylethylamine (348 μl, 2 mmol) (1.5 ml). N, N-diisopropylmethyl phosphoramidic chloride (200 μl, 1 mmol) is added dropwise while stirring and flowing in an argon stream. 1 hour later, 1%
Ethyl acetate containing triethylamine was added (50 m
l) The resulting solution is extracted three times with a saturated aqueous solution of sodium bicarbonate. The organic layer is dried over anhydrous magnesium sulfate and concentrated under reduced pressure to obtain an oil. The purity of this substance is
_{^{3 1 P-NMR (CD 3}} CN, trimethoxy phosphite Holic acid, external standard) is estimated to be higher than 95% by: δ147.5. Recrystallization of this material in a mixed solvent of toluene / hexane at -78 ° C was unsuccessful. Therefore, the crude sample is used directly for linker addition.

Example 3 (a): Synthesis of a 6-amino-1,2-hexanediol-based linker reagent: The reaction scheme is shown in FIG. 4 and described below. (A) Synthesis of 1,2- (isopropylidene) -1,2,6-trihydroxyhexane (14): Reagents: 1,2,6-trihydroxyhexane and 2,2
2-Dimethoxypropane was purchased from Aldrich (USA). Method: 1,2,6-trihydroxyhexane (1.00
g, 7.45 mmol), dry acetone (10 ml) and concentrated sulfuric acid (30 μl) are added to a 50 ml round bottom flask equipped with a magnetic stirrer. The flask is filled with nitrogen, capped with a rubber septum, and shut off moisture. next,
2,2-dimethoxypropane (3.00 ml, 24.4
Mmol) is added slowly via syringe over 30 minutes into the stirred solution. Stirring is continued for 2 hours. Anhydrous sodium carbonate (150 mg) was added to terminate the reaction,
The contents are then stirred overnight. Finally, the solution is filtered and concentrated under reduced pressure to give a pale yellow syrup (1.
6g). Use this material in the next step without purification.

(B) 1,2- (isopropylidene) -6
Synthesis of-(p-toluenesulfonyl) -1,2,6-trihydroxyhexane (15) Reagent: p-toluenesulfonyl chloride was purchased from Aldrich (USA). Method: The crude isopropylidene material obtained in the previous step (1
4, about 7.45 mmol) in dry acetone (15 ml)
Medium dissolved. Next, p-toluenesulfonyl chloride (2.8 g, 14.9 mmol) and dry pyridine (5 ml) are added and the contents are stirred at room temperature for 3 hours while keeping the moisture away. Then, the solvent is removed under reduced pressure, the residue is taken up in methylene chloride (25 ml), dried over anhydrous magnesium sulfate, filtered and concentrated under reduced pressure to obtain solid crystals (15, 2.8 g). The crude product is purified by flash chromatography on silica gel as above using chloroform as mobile phase. Each fraction is analyzed by thin layer chromatography on fluorescent silica gel plates using the same solvent system. The spot is caused to emit light by a fluorescent lamp. Product containing fraction (Rf 0.5
0) was collected and concentrated under reduced pressure to give a final yield of 96.9% oil (15, 2.37 g).

(C) 1,2- (isopropylidene) -6
Synthesis of -azido-1,2-dihydrohexane (16): Method: Tosyl form of the previous step (15, 2.37 g, 7.2
2 mmol) in dry dimethylformamide (30 ml)
Dissolve in. Sodium azide (1.64 g, 2
5.2 mmol) is added via a magnetic stirrer bar, fitted with a reflux condenser and a CaCl ₂ drying tube. The mixture is then stirred for 3 hours at 60-65 ° C. in a water bath. Stirring is continued at room temperature overnight. The precipitate is then removed by centrifugation and the resulting solution is concentrated under reduced pressure to give a final volume of about 5 ml. The concentrate is taken up in chloroform (50 ml) and water (15 ml). Further, the organic layer was washed with water (15 ml) and dried over anhydrous MgSO.
₄ , dried, filtered and concentrated under reduced pressure to give an amber oil (16). The crude product is then used in the next step without further purification.

(D) Synthesis of 6-amino-1,2-dihydroxyhexane (17) Reagent: Lithium aluminum hydride in diethyl ether (1.0 M) was purchased from Aldrich (USA). Method: anhydrous diethyl ether (10 ml) and lithium aluminum hydride in diethyl ether (1.0 M)
In a 250 ml round bottom flask under a stream of argon. The crude azide from the previous step (1.
6, about 7 mmol) while stirring the solution in a stream of argon.
Add from dropping funnel. After all additions, stir in argon. After all the addition, the mixture is stirred under reflux for 90 minutes. The obtained slurry was mixed with diethyl ether (25 m
1) and the following solutions are added in the stated order with stirring: water (1 ml), 5N NaOH (1 ml) and water (1 ml). The mixture is then filtered on a glass filter. The filtrate is concentrated by distillation under high vacuum at room temperature to give a pale yellow oil. Next, water (10.8 ml) and 88
% Formic acid (14.2 ml) is added. The resulting mixture is left at room temperature overnight and then heated to 70-75 ° C for 2 hours. The solution was concentrated under reduced pressure to give a syrup, which was then dissolved in water (50 ml) and the mixture was treated with AG 50W-X.
Apply to a cation exchange column (form H, 50 ml bed capacity, Bio-Labs, Richmond, CA, USA) containing 8 resins. The column is eluted with 1N HCl. The amine product is spotted on a silica gel TLC plate, sprayed with a ninhydrin reagent to develop color, and heated as above. The fractions containing the product are collected and concentrated under reduced pressure to give a syrup, which is co-distilled with methanol to give pale yellow needles (17, as hydrochloride).

