HUT73383A - Process for preparing cancer vaccines - Google Patents

Description

The invention relates to gene therapy, in particular to its use in the context of cancer therapy.

In the last 20 years, there has been no decisive breakthrough in the treatment of cancer, with the newly developed initiative, the so-called “cancer vaccine,” for the first time, that has raised hope for advancement in cancer therapy.

In cancer patients, the immune system has a major influence on the development of tumors and the likely outcome of the disease. In patients with malignant (malignant) melanoma, the immune response in 0.5% of patients may lead to complete tumor regression. In contrast, in most patients, the immune response controlling tumor formation, which is not able to turn off all cancer cells, is observed during the early stages of the tumor. In advanced stages, it is often found that cancer cells escape immune recognition or are under specific suppression of the immune system (Hoon et al., Cancer Slit. 50: 5358-5364 (1990)]. It has been recommended that patients be treated with a cancer vaccine following surgical removal of the primary (primary) tumor. Cancer vaccines contain genetically engineered cancer cells or cancer cells in combination with immunostimulating adjuvants that induce or reactivate a cancer-specific immune response in a patient [Hoon et al. , Cancer Slit. 50: 5358-5364 (1990); Bystryn et al. , Cancer Metastasis Rév. 9: 81091 (1990) and Cancer 69: 1157-1164 (1992); Berd et al. J. Clin. Oncol. 8, 1858-1867 (1990); Fearon et al. Cell 60: 397-403 (1990); Lotze et al. , J. Immunotherapie 12,

212-217 (1992); Pardoll et al. , Curr. Opin. Immunol. 4: 619-623 (1992); Rosenberg et al. Human Gene Therapy 3: 75-90 (1992); Spectrum Der Wissenschaft, Jan. 90, 38-50 (1990)].

The genes with which cancer cells are transformed, in order to render them more immunogenic and, consequently, less tumorigenic, fall into three categories:

1) Genes encoding proteins that are absent from tumor cells (so-called foreign or neoantigens): The so-called "xenogenesis can be achieved by expression of MHC-I syngeneic tumor cells, expression of allogeneic MHC-I or MHC-II antigens , or by expressing viral proteins such as hemagglutinin [Itaya et al. , Cancer Slit. 47: 3136-3140 (1987); Fearon et al. , Cancer Slit. 48: 2975-2980 (1988); Plaksin et al. , Proc. Natl. Acad. Sci. USA 85: 4463-4467 (1988); Ostrand-Rosenberg et al., J. Immunol. 144: 4068-4071 (1990)].

2) Cytokine genes: Expression of these genes (e.g., interleukin-2, CSF = colony stimulating factor, interferons) serves to activate the immune system, which results in the foreigner recognizing and removing tumor cells.

3) Genes encoding so-called "auxiliary proteins or" co-stimulatory molecules: Recent discoveries in immunology have shown that effective stimulation of T cells requires both activation of the T cell receptor and activation of a second receptor on the T cell. by a molecule on the surface of a cell presenting an antigen [Jenkins and Johnson, Curr. Opin. Immunol. 5: 361367 (1993). The B7 / CD28 pair forms a unit of such co-stimulatory molecules. B7 expression on melanoma cells stimulates immune defense under normal conditions in non-immune cells [Baskar et al., Proc. Natl. Acad. Sci. USA 90: 5687-5690 (1993); Chen et al., 1992, Cell 71: 1093-1102; Townsend and Allison, Science 259: 368-370 (1993); Schwartz R.H., Cell 71: 1065-1068 (1992)]. Heat-stable antigen (HSA = heat-stable antigen), expressed inter alia from dendrites (nerve cells) and spleen B cells, also has co-stimulatory activity [Liu et al. , Eur. J. Immunol. 22, 2855-2859 (1992) and J. Exp. Med., 175, 437-445 (1992)] and is likely to interact with B7 in promoting T cell growth. A feature of co-stimulatory molecules, such as B7, is likely to be that it lends properties of antigen presenting cells to tumor cells.

The cancer-specific immune response generated by transfection of tumor cells with a gene from one of the above groups must result in the destruction of micrometaphases, which have not yet been clinically detected and surgically removed, after tumor removal, in order to prevent the re-emergence of cancer.

In contrast to non-specific stimulation of the immune system, cancer vaccine-based therapy provides an inactivated immunotherapy with an inactivated vaccine, preferably from the patient's own tumor cells or portions thereof, by which the patient's immune system targets the tumor or at least the same antigen.

Since it has been shown that inactivation of tumor cells can cause a decrease in the immune response, cancer vaccines have recently been developed that consist of viable tumor cells [Rosenberg et al. , Human Gene Therapy 3: 75-90 (1992)]. However, for safety reasons, a vaccine based on cells with limited life span, which is no longer able to divide, should be sought.

One of the critical steps in the preparation of cancer vaccines is the transfer of the gene to the cells that make up the vaccine or a part thereof.

To date, the most advanced technique for gene transfer to cells, including the use of cancer vaccines, utilizes recombinant retroviral vectors; such a method is briefly recommended by Rosenberg et al. (1992) Human Gene Therapy 3: 75-90. However, the use of retroviruses is problematic because, at least in a small percentage, it carries the risk of side effects such as infection with the virus. In addition, retroviruses can only infect dividing cells. In addition, these vectors, as proposed recombinant adenoviruses as an alternative to retroviral systems, are subject to restrictions as to the size and structure of the DNA to be delivered.

Recently, the use of non-recombinant adenoviruses for gene transfer of DNA complexes by receptor-mediated endocytosis has been suggested, based on the ability of these viruses to release the content of endosomes. The use of adenoviruses results in an increase in the efficiency of gene transfer by preventing the degradation of lysosomes by internalizing the DNA complex [Curiel et al. , Proc. Natl. Acad. Sci. USA 88, 8850-8854 (1991) and Am. J. Respir. Cell and

Mole. Biol. 6: 247-252 (1992) and Human Gene Therapie 3: 147-154

(1992); Zatloukal et al. , Ann . New York Acad. Sci. 660, 136-153 (1992); Cotten et al al . , Proc. Natl. Acad. Sci. USA 89, 6094-6098 (1992); Wagner et al al ., Proc. Natl. Acad. Sci. USA 89, 6099-6103 (1992)] including between have been recommended adenoviruses

coupling to polylysine. Adenovirus-polylysine conjugates, together with transferrin-polylysine conjugates, can be complexed with DNA to form triple transferrin-polylysine / transferrin-polylysine / DNA complexes [Wagner et al. , Proc. Natl. Acad. Sci. USA 8 9, 60996103 (1992)]. The complexes bind to the transferrin and adenovirus receptors on the target cells. After endocytosis, the adenovirus causes the endosomes to rupture and results in the release of the substance from the endosome into the cytoplasm. Based on this, DNA can enter the nucleus, where the gene is predominantly expressed by DNA located at episomic levels. This technique has the following advantages over conventional viral and non-viral gene transfer methods: Since in this context the adenovirus serves only as a means of releasing the transfection complex from the vocabulary, the virus can be inactivated by genetic and / or chemical methods, optionally combined with physical methods. which is traditional

enhances safety against viral techniques [Cotten et al., Proc. Natl. Acad. Sci. USA 89: 6094-6098 (1992). Furthermore, the gene structure is transported on the outside of the virus; is not part of the viral genome. Therefore, there is no need to produce viral vectors and there is virtually no restriction on the size and sequence of the DNA to be delivered.

A further advantage of receptor-mediated gene transfer is its wide applicability to target cells. Thus, complexes containing transferrin and / or adenovirus conjugates can be uptake via transferrin and / or adenovirus receptors. Other ligands specific for a specific cell population may be used in place of transferrin, for example LDL has been found to be very suitable for melanoma cells. This system can achieve high gene expression values in many cell types (10-100 times higher than cells transformed with retroviruses (Lotze et al., 1992, J. Immunotherapie 12, 212-217); Rosenberg et al., Human Gene Therapy 3, 1992). 75-90 (1992)] or in stable transformed cells obtained by co-precipitation of Ca ₃ (PO ₄ ) ₂ (Fearon et al., Cell 60, 397-403 (1990)) .In addition, amplified copies of the gene structure may be introduced into the cells. Both dividing and non-dividing cells can be transformed, and the expression of the DNA introduced into the cell lasts for months in continuous cell cultures (Zatloukal et al., Ann. New York Acad. Sci. 660, 136-153 (1992)). in addition to viruses or fragments of viruses, certain peptides also have the ability to break endosomes. These peptides, called "endosomal malicidal" or "fusogenic" peptides, are also used s, that receptor-mediated gene expression géntranszfernél reach the resurgence. The use of such peptides to facilitate gene transfer is described in WO 93/07283.

Experiments with the dl312 adenovirus indicated toxicity problems; the virus replication error, which is due to a defect in the E1A region, was partially avoided by the transformed cells, so the error was "loose. As a result, viral yield is not satisfactory in host cell lines that have the ability to complement the Ad5 dl312 error.

SUMMARY OF THE INVENTION The object of the present invention is to provide a method for producing cancer vaccines based on an improved gene transfer system.

The present invention therefore relates to a process for the preparation of cancer vaccines containing autologous tumor cells. The method is characterized in that the tumor cells or fibroblasts are cultured and the cultured cells are transformed ex vivo with a composition comprising the following components:

(ai) a DNA molecule comprising one or more sequences capable of being expressed in a cell which encode one or more identical or different immune stimulatory polypeptides, or multiple DNA molecules comprising sequences encoding different immune stimulatory polypeptides;

(aii) optionally, an additional DNA molecule free of chair encoding a polypeptide that is functionally active in the cell to be transformed;

(bi) a conjugate between a DNA binding molecule and an adenovirus containing at least one mutation in the E4 region; or bii) a conjugate in which an endosomal malicidal peptide is ionically bound to a DNA binding molecule;

in that particular case

c) a DNA binding molecule, preferably conjugated to and internalized to a surface molecule of cells to be transformed, wherein components b) and c) form a substantially electronutral complex with the DNA as defined in a), by inactivating the transformed cells such that, while retaining their ability to express DNA as defined in (ai), they lose their ability to divide, where they are mixed with untransformed and inactivated tumor cells when transfected with fibroblasts, and that the cell population is optionally pharmaceutically acceptable; and mixed with carriers. The conjugate defined in (b) is hereinafter referred to as the "endosomal malic conjugate.

In contrast to the cancer vaccines recommended by Rosenberg et al., Human Gene Therapy 3: 75-90 (1992), the cancer vaccines of the present invention contain inactivated tumor cells which, surprisingly, have a fully elicited immune response despite irradiation. effective. This is probably due to the fact that the high expression rate of the immunostimulatory genes in the transformed cells at least partially offsets the reduction in antigenicity and loss of antigenicity resulting from the inactivation of the cells.

Autologous tumor cells, optionally mixed with fibroblasts, serve as starting materials for tumor vaccines, which are individually prepared for each patient. Fibroblasts can also be autologous cells, but there is also the possibility of implanting the cells into a fibroblast cell line, which eliminates the need to produce individual fibroblast cultures in each case, which takes several weeks.

In particular, tumor cells and / or fibroblasts are isolated from tissue samples of the subject to be treated. Methods for doing so are known to those skilled in the art. For example, primary melanoma cells can be most easily isolated from lymph node metastases by surgically removing the metastases and mechanically dissociating them under sterile conditions, and optionally enzymatically dissociating them.

Isolation from primary cancers is generally more difficult, especially for smaller cancers.

For example, in melanomas, the tumors are surgically removed, mechanically comminuted and, in addition, dissociated enzymatically. Known literature for dissociation using collagenase, DNase and hyaluronidase.

Isolation from other cancers can be done according to the same principle, and methods of isolation and dissociation are modified depending on the surrounding tissue. Methods known in the art for isolating and culturing tumor cells, such as those described in Human Cancer in Primary Culture Hsg. John R.W. Masters, (1991).

In a preferred embodiment of the invention, the gene constructs are introduced into primary fibroblasts instead of cancer cells, which are then mixed with untransformed, irradiated cancer antigen-bearing cancer cells [Fakhrai et al. , J. Cell. Biochem. Suppl. 16F, 47 (1992)]. The advantage of this embodiment is that fibroblasts can be easily and in large numbers obtained from patients, which is of particular importance when smaller tumors are available and therefore fewer tumor cells are available and that gene transfer to autologous primary fibroblasts is easier to standardize than transfection of primary tumor cell isolates from patients. A further advantage of this embodiment is that the tumor cells do not need to be cultured for an extended period of time and therefore retain their antigen spectrum which may be partially lost by culturing. In addition, the disadvantage associated with the cultivation of tumor cells is that certain populations, such as fibroblasts, which have a low incidence in the tumor isolate or tumor cell clone overgrow the culture.

Fibroblasts are isolated and cultured from skin biopsies according to known methods. Such methods are described, for example, in Jones G.E., Establishment, Maintenance and Cloning of Human Primary Cell Strains, Methods in Molecular ·····································································

Biology, Vol. 5 (1989); Freshney R.I., Disaggregation of Tissue and Primary Culture, Culture of Animal Cells (1987); Sly W.S. and Grubb, J., Isolation of Fibroblasts from Patients, Methods in Enzymology Vol. (1979)].

After culturing, the cells are treated with transfection medium containing complexes of components a) -c). Co-administration of conjugate b) with the complex between DNA and internalizing factor conjugate is generally preferred. The complexes can also be used repeatedly to amplify gene expression.

After transfection, the cells are freed from excess media containing the transfection complexes, washed with fresh medium and further cultured as desired.

Inactivation of tumor cells or fibroblasts, which is preferably performed in the same manner as inactivated transformed fibroblasts, by known methods such as physical methods such as X-ray or gamma-radiation treatment and / or chemical treatment with mitosis inhibitors such as Mitomycin C It happens. Substances that block DNA replication or so-called "spindle poisons," substances that inhibit the mitosis spindle are suitable.

The appropriate inactivating dose can be determined by, for example, determining the incorporation or proliferation rate of H-thymidine in the cells at different radiation doses and different concentrations of chemical inactivating agents and / or different treatment times, and the expression of the foreign gene.

Irradiation of transformed cells and their limited lifetime will reduce the potential for long-term side effects. Our goal is to achieve a transient, time-limited gene expression as determined by the gene dose. In the experiments performed it was found that the dose of gamma irradiation up to 100 Gy does not decrease the expression of the transformed gene structures.

Inactivation of transformed fibroblasts is also preferred. This operation deactivates the tumorigenic potential that may be acquired during transfection and / or cultivation.

As an intermediate step in the preparation of cancer vaccines, it is preferred to freeze the cells under controlled conditions and to add substances to avoid freezing of the cells ("cryoprotectants"), such as dimethylsulfoxide (DMSO). The freezing step can in principle be designed at any point in the process, for example before or even after transfection of the cultured cells, but also as a last step, that is, after the cells are irradiated and immediately before the vaccine is administered. Freezing makes available a set of cells prepared for transfection or already transformed, which then facilitate the preparation of a tumor vaccine in small portions. This is preferably a frozen preparation that can be stored temporarily and only needs to undergo a preparatory operation, including irradiation, before use.

In all cases, it is necessary to freeze the cells before administering the tumor vaccine! Protective materials.

The cancer vaccines produced in vitro according to the method of the invention are administered to patients for the induction or reactivation of a regular, tumor-specific immune response.

The amount of tumor cells per immunization is in the order of 10 ^{5 to} 10 ⁷ cells. In an embodiment involving culturing and transforming fibroblasts, the number of admixed fibroblasts is of the same order of magnitude, but may be reduced to 1/100 of the cell number, if appropriate.

Within the scope of the present invention, we studied in a mouse model how long these genetically modified melanoma cells can be detected at the injection site following the injection of the cancer vaccine. Furthermore, we examined whether these cells are distributed in the blood or in different organs. Detection was by PCR (polymerase chain reaction) technique. In the preparation of the cancer vaccine, cells were transformed with interleukin-2 plasmid DNA. IL-2 and adenoviral DNA fragments were detected from tissue samples using specific primers as markers of genetically engineered melanoma cells.

Studies at the immunization site showed that the cancer vaccine consisting of genetically modified melanoma cells administered disappeared within a few days after injection. In the acute phase of cell degradation, 2 days after immunization, it was found that recombinant IL-2 or adenoviral DNA was not transferred to the blood, organs or germ cells.

In another aspect, the invention relates to DNA comprising a sequence encoding one or more immune stimulatory polypeptides, a DNA binding molecule preferably conjugated to an internalizing factor of tumor cells and / or fibroblasts, in particular polylysine, and a DNA binding molecule and an adenovirus or peptide as defined above. is a transfection complex consisting of a constitutive endosomal malic conjugate, wherein the DNA binding molecule c) and the DNA binding portion of the conjugate b) are linked to DNA.