(E) 6-N- (9-fluorenylmethoxycarbonyl) -amino-1,2-dihydroxypropane (18): Reagent: 9-fluorenylmethylsuccinimidyl-dicarbonate (Fmoc- NHS) was purchased from Bahem (Torrance, CA, USA). Method: Amount of 6-amino-1, according to the yield obtained in the previous step,
2-Dihydroxyhexane hydrochloride (17) was added to water (10
7.) and a final pH of 8 with 5N NaOH.
Adjust to 7. Add sodium bicarbonate (588 mg, 7 mmol), Fmoc-NHS (2.76 g, 7 mmol) and acetone (10 ml). After all Fmoc-NHS has been added to the solution, the suspension is stirred overnight at room temperature. The reaction mixture is concentrated under reduced pressure to remove acetone. 1N HCl (50 ml) and ethyl acetate (150 ml) are added and the mixture is transferred to a separatory funnel.
The organic layer is separated and washed with 0.1N HCl (50 ml) followed by water (2 × 50 ml). Next, the organic layer was dried with anhydrous M
dried over MgSO _4, filtered, to obtain an oil concentrated.
Using the product as a mobile phase, chloroform / acetone (50:
Purify by flash chromatography on silica gel using 50). The fractions are analyzed by thin layer chromatography on fluorescent silica gel plates using the same solvent system. The spot is caused to emit light by a fluorescent lamp. The fractions containing the product (Rf, 0.25) are collected and evaporated to give white solid crystals (18, 1.20 g). Starting materials,
Based on 1,2,6-trihydroxyhexane, the final yield is 45%.

(F) 1-O- (dimethoxytrityl)-
Synthesis of 6-N- (9-fluorenylmethoxycarbonyl) amino-1,2-dihydroxyhexane (19): Method: Dry the product of the previous step (18, 0.5 g, 1.41 mmol) Co-evaporate with pyridine (3 × 3m
l) and then dissolved in dry pyridine (8 ml) in argon. A solution of dimethoxytrityl chloride (0.5736 g, 1.69 mmol) in methylene chloride (2 ml) is added via syringe over a few minutes while stirring. Stirring is continued for 2 hours at room temperature, after which the reaction is stopped by adding methanol. The solvent is removed under reduced pressure, and the residue is dissolved in chloroform (100 ml). The obtained solution was transferred to a separating funnel, and a saturated sodium hydrogen carbonate solution (3 × 20 m
1) Then, it is washed with 5M-NaCl. The organic layer is dried over anhydrous MgSO ₄ , filtered, and concentrated under reduced pressure to obtain an oil. The product is purified by flash chromatography on silica gel as above using a solvent system of methylene chloride / ethyl acetate / triethylamine (95: 5: 0.5). The fractions are analyzed by thin-layer chromatography on silica gel plates using the same solvent; the plates are treated with fuming HCl to develop spots. The fractions containing the product (19, Rf, 0.35) are collected and evaporated under reduced pressure to give a foam (910 mg, 100% theoretical yield).

(G) 1-O- (dimethoxytrityl)-
6-N- (fluorenylmethoxycarbonyl) -2-O
-(Methyl-N, N-diisopropylphosphoramide)
-6-amino-1,2-dihydroxyhexane (20)
Synthesis: Reagents: The raw materials are the same as those described in the preceding Examples. Method: N, N-diisopropyl-methoxyphosphinyl chloride (102 μl, 0.513 mmol) was added to 19 (225 mg,
0.34 mmol) and a stirred solution of N, N-diisopropylethylamine (236 μl, 1.36 mmol). After 90 minutes, the reaction mixture was reduced to 2%
Diluted in ethyl acetate containing triethylamine (50 ml) and saturated aqueous sodium bicarbonate (2 × 25 m
Wash in 1). The organic layer was dried over anhydrous MgSO _4, filtered, evaporated to dryness under reduced pressure. The residue was dissolved in toluene (2
ml) and added dropwise to petroleum ether at -20 ° C with rapid stirring. The resulting mixture is then left at -20 ° C for 16 hours. Then warm to room temperature and decant the supernatant. The precipitated product (20)
Is dried under reduced pressure: yield = 160 mg (58% yield).
Purification of this material is accomplished by thin layer chromatography on silica gel plates using a solvent system of methylene chloride / ethyl acetate / triethylamine (10: 1: 0.1) and illuminated by UV irradiation (R0. Rf, 0.9, compared to 25). Further, the third embodiment described above.
Analogous substances to the linker reagent described in (a) were also synthesized. The structures of these analogs are illustrated in FIG. 5 (21-24). The preparation of these analogs is described in the Examples below.

Example 3 (d) Synthesis of 3-N- (glycinoyl) -amino-1,2-propanediol-based linker reagent (21): FIG. 6 outlines the formula for this synthesis. (A) Synthesis of 3-N- [N- (9-fluorenylmethoxycarbonylglycinoyl] -amino-1,2-propanediol (25) Raw materials: Baychem Inco-Porated (Trans, CA, USA) N- (Fluorenylmethoxycarbonyl) -glycine-N-hydroxysuccinimide (Fmoc-glycine-NHS) was purchased from USA) Other reagents were described above Method: 3-Amino-1,2-propane Diol (91m
g, 1 mmol) in acetone (7 ml).
-Added to a solution containing glycine-NHS (394 mg, 1 mmol). To this solution was added a solution of sodium bicarbonate (84 mg, 1 mmol) in water (5 ml). The reaction mixture was stirred at room temperature for 16 hours. Silica gel plate and methylene chloride / methanol / acetic acid (2
0: 2: 0.1) Thin layer chromatography using a solvent system indicated that the reaction was complete. Product (25)
Formed as a precipitate in the flask, which was filtered and dried under vacuum over P ₂ O ₅ for 2 days. Yield 310
mg (84%).

(B) 1-O- (dimethoxytrityl)-
3-N- [N- (fluorenylmethoxycarbonyl)-
Synthesis of [Glycinoyl] -amino-1,2-propanediol (26): Raw materials: The raw materials are described in the above Examples. Method: Compound 25 (185 mg, 0.5 mmol) was dried by concentrating with dry pyridine (3 x 3 ml). Thereafter, it was dissolved in dry pyridine (3 × 3 ml) and then a solution containing dimethoxytrityl chloride in a mixture of methylene chloride / pyridine 1: 1 (4 ml) was added dropwise with stirring. Stirring was continued for 1.5 h, after which the reaction was monitored by silica gel thin layer chromatography using a methylene chloride / methanol (8: 1) solvent system. The reaction was terminated by the addition of methanol (0.2 ml) and stirring was continued for 10 minutes. Pyridine was concentrated under vacuum. The residue was treated with methylene chloride (1
(50 ml), washed with a saturated sodium hydrogen carbonate solution (2 × 50 ml), and washed with water (50 ml). After drying over anhydrous MgSO ₄ , the methylene chloride solution was concentrated to dryness under vacuum. The residue was purified by flash chromatography on silica gel using a methylene chloride / ethyl acetate (11: 5) solvent system containing 0.1% pyridine according to the method described above. Product containing fractions were identified by silica gel thin layer chromatography as described above. These fractions were saved, concentrated to dryness and 250 mg of (2
6) was obtained. (75% yield).

(C) 1-O- (dimethoxytrityl)-
2-O- (N, N-diisopropylamino-methoxypho
Sphinamide) -3-N- [N- (fluorenylmeth
Xycarbonyl) -glycinoyl] -amino-1,2-
Synthesis of propanediol (21): Raw materials: The raw materials are described in the above-mentioned Examples. Method: Compound 26 (235 mg, 0.35 mmol)
Concentrate with dry pyridine (2 × 3 ml) to dry
Dried. Then, it was dried with pyridine chloride (2m
l) After dissolving in N, N-diisopropylethyl
The amine (244 ul, 1.4 mmol) was added. Continued
And N, N-diisopropylamino-chloromethoxypho
Sphine (105 μl, 0.53 mmol)
The mixture was added dropwise with stirring under an atmosphere. Methylene chloride
/ Ethyl acetate / triethylamine (10: 5: 0.5)
For silica gel thin-layer chromatography using a solvent system
It was found that the reaction was completed after 20 minutes. That
The post-reaction mixture was washed with a saturated sodium bicarbonate solution (2 × 25
ml) in ethyl acetate. Anhydrous MgSO ₄
After drying on, the ethyl acetate layer was concentrated under vacuum. Remaining
The residue was redissolved in ethyl acetate (3 ml),
Poured into hexane (150 ml) in degrees (° C). The precipitate
Filter and dry under vacuum to give 210 mg of (21)
(Yield 72%).³¹ P-NMR (CDCl₃, Trimethyl phosphate
147.5 (d).¹H-NM
The structure was also confirmed by R analysis.

Example 3 (c) 3-N- (4-aminobutyryl) -amino-1,2-propanediol and 3-N- (6-aminocaproyl) -amino-1,2-propanediol basic Preparation of Linker Reagents (22, 23): The synthetic steps specific to this example are illustrated in FIG. 7 and described below. (A) N of 4-aminobutyric acid and 6-aminocaproic acid
-Synthesis of fluorenylmethoxycarbonyl protected form: Raw material: 4-aminobutyric acid and 6-aminocaproic acid were purchased from Aldrich Chemical Corporation (Milwaukee, Michigan, USA). Fm
oc-NHS is described in Example 3 (a). Method: Ai Park (Canadian Journal of
Chemistry, 1982, 60, 976).

(B) N-Fmoc-4-aminobutyric acid using 3-amino-1,2-propanediol and N-
Fmoc-6 Coupling of each of the aminocaproic acids. Ingredients: Trimethylacetyl chloride was purchased from Aldrich Chemical Corporation (Milwaukee, Michigan, USA). Other reagents have been described above. Method: First, each of compounds 27 and 28 (1 mmol) was dried by concentrating with pyridine (2 × 3 ml). Then dry dimethylformamide (3m
The residue was dissolved in a mixture of 1) and dry tetrahydrofuran (3 ml). The resulting solution was cooled in an ice bath, then N, N-diisopropylethylamine (1 mmol) was added and trimethylacetyl chloride (1 mmol) was added slowly with stirring. Stirring was continued in the ice bath for 45 minutes. Then, a solution of 3-amino-1,2-propanediol (1.2 mmol) in dry dimethylformamide (3 mmol) was added, and the resulting mixture was warmed to room temperature and stirred for 1 hour. The reaction was monitored by thin layer chromatography using a methylene chloride / methanol / acetic acid (10: 1: 0.1) solvent system. Based on this analysis, the reaction was determined to be approximately 90% complete. The reaction mixture was then concentrated under vacuum, diluted with ethyl acetate (100ml) and transferred to another container. Saturated sodium bicarbonate solution (2 × 50
ml) and water (50 ml) to wash the organic solution. After drying over anhydrous MgSO ₄ , the organic layer was concentrated to dryness. Generally, the resulting product was determined to be above 95% pure and was used in the next step without further purification. However, if purification is required, methylene chloride /
Performed by flash chromatography on silica gel using a methanol (40: 1) solvent system. (2
The purity of 9) and (30) was confirmed by ¹ H-NMR analysis.

(C) 1-O- of (29) and (30)
Dimethoxytritylation The raw materials and method for this synthesis are the same as described in (b) of Example 3 (b). The purity of these materials is ¹ H-
Confirmed by NMR. (D) Corresponding 2-O- of the compounds described in part (c) above
Conversion to (N, N-diisopropylethyl) -phosphoramidites (22) and (23): The raw materials and method for this synthesis are as described in Example 3 (b) (c). . The purity of these raw materials was confirmed by ³¹ P-NMR.

Example 3 (d) 3-N- (6-aminocaproyl) -amino-1,2-
Synthesis of a further extended analog of the propanediol basic linker reagent: The steps unique to this synthesis are illustrated in FIG.
It is described below. (A) 1-O- (dimethoxytrityl) -3-N- (6
Synthesis of -aminocaproyl) -amino-1,2-dihydroxypropane (32) Starting material: Compound (31) was prepared as described in (c) of Example 3 (c). Method: concentrated ammonium hydroxide and pyrazine (10 m
l) using compound (31) (0.89 g,
1.1 mmol) was ammonolysed. An appropriate amount of the reaction product was spotted on a silica gel TLC plate, treated with a ninhydrin reagent, and deprotection of the primary amine was observed. Then the reaction mixture is evaporated to dryness under vacuum and the resulting residue (32)
Used for next step without purification.

(B) Compound (3) using compound (28)
Coupling of 2) Starting Material: Compound (28) was prepared as described in (a) of Example 3 (c). Method: N-Fmoc-aminocaproic acid (28, 1...) Was prepared by the method described in (b) of Example 3 (c) above.
1 mmol) was reacted with trimethylacetyl chloride (1.1 mmol). Then, also in this case, a solution containing compound (32) (1.1 mmol) in dry dimethylformamide was added by the method described in (b) of Example 3 (c) above. The resulting addition product (33) was purified by flash chromatography on silica gel using a chloroform / methanol (30: 1) solvent system as described in the previous example. Product yield was 250 mg (23%).