It has been found that the complexes of the invention allow efficient gene transfer to primary human melanoma cells and primary human fibroblasts that transformed murine melanoma cells produce 24000 units of IL-2 at 1 x 10 ° cells per 24 hours, which is at least 30 times that of other human melanoma cells. viral [Lotze et al. J. Immunotherapie 12: 212-217 (1992); Rosenberg et al., Human Gene Therapy 3: 75-90 (1992)] or non-viral (Fearon et al., Cell 60, 397-403 (1990)) values that up to 100 Gy irradiation were detected. The present invention demonstrates the effect of a murine melanoma vaccine in a mouse model that elicits a systemic immune response in immunized mice and protects the animals from the development of tumors after administration of a melanoma cell at a tumor-causing dose. Furthermore, in an animal model, we were able to demonstrate the efficacy of a melanoma vaccine against metastasis formation.

The DNA molecule defined as component (ai) is a plasmid that contains a sequence encoding an immunostimulatory polypeptide, such as a cytokine, in an expressable form. In the context of the present invention, "immunostimulants are understood to mean so-called co-stimulatory molecules such as B7" (Schwartz R.H., Cell 71: 1065-1068 (1992); Townsend and Allison, Science 259: 368-370 (1993)], or adhesion molecules such as HSA (heat-stable antigens) (Kay et al., J. Immunology 145, 19521959 (1990)) or ICAM (Springer et al., 1990). , Anna. Port. Immunol. 5: 223 (1987)]; immunostimulatory agents also include foreign antigens (so-called neo-antigens), such as viral antigens. The sequence encoding the immunostimulatory polypeptide is linked to regulatory sequences that allow for the high expression of the immunomodulatory polypeptide in target cells. Preferably, strong promoters such as the CMV promoter [Boshart et al. Cell 41: 521-530 (1985)] or the β-actin promoter (Gunning et al., Proc. Natl. Acad. Sci. USA 84: 4831-4835 (1987)]. The appropriate structure can be determined in preliminary experiments by comparing expression values.

In a preferred embodiment of the invention, an interleukin-2 (IL-2) coding sequence is used.

However, DNA sequences encoding other cytokines such as IL-4, IL-12, IFN-γ, TNF-α, GM-CSF may also be used [Pardoll D., Curr. Opin. Immunol. 4: 619-623 (1992)]. Combinations of cytokine coding sequences may also be used to enhance the immune stimulatory effect, e.g., IL-2 + IFN-γ, IL-2 + IL-4, IL-2 +

TNF-α or TNF-α + IFN-γ. The chair 17 coding for the two different cytokines is preferably located on separate plasmids. Thus, as is the case, for example, in the experiments according to the invention

As shown for IL-2 and IFN-γ, a subtle degree of cytokine expression is achieved such that the quantitative ratios of both plasmids can be altered.

In a further embodiment of the invention, a DNA molecule comprising one or more co-stimulatory molecule coding sequences is introduced. In a preferred embodiment, the co-stimulatory molecule is a heat-stable antigen (HSA). DNA containing the HSA coding sequence may be introduced alone or in combination with DNA encoding a cytokine, preferably IL-2.

In a further embodiment of the invention, a DNA molecule comprising one or more neo-antigen coding sequences is introduced. In a preferred embodiment, the neo-antigen is a viral protein or fragment thereof, such as a Rabies glycoprotein. DNA containing the viral protein coding sequence may be introduced alone or in combination with DNA encoding a cytokine, preferably IL-2.

There is virtually no restriction on the size of the DNA construct, and the gene transfer system used has been shown to be suitable for 48 kb constructs [Cotten et al. , Proc. Natl. Acad. Sci. USA 89: 6094-6098 (1992).

Optionally, DNA encoding an immunostimulatory polypeptide, i.e., therapeutically active DNA, is provided in admixture with a DNA molecule as defined in aii) which serves as a "filler DNA". The sequence of this DNA is not critical, and the therapeutically effective DNA has to fulfill the purity criteria only that it does not contain a sequence which encodes a functionally active polypeptide in the cell. The size of this DNA is also not critical, and it is generally desirable to be of the order of or less than the size of the gene therapy DNA molecule.

This filler DNA, starting from a constant amount of DNA, may complement different portions of the therapeutically effective DNA with respect to the ratio of the other complex partners. The advantage of this is that the therapeutic DNA dose and thus the amount of cytokine expressed in the cell can be varied without having to change other parameters, which is very important in the process of producing a standardized tumor vaccine. Within the scope of the present invention, we have been able to show that the amount of gene expressed in a cell is reduced proportionally with the filler DNA portion.

In a further embodiment of the invention, the plasmid DNA used is free of lipopolysaccharides. It was surprisingly found that expression values are significantly higher when plasmid DNA is largely free of lipopolysaccharides. They are frequent contaminants of plasmid DNA, which is usually produced in E. coli. To remove the lipopolysaccharides or by suitable methods, the DNA may be purified, for example, by a combination of chromatography methods including polymyxin chromatography, or the lipopolysaccharides, optionally derived from the culture medium, may be added to the culture medium as lipopolysaccharide binding reagents.

If the target cell has adenovirus receptors through which internalization sufficiently guarantees the effective expression of foreign DNA in the cell, the use of adenovirus conjugates as component b) may be sufficient to introduce as DNA component a non-conjugating DNA binding molecule as component c); in general, this is the same molecule as the conjugate b), preferably polylysine. In this embodiment of the invention, the adenovirus itself performs the function of an internalizing factor, in which case it is not necessary to conjugate the DNA binding agent to another internalizing factor.

DNA in an embodiment of the invention wherein c) is a non-conjugated DNA binding agent is complexed with conjugate b); the function of component c) in this case is primarily to facilitate the uptake of complexes into the cell [Wagner et al. , Proc. Natl. Acad. Sci. USA 8, 8, 4255-4259 (1991)] In certain applications, such as the use of small DNA molecules, a non-conjugated DNA binding molecule as component c) can be completely eliminated.

In a preferred embodiment of the invention, the DNA binding agent defined as component c) is conjugated to an internalizing factor. This embodiment of the invention is particularly useful when the target cell has no or only few adenoviral receptors when using an adenovirus conjugate, for example when using a virus from a distant species, or when a peptide conjugate is introduced b) as an endosomal malic conjugate. In the presence of an additional internalizing factor conjugate, the viral conjugates utilize the internalizing ability of the conjugate c) by co-complexing with the nucleic acid and entering into a cell of the resulting complex, hereafter referred to as a "combination complex" or "triple complex". . Without wishing to be bound by this theory, combination complexes are taken up by cells either by binding to a specific surface receptor on the internalizing factor, or by binding to the viral receptor or both, via receptor-mediated endocytosis. When the viruses are released from the endosomes, the DNA in the complex is also released into the cytoplasm and thus escaped from lysosomal degradation.

Conjugates preferably preferred as c) between an internalizing factor and a DNA binding agent are known per se.

In the context of the present invention, the internalizing factor is defined as ligands or fragments thereof which, after binding to a tumor cell or fibroblast, are internalized by endocytosis, preferably receptor-mediated endocytosis, or factors whose binding / internalization is effected by fusion with elements of the cell membrane.

Examples of internalizing factors are transferrin ligands [Klausner et al. , Proc. Natl. Acad. Sci. USA, 80, 2263-2266 (1983)], asialoglycoproteins (such as asialo-transferrin, asialo-rozomucoid or asialo-fetuin) [Ashwell et al., Annu.

Port. Biochem., 51, 531-554 (1982)], lectins [Goldstein et al. .

Natur. 285, 66 (1980); Sharon N., Cell Separation: Methods and

Selected Applications, Vol. 5, Academic Press Inc., 13-44 (1987)] or substances containing galactose and internalized via the asialoglycoprotein receptor; mannose-containing glycoproteins [Stahl et al. , Proc. Natl. Acad. Sci. USA 75: 1399-1403 (1978)], lysosomal enzymes [Sly et al. , J. Cell Biochem., 18, 67-85 (1982)], LDL [Goldstein et al. Clin. Sl., 30, 417-426 (1982)], modified LDL [Goldstein et al. , Proc. Natl. Acad. Sci. USA, 7, 6, 333-337 (1979)], lipoproteins that are taken up by the cell via receptors (apo B100 / LDL); viral proteins; antibodies [MeIlmán et al.,

J. Cell Bioi., 98, 1170-1177 (1984); Kuhn et al., Trends Biochem. Sci., 7, 299-302 (1982); Abrahamson et al., J. Cell

Biol., 91, 270-280 (1981)] or fragments thereof against cell surface antigens, such as anti-CD4, anti-CD7, anti-CD3; cytokines such as interleukin-1 [Mizel et al. , J. Immunol., 138, 2906-2912 (1987)], interleukin-2 [Smith et al., Proc. Natl.

Acad. Sci. USA 82: 864-867 (1985)], TNF [Imamura et al. , J.

Immunol., 139, 2989-2992 (1987)], interferons [Anderson et al. .

J. Bioi. Chem. 257: 11301-11304 (1982)]; CSF (Colony-stimulating Factor) [Walker et al. , J. Cell Physiol., 130, 255-261 (1987)], factors and growth factors such as insulin (Marshall, S., J. Biol. Chem., 250, 4133-4144 (1985)], EGF (Epitermal Growth Factor) (Carpenter G., Cell, 37, 357-358 (1984)); PDGF (Platelet-derived Growth Factor) [Heldin et al., J. Bioi. Chem., 257, 4216-4221 (1982)], TGFα and TGFB (Transforming Growth Factor α and β = α and β transforming growth factor) (Massague et al., J. Cell Physiol. 128, 216-222 (1986)). )], HGF (Hepatocyte Growth Factor) [Nakamura et al. , Natur 342, 44 0 -

443 (1989)] nerve growth factor [Hosang et al. , EMBO J. 6,

1197-1202 (1987), Insulin-like Growth Factor I (Schalch et al., Endocrinology, 118, 1590-1597 (1986)), LH, FSH (Ascoli et al., J. Bioi. . Chem.,

253: 7832-7838 (1978)], growth hormone [Hizuka et al. , J.

Biol. Chem., 256, 4591-4597 (1981)], prolactin (Posner et al., J. Cell Biol., 93, 560-567 (1982)), glucagon (Asada-Kubota et al., Exp. Pathol. 23, 95-101 (1983)], thyroid hormones [Cheng et al., Proc. Natl. Acad. Sci. USA, 77, 3425-3429 (1980)], α-2-macroglobulin protease (Káplán et al., J. Biol. Chem. 254: 73237328 (1979). Other examples are immunoglobulins or fragments thereof, such as ligands for the Fc receptor, or anti-immunoglobulin antibodies that bind to SIgs (Surface Immunoglobulins). The ligands may be of natural or synthetic origin (see Trends Pharmacol. Sci. (1989) and references therein].

Within the scope of the invention, transferrin and EGF are preferred as the internalizing factor.

Suitable DNA binding agents include, as component c) (unconjugated or conjugated as part of an internalizing factor conjugate) or component b) conjugates, for example, polycations containing homologous organic polycations such as polylysine, polyarginine, polyiornithine or heterologous two or more positively charged amino acids. with different chain lengths «

V * · • · • · »

and non-peptide synthetic polycations such as polyethyleneimine. Suitable DNA binding agents include natural, polycationic DNA binding proteins such as histones or protamines, or analogs or fragments thereof, and spermine or spermidine.

The length of the polycation is not critical if the complexes are substantially electronutral. If the DNA

It has 6,000 base pairs and 12,000 negative charges, for example the amount of polycation per mole of DNA is

60 M polylysine 200 monomer, 30 M polylysine 400 monomer, 120 M polylysine 100 monomer

or or etc. may.

The average person skilled in the art can, through simple routine experiments, select other combinations of polycation length and molar amount.

Polylysine is preferably included within the scope of the invention, especially chains of about 200-300 lysine monomers.

If the DNA binding molecule is modified to bind to an endosomal malic agent, particularly the virus, for example conjugation of polylysine to streptavidin for binding to biotinylated adenovirus, the DNA binding molecule so modified is a component c). can be entered. In practice, this means that an excess of polylysine streptavidin is taken up in the preparation of the polylysine-streptavidin / biotin-adenovirus conjugates, which takes over the role of component c).

Internalizing factor-polycation conjugates may be prepared chemically, in the case where the polycation is a polypeptide, by recombinant means. Reference is made to EP 388 758 for methods of preparation.

Conjugates can also be prepared according to the method described by Wagner et al., (1991) Bioconjugate Chem. 2, 226-231, wherein a glycoprotein, such as transferrin, and a DNA-binding molecule, particularly polylysine, are one or more carbohydrates of the glycoprotein. link through each other.

An adenovirus conjugate b) preferably contains an adenovirus that is defective in the E4 region. Such adenoviruses are described by Bridge and Ketner, J. Virol. 63: 631-638 (1989)]. The role of the proteins encoded in the complex E4 region is only partially clarified. It is known that the E4 region, like the Elb region, plays an important role in the transition between the viral early and late gene expression programs and in the switching off of host cell protein synthesis, and is responsible for viral replication and virion assembly. 24 E4 mRNAs exist, so far seven open reading frames have been identified, suggesting that reading frames 3 and 6 should be primarily responsible for the E4 phenotype. The gene product of the 6/7 open reading frame (ORF) plays a very important role. This protein is likely to bind to the cellular E2F transcription factor, thereby becoming a highly specific adenoviral transcription factor. Surprisingly, we have found that an adenovirus that is defective in the E4 region as a component of a re25 receptor-mediated endocytosis-based gene transfer system in which the adenovirus acts as an endosome disruptor exhibits low toxicity to tumor cells during use. .

Among the adenoviruses described by Bridge and Ketner, the dll014 mutant, which has intact ORF 4 but is defective in ORF 3 and ORF 6 and ORF 6/7, was selected based on the feature that it is most severely impaired in viral protein synthesis. As the role of viral proteins encoded in the E4 region is not yet fully elucidated, it is not yet possible to determine in which reading frames mutations must be made to achieve the desired effect. In addition to dll014, other suitable mutants can be empirically identified while generating E4 mutants as described by Bridge and Ketner and tested in standardized transfection and cytotoxicity assays as described in the Examples. The reporter gene may then be used in place of the cytokine gene in the orientation transfection assay. Mutants that produce comparable gene expression and cytotoxicity values, such as dll014 and dll014, which are still superior to mutants, are suitable components of the transfection complex within the scope of the present invention, provided they further satisfy the requirement that viruses such as dll014 in the W162 cell line, a high titer in an E4 error compensating cell line.

As an alternative to the E4-defective adenovirus, a defective adenovirus may be used in the Ela region which, in addition to the Ela-defect, has one or more additional gene defects produced by chemical, physico / chemical or genetic methods.

Errors created by chemical or physico / chemical methods are not targeted defects, but can occur scattered throughout the viral genome.

Within the scope of the invention, inter alia, an adenovirus mutant dl312 [Jones and Shenk, Proc. Natl. Acad. Sci.

Other suitable Ela mutants may be prepared according to methods known in the art, supplemented with various inactivation methods and / or dosages, and as described for E4 mutants, can be tested as components of transfection complexes for the preparation of cancer vaccines.

As an alternative to 8-methoxy-psoralen, other psoralen derivatives, such as 4 '- (aminomethyl) -4,5', 8-trimethyl-psoralen, which have been found to be suitable for inactivation of adenoviruses for gene transfer, may be used. (Psoralen derivatives have intercalary capacity and, after 365 nm UV irradiation, form covalent, inter-fiber and intra-fiber adducts with viral DNA (Hanson CV, Blood Cells 18, 7-25 (1992)). These adducts inactivate the subject. It has been found that there is a decrease in viral replication of more than 5 logs (as determined by CPE assay) and a decrease in viral replication of more than 7 logs (plaque), which can block gene functions such as viral transcription and replication.

assay = as determined by the plaque assay) as compared to a mere 0.5 lg reduction in gene transfer amplification [Cotten et al., Proc. Natl. Acad. Sci. USA 89: 6094-6098 (1992).