(C) Corresponding 2-O- of compound (33)
Conversion to (N, N-diisopropylamino) -methoxy phosphoramidite (24): Method: The method is basically the same as described in Example 3 (b) (c) above. That is, compound (33) was prepared in dry methylene chloride containing N, N-diisopropylethylamine (198 μl, 1.14 mmol).
(240 mg, 0.285 mmol) in N, N-diisopropylamino-chloromethoxyphosphine (73 μm).
1, 0.371 mmol). The reaction was diluted with 2% triethylamine in ethyl acetate (50ml) and extracted with saturated aqueous sodium bicarbonate (25ml) and water (25ml). The resulting organic layer was dried over anhydrous sodium sulfate and concentrated. The residue was dissolved in a few milliliters of ethyl acetate as described in the previous example and then precipitated with hexanes (150 ml). (3
The yield of 2) was 200 mg and its purity was H- and ³²
Confirmed by P-NMR spectroscopy.

Example 4 Automatic coupling of a synthetic oligonucleotide with a linker based on 2- (3-aminopropyl) -1,3-dihydroxypropane: the linker reagent described in Example 1 (hereinafter referred to as "L
1 ". ) And various synthetic oligonucleotides are described. (A) The "L1" reagent was attached to the 5'-end of the deoxyoligonucleotide. Using a model 380A DNA synthesizer (Applied Biosystems, Inc.) using standard phosphoramide (phosphoramidite) chemistry, the sequence "5'-GCTCGTTGCGGGACTTAACCC on a porous glass control support.
AACAT-3 '"was synthesized. 5 '
-The dimethoxytrityl group was removed and "Ll" in dry acetonitrile (0.1 M) was coupled twice using a standard coupling cycle. By measuring the absorbance at 498 nm of the dimethoxytrityl released at the end of each binding cycle, the percent coupling of the first and second addition of "L1" was quantified relative to the amount of full-length deoxyoligonucleotide. did. These values were measured to be 29% and 42%, respectively. 5 '-(L1)-and 5'-(L1)-by gel electrophoresis using 20% polyacrylamide gel containing 7M urea.
(L1) -oligonucleotide was purified. The corresponding band was visualized by UV shadowing, which revealed that about 1.
Slow migration on the gel with 5-fold spacing was evaluated. These bands were excised and linker-modified deoxynucleotides were recovered and purified by standard methods.

(B) The "L1" reagent was bound to the 3'-end of the deoxyoligonucleotide. In this synthesis, a Teflon oxidizable solid support (Molecular Biosystems, Inc., Cat. # OSS-01, San Diego, USA) was used. When the deoxyribonucleotide is cleaved from this support, the compound used during the first binding cycle becomes 3 '
-Remains at the 3'-end together with the terminal phosphate group. Applied
Biosystems, Inc. Model 38
"L1" dry acetonitrile solution (0.2 M) was bound to this support using three binding cycles with standard phosphoramidite chemistry on a OA DNA synthesizer. Next, a deoxyoligonucleotide sequence identical to the sequence shown in (a) above was added using the same coupling chemistry. The percent initial coupling with the "L1" reagent was determined as described above to be 40%, 63% for the first, second and third couplings, respectively.
% And 63%. After removing the terminal dimethoxytrityl group from the resulting trimer, a deoxyoligonucleotide having the same sequence as in 4 (a) was attached by standard phosphoramidite chemistry. Next, the support material was removed from the synthesizer and treated with concentrated ammonium hydroxide at 55 ° C. for 16 hours. Next, the support was washed three times with water and a 20 mM sodium phosphate buffer (pH 7.
4) Treatment with 50 mmol NaIO ₄ in 2.5 h at room temperature. Finally, the support is washed several times with 10% n
Treated with an aqueous solution of -propylamine at 55 ° C for 3 hours. The resulting solution was applied to a 20% polyacrylamide gel containing 7M urea and electrophoresed. The corresponding 3'-
(L1)-(L1)-(L1) deoxyoligonucleotide was recovered as described above.

(C) The sequence "5'-AAATAACGAA
CCCTTGCAGGTCCTTTCAACTTTGA
3 ′ of deoxyoligonucleotide having “T-3 ′”
-"L1" was bound to the terminus. This synthesis method is (b)
The method is the same as that described in section
A model 8750 DNA synthesizer was used.
(D) The sequence "5'-CAGTCAAACTCTAGCC
"L" is added to the 3'-end of the deoxyoligonucleotide having "ATTACCTGTCTAAAGTCATTT-3 '".
1 "was bound. Again, the method described in (b) was used, except that the automation part of the synthesis was performed on a Biosearch Model 8750 DNA synthesizer.

(E) 2 inserted between nucleotide bases
-Hybridization and melting point (Tm) of synthetic deoxyoligonucleotide probe containing-(3-aminopropyl-1,3-dihydroxypropane linker ("L1"): Raw material: two of 33-mer deoxyoligonucleotide probe The L1-derivative was synthesized by a method similar to that described above.
L inserted between 1 and 22 (counting from the 5'-end)
One. “L1-substituted” has L1 between nucleotide residues 20 and 22 as a substitution at residue 21. Both probes have a sequence complementary to ribosomal RNA from Chlamydia trachomatis ("target rRNA").
Having. Gen-Probe, a standard protocol developed by Incorporated, allows these probes to be
Was ^{1 25} I-labeled. "Hydroxyapatite" (HAP) was obtained from Bering Diagnastic, Calbiochem Division (La Jolla, CA). Sodium dodecyl sulfate (SDS), sodium phosphate (mono and dibasic salts) and hydrochloric acid were reagent products of Fisher Scientific Corporation. Beta gel (liquid scintillation cocktail) was obtained from Westchem (San Diego, CA). All other materials were reagent products. Unless otherwise specified, the operation was a 1.5 ml screw
Performed in cap polypropylene eppendorf tubes.