In view of the desire for maximum standardization in the manufacture of drugs in general and in the manufacture of cancer vaccines in particular, which includes all components and process parameters, including the viruses introduced, it is preferable to introduce a virus which has been inactivated according to a standardized method. Above all, the requirement of standardization is met by chemical inactivation methods, which override physico / chemical methods in this regard. An example of a chemical inactivation method is β-propiolactone inactivation [Morgeaux et al. , Vaccine 11: 82-90 (1993); De Shu et al. , J. Bioi. Stand. 14, 103 (1986); Budowsky and Zalesskaya, Vaccine 9, 319 (1991)]. This method has the advantage that due to the instability of the inactivating agent in aqueous solutions, the purification of the unreacted reagent is eliminated. In addition, this inactivation method does not require UV treatment, which is also an advantage for standardization. Within the scope of the present invention, it has been found that treatment of adenovirus with 0.3% β-propiolactone in two small increments for 4 hours at room temperature results in a decrease in virus titer to 5 logs, which is comparable to inactivation with 8-methoxy-psoralen. DNA transport activity remains unchanged at medium doses of β-propiolactone (0.3%), whereas treatment with 1% β-propiolactone results in a significant decrease in this ability. Analysis of the gene expression of the inactivated virus showed that both psoralen derivatives and β-propiolactone block the viral gene expression (Ela and E3) to the same extent. However, the more sensitive plaque method showed that psoralen treatment inactivates the virus by more than 7 logs, where no plaque could be observed at the highest doses of virus. In contrast, β-propiolactone inactivation caused only a 5 log drop in viral titre, where plaques were observed at higher doses of virus.

Thus, in a further embodiment of the invention, a virus is introduced which is exclusively inactivated by chemical methods, preferably β-propiolactone.

The suitability of a method for inactivating viruses with respect to their use in gene transfer, in particular for the cancer vaccine of the invention, can be determined in preliminary experiments, as is the inactivation of adenoviruses with 8-methoxypsoralen / UV, 4 '- (aminomethyl) -4,5', 8 -trimethyl-psoralen / UV and β-propiolactone are illustrated in the Examples. The efficiency of virus inactivation is determined by determining the viral titer and / or the more sensitive plaque assay and additionally testing the ability of the virus to amplify the receptor-mediated gene transfer using a reporter gene. In order to determine which part of the viral genome is affected by the inactivation method, i.e., which sections are destroyed, hybridization experiments can be performed with DNA probes, which can be used to detect viruses for the presence of appropriate transcripts. Within the framework of the invention, according to this principle: ·. · ·

- · · * We tested a variety of inactivation methods for their ability to block viral replication and transcriptional functions. An inactivation method is appropriate if it provides adenoviral particles that still have the endosomal malic activity required for DNA transport function, which is the function of the viral capsid, while lacking the ability of viral gene expression or replication, which could result in unwanted changes in the cell. We found that adenovirus with 8-methoxy-psoralen or 4 '- (aminomethyl) -4,5', 8-trimethyl-psoralen, followed by 25 minutes of UVA irradiation, as well as 2 x 0.3% β- treatment with propiolactone results in viral particles that retain their ability to enhance efficient DNA transport. With the help of CPE (Zytopathischer Endpunktassay = Cytopathic Endpoint Assay), it was determined that the three treatments were comparable with respect to the reduction in viral titer. No viral genome transcription could be detected after treatment with either 8-methoxy-psoralen / UV or β-propiolactone. However, the more sensitive plaque assay has shown that viruses treated with β-propiolactone are capable of replication if the complementing cell line is present in sufficient quantities. In contrast, treatment of the virus with both psoralen derivatives completely blocks viral replication so that plaques were not detectable with this test.

RNA analysis to detect gene expression was performed with either an adenovirus Ela probe that recognizes a portion of the Ela gene excised from the dl312 adenovirus or an adenovirus.

With the E3 probe, which recognizes a portion of the common E3 region encoding the E3 19K glycoprotein (serves as a control; dl312 virus must lack an RNA signal, which however is detectable at dll014 because it has a wild type E1 region ). E3 expression is thought to play an important role in the immune response to transformed cells, since at least two of the E3 genes modulate the surface expression of MHC class I molecules and TNF receptor molecules on the surface of infected cells. For the use of dll014 viruses in gene therapy applications in which immunogenic tumor cells are produced, an error in the E3 region is desirable, since expression of this region in this composition could interfere with the immune response to transformed cells.

The introduction of an endosomal malic substance coupled to (or ionically bonded to) the polylysine is preferred as a component of a triple or combination complex. The adenovirus can be linked to polylysine in different ways:

The linkage of the virus to the peptides may be chemically coupled in a manner known per se, where necessary, where necessary, each component may be provided with linker materials prior to the coupling reaction (this step is required if a functional group such as an mercapto or alcohol). Linkers are bifunctional compounds that react primarily with the functional groups of each component to which the modified components are coupled.

A possible way of attaching the virus to polylysine is similar to that used for the preparation of transferrin-polylysine conjugates [Wagner et al. , Proc. Natl. Acad. Sci. USA 87: 3410-3414 (1990)] after modification of a defective adenovirus with a heterobifunctional reagent. If the virus has appropriate carbohydrate chains, it can bind to the DNA binding agent via one or more carbohydrate chains of the glycoprotein (Wagner et al., 1991, Bioconjugate Chem. 2, 226-231).

Another method for preparing a virus-polylysine conjugate is the enzymatic coupling of a virus to a DNA binding agent, particularly a polyamine, via a transglutaminase [Zatloukal et al. , Ann. New York Acad. Sci. 660, 136-153 (1992)].

A further method for preparing an adenovirus-polylysine conjugate is to attach the virus to the polycation via a biotin-protein bridge, preferably a biotin-streptavidin bridge [Wagner et al. , Proc. Natl. Acad. Sci. USA 8 9, 6099-6103 (1990).

Optionally, binding to biotin may also be via avidin.

Further, the virus-to-polylysine linkage can be made by biotinizing the virus on the one hand and conjugating an anti-biotin antibody to polylysine on the other, and linking the virus to polylysine via the biotin / antibody linkage, where the standard polyclonal anti-biotin or monoclonal antibodies.

The linkage between the virus and polylysine can also be prepared by coupling the polylysine with a lectin that binds to a water.

has an affinity for the surface glycoprotein, where the bond in such a conjugate is formed by a bond between the lectin and the glycoprotein. If the virus itself does not have suitable carbohydrate side chains, it can be modified accordingly.

The virus, if it contains acidic regions between its surface proteins and is capable of binding to a polycation, may also ionically attach to the DNA binding molecule.

In addition to the selected adenoviral mutants, the endosomal malic component of the conjugate as defined in (b) may also be a peptide which is ion-linked to a DNA binding molecule. The requirements for such peptides and their attachment to the DNA binding molecule are referred to in WO 93/07283.

Within the scope of the invention, we prefer a synthetic dimeric influenza peptide of SEQ ID NO: 7 when used ionically linked to polylysine to achieve high IL-2 expression values in melanoma cells. Melanoma cells transformed with a transferrin-polylysine conjugate containing plasmid IL-2 in the presence of this peptide conjugate have been shown to be a cancer vaccine with prophylactic protection against tumor formation.

The order of the steps for the preparation of the transfection complexes is not critical;

Starting from DNA molecules, we determine the type and amount of DNA binding agent that guarantees the complexation of the DNA33

being, the resulting complexes are preferably substantially electronutral. For complexes containing a viral conjugate and an internalizing factor conjugate, the cation share of both conjugates is considered in terms of electron neutrality.

In determining the molar ratios of components (a), (b) and (c), account must be taken of the fact that DNA complexation occurs, that the complex formed is bound to the cell, transported to the cell, and released from endosomes.

The particular internalizing factor-conjugate / DNA ratio chosen is primarily based on the size of the polycation molecule and the number and distribution of the positively charged groups, criteria which are aligned with the size and structure of the DNA to be delivered, where the viral conjugate is to be considered. The molar ratio of internalizing factor: polylysine is preferably from about 10: 1 to 1:10.

When using an adenovirus conjugate and a non-conjugated DNA binding agent, the amount of conjugate moiety that can be replaced by a DNA binding agent is determined by titration after determining the optimal conjugate to DNA ratio for transfection and expression efficiency.

Preference is given to introducing polylysine both as component c), preferably conjugated to an internalizing factor, and as component b) of the adenovirus conjugate.

A suitable method for determining the proportions of components that comprise complexes is to first define the gene structure to be delivered to the cell and, as described above, to find a virus suitable for transfection. The virus is then bound to the polycation and complexed with the gene structure. Starting from a constant amount of DNA, the optimal ratio between the viral conjugate and the internalizing factor conjugate and the unconjugated DNA binding agent is determined by titration.

Complexes can be prepared by mixing components a), b) and c), which are always in the form of dilute solutions.

The optimum ratio of DNA to conjugate and non-conjugated DNA binding agent is determined by titration, i.e. a series of transfection experiments with constant amount of DNA and varying amounts of conjugate / polylysine. The optimum ratio of conjugate to polycation in the mixture is obtained by comparing it with routine experiments and with the optimal ratio of mixtures prepared in titration experiments.

DNA complexes can be prepared at physiological salt concentrations. Another option is to use higher salt concentrations (about 2 M NaCl) and then adjust to physiological values by slow dilution or dialysis.

The most appropriate mixing order of the components is determined individually in preliminary experiments.

The amount of endosomal malic conjugate administered is tailored to the individually designed transfections. It is advisable to introduce the minimum amount of endosomal malic conjugate required to guarantee internalization of the complexes • 1 • »

Λ «• ·« and most of the endosomes. their release. If an adenovirus conjugate is used, the amount of conjugate will be adjusted to the particular cell type, which should in particular consider the infectivity of this cell type to the virus. A further criterion is the particular internalizing factor conjugate, particularly with respect to the internalizing factor, for which the target cells have a defined number of receptors. In addition, the amount of endosomal malic conjugate is adapted to the amount of DNA to be delivered. For specific applications, the target cells for each transfection and the vector system for transfection are pre-experimentally determined to optimize the concentration of the endosomal malignant conjugate, whereby DNA is preferably introduced into a gene structure of a size that is highly consistent with the intended use, contains a reporter gene for measurement. Within the scope of the invention, we have demonstrated the suitability of the luciferase gene as a reporter gene in such experiments.

In another aspect, the invention relates to tumor cells and fibroblasts transformed with the complexes of the invention.

In another aspect, the invention relates to cancer vaccines obtainable by the process of the invention. These vaccines are pharmaceutical compositions containing the transformed tumor cells or the transformed fibroblasts in admixture with the tumor cells in a pharmaceutically acceptable form.

Ready-to-use cancer vaccines are preferably available as suspensions, optionally obtained by trypsinization. The cells are suspended in physiological saline (physiological saline or buffer), which optionally contains the nutrients, especially amino acids, required by the cells for a short period of time between vaccine preparation and use.

In experiments performed within the scope of the invention, melanoma cells were in RPMI 1640 medium supplemented with fetal calf serum (FCS).

The galenic formulation of the tumor vaccines of the present invention has been tested in various media for their therapeutic use.

Media containing supplements such as fetal calf serum, human serum, human serum albumin and / or hydroxyethylcellulose have been shown to guarantee the viability of a sufficient number of cells for the vaccine. In one embodiment, for the sake of good compatibility, the tumor vaccines are preferably in serum AB, and autologous serum may be used as a medium. Optionally, the medium contains growth factor or cytokine such as IFN-γ or GM-CSF to favorably influence cellular antigen presentation.

The type of cancer vaccine that can be produced by the present invention outlines a new development in the field of cytokine therapy. The advantage is that the locally limited production and activity of cytokines avoids the serious side effects of regularly administered cytokines. Outside treatment of melanomas and colon carcinomas ·· ··· «····,.

; * · · · Ϊ. · ··.

·· · ·.

other types of cancer can be treated with the cancer vaccines of the invention, such as kidney or breast cancer.

An overview of the figures

Figure 1: Gene transport in primary human melanoma cell cultures

Figure 2: Determination of ligands involved in uptake of gene transfer complexes;

use of non-conjugated polylysine

Figure 3: Effect of psoralen / UV inactivation of adenoviruses on gene expression in primary human melanoma cells

Figure 4: Determination of long-term cytotoxicity of adenoviruses

Figure 5: Effect of irradiation of tumor cells on expression of transformed genes

Figure 6: Effect of plasmid concentration on luciferase reporter gene expression

Figure 7: Effect of plasmid concentration on IL-2 and / or IFN-γ expression

Figure 8: Loss of tumorigenicity of transformed mouse melanoma cells

Figure 9: Induction of a systemic immune response against melanoma in mice by immunization with irradiated tumor cells transformed with cytokine

Figure 10: EGF as a gene transfer ligand in cells of human epidermoid carcinoma cell line (A: + 2% FCS, B: no FOS)

Figure 11: IL-2 expression in murine melanoma cells using different vectors »· ···· ·« ·· a! í · · ·

figure: IL-2 expression in fibroblasts is a variety of vectors application figure: Stimulation of the immune response by melanoma cells expressing HSA on their surface figure: Stimulation of immune response by melanoma cells which express Rabies glycoprotein on their surface figure: Titration of 8-methoxy-psoralen figure: Titration of 4 '- (aminomethyl) -4,5', 8-trimethyl-psoralen figure: titration of β-propiolactone figure: Adenovirus gene transport activity of dll014 after treatment with 8-methoxypsoralen or low concentrations of β-propiolactone figure: With 8-methoxy-psoralen, β-propiolactone or 4 '- - (aminomethyl) -4,5 ', 8-trimethyl-psoralen inactivated Determination of dll014 adenovirus by plaque assay figure: Determination of dl104 adenovirus inactivated with 8-methoxy-psoralen or various β-propiolactone treatments figure: Inactivated virus gene expression figure: Reverse transcription PCR analysis figure: The site of storage of 8-methoxy-psoralen in the viral genome figure : Growth of human melanoma cells as a function of gamma ray dose figure: Protective action against metastasis formation forms by immunization with melanoma cells (transfection with adenovirus)

Figure 26: Efficacy of cancer vaccine versus cytokine dose

Figure 27: Protective effect against metastasis formation by immunization with cytokine-transformed melanoma cells (transfection with endosomal malic peptide)

Figure 28: Interleukin-2 expression in human melanoma cells

Figure 29: Effect of DNA endotoxin content on IL-2 expression in human melanoma cells

In the Examples which illustrate the invention, unless otherwise indicated, the following materials and methods were used:

(a) Plasmid structures

i) Containing a human or mouse IL-2 coding sequence

DNA plasmid constructs

6-8. The plasmid BCMGneomIL-2 described by Karasuyama et al., J. Exp. Med. 169, 13 (1989) was used in the experiments.

A plasmid pWS2m was constructed containing the murine IL-2 gene under the control of the Cytomegalovirus enhancer / promoter: Plasmid pHBAPr-1 [Gunning et al. , Proc. Natl. Acad. Sci. USA 84, 4831-4835 (1987)] were digested with BamHI and EcoRI. A 2.5 kb fragment containing the ampicillin resistance gene, the origin of replication of pBR322 and the polyadenylation signal of SV43 was isolated by agarose gel purification. This fragment was ligated with the CMV promoter / enhancer, previously amplified as a 0.7 kb PCR fragment of the pAD-CMVI vector (described in EP-A 393 438) and digested with EcoRI / BamHI. The resulting plasmid was named pWS. The cDNA encoding murine IL-2 a

As a PCR fragment of BMGneo mIL-2 [Karasuyama and Melchers, Eur. J. Immunol. 18: 97-104 (1988)]. The first

From the ATG codon to the 5 'end, the GCCGCC sequence was inserted for optimal translation initiation. The 3 'non-coding region was removed. The PCR fragment was ligated into the pWS vector opened by SalI / BamHI digestion.

For use in human cells, the vector pWS2, obtained in a manner similar to pWS2m, was introduced, except that plasmid pIL2-50A was used as a template for PCR amplification instead of BMGneomIL-2 [Taniguchi et al. (Natura 302: 305-310 (1983)) which contains the cDNA encoding human IL-2.

As an alternative to an ampicillin resistance plasmid, the vector pGShIL-2tet containing the tetracycline resistance gene was excised from pBR327.

For the plasmid pCM2, the murine IL-2 sequence, together with the 5 'and 3' flanking regions (cleavage and poly (A) signals from the rabbit β-globin gene), was excised from the BCMGneo-mIL-2 plasmid as a SalI / BamHI fragment. into the vector pAD-CMV1.

ii) A DNA plasmid construct comprising a murine IFN-γ coding sequence

Gray and Goeddel, Proc. Natl. Acad. Sci. USA 80: 5842-5846 (pSVEmuIFN-γ 1983).

iii) a DNA plasmid construct containing the HSA coding sequence

The plasmid pHSA, which contains the HSA sequence folded by the CMV promoter, was obtained by inserting the HSA cDNA (Kay et al., 1990, J. Immunology 145, 1952-1959) (Seed B.). , Natura 329: 840-842 (1987)] was cloned into the BstXI site.

iv) pWS-RABIES DNA Plasmid Containing Rabies Glycoprotein Sequence

The coding sequence for the Rabies glycoprotein is from pKSV-10 vector (Pharmacia), which is a Rabies glycoprotein et al., Comp. Immunol. Microbiol. Infect. Dis.

site cloned - isolated as Bgl II fragment. The pWS2m vector with Bgl II and

We cleaved with BamHI. The fragment containing the murine IL-2 cDNA was separated by agarose gel electrophoresis and inserted into the pWS vector. The fragment was isolated and the Rabies correct Rabies direction was confirmed by sequencing with the fragment. The ligaby Rabiesglycoprotein sequence is shown as SEQ ID NO: 1

v) DNA plasmid construct pWS-Gm containing the sequence encoding the murine GM-CSF

The vector pWS2 described in i) was cleaved with SalI and BamHI and the resulting fragment encoding IL-2 was separated by agarose gel electrophoresis. DNA encoding murine GM-CSF was synthesized from 12 mutually overlapping oligonucleotides. The sequence used corresponded to that described by Miyatake et al. (EMBO J. 4: 2561-2568 (1985)) (coding region 32 to 457), except that substitutions were made at 178 (G instead of A). , 274 (C for G), and 355 (C for G). In addition, the AGC triplet (positions 446-448) was replaced by GTC.

The 5 'region is provided with a SalI-compatible extension, and the 3' region is provided with a BamHI-compatible extension. The 5 'end was provided with a GCCGCC sequence similar to the IL-2 sequence of pWS2. The synthetic GM-CSF gene was cloned and sequenced into the pWS2 vector following the Shot-gun method (Sambrook et al., 1989, Molecular Cloning, Cold Spring Harbor Laboratory Press (2nd edition)). Errors detected by sequence analysis were corrected for sequence mutagenic treatment according to the Phosphorothioat method (Amersham-Kit).

vi) pGShIL-2 tet containing the human IL-2 coding sequence

DNA plasmid construct

An IL-2 cassette containing the CMV enhancer / promoter, the IL-2 coding sequence and the SV40 polyA sequence was obtained by PCR using the pWS2 vector described in (i) as a sample. The POR product was subjected to restriction digestion with EcoRI and cloned into the EcoRI / SmaI site of plasmid pUC19 (Pharmacia). The resulting plasmid was called pGShIL-2. The source of the tetracycline resistance gene and part of the upstream region of the β-lactamase gene (ampicillin resistance gene) was plasmid pBR327 (Soberon et al., Gene 9, 287 (1980)), previously digested with Sspl and Aval. Together with an EcoRI / Aval adapter, the isolated tet sequence was cloned into the EcoRI / Sspl site of plasmid pGShIL-2. The IL-2 cassette of the resulting pGShIL-2tet / amp clone was sequenced; then the amp sequence was excised by restriction digestion with Eamll10 and Sspl, and the plasmid was re-ligated. The resulting plasmid was designated pGShIL-2tet.

vii) pCMVL reporter plasmid construct

Plasmid pCMV was constructed by inserting the BamHI insert of pSTCX556 [Severne et al. EMBO J.J., 2503-2508 (1988)]. The plasmid was treated with the Klenow fragment and inserted the HindIII / SspI and Klenow-treated fragment from pRSVL (containing the Photinus pyralis luciferase gene under the control of the Rous Sarcoma virus LTR enhancer / promoter [Uchida et al., J. Biochem. 82 , 1425-1433 (1977); De Wet et al., Mol. Cell Biol. 7: 725-737 (1987)] The reporter plasmid was designated pCMVL.

b) Preparation of transferrin-polylysine conjugates

For the synthesis of conjugates consisting of transferrin and 290 lysine residual chain polylysine, the method described by Wagner et al., Bioconjugate Chem. 2, 226-231 (1991) was used.

c) Preparation of EGF-Polylysine Conjugates mg of EGF (Epidermal Growth Factor, Sigma, St. Louis, Cat. No. E-4127) was purified by gel filtration (Sephadex G-10) with HBS elution buffer.

135 nm (0.8 mg) epithelial growth factor (EGF) in 1.5 ml HBS was treated with a solution of SPDP in 15 mM ethanol (1.2 pmol). After 2 hours at room temperature, the modified protein was gel-filtered on a Sephadex G-10 column to obtain 50 nmol of EGF modified with a dithiopyridine linker. The modified protein was reacted with 3-mercaptopropionate-modified polylysine (50 nmol, 150 nmol mercaptopropionate linker modified, 290 lysine monomer, average chain length) in a total of 1 ml HBS in argon 44. The conjugates were isolated by gel chromatography on a Superdex 75 column (Pharmacia) (buffer: 0.5 M sodium chloride). The product fraction contains a conjugate of 20 nM streptavidin and 25 nM polylysine.

d) Preparation of streptavidin-polylysine conjugates

The coupling of streptavidin to polylysine is described in Wagner et al., Proc. Natl. Acad. Sci. USA 87: 3410-4314 (1990) and EP-A1 388 758 according to the method for preparation of transferrin-polylysine conjugates.

of streptavidin (4.7 mg) in 1 ml of a mixture of 200 mM HEPES pH 7.9 and 300 mM NaCl was treated with SPDP in 15 mM ethanol (236 nmol). After 1.5 hours at room temperature, the modified protein was gel-filtered on a Sephadex G-25 column to obtain 196 nmoles of streptavidin modified with a dithiopyridine linker. The modified protein was reacted with 3-mercaptopropionate-modified polylysine (75 nmol, 190 nmol mercaptopropionate linker modified, 290 lysine monomer average chain length) in 2.6 ml of a mixture of 100 mM HEPES pH 7.9 and 150 mM NaCl, under argon. The conjugates were isolated by cation exchange chromatography on a Mono S HR5 column (Pharmacia). (Gradient: 20-100% buffer. Buffer A: 50 mM HEPES pH 7.9; Buffer B: Buffer + 3 M NaCl. The product fraction eluted at 1.2-1.7 M salt concentration). dialysis against mM HEPES pH 7.3, 150 mM NaCl) yielded a conjugate of 45 nM streptavidin and 53 nM polylysine.

e) Production of biotinylated, inactivated adenovirus

i) dl312 adenovirus preparations

Jones and Shenk, Proc. Natl. Acad. Sci. USA 7, 3665-3669 (1979)] used the dl312 adenovirus strain having a deletion in the Ela region. Virus propagation was performed in the Ela-trans-complementing 293 cell line, prepared by Davidson and Hassel, J. Virol. 61: 1226-1239 (1987)]. Purified virus was stored in storage buffer (100 mM Tris, pH 8.0, 100 mM)

NaCl, 0.1% BSA, 50% glycerol) or HBS / 40% glycerol and stored in small portions at -70 ° C. Virion concentration was determined by UV spectrophotometric analysis of extracted genomic viral DNA (one optical density unit (OD, A ₂₆₀ ) corresponds to 10 ¹² viral particles per ml; Chardonnet and Dales, Virology 40, 462-477 (1970)). ).

ii) dll014 adenovirus preparations

Bridge and Ketner, J. Virol. 63: 631-638 (1989)] was grown in the W162 cell line derived from the Verő (ATCC No. CCL81) cell line, prepared by Weinberg and Ketner, Proc. Natl. Acad. Sci. USA 80: 5383-5386 (1983). Large-scale preparation, purification and determination of virion concentration were performed as described for dl312.

iii) Biotinization of adenovirus with 2.4 ml of a solution of dl312 adenovirus (about 10 ¹¹ virus particles) in gel filtration (Sephadex G-25 PD10, Pharmacia) at 150 mM

NaCl / 5 mM HEPES pH 7.9 / 10% glycerol was supplemented with 10 μΐ (10 nmol) of a 1 mM solution of NHS-LC-biotin (Pierce 21335). After 3 hours at room temperature, the biotin-modified virus was separated from excess reagent by gel filtration (as above). The solution was adjusted to 40% glycerol (3.2 mL total volume) by addition of glycerol and stored at -25 ° C.

Qualitative evidence of virus biotination was demonstrated by dropping various dilutions onto the cellulose nitrate membrane: blocked with BSA at 80 ° C for 2 hours after drying in a vacuum oven, incubated with streptavidin-conjugated alkaline phosphatase (BRL) and Positive color reaction was obtained with X-phosphate developing solution (nitroblutetrazolium salt / 5-bromo-4-chloro-3-indole phosphate, toluidine salt; Boehringer Mannheim).

For the biotinization of dll014 adenovirus, 15 ml of adenovirus preparation (1.2 x 10 particles / ml) were treated with 150 μΐ of 1 mM NHS-LC-biotin. After 3 hours at room temperature, dialysed against 1 L of HBS + 40% glycerol at 4 ° C, the buffer was replaced fresh and a second dialysis was performed. A viral composition having a titer of about 1.2 x 10 particles / ml was obtained.

iv) Inactivation of biotinylated adenovirus with 8-methoxy-

-psoralennel

200-200 μΐ of biotinylated virus preparation was added to two wells of a 1.6 cm tissue culture plate. To each sample was added 2 μΐ (33 mg / ml) of 8-methoxy-psoralen (Sigma, Catalog No. M-3501, dissolved in DMSO), placed on ice and exposed to UV47 lamp (365 nm; UVP TL-33 lamp) for 10 min. ), where the sample distance from the filter was 4 cm. After irradiation, the two samples were pooled and gel filtered (G50, Nick column, Pharmacia) where the column was previously equilibrated with HBS + 40% glycerol.

Inactivation of biotinylated dll014 adenovirus was performed by adding 40 μΐ of 8-methoxy-psoralen (33 pg / μΐ in DMSO) to 4 ml of virus preparation (1 x 10 virus particles). Samples were allowed to stand for 1 hour at room temperature and placed in 12 x 300 μΐ culture dishes, placed on ice and irradiated with UV for 25 minutes as described above. Finally, gel filtration was performed (in 2 parts) on a G-25 PD10 column with HBS / 40% glycerol. 4.5 ml of the virus preparation was obtained with a titer of 9, 4 x 10 ^u .

f) Preparation of transfection complexes

The triple complexes were prepared in three steps. In the first step, biotinylated adenovirus mixed with 100 μΐ HBS was mixed with streptavidinated polylysine (StreptpL) mixed with 100 μΐ HBS and incubated for 30 minutes at room temperature. Subsequently, 6 µg of plasmid DNA in 150 μ 150 HBS was added, mixed well and incubated for an additional 30 minutes. Finally, polylysine-modified human transferrin (TfpL) in 150 μΐ HBS was added, mixed well, and incubated for 30 minutes. (The respective amounts of adenovirus, StreptpL and TfpL are given in each example.) The ratio of plasmid DNA to polylysine conjugate is calculated with respect to the electron neutrality of the final complexes. For transfections, complexes were plated on cells in a total volume of 2 ml of medium without FCS. After incubation for 4 hours at 37 ° C, the medium was removed and fresh serum-containing medium was added.

(g) Cells and culture media

i) Mouse melanoma cells

Cloudman S91 (clone M3) mouse melanoma cell line was obtained from ATCC (No. CCL 53.1). Cells were cultured in 6 cm plastic cups or T25 culture flasks coated with 0.1% gelatin in Ham's F10 medium containing 12.5% horse serum, 2.5% FCS, 2 mM glutamine and antibiotics.

ii) Mouse fibroblasts

Primary mouse fibroblasts were isolated from DBA / 2 mice as follows: 4-week-old DBA / 2 mice were sacrificed by cervical dislocation and immersed in 70% ethanol. Muscle was removed from the hind limbs under sterile conditions and washed with PBS. Samples were minced into pieces smaller than 2 mm and excess PBS was removed. The tissue pieces were then 3x5 ml, 0.25% trypsin (from porcine pancreas, Sigma Catalog No. T-2904), 0.1% collagenase (Typ XI, Sigma, Catalog No. C-9407),

0.1% BSA (Fraction V, Boehringer Mannheim, Catalog # 735)

094) and incubated for 30 min at 37 ° C with agitation. The tissue pieces were then allowed to settle for 5 minutes and the supernatant containing the liberated cells was mixed with 5 ml of 20% FCS in DMEM. The undissociated material was digested for an additional 30 minutes and the supernatant was collected as described above. This process was repeated until all the material had disintegrated. The pooled supernatants were centrifuged at 500 x g for 15 minutes, the cell pellet resuspended in 20% FCS-containing DMEM and plated in culture dish. After 30 minutes, non-adherent cells were aspirated and fresh medium was added.

iii) Human melanoma cells

Primary human melanoma cells were isolated from surgically removed melanomas. The tumors were mechanically divided into small pieces (with pin and surgical knife) in the presence of RPMI 1640 medium containing 5% FCS, 2 mM glutamine and antibiotics. The pieces of tissue were then pushed through a metal screen with a plunger of a syringe. Subsequently, the material was washed several times by centrifugation and resuspended, and the liberated cells were plated in T25 culture flasks.

iv) Human fibroblasts

After surgical removal, skin biopsies were added to 4 ° C DMEM containing 10% FCS, 2 mM glutamine and antibiotics (penicillin / streptomycin or gentamicin for human fibroblasts). The biopsies were thoroughly comminuted in a tissue culture apparatus with a pin and surgical knife, under a laminar flow of air, in sterile 6 cm plastic cups. DMEM containing 20 mL of 20% FCS, 2 mM glutamine and antibiotics was then added and the culture was placed in a 37 ° C thermostat. After 10 days, the medium was replaced with DMEM containing 10% FCS. Thereafter, the medium was changed twice a week. Four weeks after the start of culture, cells washed from tissue pieces were treated with trypsin and plated in new culture dishes for transfection.

Another preferred method consisted of transferring the pieces of skin to fresh medium after shredding and washing them 1-2 times with medium. 5 to 10 pieces of tissue were evenly distributed in a T25 culture flask, the surface of which was previously moistened with DMEM + 10% FCS and inverted. As a result, the biopsies were hanging down (hanging drop configuration; described by Jones (Establishment, Maintenance and Cloning of Human Primary Cell Strains, Methods in Molecular Biology, Vol. 5, 1989)). After 1-3 hours of thermostation, the bottles were inverted and filled with 1-2 ml of culture medium. Adhesive biopsies were filled to 5 ml after 24 hours; otherwise, the procedure was repeated. After 6 to 10 days, the first fibroblasts grew and from this point the medium was changed once a week. When the cells became cohesive, they were transferred to a T75 bottle.

v) KB cells

The human epidermoid (epithelial) cancer cell line KB was obtained from ATCC (No. CCL 17). Cells were grown in 6 cm plastic dishes in MEM containing 10% FCS, 2 mM glutamine and antibiotics.

(h) Determination of gene expression

(i) Luciferase assay

The preparation of cell extracts, standardization of protein content and determination of luciferase activity were performed as described in Zenke et al., Proc. Natl. Acad. Sci. USA 87: 3655-3659 (1990); Cotten et al., Proc. Natl. Acad. Sci. USA 87: 4033-4037 (1990) and in U.S. Pat

European Patent Publication No. 388,758].

ii) IL-2 determination

Interleukin-2 expression was determined by a bioassay as described by Karasuyama and Melchers, Eur. J. Immunol. 18: 97-104 (1988)]. In addition, IL-2 production was performed using the IL-2 ELISA Kit (Becton Dickinson, Catalog No. 30032) according to the manufacturer's instructions.

iii) IFN-γ determination

Mouse IFN-γ expression was performed using the IFN-γ ELISA Intertest-γ (Genzyme, Catalog No. 1557-00).

(iv) GM-CSF definition

GM-CSF expression values were determined using a commercially available ELISA (Endogenous).

j) Testing of Complex Components

In order to test the reliability of the experiments with regard to the ability of the ligands to internalize or the efficiency of the DNA constructs, transfection experiments with different viral preparations were performed in preliminary experiments. These experiments have shown that the results obtained with dl312 in this regard can be transferred to the dental β112 adenovirus inactivated by psoralen / UV and the den014 adenovirus (inactivated by psoralen / UV). Therefore, dl312 was used as a substitute in some experiments.

Example 1:

Gene transport to primary human melanoma cell cultures

Primary human melanoma cell isolates obtained from two different patients (HMM-1 and HMM-2) had different time intervals from the time of culturing hand52. after transformation with complexes containing the following components: 1.7 x 10 ¹⁰ dl312 adenovirus particles, 100 ng

StreptpL, 6 pg pCMVL-DNA, 7 pg TfpL. Twenty-four hours after transfection, luciferase expression was determined. Expression was standardized to 1 x 10 ⁶ cells based on the protein content of the cell lysate. The results of these transfection experiments are shown in Figure 1.