Hybridization was performed as follows. 48 μl of 1 M sodium phosphate (pH 6.8),
10 μl of 1% SDS (v / v), 10 μl of ¹²⁵ I
Mix labeled probe (about 200000 PM), 29.5 μl water and 2.5 μl rRNA solution (0.5 μg, “target”) or 2.5 μl water (“control”) and mix
Incubate at 0 ° C. for 1 hour. Next, 10 μl
Aliquots of 1 ml of 0.12 M sodium phosphate (p
H6.8) /0.02% SDS / 0.02% sodium azide and vortexed for 5 seconds. Incubate the diluted aliquots in a water bath and allow
Heated to 0 ° C. Aliquots were removed at that temperature and stored on ice. Then, 0.12 M sodium phosphate (pH
6.8) /0.02% SDS / 0.02% The sample was passed through a small column of hydroxyapatite equilibrated with 0.02% sodium azide and the eluent was counted by scintillation using standard methods (still attached to the column). Corresponds to the hybridized probe). The Tm value was calculated as the temperature at which 50% of the initially formed hybrids heat denatured to single strands. Result: Probe Tm L1- = insertion 69 ° C. L1-substitution 66 ° C. The above data shows that both probes hybridized with the target rRNA as expected and that the Tm of the “inserted” probe was about 3 ° C. higher than the Tm of the “substituted” probe. Indicates that

Example 5 It has been demonstrated that "L1" modified deoxyoligonucleotides can be labeled with biotin and fluorescein. (A) 5 ′-(L1)-and 5 ′-(L1)-(L1) -modified deoxyoligonucleotides described in Example 4 (a) above (“5′-L1-GCTCGTTGCGGGGA
CTTAACCCAACAT-3 '"and"5'-L
1-L1-GCTCGTTGCCCCACTTAACC
CAACAT-3 '") was labeled with P-32. Ingredients: Alpha-32p-adenosine triphosphate was purchased from New England Nuclear (Dupont, Boston, Mass., USA). Terminal deoxynucleotidyl transferase (TdT)
And 5X tailing buffer are available from Bethesda Research
Laboratories (Gaithersburg, Maryland, USA). 20 picomoles of 5'-
(L1)-(L1) modified oligonucleotide at 37 ° C.
For 1 hour with 16.5 picomoles of alpha-P-32 adenosine triphosphate (specific activity 3000 Ci / mmol) and 40 units of TdT in 20 μl of 1 × tailing buffer. The resulting P-32 labeled oligonucleotide was tested at the Nensorb-20 (TM) force column (New England Nuclear, Dupont Corporation, Boston, Mass., USA) using the procedure indicated by the manufacturer (part of the description cited therein). ).

(B) P-32 label 5 '-(L1)-(L
1) -Oligonucleotide was converted to biotin-E-aminocaproic acid N-hydroxysuccinimide ("Bio-X
-NHS ", Calbiochem-Bering Corp., San Diego, California, USA). Streptavidin-agarose purchased from Bezesda Research Laboratories (Gaithersburg, MD, USA)
(+) Biotin was purchased from Calbiochem-Bering Corporation (San Diego, California, USA). One picomole of each of the modified oligonucleotides described above was combined with 12.5% dimethyl sulfoxide-containing 1
It was reacted with 2.5 mmol Bio-X-NHS in 25 mmol borate buffer (pH 9) for 1.5 hours. A small aliquot of the resulting reaction mixture was then
50 mM sodium phosphate (pH 7.4) / 2 mM EDTA / 0.5 Na in the presence ("non-specific binding") or absence ("specific binding") of D./ml D (+) biotin
1 was tested for binding to streptavidin-agarose. Bound material was quantified by scintillation counting. Oligomer Non-specific binding (%) Specific binding (%) 5 ′-(L1) 0.3 71.8 5 ′-(L1)-(L1) 0.5 90.3 Binding of these L1-modified oligomers to biotin Was also confirmed by electrophoresis of an aliquot of the above reaction mixture on a 20% polyacrylamide / 7M urea gel. Visualization of a representative band by autoradiography showed an almost quantitative conversion to the biotinylated form, which migrated more slowly than the non-biotinylated control.

(C) 3'-L described in Example 4 (c, d)
1-modified deoxyoligonucleotide ("5'-AAA
TAACGAACCCTTGCAGGTCCTTTCA
ACTTTGAT-L1-3 '"and"5'-CAG
TCAAACTCTAGCCATTACCTGCTTAA
AGTCATTT-L1-3 ′ ”) was labeled with fluorescein isothiocyanate and biotin-X-NHS, respectively. First, the Maxam and Gilbert method (Proceedings of the National
Academy of Sciences of the You
They were kinased and ^{- [32} P gamma] adenosine triphosphate by oligonucleotide S. Aye, 1977,74, pp. 560 pp., Using a by reference as part of the description) in accordance with T4- polynucleotide kinase this. Fluorescein isothiocyanate (FITC, Sigma Chemical Company,
St. Louis, Missouri, USA). 40 picomoles of this oligomer were reacted with 90 mmol of FITC in 0.1 M borate buffer (pH 9) containing 90% DMSO for 12 hours. The reaction mixture was then electrophoresed on a 20% polyacrylamide / 7M urea gel. Bands were visualized by autoradiography. Cut off the top band from each lane,
The TC labeled oligomer was recovered from the gel and purified.

The binding of the oligonucleotide to fluorescein was confirmed using a binding assay to a solid support derivatized with an anti-FITC antibody. Anti-FITC magnetic microspheres were purchased from Advanced Magnetics, Inc. (Cambridge, Mass., USA, catalog # 4310). Aliquots of the purified ³² P-labeled FITC-modified oligonucleotide were prepared in the presence (“non-specific binding”) or absence (“specific binding”) of 20 mM hydrolyzed FITC.
0.5 ml containing 20 μl anti-FITC microspheres
Buffer (50 mM sodium phosphate, pH 7.4 / 2)
(MM EDTA / 0.5 M NaCl).
After one hour, the microspheres were removed by magnetic separation and the supernatant was counted by Zerenkov radiation to determine the amount of bound material: Percent non-specific binding: 0.1% Percent specific binding: 80.2% Second modification The oligonucleotide was reacted with biotin-X-NHS. Forty picomoles of this oligomer are converted to 20% D
Treated with 10 mmol of biotin-X-NHS in 0.1 M borate buffer (pH 9) containing MSO for 1 hour.
The resulting biotinylated oligomer was purified by the above-mentioned polyacrylamide gel electrophoresis. The presence of biotin bound to the oligonucleotide was confirmed by binding analysis on streptavidin-agarose as described above in this example. Non-specific binding percentage: 0.3% Specific binding percentage: 87.4%

Example 6 Resistance of 3'-L1-Modified Deoxyoligonucleotides to Phosphodiesterase-Catalyzed Hydrolysis Source: Phosphodiesterase from Crotalus-durissus was converted to Boehringer-Mannheim Biochemicals (Indianapolis, Indiana, USA ) Purchased from. This enzyme has the 3'-
Exonucleolytic cleavage from the end was catalyzed.
"5'-AAATAACGAACCCTTG on an Applied Biosystems model 380A DNA synthesizer using standard phosphoramidite chemistry
A synthetic deoxyoligonucleotide having the sequence "CAGGTCCTTTCAACTTTGAT-3 '" was synthesized. According to the method described in Example 4, a probe having the same sequence but having a 3′-L1 linker bound thereto was synthesized. Both oligonucleotides were prepared according to the method described in Example 5.
Kinase-treated with ³² P. About 350,000 CPM of each labeled oligonucleotide was added to 3 × 10 ⁻⁵ or 3 ×
The reaction was performed in 10 μl of a buffer (0.1 M Tris-HCl, pH 8.0 / 20 mmol MgCl ₂ ) containing 10 ⁻⁶ units of phosphodiesterase. 1.5 μl aliquots were removed at 5, 10, 15 and 30 minute intervals. The reaction was quenched by adding 3 μl of 0.1 N NaOH. Next, 5 μl of 90% formaldehyde containing bromophenyl blue and xylanol XCFF dye was added to each aliquot and the resulting samples were electrophoresed on a 20% polyacrylamide / 7M urea gel. The gel was then analyzed by autoradiography. The 3'-L1 modified oligonucleotide was found to exhibit greater than 95% resistance to phosphodiesterase-catalyzed hydrolysis after 30 minutes with both concentrations of the test enzyme. There was essentially no visible full-length unmodified oligonucleotide on the gel, but it has been shown that this enzyme usually cleaves oligomers without a 3'-L1 group.

Example 7 Automatic incorporation of a ligation reagent based on 2,2-di- (3-aminopropyl) -1,3-dihydroxypropane into a synthetic oligonucleotide: the ligation reagent described in Example 2 (hereinafter referred to as " L2)) is due to the insertion of a synthetic oligonucleotide between bases and has the sequence "5'-CGTTACTCGGATGCCCAAAT."
(L2) ATCGCCACATTCG-3 ′ ”was generated. The method used was similar to that described in Example 4 (a), except that the solution of "L2" in the thirteenth binding cycle was not the final binding cycle described in Example 4 (a). (0.1 M in acetonitrile). As estimated from the amount of dimethoxytrityl released, the binding efficiency with “L2” was about 30% (see Example 4 (a)).

Example 8 Automatic incorporation of ligation reagents based on 3-amino-1,2-propanediol into synthetic oligonucleotides. The sequence "5'-CCCGCACGTCCTATT (L3) A
The incorporation of this ligation reagent (hereinafter referred to as “L3”) into a synthetic oligonucleotide having ATCATTACGATGG-3 ′ was performed according to the method described in Example 4 (a). In this example, a solution of “L3” (0.3
M, in dry acetonitrile) were reacted in the 15th binding cycle. As assessed from dimethoxytrityl release (see Example 4 (a)), the coupling efficiency at this stage was about 60%.

Example 8 (a) Ligation reagents 20, 21, 2 to synthetic oligonucleotides
Automatic integration of 2, 23 and 24: ligation reagents 20-
24 (this synthesis was performed in Examples 3 (a) -3).
(D)) and the procedure described in Example 4 (a). The corresponding linkers obtained by combining these reagents are hereinafter referred to as “L4”, “L5”, “L6”,
Called "L7" and "L8". That is, in certain embodiments corresponding to the use of one of the aforementioned reagents, a 0.12-0.2 M solution of the reagents (in dry acetonitrile)
To Applied Biosystems Model 380A
Ranked # 6 on a DNA synthesizer (Foster City, California, USA). Incorporation of reagents into the oligonucleotide polymer was performed according to a standard phosphoramidite coupling protocol. A series of oligonucleotides, 17-35 bases in length, with linkers L4-L8 inserted at various positions in the sequence, respectively, was prepared. Trityl release was measured at the end of the conjugation cycle, with conjugation efficiencies associated with these reagents ranging from 75% to 98%.

Example 9 Labeling of Amine Linker-Arm Probe with Acridinium Ester and Subsequent Purification: 25 mM stock solution of acridinium ester (for composition, see Weeks et al., "Clinical Chemistry", vol. 29,
1474, (1983)) was prepared in distilled DMSO. The desired amount of polymer produced in Examples 4, 7 or 8 (a) was Concentrated to dryness in a ml conical polypropylene tube. The following cocktail was constructed by sequentially adding the components listed below: 3 μl H ₂ O 1 μl 1 M HEPES (8.0) 4 μl DMSO (distilled) 2 μl 25 mM acridinium ester, DMSO
During (distillation) The mixture was vortexed, spun in a small centrifuge for 2 seconds (collect the contents at the bottom of the tube) and incubated at 37 ° C for 20 minutes. At that point, the components listed below were added to the reaction cocktail in order: 3 μl 25 mM acridinium ester, DMS
1.5 μl H ₂ O in O (distilled) 0.5 μl 1 M HEPES (8.0) Again the cocktail was swirled, spun and incubated at 37 ° C. for a further 20 minutes. 0.1M HEP
ES (8.0), 5 μl of 0.125 in 50% DMSO
Unreacted label was quenched with a 5-fold excess of lysine by adding M-lysine and incubated for 5 minutes at room temperature.