Example 2:

Identification of ligands involved in uptake of gene transfer complexes

Primary human melanoma cell isolates HMM-1 were transformed with complexes containing 1.7x10 ¹⁰ dl312 adenovirus particles, 100 ng StreptpL, 6 pg pCMVL DNA, 7 pg TfpL, 2 weeks after the start of culture. In parallel, transfection was performed in the presence of 50 molar excess of free iron-saturated transferrin as a competitor to the internalization of TfpL-DNA adenovirus complexes. Alternatively, transfection complexes were prepared in which TfpL was replaced by unconjugated pL (pL). The results of these experiments are shown in Figure 2. Addition of free transferrin has been shown to reduce the amount of luciferase expression, suggesting that the complexes are, at least in part, upregulated by binding to the transferrin receptor. On the other hand, however, the still significant gene expression seen in the presence of free transferrin suggests that binding to adenoviral receptors also contributes significantly.

Example 3:

Effect of inactivation of dl312 adenovirus with psoralen / UV on long-term toxicity in transformed primary human melanoma cells

Per petri dish (6 cm) 3x10 ⁵ HMM-1 primary human melanoma cells were transformed with complexes containing 1.2 x 10 ¹⁰ dl312 adenovirus particles, 1200 ng StreptpL, 6 pg pCMVL and 6.6 pg TfpL-. or 7.5 x 10 ⁹ 8-methoxy-psoralen / UV-inactivated dl312 adenovirus particle (dl312 P1), 600 ng StreptpL, 6 pg pCMVL and 6-6 pg TfpL (optimal for StreptpL amount of the various viruses was determined by preliminary titration). At 1, 3, and 7 days after transfection, 3 x 10 ⁵ cell luciferase expression was measured. The effect of 8-methoxy-psoralen / UV inactivation on gene expression is shown in Figure 3. Seven days after transfection, a marked decrease in gene expression was observed, consistent with the severe cytopathic changes observed in this culture. Transfection of cells with 8-methoxy-psoralen / UV-inactivated adenovirus significantly reduced cytopathic lesions and resulted in 10-fold higher expression values on day 7 than non-inactivated virus.

Example 4:

Determination of long-term cytotoxicity of adenoviruses

Fibroblasts derived from malignant melanoma were transformed with combination complexes containing either d133 adenovirus or 8-methoxy-psoralen / UV-inactivated d133 adenovirus or dll014 adenovirus.

Cells were transformed with complexes of 6 µg pCMVL DNA, 0.8 µg StreptpL, 6.8 µg TfpL, and 20 µl dl312 adenovirus formulation (0.25 x 10 virus particles / ml) or p 8 8-methoxy-psoralen / UV-inactivated d1312 formulation (0.13 x virus particle / ml) or 3 µl adenoviral tag adenovirus formulation (4.1 x 10 ¹² virus particles / ml).

100 µl portions of this mixture and the virus shown in Figure 4:

In order to maintain a cell ratio, 1: 3 serial dilutions of this mixture were plated in a 24-well cell culture plate at 3 x 10 ⁴ cells / well in 500 µl RPMI + 2% FCS. After 2 hours at 37 ° C, the medium was replaced with 2 ml RPMI + 10% FCS. After 8 days, the medium was removed and the cells were fixed for 5 minutes with a mixture of 4% formaldehyde and 150 mM NaCl and then stained with 0.1% crystal violet in 2% ethanol for 10 minutes. The cells were then washed 2 times with PBS and 1x with water and photographed. The result of the cytotoxicity assay is shown in Figure 4: at a 10000: 1 virus: cell standard ratio, the dl312 adenovirus is cytotoxic; this cytotoxicity is reduced by treatment of the virus with psoralen / UV. An equal amount of dll014 adenovirus showed no cytotoxic effect on the cells.

Example 5:

Effect of irradiation of tumor cells on gene expression ·· * ·· »...»,.

hum ΙΟ ⁵ ΗΜΜ-5 primary human melanoma cells and the M-3 mouse melanoma cell line were treated with complexes of 3 x 10 ^{7 x 9} 8 -methoxypsoralen / UV-inactivated dll014 adenovirus particle, 600 ng StreptpL, 6 They contained pg pCMVL and 6.8 pg TfpL. Six hours after transfection, cells were exposed to radiation at doses of 0-100 Gy. The expression of the transformed luciferase gene was measured 48 hours after irradiation. The values in Figure 5 represent luciferase expression in light units / pg cell lysate protein.

Example 6:

Effect of plasmid concentration on gene expression χ 10 ⁵ M3 mouse melanoma cells were transformed comprising the following ingredients complexes: 8.6 χ 10 ⁹ 8-methoxy-psoralen / / UV-inactivated dll014 adenoviruspartikula, 400 ng StreptpL, 6 pg DNA and 5.1 pg TfpL. Plasmid combinations containing different ratios of plasmids (pCMVL / pSP = pSP65 Boehringer Mannheim; pSVEmu-IFN-γ; IFN-γ / pBCMGneo-mIL-2) were introduced into the complexes. Quantity ratios of plasmids and gene expression values obtained from Table I and Figure 6 (luciferase expression) and Figure 7. (IFN-γ / IL-2).

Example 7:

Loss of tumorigenicity of transformed mouse melanoma cells

M-3 mouse melanoma cells (3 × 10 ⁵ cells / β cm Petri tube 56 · · * w · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · 2 x 10 ⁹ dl312 adenovirus particles, 250 ng StreptpL, 6 pg plasmid DNA (containing murine IL-2 or mouse IFN-γ) and 7.5 pg TfpL were transformed. complexes. Four hours after transfection, cells were washed 2 times with serum-free Ham's F10 medium. Finally, each was administered one 10 ⁵ cells subcutaneously δ χ anesthetized DBA / 2 mouse's back. As a control, 6 DBA / 2 mice served as another group, each of which received 1 χ 10 ⁵ untransformed M-3 cells. Tumor growth was monitored at the injection site weekly. Figure 8 shows the development of tumor development.

Example 8:

Inducing a systemic immune response against melanoma by immunization with cytokine-transformed irradiated tumor cells ("Profactic mouse model")

a) M-3 murine melanoma cells (3 × 10 ⁵ cells / T25 culture flask) were transformed with 3 × 10 ⁹ 8-methoxy-psoralen / UV-inactivated dll014 adenovirus particle, 6 ng StreptpL, 6 pg IL-2 plasmid DNA or pSP plasmid DNA, which does not contain a cDNA insert and therefore does not express a gene product in transformed cells, and complexes containing 6.8 pg TfpL. Four hours after transfection, the transfection complexes were removed and fresh serum-containing medium was added. Cells were then exposed to 20 Gy X-rays 6 hours after transfection and cultured for an additional 18 hours. 24 hours after transfection, cells were trypsinized and washed 2 times in Earl's Buffered Saline (EBSS) and the culture was adjusted to a concentration of 1 x 10 0 cells / ml. Anesthetized DBA / 2 mice were immunized with 1 x 10 ³ cells subcutaneously into the spinal cord. In parallel, a group of 6 mice were immunized with untransformed M-3 cells, which were previously irradiated and treated in the same way as the transformed cells. One week after the first immunizations, mice received booster immunizations with cell preparations as used for the first immunizations. After an additional seven animals were exposed to the highly tumorigenic amount of 1 ⁵ 10 χ M-3 cells, which were implanted from the previous immunization areas. In addition, 4 mice that had not been previously immunized were similarly exposed to tumor-causing cells. 8 weeks after tumor cell implantation, all (4/4) non-immunized animals developed tumors, whereas all mice previously immunized with irradiated IL-2-transformed M-3 cells were tumor-free (0 tumors / 5 animals). . Mice inoculated with irradiated, untransformed M-3 cells and irradiated with "empty plasmid (pSP) -transformed M-3 cells" only partially protected (4 out of 6 mice developed tumor). The development of tumors in animals is shown in Table II. Table 9 and Figure 9. The results obtained indicate that immunization of mice with irradiated tumor cells transformed with IL-2 elicits a systemic immune response that protects the animals from further tumor formation.

b) In a further series of experiments, mice were treated with the same immunization procedure with irradiated M-3 cells previously transformed with complexes of x 10 ⁹ 8 -methoxys psoralen / UV-inactivated d1010 adenovirus.

particle, 600 ng StreptpL was, a) e j pg pBCMGneo-mIL-2 IL-2 plasmid (IL-2 100 %), b) 5.4 pg pSP plasmid and 0.6 pg IL-2 plasmid (IL-2 10% ), c) 5.4 pg IL-2 plasmid and 0.6 pg IFN-γ plasmid (IL-2 90% + IFN-γ 10%) obsession d) 5.4 pg of pSP plasmid and

They contained 0.6 pg of IFN-γ (10% IFN-γ) and 4.7 pg of TfpL. In addition, a group of mice were immunized with irradiated M-3 cells previously treated with 3.6 x 10 ⁹ inactivated dl312 adenovirus particles, 600 ng StreptpL, 6 pg IL-2 plasmid and 4.7 pg TfpL (IL-2 100% dl312). ). One week after the booster injection, 1 x 105 ⁵ M-3 cells were implanted into the immunized and non-immunized control animals. The development of tumors in III. are summarized in Table.

c) Using the same immunization procedure as in the previous experiments, mice were treated with irradiated M-3 cells previously transformed with complexes of 3 x 10 8 -methoxysporalen / UV-inactivated dll014 adenovirus particle, 600 ng StreptpL, a) 6 pg IL-2 plasmid = 100% IL-2, b) 5.76 pg plasmid pSP and 0.24 pg IL-2 plasmid - 4% IL-2, or c) 6 pg pSP plasmid and 4.7 TfpL. IL-2 produced by transformed irradiated cells was measured on the day of immunization: M-3 cells transformed with 100% IL-2 plasmid produced 33,000 units of IL-2 per 1 x 10 ⁶ cells over 24 hours, while 4% IL-2 M-3 cells transformed with plasmid -2 produced 396 units of IL-2 per 1 x 10 ⁶ cells per 24 hours. One week after booster vaccination, 1 x 10 ° M-3 cells were implanted into immunized animals and non-immunized controls. To obtain further information on the magnitude of the immune response elicited by the use of different amounts of IL-2 plasmid, 3 x 10 ⁵ M-3 and 1 x 10 ⁶ M-3 cells were implanted into additional groups of mice. To demonstrate that the immune response was tumor-specific, a group of mice previously immunized with irradiated M-3 cells transformed with 100% IL-2 were implanted with 1 x 10 ⁵ synaptic squamous cell carcinoma cells (KLN 205, ATCC No. CRL 1453). in. The development of tumors in IV. is shown in Table II.

Example 9:

Gene transfer to cells of an epidermoid carcinoma cell line

KB cells were grown at a density of 400,000 cells / 6 cm and transformed with various complexes: 2.5 x 10 ⁹ dl312 adenovirus particles, 200 ng StreptpL, 6 pg pCMVL DNA and optionally 3.8 pg polylysine, 3.8 pg EGF -pL (amount relative to polylysine content) or 6 pg TfpL. The complexes (500 µl each) were mixed with 1.5 mL of medium with or without 2% FCS. In the competition experiments, 1 µg of EGF was added to the mixture of complexes and medium. The complexes were added to the cells with the medium. After incubation for 2 hours at 37 ° C, the medium was removed and fresh serum-containing medium was added.

Cell harvest after 24 hours and luciferase assay yielded the following results (Fig. 10A: Experiment with 2% FCS60, Fig. 10B: Experiment without FCS): 10A. Figure 2B shows a value of 20845000 light units with EGFpL; this value is significantly higher than that obtained with TfpL (3970000) or polylysine (pLys 10550000). In the competition experiment, unexpected signal reduction (EGFpL + EGF 14150000) was observed in free EGF as compared to TfpL (TfpL + EGF 12350000 light units) or polylinic experiments (pLys + EGF 14055000). This indicates that the amplified gene transfer ligand is specifically via the EGF receptor. In the experiment without FCS (Figure 10B), the effect of EGFpL was even more pronounced (EGFpL 15150000, TfpL 2000000, pLys 5100000, EGFpL + EGF 5900000 light units). Expression values refer to 50% of the cells.

Similarly, KB cells were transformed with complexes containing 5x108 8-methoxy-psoralen / UV-inactivated dll014 adenoviral particles; comparable luciferase expression values were obtained.

Example 10:

IL-2 expression using different vectors

a) M-3 cells x 10 ⁵ M-3 cells were transformed with various plasmid constructs containing triple complexes. 3 µl of dl312 adenovirus composition, 0.3 µl (approximately 200 µg) of StreptpL, 6 µg of TfpL and 6 µg of plasmid DNA (BCMGneo-mlL2, pWS2m, BMGneo-mIL-2 or pCM2) were added to a total volume of 500 µl. ki on HBS.

For experiments with 8-methoxy-psoralen / UV-inactivated dll014 adenovirus, transfection complexes of the following composition were introduced: 9 μΐ virus preparation, 600 ng StreptpL, 6 pg TfpL, 6 pg BCMGneomyl-2.

At the intervals shown in Figure 11, IL-2 activity was determined. BCMGneoMIL-2 also obtained 64000 units after 48 hours and 7128 units after 28 days (not shown). pCM2 yielded 3227 units after 48 hours and 950 units after 28 days, 396 units after 24 hours, 604 units after 48 hours, 297 units after 7 days and 264 units after 14 days (BMGneo-mIL-2) (not shown). Figure). b) Fibroblasts

Primary human fibroblasts were transformed with IL-2 constructs as described in a) and IL-2 expression was determined on the days shown in Figure 12 after transfection. The composition of the transfection medium for BCMGneome-mIL-2 was the same as for M-3 cells; For BMGneo-mIL-2, the same transfection complex was prepared.

Example 11:

Melanoma cells expressing HSA on their surface stimulate immune responses against unmodified tumor cells

M-3 cells were cultured in Ham's F12 medium containing 12.5% horse serum and 2.5% FCS in a gelatin-coated plastic dish. Twenty-four hours prior to transfection, cells were plated at 3 x 10 ³ in a 25 cm culture dish. Transfection complexes were suppressed for this cell volume62 containing 9 µl of biotinylated 8-methoxy-psoralen / UV-inactivated dll014 adenovirus (1.4 x 10 ¹² particle / ml), 5.2 µg of transferrin polylysine, 800 µg of streptavidin polylysine and 6 pg of the respective plasmid DNA (pSP, pWS2m in combination with pSP, pHSA in combination with pSP and IL-2 in combination with pHSA) were combined in a total volume of 500 µl. This volume was added to each culture flask with 2 ml Ham's F12 medium containing 12.5% horse serum and 2.5% FCS. After 2 hours incubation at 37 ° C, the medium was replaced with fresh medium and the cells were irradiated (20 Gy). Twenty-four hours after transfection, cells were trypsinized, washed twice with HBSS (Hank's Buffered Saline Salts), counted, and resuspended in 100 µl HBSS. These cells formed the vaccine which was used to inoculate the recipient mice within 60 minutes.

Mice were inoculated as described in the previous experiments. At one week intervals, two separate inoculations were performed with 100,000 cells each at two different sites in the back. One week after the second inoculation, mice were inoculated with 300,000 unmodified, unirradiated M-3 cells in HBSS to a third site in the back. Tumor development was monitored at weekly intervals.

Figure 13 shows the results of these experiments (abscissa is the number of days and ordinate is the tumor size in mm ^3. The numbers at the endpoints represent the number of tumorous mice relative to the total number of mice in each group. PSP: 6 pg pSP; 80 IL-2/20 pSP: 4.8 pg pWS2m + 1.2 pg pSP; 20 HSA / 80 pSP: 1.2 pg pHSA + 4.8 pg pSP; 80 IL-2/20 HSA:

4.8 pg pWS2m + 1.2 pg pHSA): Inoculation with irradiated M-3 cells transformed with the pSP empty vector was not protected against tumor growth; 4 out of 6 mice developed significant tumor nodules. IL-2-producing cells exhibited only moderate tumor suppression in all mice (3/3) in which the tumor was formed. (This effect is due to the fact that the experimental conditions were chosen to test the beneficial effect of HSA, where mice were given a 3-fold dose of tumor cells with a reduced amount of IL-2 DNA.) In contrast, those mice , previously inoculated with M3 cells expressing HSA, showed strongly restrained tumor growth. Mice that previously had both HSA and IL-

They received inoculations containing M-3 cells expressing 2, formed tumors with a significantly reduced frequency (2 out of 6), and the tumors formed were small compared to control tumors (inoculated with pSP-transformed cells); average size 18

It was 3mm, compared to 1149mm.

Example 12:

Melanoma cells expressing Rabies neoantigen on their surface stimulate a protective immune response against unmodified tumor cells

M-3 cells were treated and transformed as described in Example 11. Only the transfection complexes, prepared in the same manner as in Example 11 (6 µg plasmid DNA), had a cell action time of 4 hours instead of 2 hours. Inoculation of mice was performed in the same manner as in Example 11, except that the time interval between injections was extended from one to two weeks and the injected volume was always 100 μΐ.