At that time, the acridinium ester-labeled oligomer was purified by the following method. Add 20 μl of the quenched reaction mixture to 30 μl of 3M-naOAc.
(5.0), 245 μl of H ₂ O and 5 μ of glycogen were added as carriers (glycogen was pretreated to remove all nuclease activity). The sample was swirled briefly and 640 μl absolute EtOH was added. The sample is swirled briefly, incubated on ice for 5-10 minutes, then 15000 rpm in a small centrifuge.
and centrifuged for 5 minutes. The supernatant was carefully removed and the precipitate was washed with 207 l of 0.1 M NaOSc (5.0),
Redissolved in 0.1% SDS. The sample was further purified by ion exchange high performance liquid chromatography (HPLC) as follows. 20 μl of the redissolved precipitate was injected onto a Nucleogen-DEAE 60-7 ion exchange HPLC column mounted on an IBM9533 HLPC system. All buffers used in this method were prepared by HPLC water acetonitrile _(CH 3 CN) and sodium acetate (NaOAc), and reagent grade glacial acetic acid (HOAc) and LiCl. In addition, all buffers were filtered through a 0.45-μm pore size nylon-66 filter before use. Total 26 monomer units (of which 1
In embodiments of nucleotide / non-nucleotide multimers having only non-nucleotide monomer units), the following elution protocol was used. Buffer A
Is 20 mmol NaOAc, pH 5.5, 20% CH
₃ CN. Buffer B contains 20 mM NaOAc
(PH 5.5), 20% CH ₃ CN and 1 mol LiC
l. 30% from 55% buffer A, 45% buffer B
Flow rate 1 by linear gradient to% buffer A, 70% buffer B
Eluted at 25 ml / min for 25 minutes. The absorbance at 260 nm was monitored during the elution. 0.5 ml fractions were collected in 1.5 ml conical polypropylene tubes. After elution,
5 μl of 10% SDS was added to each tube, and then each tube was swirled (this was done to ensure that the acridinium ester-labeled probe was not attached to the tube wall). Aliquot 0.5 μl aliquots 21-
Removed from 42 and added to 200 μl of water in a 12 × 78 mm tube (a separate pipette tip was used for each aliquot to avoid carryover problems). Next, 200 μl of 0.25 in Bertoid Clinylmat
N-HNO ₃ , 0.1% H ₂ O ₂ , then 1 second delayed by 2
The chemiluminescence of each aliquot was measured by automatically injecting 00 μl of 1 N NaOH and reading the chemiluminescence for 10 seconds. To each of fractions 29-33, 5 μl of glycogen was added, each swirled, 1 ml of EtOH was added to each swirl, incubated on ice for 5-10 minutes, and incubated at 15000 rpm in a small centrifuge.
They were EtOH precipitated by centrifugation for minutes. Each supernatant was carefully removed and each precipitate was redissolved in 20 μl of 0.1 M NaOAc, pH 5, 0.1% SDS, and these separated fractions were pooled.

[0068]

All of the foregoing, the above examples demonstrate that the reagents of the present invention can be prepared as having a non-nucleotide backbone, first and second binding groups and ligands, respectively. In particular, reagent (5) is methyl-
A non-nucleotide propyl backbone to which the first linking group of N, N-diisopropylphosphamide is attached, a second linking group of 1-hydroxy protected by dimethoxytrityl (DMT), and protected by trifluoroacetyl It has a ligand in the form of an aminopropyl-linked arm. Reagent (10) is substantially the same as reagent (5), except that in the latter case there are two identical ligands (two protected linked arm forms trifluoroacetylaminopropyl). Also, reagent (13) is similar to reagent (5), except that the non-nucleotide backbone is ethyl rather than propyl, the linking arm is short, and only trifluoroacetyl protected methylamine is used. Aminopropyl is not.

Also, as demonstrated above, the use of the single reagent of the present invention allows the linking arm to specifically bind only to the pre-selected position (s) of the nucleotide multimer without introducing undesired nucleotides. Can be provided. As also described above, by linking the backbone to nucleotides and another backbone (which in turn is linked to another backbone, resulting in a chain), the reagents of this invention provide a series of adjacent ligands. (For example, a label or a linking arm to which the label can bind) can be introduced into the nucleotide multimer. That is, by linking multiple adjacent labels to a probe, the sensitivity of a hybridization assay using the probe can be increased.

In addition, by additionally using one of the non-nucleotide backbones of the present invention or a series of non-nucleotide backbones linked together, two of the probes complementary to the corresponding sequence of the target nucleotide multimer may be used. Bridges can be formed between nucleotide sequences and can be cross-linked by a single different nucleotide or different sequences in a sample. That is, the target nucleotide multimer actually consists of a consensus nucleotide sequence of interest 2
May be a group of one or more nucleotide multimers,
They are bridged by a single different nucleotide of interest or a different nucleotide sequence from each other. Even where a single target sequence is of interest, it is possible to produce a probe with a complementary sequence having a non-nucleotide monomer unit with a label group attached between any two nucleotides. In that case, the probe will hybridize to the target nucleotide sequence in the usual manner, but the monomer units bearing the labeling group will tend to be arranged in a manner that does not interfere with the aforementioned hybridization (ie, it will “loop out” from the hybrid structure). It's easy to do).
This arrangement is based on the use of the insertion (intercalation) effect (by Asserin et al., Proceedings of the National Academy of Sciences of the USA, Vol. 81, 3297). ~ 3
At page 301), for example, in situations where it is likely that enhanced probe specificity is desired. Of course, the fact that the present invention uses non-nucleotide monomer units, together with prior probes using nucleotide monomer units, significantly reduces the aforementioned types of interference. As mentioned above, compounds (4), (9) and (12) can be bound to a solid phase synthesis support by means of their primary hydroxyl groups (see the texts of Gate and Salang for techniques compatible with said application). , Supra). These derivatized supports were used for additional polymer synthesis, resulting in the attachment of non-nucleotide monomer units to the 3'-end of the resulting nucleotide / non-nucleotide polymer.

Many modifications can be made to the above invention. For example, the ligand may in fact be a label or intercalator (intercalator) incorporated into the reagents of the invention before they are linked to the nucleotides of the nucleotide multimer. Further, as noted above, in addition to the specific protecting groups of the above examples, various other protecting groups may be used. However, the use of either one of the trifluoroacetyl and 9-fluorenylmethoxycarbonylamino protecting groups is particularly preferred. It the known standards (typically using 1 to 12 hours concentrated NH 4 _OH at 50 ° C.) oligonucleotides conditions used for the deprotection of the exocyclic nucleotide amines in the synthesis are cleaved under the same alkaline conditions with an amine This is for deprotection. Similarly, dimethoxytrityl 5 ′ hydroxy protection,
With all methyl or beta-cyanoethyl phosphite O protection and the use of N, N-diisopropyl as the phosphite leaving group in the linkage, the reagents are sufficiently compatible with current standard oligonucleotide solid phase synthesis techniques, The need for additional special steps is minimized.