Figure 14 shows the results of the experiments, the structure of the diagram is similar to Figure 13. The pSP negative control shows the expected significant tumor growth. The positive control where only pWS2m (100% IL-2) was transformed shows complete protection; transformed cells produced 45,000 IL-2 units per cell for 10 ^s 24 hours after transfection and prior to inoculation. In the group of mice that received only 50% pWS2m (50% pSP empty vector), incomplete protection was observed. This was significantly improved when the Rabies expression plasmid pWS-RABIES was transformed into the empty vector. Poor tumor growth between weeks 2 and 4 reversed from week 5 onwards.

Example 13:

Comparison of different methods for inactivating adenoviruses

Within this example, various methods have been applied and compared with respect to the reduction of virus titer and the ability of inactivated viruses to amplify gene transfer by receptor-mediated endocytosis. In addition, we examined which viral genes are turned off by inactivation.

(a) Testing for the inactivation of adenoviruses by 8-methoxy-psoralen

i) Inactivation of viruses

Biotinylated dll014 adenovirus samples (300 μΐ) in HBS / 40% glycerol were added to 4 wells of a culture dish (NUNC, Catalog No. 176740). Small portions of 8-methoxy-psoralen dissolved in 33 mg / ml DMSO were added to the viruses to achieve the desired final concentration. The samples were placed on ice with a closed lid and, as described under (e) (iv) in the methods, subjected to UV irradiation for 25 minutes, whereby the position of the sample plate was changed every 10 minutes to avoid shading. Unreacted psoralent was removed by gel filtration by applying a virus / psoralen sample (2 mL) to a Pharmacia PD-10 gel filter column (previously equilibrated with 30 mL HBS / 40% glycerol). The sample was washed with 0.5 ml HBS / 40% glycerol on the column and the virus was eluted with HBS / 40% glycerol where the first 400 μΐ was discarded and the next 4 ml was collected in 0.5 ml fractions. To identify the viral fractions, ninhydrin assays were performed, the positive fractions pooled, the protein concentration measured, and the virus frozen in small portions at -70 ° C.

ii) Titration of 8-methoxy-psoralen (CPE versus gene transfer)

Titrations were performed to determine the optimal concentration of psoralen, which does not impair the capacity of viral DNA transport even after complete viral inactivation. (There are reports that poor inactivation performance is achieved when psoralen is used at concentrations close to the saturation value, but at significantly lower concentrations it can be attributed to either a crystallization phenomenon that extracts the compound from the solution or a filtering effect. The latter is due to the fact that a large amount of unbound compounds absorbs UV rays and thus blocks the UV activation of DNA-bound material.)

The CPE assay (Zytopathischer Endpunktassay or Cytopathic Effect Assay) [Precious and Russell, Virology, ed. Mahy, B.W.J., 1985, IRL Press, Oxford, Washington, DC, 193-205] using W162 cells, plated at 50,000 cells / well, in plates containing 24 wells. Serial dilutions of the samples were prepared in DMEM / 2% heat inactivated horse serum and the diluted virus was added to the cells in 500 µl DMEM / 2% heat inactivated serum. After 2 hours incubation at 37 ° C, the medium was replaced with fresh DMEM / 10% FCS. After 4-5 days at 37 ° C, cells were fixed with formaldehyde and stained with crystal violet.

The suitability of the inactivation method was tested for gene transfer by introducing the luciferase gene into K562 cells (ATCC No. CCL 243). Transfections were performed using combination complexes as disclosed in WO 93/07283, wherein 9 µl of dll014 adenovirus (1.4 x 10 ^{12 12} particles / ml) and 13.5 µl of β-propiolactone inactivation were used. (9.3 x 10 ^U particle / ml), 800 ng of streptavidin polylysine, 6 pg of pCMVL DNA and 5.2 pg of transferrin polylysine in 500 µl of HBS (complexes as described in f) (). In addition, the relative titer of each virus preparation on W162 cells was determined using CPE. The result of these titrations is shown in Figure 15: the numbers on the left-hand axis of the graph refer to the relative viral titer (black triangles), the numbers on the right-hand axis of the graph refer to the luciferase light unit (blank squares). Concentrations of 8-methoxy-psoralen in mg / ml were applied to the abscissa. It has been found that treatment of the virus with 0.11 mg / ml of 8-methoxy-psoralen causes a reduction in the viral titer that is not different from that induced by the pre-experiments at 0.33 mg / ml. DNA transport activity is maintained at this concentration. Under the conditions chosen, the concentration of 0.033 mg / ml 8-methoxy-psoralen was ineffective. (A more sensitive analysis by the plaque assay, see Figure 19, showed that concentrations of 0.11 and 0.33 mg / ml 8-methoxypsoralen caused comparable reductions in viral titer.)

b) Testing for the inactivation of adenoviruses with 4 '- (aminomethyl) -4,5', 8-trimethyl-psoralen

i) Inactivation of viruses

The less hydrophobic psoralen derivative 4 '- (aminomethyl) -4,5', 8-trimethyl psoralen was used; it interacts and consequently inactivates single-stranded RNA viruses in the same way as DNA viruses and dissolves in water up to a concentration of 5 mg / ml. The 4 '- (aminomethyl) -4,5', 8-trimethyl psoralen used was obtained from H.R.I. (Catalog No. 6) and dissolved in HBS at 5 mg / ml. After small portions of these were added to the virus samples, virus inactivation and purification were performed as described for 8-methoxy-psoralen.

I * * ii) Titration of 4 '- (aminomethyl) -4,5', 8-trimethyl-psoralen (CPE versus gene transfer)

The titrations were carried out in the same manner as described in a) ii) for 8-methoxy-psoralen. The results of these titrations are shown in Figure 16: the numbers on the left-hand axis of the graph refer to the relative viral titer (black triangles), and the numbers on the right-hand axis of the graph refer to luciferase light units (blank squares). Concentrations of 4 '- (aminomethyl) -4,5', 8-trimethyl-psoralen in pg / ml were applied to the abscissa. At concentrations of 0.3 and 1 mg / ml 4 '- (aminomethyl) 4,5', 8-trimethyl-psoralen, conditions were found which caused at least 5 log titers, while maintaining the efficiency of DNA transfer. Lower concentrations (<0.1 mg / ml) of 4 '- (aminomethyl) -4,5', 8-trimethyl-psoralen cause only a moderate decrease in virus titer. The plaque method - see Figure 19 - also showed that concentrations of about 1.0 and 0.3 mg / ml of 4 '- (aminomethyl) -4,5', 8-trimethylpsoralen cause a decrease in viral titers not deviating from the effects of 0.11 and 0.33 mg / ml of 8-methoxypsoralen. The gene transfer capacity of the inactivated virus was determined as described in a) ii). In addition, the relative titer of each virus preparation on W162 cells was determined using CPE.

(c) Testing for the inactivation of adenoviruses by β-propiolactone

i) Inactivation of viruses

Virus samples were adjusted to 0.3 M HEPES, pH 7.9, and 10-fold concentrated solutions of β-propiolactone were added. Concentrated β-propiolactone solutions were prepared by diluting β-propiolactone (Sigma, Catalog No. P5648) immediately before use with HBS. Control experiments were performed to show that 0.3 M HEPES (pH 7.9) was sufficient to buffer the β-propiolactone treatment at 1%. Small portions of β-propiolactone were added to the buffered virus-containing solutions at room temperature, then the virus samples were incubated for 4 hours at room temperature before being stored at -70 ° C or used for transfection experiments.

ii) Titration of β-propiolactone (CPE versus gene transfer)

Adenoviruses were exposed to various concentrations of β-propiolactone for 4 hours at room temperature. Otherwise, the experiments were performed in the same manner as described for psoralen derivatives. It has been found (Figure 17) that treatment with 0.3% β-propiolactone causes a viral titer decrease of viral titer of about 5, while maintaining the DNA transport activity. Concentrations of 1% and higher cause a more pronounced decrease in titer, but the activity of DNA transport is also impaired. The numbers on the left-hand axis of the graph refer to the relative viral titer (black triangles), while the numbers on the right-hand axis of the graph refer to the luciferase light unit (blank squares). Concentrations of β-propiolactone in% were recorded on the abscissa.

iii) Adenovirus gene transfer capacity after multiple treatments with low concentration of β-propiolactone

The strong decrease observed in (ii) in the DNA transfer in activiv70 «* wood at concentrations of 0.3-1% β-propiolactone suggests that while at lower concentrations there is an advantageous modification in the viral nucleic acid, higher concentrations of the inactivating agent modify the capsid proteins. and the damage to the endosomal malic activity of the virus begins. To test the validity of this assumption, adenoviruses were treated with several small portions of a lower concentration (<0.3%) of β-propiolactone in the hope that it would advantageously achieve modification in the viral DNA without damaging the viral protein. For this, virus samples were treated with one dose of 0.3% β-propiolactone, two doses of 0.3% β-propiolactone, three doses of 0.2% β-propiolactone, four doses of 0.15% β-propiolactone or one dose of 1% β-propiolactone . The gene transfer activity of these virus preparations incorporated into combination complexes was tested with K562 cells as described above under f). As shown in Figure 18, except for the 1% sample, each treatment resulted in less than 1 log gene transfer capacity reduction. Treatment with 1% β-propiolactone resulted in more than 2 log decreases. (Sample 1: Non-inactivated virus; Sample 2: Inactivation with 0.11 mg / ml 8-methoxy-psoralen; Sample 3: Inactivation with 0.3% β-propiolactone; Sample 4: Inactivation 2 x 0.3 % β-Propiolactone Sample 5: Inactivation 3 x 0.2% β-Propiolactone Sample 6: Inactivation 4 x 0.15% β-Propiolactone Sample 7: Inactivation with 1% β-Propiolactone Numbers for Columns luciferase light units.)

d) Determination of replication ability of inactivated adenoviruses ♦ · ··· «···· ··

plaque-assay

(i) Comparison of dll014 adenovirus inactivated with 8-methoxy-psoralen, β-propiolactone or 4 '- (aminomethyl) -4,5', 8-trimethyl-psoralen

The plaque method is used to more sensitively determine the virus's ability to replicate: Adenovirus 5 requires 10 to 50 virus particles to be delivered to the cell to infect the cell. The following CPE assay lacks the ability of chemically inactivated viruses to induce cytopathic viral infection, which however requires at least 10% of the target population to be infected in order to be detected within four days of the assay.

That is the definition

Detects 50,000 viral particles under optimal conditions, using the plaque method to detect a single plaque

It is created by invading 10-50 viruses; so this test is about 1000 times more sensitive than the CPE determination.

For the purposes of the present invention, the following method was used to determine the plaque method: W162 cells per well

500,000 were plated on a 6-well plate 18 hours prior to the start of the assay. The medium was then removed and replaced with fresh medium (2% horse serum / DMEM) plus the respective dilution of virus, where the virus was evenly distributed on the cells. Then the disks

After incubation for 1.5 hours at 37 ° C, the plate was gently shaken every 20 minutes. Meanwhile, a 2X agarose solution [2% (2 g / 100 mL) of low-freezing SeaPlaque-Agarose (FMC)

Catalog # 5010) in 5 mM HEPES, pH 7.4, adjusted to pH before autoclaving for 25 minutes] was heated to 70 ° C to thaw the agarose and equilibrated at 37 ° C. Similarly, a 2X DMEM / 10% FCS solution (double concentration DMEM / double penicillin / streptomycin / double glutamine / 10% FCS (heat inactivated at 56 ° C for 30 min)) was prepared. At the end of incubation of the cells with the virus for 1.5 hours, a 50-well aliquot was prepared (25 ml 2X agarose + 25 ml 2X DMEM / 10% FCS in a Falcon tube). The media / virus solution was removed from a plate and 3.5 ml coated in each well. The plates were then allowed to stand for at least 30 minutes at room temperature to solidify the agarose before incubating again at 37 ° C. On the 6th day after virus addition, an additional 2-3 ml of coating solution was applied to each well. In this procedure, plaques (patches) are normally shown in FIGS. day. The plaques are always 14-18 after infection. days.

Testing of various inactivated virus formulations using a plaque assay showed that treatment with β-propiolactone (2 x 0.3%) resulted in a viral titre reduction of about 5 (Figure 19: Sample 1, non-inactivated virus, 2). Sample: Inactivation with 0.33 mg / ml 8-methoxy-psoralen, Sample 3: Inactivation with 0.11 mg / ml 8-methoxy-psoralen, Sample 4: Inactivation with 2 x 0.3% β-propiolactone, Sample 5 : inactivation with 0.28 mg / ml 4 '(aminomethyl) -4,5', 8-trimethyl-psoralen, Sample 6: inactivation with 0.83 mg / ml 4 '- (aminomethyl) -4,5 ', With 8-trimethyl-psoralen The numbers written on the columns are pfu / ml = plaque forming unit / ml = plaque * · · · · 4 · 4 · forming units / ml). No plaques were observed with either 8-methoxy-psoralen (0.33 or 0.11 mg / ml) or 4 '- (aminomethyl) -4,5', 8-trimethyl-psoralen (0.28 or 0.83 g mg / ml) for treated adenoviruses. The 6 log dilution factor between non-inactivated dll014 (1 x 10 pfu / ml) and psoralen-inactivated samples means that less than 10 plaque forming units (pfu) are present in psoralen-inactivated samples. An important observation is that viruses inactivated by β-propiolactone form plaques at a detectable rate. Thus, if β-propiolactone inactivation also appears to be equivalent to psoralen inactivation as defined by CPE, the plaque method reveals a clear difference between the two types of compounds.

ii) Comparison of determinations of dll014 adenovirus inactivated with 8-methoxy-psoralen or various β-propiolactone treatments Inactivated dll014 adenovirus preparations with various multiple amounts of β-propiolactone (see Figure 20), analyzed and compared with 0.11 mg / ml was inactivated with 8-methoxy-psoralen. (Sample 1: Non-inactivated virus; Sample 2: Inactivation with 0.11 mg / ml 8-methoxy-psoralen; Sample 3: Inactivation with 0.3% β-propiolactone; Sample 4: Inactivation 2 x 0.3 % β-Propiolactone Sample 5: Inactivation 3 x 0.2% β-Propiolactone;

Sample 6: Inactivation with 4 x 0.15% β-propiolactone; Sample 7: Inactivation with 1% β-propiolactone. The numbers on the columns represent pfu / ml. This experiment (shown in Figure 20) did not result in detectable viruses in the sample treated with psoralen. From the 7 log dilution factors between the non-inactivated dll014 virus of 6.7 x 10 pfu / ml and the psoralen inactivated virus, it should be noted that there should be less than 6.7 x 10 ¹ pfu / ml in the psoralen inactivated sample. In contrast, in each sample treated with β-propiolactone, sufficient plaques were detected that correspond to an inactivation of between about 2 logs (0.3% β-propiolactone) and 5 logs (2 × 0.3% β-propiolactone). Although 1% β-propiolactone caused a strong decrease in DNA transport activity (compare with Figure 17), it caused only a slight decrease in virus titer, which is consistent with the assumption that higher concentrations of β-propiolactone modify the protein than DNA and therefore more damaging to the virus's endosome rupture ability (and hence virus entry) than to viral replication.

(e) Expression of inactivated virus genes

Various combination complexes were prepared according to the methods described in paragraph (f) of the Methods, which contained an optimal amount of dl312 adenovirus, 8-methoxy-psoralen inactivated dl312 adenovirus, 8-methoxy-psoralen inactivated dll014 adenovirus, and din014 inactivated adovovirus. The complexes contained approximately 1 µl of ¹⁰ viral particles, 800 µg of streptavidin polylysine, 6 µg of pCMV DNA, and 5.2 µg of transferrin polylysine in a final volume of 500 µl in HBS. The complexes were plated on K562 cells (pre-cultured for 24 hours in 50 pM deferrioxamine / RPMI / 10% FCS, spread at 250,000 cells / ml), 2 ml / well in a well containing 24 wells. After 2 hours incubation, cells were washed with fresh medium without deferrioxamine and harvested 48 hours later to determine luciferase activity or subjected to RNA analysis on selected adenoviral genes, where the pooled material was used for three separate transfections.

Measurements of luciferase activity showed that each transfection resulted in an expression that was within the order of magnitude.

i) Northern analysis

RNA Northern analysis was performed by Paeratakul et al., J. Virol. 62, 1132-1135 (1988)], 48 hours after transfection, cells were washed 3 times in HBS and serial dilutions of 30000, 10000 or 3000 cells were made using a 96-well Dot Biot instrument (Schleicher and Schuell). applied to a filter. Cells were then fixed with 1% glutaraldehyde (in HBS) for 60 min at 4 ° C, digested with proteinase K (20 pg / ml) and 30 min at 37 ° C in HBS / 0.1% SDS. keeping followed. The filter was then pre-hybridized in Churchpuffer (0.5 M sodium phosphate, 7% SDS, 1 mM EDTA pH 8) at 65 ° C for 5 hours, followed by overnight incubation at 65 ° C with a stained DNA probe. minimum volume of buffer. The filter was then washed twice in 2X SSC / 0.1% SDS for 30 minutes at 65 ° C, followed by 30 minutes each in 0.1X SSC / 0.1% SDS. The radioactive sample was visualized by phosphorus detection. Radiolabeled ( ³² P) probes were prepared from PCR products of dl1014 adenovirus sequences. An Ela probe (383 bp) was constructed using PCR primers corresponding to sections 736-751 bp (Ela.1) and 1119-1101 bp (Ela.2) of the Ad5 genome. (This is a portion of the region that has been deleted in dl312. It serves as a control; the RNA signal must be absent in dl312 samples, but the dll014 samples must contain it because the latter virus has a wild type E1 region .) An E3 probe (436 bp) from the most highly expressed E3 gene, the 19 K glycoprotein gene [Gooding LR, Cell 71, 5-7. (1992)] using primers corresponding to sections 28722-28737 bp (E3.a) and 29157-29142 bp (E3.b) of the Ad5 genome. (E3 expression should play an important role in the immune response to transformed cells, since at least two E3 genes modulate the surface expression of MHC class I molecules and TNF receptor molecules on the surface of infected cells.) Purified on a molten agarose gel in TAE buffer, the desired DNA fragment was excised, weighed and taken up in 1.3 ml of water per g of gel fragment. The gel fragment taken up in water was then heated to 95 ° C for 10 minutes and 10 μΐ of the resulting solution was allowed to stand at room temperature for 12 hours using the random primer method [Feinberg and Vogelstein, Anal. Biochem. 137: 266-267 (1984)]. In this connection, the labeled DNA was purified by ethanol precipitation in the presence of ammonium acetate and tRNA.

Figure 21 shows the autoradiogram: it was found that dl312 samples, neither inactivated nor inactivated with 8-methoxy-psoralen, showed no Ela expression. Ela expression is strong in non-inactivated dll014 viruses, but is completely absent in both 8-methoxy-psoralen-treated and twice 0.3% β-propiolactone inactivated viruses. E3 was less strongly expressed in non-inactivated dl312 adenoviruses than in dll014. This fact is consistent with the knowledge of the role of Ela as a positive modulator of the expression of E3 and other early genes (Nevins J.R., TIBS 16, 435-439 (1991); Science 258: 424-429 (1992)]. Inactivation of 8-methoxypsoralen and β-propiolactone completely blocked RNA synthesis from these genes.

ii) Reverse transcription PCR analysis

We start from cells transformed by the addition of uninactivated dll014 adenovirus or 8-methoxypsoralen deactivated adenovirus as described in the previous experiments. The same amount of virus was introduced in both transfections. RNA purification was performed with 1 x 10 ° transformed M-3 cells, which were harvested 24 hours after transfection with PBS and short pelleting in an Eppendorf centrifuge. Cell pellets were dissolved in 1 ml Trisolv (phenol / guanidine thiocyanate in a single phase solution; Biotecx) and briefly mixed in a Vortex. Chloroform (500 μΐ) was then added, resulting in two phases from which the aqueous contained cellular RNA. RNA was precipitated from the aqueous phase by the addition of an equal amount of isopropyl alcohol, and the pellet was collected by centrifugation and the cell pellets were washed once with 80% ethanol.

washed and dissolved in 20 μΐ RNase-free water. DNA contamination in the RNA sample was removed by digestion with RNase-free DNase (Boehringer Mannheim; 60 min at 37 ° C). Finally, DNase was inactivated by further incubation at 95 ° C for 5 minutes.

Reverse transcription reactions consisted of 10 μΐ RNA solution, 2 μΐ 10 mM dNTP, 4 μΐ 25 mM MgCl ₂ , 2 μΐ 10X RT buffer (100 mM Tris-HCl, 900 mM KCl, pH 8.3), 1 μΐ 50 μΜ oligo d (D) ₁₆ , 1 μΐ 20 U / μΙ RNase inhibitor (Perkin Elmer). Reverse transcription reactions were performed for 10 minutes at 25 ° C and 15 minutes at 42 ° C followed by 5 minutes at 95 ° C to inactivate the reverse transcriptase enzyme.

Primers corresponding to the following fragments of the adenovirus genome 5 were used: Ela up: 1228-1248 bp, Ela down: 1545-1526 bp, E3 up: 28722-28737 bp, E3 down: 29157-29140 bp.

The POR reaction compositions were 35 μΐ water, 5 μΐ PCR buffer (100 mM Tris-HCl, pH 8.9, 1 M KCl, 15 mM MgCl ₂ ), 1 μΐ 10 mM dNTP, 1 μΐ up- and downstream primer (25 mM), 0.5 μΐ Taq polymerase (5 U / μΙ, Boehringer Mannheim) and 6.5 μΐ diluted cDNA probe (RNA as control). Samples were denatured at 95 ° C for 90 seconds, followed by 35 cycles: 30 seconds at 95 ° C, 60 seconds at 60 ° C, 30 seconds at 72 ° C coupled to a 3 minute 72 ° C extension at. The amplified DNA products were separated on 2% agarose TAE gel and visualized by ethidium bromide staining. Figure 22 shows that in the non-inactivated adenovirus, the expected PCR domain79 shows both Ela and Ela products. from the E3 region, where the signal can be detected at a 1: 1000 dilution of the target nucleic acid (top panels in the figure). In contrast, no signal was detected in samples derived from psoralen inactivated virus. The lack of a PCR signal in a control sample in which the reverse transcription reaction was omitted proves that the observed signals are due to RNA amplification and not to adenovirus DNA contamination in the nucleic acid preparation.

f) Analysis of 8-methoxy-psoralen binding to adenovirus

i) Quantification of adenovirus-bound 8-methoxy-psoralen

0.41 ml of tritium-labeled 8-methoxy-psoralen (0.8 mCi / ml) was dried, dissolved in 20 μΐ of DMSO and mixed with 8.7 μΐ of unlabeled 8-methoxy-psoralen (33 pg / μΙ in DMSO). To this mixture was added 1.8 ml of biotinylated dll014 adenovirus. UV irradiation and purification by PD-10 chromatography were performed as described above. ³ H 8 -methoxypsoralen was determined by counting small amounts of purified virus in scintillation fluid. Calculations based on the measurement of radioactivity incorporated into DNA showed that one psoralen molecule occurred per 800 bp of virus. In addition, thin-layer chromatography (silica gel, dichloromethane as solvent) showed no unreacted 8-methoxypsoralen remaining in the sample.

ii) Investigation of the storage site of 8-methoxy-psoralen in the viral genome.

To determine whether 8-methoxy-psoralen is distributed throughout the viral genome or is concentrated at defined, accessible sites in the viral DNA, the viral DNA is purified and cleaved with restriction enzymes into 10 or 11 DNA fragments: ³ H 8 -methoxy -sporalen-labeled virus was purified by incubating the virus with 0.4% SDS / 0.4 mg / ml proteinase K for 45 minutes at 56 ° C. The sample was extracted twice with phenol / chloroform (1: 1) and once with chloroform, and the DNA was precipitated from the aqueous phase by addition of 1/10 volume of 3M Na acetate (pH 5), 0.54 volume of isopropyl alcohol. The DNA precipitate was centrifuged, washed 2 times with ice-cold 80% ethanol, air dried and dissolved in TE. Small portions of non-inactivated or ³ H 8 -methoxypsoralen-labeled adenovirus DNA were digested with HindIII or Asp718 according to the manufacturer's instructions (Boehringer Mannheim), but digested with 10x enzyme, phenol / chloroform and chloroform extraction. and precipitated on 0.9% agarose / TAE gel in the presence of ethidium bromide (Sambrook et al., 1989, Molecular Cloning, Cold Spring Harbor Laboratory Press (2nd edition)). The gel was dried, impregnated with scintillation fluorine (Enhance, Amersham) and exposed to X-ray film. Figure 23 shows the ethidium bromide stained gel and the fluorogram; the labeled sample shows that ³ H 8 -methoxypsoralen is distributed throughout the genome. The fragments obtained by Asp718 or HindIII digestion were, with few exceptions, labeled proportionally to their length. Two HindIIIII81 appeared to be located near the ends of the genome

4 «« · · · · · · • ·· ···· "• • · · · · · ··" ·· · · · · .fragmentum stronger candidate. In contrast, similarly located Asp718 fragments in the genome did not show such preferential labeling. Overall, the 8-methoxy-psoralen was distributed equally in the viral genome.

Example 14:

To determine the radiation dose required to inactivate tumor cells

To this end, 6 x 10 ⁵ human melanoma cells in 6 medium tissue culture flasks (T75), each containing 20 ml of normal medium, were treated with 5, 10, 20, 25, 50, 75 or 100 Gy radiation daily; 6 bottles were left without irradiation. For irradiation, a Gammacell 40, No. 126, Type B (U) (Fa. Nordion International INC) was used, containing two Cs-137 gamma cells, which together provide a dose of approximately 72.5 Gy / hr. Six days after irradiation, cells were trypsinized, centrifuged, pellet harvested, 100 μΐ cell suspension was mixed with trypan blue, and counted in a counting chamber. The remaining cells were mixed with new media and placed in a new culture flask (passage 1). One week later, we repeated the process; one bottle from each group was trypsinized, counted, and passage 1 counted as a control. Non-irradiated and 5 Gy-irradiated cells showed clear growth. After a further one week, the procedure was repeated and the experiment was completed in a total of 6 weeks. The growth curves were always counted with the highest calculated cell number (in the original or control flasks). From the 20 Gy irradiation dose, neither the original nor the control flasks showed cell proliferation. At the dose of 10 Gy, growth was observed in the original bottle. The growth curves are shown in Figure 24. Based on the values obtained from three different melanoma cell cultures, a dose of 100 Gy was selected as the safe irradiation dose for each experiment.

Example 15:

Detection of plasmid and adenovirus DNA by polymerase chain reaction (PCR)

In this example, the following methods were used:

Administration of the cancer vaccine:

M-3 melanoma cells were transformed with recombinant murine interleukin-2 using the adenovirus transferrin method as described in Example 8 (c). After 24 hours, cytokine production was determined (20000-50000 units of IL-2 per million cells per 24 hours). Cells were trypsinized, washed in serum-free medium and adjusted to 3 x 10 ⁵ and 1 x 10 ⁵ cells / 100 μΐ with isotonic saline. 100 μΐ cell suspension was injected subcutaneously with a cannula into the right lumbar region of DBA / 2 mice (see

7 and 8).

Cleaning of tissue samples:

At various times after vaccination, mice and sites were sacrificed and tissue samples were collected. These samples were mechanically shredded and incubated overnight in 1 ml proteinase K buffer (50 mM Tris-HCl, 100 mM NaCl, 100 mM EDTA, 1% SDS, 0.5 mg / ml proteinase K) at 55 ° C. Finally, the DNA was extracted with phenol / chloroform and precipitated with 0.5 volumes of isopropyl alcohol. Samples containing total cellular DNA were washed with 70% ethanol and taken up in TE buffer. Cardiac puncture was performed to purify peripheral mononuclear blood cells (PMBZ = peripheral mononuclear Blutzellen). Blood mixed with citrate buffer (10 mM) was finally separated by a Ficoll gradient and PMBZs were digested with proteinase K buffer. The DNA was purified as described above.

Polymerase chain reaction (PCR):

The reaction mixture was 1 µg of DNA, 1 x PCR buffer (Boehringer Mannheim), 1 mM deoxynucleotide, 3 units

Taq polymerase (Boehringer Mannheim) and 25 pmoles of the specific primer. In addition, 1000 copies of the internal control were added to amplify the interleukin-2 plasmid. The PCR reaction times were 5 minutes at 95 ° C for denaturation followed by 40 cycles of 30 seconds at 94 ° C, 30 seconds at 60 ° C, 2 minutes at 72 ° C. The amplification products were then mixed with sample buffer and separated on a 2% agarose gel. The specific primer had the following sequences:

IL-2 Up (Position 99-122) (SEQ ID NO: 3) GTCAACAGCGCACCCACTTCAAGC

IL-2 Down (Position 548-526) (SEQ ID NO: 4) GCTTGTTGAGATGATGCTTTGACA

Adeno up (positions 1228-1248) (SEQ ID NO: 5)

GGTCCTGTGTCTGAACCTGAG

Adeno Down (Position 1545-1525) (SEQ ID NO: 6) TTATGGCCTGGGGCGTTTACA.

(In the sequence diagram, for engineering reasons, the synthetic oligonucleotides are uniformly designated "cDNA" and "5'UTR" as the molecule type.)

The limit of detection of the replication products is between 200 and 1000 copies of DNA per test.

a) For detection of recombinant IL-2 DNA and dll014 adenovirus DNA at the injection site, at different times after vaccination, 9 DBA / 2 mice were immunized with 3 x 10 ⁵ M-3 melanoma cells transformed with IL-2 plasmid each. After 1, 2 and 5 days in each case, 3 mice were sacrificed and the immunization sites cut. PCR analysis showed that strong IL-2 DNA degradation begins after 2 days and that DNA is no longer detectable after 5 days. In a similar experiment, IL-2 plasmid DNA was detected at the injection site of an animal 5 days after injection. PCR reactions with adenovirus-specific primers were able to detect adenoviral DNA in Day 1 and Day 2 samples, but not in Day 5 samples.

b) For detection of IL-2 DNA and dll014 adenoviral DNA from peripheral mononuclear blood cells 24 and 48 hours post-inoculation, twelve DBA / 2 mice were immunized with 1 x 10 M-3 melanoma cells transformed with IL-2 plasmid each. After 24 and 48 hours, while the M-3 cells undergo extensive degradation at the injection site, 6-6 mice were sacrificed and blood collected. PCR analysis showed that no specific IL-2 DNA or adenoviral DNA was detected in the blood at any time point.

c) For detection of IL-2 DNA and dll014 adenovirus DNA in tissue samples from different organs, 6 DBA / 2 mice were immunized with 1 x 10 ⁶ M-3 melanoma cells transformed with IL-2 plasmid each. After 24 and 48 hours, 3 to 3 animals were sacrificed and tissue samples were taken from the site of injection, lymphatic drainage, spleen, kidney, liver, colon, and ovary. Specific replication products were only detected at the vaccination site. All tissue samples tested were negative.

d) To exclude delivery of recombinant IL-2 DNA to germ cells, 6 female and 6 male DBA / 2 mice were immunized with 1 x 10 ⁵ M-3 melanoma cells transformed with IL-2 plasmid each. After 24 and 48 hours, 3-3 female and 3-3 male animals were killed and the germ cells isolated. PCR analysis showed no DNA transfer to germ cells.

Example 16:

a) Testing the efficacy of the cancer vaccine against metastasis formation ("therapeutic mouse model")

In this example, with respect to the transfection complexes used, cultures of cells and transfection were performed as described in Example 8. Mice from the C57BL / 6J strain were used as experimental animals with 8 animals per group. As a melanoma cell, synaptic B16-F10 cells (NIH DCT Tumor Depository) for the murine strain used [Fidler et al. , Cancer Slit. 35: 218-234 (1975)].

On day 1, experimental animals were inoculated with 1 x 10 ⁵ live B16-F10 cells intravenously to induce the development of metastasis. On days 4, 11, and 17, the cancer vaccine was administered subcutaneously to induce immunization against metastases.

For each immunization, 1 x 10 ⁵ irradiated cells were injected, in which vaccines contained cells that had been previously transformed with a cytokine plasmid ("transformed cells" means cells that have undergone transfection treatment; values for expression of cytokines are always in the mouse). , 24 hours; markings are as shown in Figure 25):

(1) controls:

(a) Cells irradiated only ('irradiated')

(b) irradiated cells transformed with the pSP empty vector ("empty vector")

2) cells transformed with plasmid IL-2:

(a) 100% transformed cell (expressed as 15000 units;

"IL-2 High)

b) 20% transformed cells, 80% non-transformed cells (expression: 3000-4000 units; "IL-2 medium")

c) 2% transformed cells, 98% non-transformed cells (expression: 400 units; "IL-2 low")

3) cells transformed with plasmid GM-CSF:

a) 100% transformed cell (expression: 500 ng;

"GM-CSF High)

b) 10% transformed cell, 90% non-transformed cell (expression: 50 ng; GM-CSF medium)

c) 1% transformed cell, 99% non-transformed cell (expression: 5 ng; "GM-CSF low")

4) cells transformed with IFN-γ:

(a) 100% transformed cell (expression: 1000 ng;

"IFN-γ high)

b) 10% transformed cell, 90% non-transformed cell (expression: 100 ng; IFN-γ medium)

c) 1% transformed cell, 99% non-transformed cell (expression: 10 ng; "IFN-γ low)

On day 28, the protective effect of the cancer vaccine against metastasis formation was analyzed by visually examining mice for the presence of tumors.