Other variations and alternatives of the embodiments of the invention will be readily apparent to those skilled in the art. Accordingly, the invention is not limited to those embodiments described in detail above.

[Procedure amendment 5]

[Document name to be amended] Statement

[Correction target item name] Brief description of drawings

[Correction method] Added

[Correction contents]

[Brief description of the drawings]

FIG. 1 illustrates a specific example of the production of the reagent of the present invention using a reaction formula.

FIG. 2 illustrates a specific example of the production of another reagent of the present invention by a reaction formula.

FIG. 3 illustrates a specific example of the production of still another reagent of the present invention by a reaction formula.

FIG. 4 illustrates a specific example of the production of still another reagent of the present invention by a reaction formula.

FIG. 5 illustrates a specific example of the production of still another reagent of the present invention by a reaction formula.

FIG. 6 illustrates a specific example of the production of still another reagent of the present invention by a reaction formula.

FIG. 7 illustrates a specific example of the production of still another reagent of the present invention by a reaction formula.

FIG. 8 illustrates a specific example of the production of still another reagent of the present invention by a reaction formula.

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat ゛ (Reference) // C07F 9/24 G01N 33/58 A G01N 33/58 C12N 15/00 A (72) Inventor Reynolds, Mark Allan United States 92130 California San Diego Caminito Carmel Landing 3717 (72) Inventor Bat, Ram Salup United States 92130 California San Diego San Toro Way 3575

Claims (1)

[Claims] 1. A non-nucleotide reagent suitable for the preparation of nucleotide / non-nucleotide polymers, comprising: (a) a ligand selected from a chemical moiety and a linking arm capable of being linked to the chemical moiety by being activated under unsuitable conditions. A nucleotide monomer unit, (b) a first and a second non-nucleotide linking group linked to the monomer unit, wherein the first linking group is capable of linking the non-nucleotide monomer unit to the first additional monomer unit, Is in an inactivated state and thus cannot substantially bind, but can subsequently be activated under unsuitable conditions to bind a non-nucleotide monomer unit to a second additional monomer unit, At least one of the second additional monomer units is a nucleotide monomer unit). 2. Ligands can be labels, intercalators (intercalating agents), metal chelators, drugs, hormones, proteins,
Peptide, hapten, radical generator, nucleic acid degrading agent, proteolytic agent, catalyst, specific binding substance, DNA transport modifier,
The reagent according to claim 1, wherein the reagent is selected from a substance that changes the solubility of the nucleotide multimer and a linking functional group that can be linked to any of the chemical moieties. 3. Non-nucleotide reagents suitable for the preparation of nucleotide / non-nucleotide polymers, comprising: (a) a ligand selected from a chemical moiety and a protective linking arm that can be deprotected under unsuitable conditions to link to the chemical moiety. , A non-nucleotide monomer unit, and (b) a non-nucleotide first bonding group and a protected second bonding group linked to the monomer unit (where the first bonding group is a non-nucleotide monomer unit and a first additional monomer unit). The second linking group may be substantially unattached, but subsequently deprotected under unsuitable conditions, thereby linking the non-nucleotide monomer unit to the second additional monomer unit, At least one of the second monomer units is a nucleotide monomer unit). 4. Ligands can be labels, intercalators (intercalating agents), metal chelators, drugs, hormones, proteins,
Peptide, hapten, radical generator, nucleic acid degrading agent, proteolytic agent, catalyst, specific binding substance, DNA transport modifier,
4. The reagent according to claim 3, wherein the reagent is selected from a substance that changes the solubility of the nucleotide multimer and a linking functional group that can be linked to any of the chemical moieties. 5. 5. The reagent of claim 4, wherein the first and second linking groups are capable of linking non-nucleotide monomer units to the monomer units 5'hydroxy and 3'phosphate, respectively. 6. The reagent according to claim 5, wherein the non-nucleotide monomer unit has an acyclic skeleton, and the first and second linking groups are linked to each end thereof. 7. The non-nucleotide monomer unit has a skeleton having a first and a second bonding group linked to each end thereof, and the skeleton is composed of 1 to 20 atom chains.
The reagent according to 1. 8. The non-nucleotide monomer unit has a skeleton in which a bonding group is connected to each end, and the skeleton has 1 to 10
The reagent according to claim 5, which is a non-cyclic hydrocarbon chain consisting of carbon atoms. 9. The reagent according to claim 5, wherein the non-nucleotide monomer unit has a skeleton in which a bonding group is linked to each end, and the linking arm is a chain of 1 to 25 atoms extending from the skeleton. 10. A polymeric probe comprising a plurality of nucleotide monomers, wherein at least one acridinium ester moiety is linked to a corresponding monomer unit of the probe. 11. A polymeric probe according to claim 10, wherein the acridinium ester moiety is derived from a reagent according to claims 1-9. 12. 12. The acridinium ester label is a chemiluminescent acridinium ester label.
The probe according to 1. 13. A method for producing a probe, comprising linking at least one acridinium ester moiety to a corresponding monomer unit of a polymer having a plurality of nucleotide monomer units. 14． 14. The method of claim 13, wherein the acridinium ester label is a chemiluminescent acridinium ester label. 15. A method for producing a substituted nucleotide comprising a non-nucleotide reagent suitable for producing a nucleotide / non-nucleotide polymer, comprising the steps of:
(A) first linking the non-nucleotide monomer unit to the first additional monomer unit via the first linking group; (b) then deprotecting the second linking group; (c) then via the second linking group A method comprising attaching a non-nucleotide monomer unit to a second additional monomer unit, provided that at least one of the first and second monomer units is a nucleotide monomer unit and the other is selected from a monomer unit and a solid support. 16. 16. The method of claim 15, wherein both the first and second additional monomer units are nucleotide monomer units. 17． Further, by attaching another monomer unit to the binding nucleotide / non-nucleotide polymer, a nucleotide sequence complementary to at least a portion of the target nucleotide sequence, provided that the complementary nucleotide sequence is
17. A method according to claim 15 or 16, comprising producing a polymer having at least one non-nucleotide monomeric unit arranged therein) and then hybridizing the nucleotide / non-nucleotide polymer sequence to the target sequence. .