The experimental results presented in Figure 25 show that cancer vaccines work depending on the transformed gene and the degree of gene expression.

b) Testing the cancer vaccine for the ability to kill artificially implanted "micrometastases"

To determine the tumorigenic content of M-3 cells, first of all, in a preliminary experiment, 1 x 10 ³ and 3 x 10 ³ , respectively, leading to local tumor progression in 50% of all animals and within 10 weeks in 100% of all animals. It was determined in M-3 melanoma cells.

On day 0, 5 x 10 live M-3 cells were injected subcutaneously into each experimental animal; M-3 cells that do not induce metastasis can be considered "micrometastases. The cancer vaccine was administered to each experimental animal after one, two and five weeks. The expression of the cancer vaccine cytokine per mouse IL-2 was 1020 units for Immunization 1, 1870 Units for Immunization 2 and 1,400 Units for Immunization 3. For GM-CSF, values are 14 ng, 9 ng and 22 ng per vaccine and mouse. The experimental groups consisted of 10-10 animals, each of which was immunized with 1x10 ⁵ pWS2m vector transformed and irradiated with M-3 cells each. The second group of animals each with 1 x 10 ⁵ PWE-Gm vector and transformed irradiated M-3 cells were immunized. The first control group was treated with 1 x 10 ⁵ irradiated but untransformed M-3 cells. The second control group received 5 x 10 ³ M-3 cells as a control for tumor formation. The animals were observed for more than 4 months. It was found that in both groups receiving cells expressing the cytokine as the cancer vaccine, 80% of the animals were protected against tumor formation. In the first control group, all animals developed tumors within 8 weeks. In the second control group, all animals except one developed a tumor.

Example 17:

Efficacy of cancer vaccine versus cytokine dose in a mouse model of proliferation

In this example, with respect to the transfection complexes used, cultures of cells and transfection were performed as described in Example 8.

DBA / 2 mice and M-3 melanoma cells were used. The cytokine plasmids used were the same as in Example 16. Example 8. Immunization végez1 needles out as described in the implantation of tumors Unlike Example 8 were carried out with 3 x 10 ⁵ cells instead of 1 x 10 ⁵ cells. The mixing ratios of transformed cells and only irradiated cells and expression values were as in Example 16. The animals were examined for tumor incidence for 8 weeks after tumor implantation; the results of these experiments are shown in Figure 26.

Example 18:

Use of endosomal malicidal peptides for the preparation of cancer vaccines

a) Synthesis of INF5 peptide

IFN5 peptide (SEQ ID NO: 7) was synthesized by the HBTU activation method [Knorr et al.

Tetrahedron

Letters 30,

1927-1930 (1989)] in the order of 1 mmol where 230 mg

TentaGel SPHB resin (Rapp polymer; 0.27 mmol / g) was used as the stationary phase. The first linked amino acid was Ν-α-Ν-ε-di-Fmoc-lysine. This head-on-head resulted in dimerization with a C-terminal lysine as a binding amino acid. (The following side chain protecting groups were used: (Trt) Asn, (Trt) Cys or (t-Bu) Cys, (t-Bu) Glu, (Trt) His, (t-Bu) Ser. The peptides were separated from the resin. and the side chain protecting peptide-filled anisole / ethanedithiol resin was removed by treatment with 1 ml of trifluoroacetic acid / water / phenol / thio (10: 0.5: 0.75: 0.5: 0.25) at room temperature for 1.5 hours. el.) Deposition of the peptide by precipitation! the mixture was pipetted dropwise into 40 ml of ether with shaking and allowed to stand for 1 hour. The crude peptide was obtained by centrifugation, washed with ether and dried under argon and finally under high vacuum.

b) Gene transfer to human melanoma cells by INF5

i) Expression of the luciferase reporter gene

Initially, experiments were carried out with the pCMVL reporter gene construct using 1.5 pg TfpL290, 5 pg pL290, 40 pg INF5 and 3 pg pCMVL to prepare transfection complexes. In these complexes, the peptide was ion-bound to polylysine. The DNA complexes were mixed with 0.5 ml of RPMI 1640 (Gibco) containing 10% FCS and plated on M-3 melanoma cells (1 x 10 ⁵ cells in 6 well plates). After 4 hours, the medium was replaced with fresh medium. 24 hours after transfection, cells were harvested and assayed for luciferase activity. Expression corresponding to 12866000 light units was detected.

ii) Human IL-2 Expression Transfection complexes containing pg pGShIL-2tet, 1.5 pg TfpL290, 5 pg pL290, 40 pg INF5 were loaded on melanoma cells as described in (i). One and two days after transfection, the amount of IL-2 secreted into the medium within 24 hours was measured by ELISA (Biokine IL-2 Test Kit, T Cell Diagnostics). On the first day, 6500 BRMP units were obtained, and on the second day, 11500 BRMP units were obtained, where one unit corresponds to 40 pg IL-2.

c) Testing of tumor cells transformed with INF5 as a cancer vaccine in a prophylactic mouse model

Mice from the C57BL / 6J strain and B16-F10 cells were used in this experiment. Two immunizations were performed with 1 x 10 ⁵ cells at 7 day intervals; 7 days after the last immunization, the tumor cells were implanted (1 χ 10 ⁵ cells). The cancer vaccine was prepared using a transfection complex containing 6 pg pWS-Gm DNA-1, 3 pg TfpL, 10 pg pL and 40 pg INF5. Cancer vaccines containing different amounts of cells carrying the GM-CSF plasmid were introduced, with the mixing ratios of irradiated and transformed cells and only irradiated cells being as described in Example 16. The results obtained with cancer vaccines containing cells transformed with INF5 are shown in Figure 27. Protective activity against tumor formation was observed at high and moderate doses of GM-CSF.

Example 19.

Interleukin expression in human melanoma cells χ 10 ⁵ melanoma cell transformed with one week after operational exceptions their 6-cm cell culture dishes in 2 ml of the transfection complex (0.5 ml of starting solution containing biotinylated inactivated 8-methoxy-psoralen / UV adenovirus ( 0.54 x 10 particles / ml), containing 100 µg / µl streptavidin polylysine, 6 µg pGShIL-2tet plasmid DNA, 1 µg / µl TfpL in HBS diluted with 1.5 ml medium. The experiments were performed with irradiated (100 Gy) and non-irradiated cells. IL-2 values were measured at the time intervals shown in Figure 28; IL-2 values are for 10 ⁵ cells and 24 hours.

Example 20:

Development of a galenic formulation for the cancer vaccine

The starting material was MMG-3 melanoma cells transformed with pGShIL-2tet and irradiated with 100 Gy dose; After incubation for 20 hours at 37 ° C, cells were trypsinized and cell counts and viability were determined with trypan blue. The cells were then divided into four equal parts to test four different freezing media. The four sample groups were centrifuged in RPMI 1640 medium at 800 rpm (120 g) prior to addition of freezing medium, and the cell pellet was added to 1 ml of freezing medium. After small portions were taken to determine cell number and viability, the samples were immediately placed in a freezer and gently frozen to -100 ° C using a temperature gradient program (-1 ° C / min) and placed in liquid nitrogen. As freezing medium, the following were tested: Medium 1: 70% RPMI, 20% FCS, 10% DMSO; Medium 2: 20% human serum albumin, 10% DMSO; Medium 3: 12% HES (hydroxyethyl starch), Ringer's solution (Leopold Pharma # 2870), 5% DMSO; Media 4: 12% in HES Ringer's solution.

days later, the cells were thawed and immediately after that cell counts and cell viability were determined using trypan blue. The samples were then washed in the first washing step with the appropriate medium (freezing medium without DMSO), in the second and third washing steps with Ringer's solution, centrifuged and resuspended in Ringer's solution. Cell counts and cell viability were then re-determined. Subsequently, cell counts and viability at 4 ° C were determined after 24 and 48 hours. The result of these experiments is

This is shown in Table V.

In addition, 300-300 μΐ of each sample group (media 1-4) was placed in T25 culture flasks with 3 ml of complete medium and incubated at 37 ° C; After 24 and 48 hours, supernatant was taken to determine IL-2 expression (sample from media group 1) and determine the proportion of cells in the supernatant. Further samples, which were first allowed to stand at 4 ° C in Ringer's solution, were also sampled with 300 μΐ after 24 and 48 hours and incubated at 37 ° C as described above (IL-2 assay in Group 1). members). The result of these experiments ("Galenic 4") is shown in Table VI. Table.

Example 21.

Effect of DNA endotoxin content on IL-2 expression in primary human melanoma cells

In this example, the following materials and methods were used:

(a) DNA preparation

Plasmid pGShIL-2tet was obtained from overnight cultures of E. coli (grown in LB medium containing 5 pg / ml tetracycline).

b) Purification of plasmid DNA from endotoxin (lipopolysaccharide)

i) Triton X-114 extraction

To obtain a homogeneous preparation of the detergent, Triton Χ-114 (Sigma) was subjected to three cycles of 0 ° C / 30 ° C according to Bordier [J. Biol. Chem. 256: 1604-1607 (1981)]. The extraction of lipopolysaccharide from a DNA sample is described in published methods [Aida and Pabst, J. Immunol. Methods 132: 191195 (1990); Manthorpe et al., 1993, Human Gene Therapy 4: 419-431] as follows: DNA sample (0.5-1.5 mg / ml in 10 mM Tris, 0.1 mM EDTA) pH 7.4 (TE)) was taken up in 0.3 M sodium acetate (pH 7.5). Then everything

To 100 μΐ of DNA solution was added 3 μΐ of Triton Χ-114, the samples were vigorously mixed in a Vortex and kept on ice for 10 minutes. To allow the two phases to separate, the samples were kept at 30 ° C for 5 minutes, centrifuged in a preheated Eppendorf centrifuge for 2 minutes at 2000 rpm, and the aqueous phase was placed in a fresh Eppendorf tube. This extraction was performed twice more and the last aqueous phase was precipitated with 0.6 volumes of isopropyl alcohol at room temperature, the precipitate was collected by centrifugation, washed twice with 80% ethanol, air dried, re-taken in TE and quantitated. To do this, the sample was treated with RNase A, proteinase K, phenol / chloroform and chloroform, re-precipitated and the final DNA pellet suspended in TE and the absorbance determined at 260 nm, starting from this assumption. that a concentration of 0.05 mg / ml DNA has an absorbance value of 1.

ii) Polymixin chromatography

To one volume of polymyxin resin slurry (Affi-PrepPolymyxin, Biorad) corresponding to the volume of the DNA sample was added three volumes of 0.1 M NaOH and then washed three times with TE of five resin volumes. The pelleted resin was resuspended in DNA samples (0.8-1.2 mg / ml in TE) and the mixture was stirred overnight at 4 ° C. The sample was then applied to a disposable column pre-treated with 0.1 M NaOH and washed with TE. The eluate was collected, the resin was washed with an additional volume of TE and the eluate was combined with the washing liquid. The DNA from this pooled sample was precipitated with 1/10 volumes of 3 M sodium acetate (pH 5) and 2 volumes of ethanol. Further treatment of the precipitate and determination of the DNA was carried out as described above.

(c) Cell culture

Primary human melanoma cells were isolated and cultured in RPMI 1640 medium (Gibco / BRL) supplemented with 100 IU / ml penicillin, 100 pg / ml streptomycin, 2 mM L-glutamine, 1% sodium pyruvate and 10% heat inactivated FCS.

(d) Endotoxin determination

The lipopolysaccharide content was determined by the chromogenic Limulus Assay (available: BioWhittaker QCL-1000), which is based on the Limulus clotting reaction of amoebocytes (Iwanaga S., Curr. Opin. Immunol. 5: 74-82 (1993)]. Prior to the assay, all biological materials and reagents used were assayed for free lipopolysaccharide (<0.1 L endotoxin unit / 50 μΐ solution).

e) Preparation of transfection complexes

Of transferrin-polylysine, streptavidin and biotinylated,

From dll014 adenovirus inactivated with 8-methoxy-psoralen (8 μΐ, 1 x

Triple complexes consisting of 10 to ¹² particles / ml) and plasmid DNA (6 pg diluted in 100 μΐ with the respective lipopolysaccharide content) were prepared as described in the previous examples.

H225 labeled primary human melanoma cells (χ 2 10 ⁵ cells / β-cm culture dish) were transformed with the plasmids purified by various methods pg-6 of Figure 29 in accordance with specified. The content of the endotoxin of the plasmid preparation prior to purification is in each case depicted below the dark bars. After purification with polymyxin resin or extraction with Triton X114, each sample contained less than 0.1 units of lipopolysaccharide per S pg of DNA. IL-2 content was measured from cell supernatants by ELISA (T Cell Diagnostics Inc., Cambridge, MA USA). Values in the figure are units per 10 ⁶ cells per 24 hours.

In addition, within this example, experiments were performed which showed that the LPS-induced relapse in addition to the purified DNA was at least partially eliminated by the addition of polymyxin to the medium.

Example 22:

Inducing a systemic immune response by immunization with irradiated cytokine-irradiated colon carcinoma cells ("prophylactic colon carcinoma model")

In this example, with respect to the transfection complexes used, cultures of cells and transfection were performed as described in Example 8, where the cytokine DNA introduced and its administration and controls (blank vector, irradiated cells only) the procedure described in Example 16 was followed; the symbols used in Figure 30 correspond to those in Example 16 and Figure 25. The CT 26 colon carcinoma cell line was used, the establishment of which by Brattain et al., Cancer Sl. 40, 2142-2145 (1980)]. Mice from BALB / c strain served as experimental animals. 1x10 ⁵ cells were used for each immunization and 3x10 ⁵ cells were implanted at the time of tumor implantation. VII. Table 24 shows IL-2 expression values (unit / mouse), IFN-gamma, and GM-CSF expression (ng / mouse each) selected between cells irradiation and injection (Immunization / Table 2). immunization). Figure 30 shows the protective effect of colon cancer cancer vaccine against tumor formation.

• ·

J ....

* ·

Table I

Plasmid ratio

Gene expression ng IFN-γ IL-2 unit (10θ per cell / 24 h)

IFN-γ 100 % / IL-2 0 O, 0 369, 6 - IFN-γ 75 % / IL-2 25 the. 0 290.4 7920 IFN-γ 50 % / IL-2 50 0. O 204, 6 11880 IFN-γ 25 % / IL-2 75 0. O 83, 8 14520 IFN-γ 10 % / IL-2 90 SHE SHE 42.9 18150

Luciferase light units / pg protein

pCMVL 100% / pSP 0 0 1531438 pCMVL 75% / pSP 25 Q. O 1191660 pCMVL 50% / pSP 50 Q. SHE 700 052 pCMVL 25% / pSP 75 O.O. 209 914 pCMVL 12.5% / pSP 87.5% 48 352 pCMVL 6.3% / pSP 93.7% 14632 pCMVL 3.1% / pSP 96, 9% 7324

CO CO LD

Φ Cn

Φ

II. spreadsheet

C -cd + J

Φ above 'CD -P

Φ + J I — I o

Φ

O>

RCO

4->

(SHE

C cd LD

Ol <d

Ό

Λί

Φ

-P

Φ cn sd

LD 'T O

co co ld \ \ \ o co co ui \ \ \ cn o

co co m

cn cn o> ςτ CO CO LD

co co ld sr cn o co <N co cn

Lf) o

co

co o

LD

SHE

C \ 1 < 4-J -U) needle She Q N lake '01 cn 'Φ kill 1 £ S > 0 CQ z - s Z- r-1 Φ cn -P • HI 43 '05 1-1 t-1 t-1 Φ X I ^- 1 'IU She She 4-1 CN g i-1 r-H _p N P 1 -------- t ι-1 <d * I-1 • H 0 τί Ό g cn Φ the m - ' 0 cn N c 1-1 g o \ o o \ o CD - (ΰ UO g C SHE SHE <-1 N SHE Ή CD SHE SHE Φ • H ! -1 P you you g the cn -P 2 X 0 CN cn g the g cu 1 1 § 1-1  <-1 φ ω H-q S hl - z the O4 hl

·· · · * ·

O LT)

Ο {N Ο <0 l0

LD

CN

C '{Ü -U co

<0 LD <0 <0 SHOOT ο <Ν Ο Ό OJ

III. spreadsheet

φ

C0 <0 'φ Γ 4-> <0 Φ -Ρ r-1 <0 : φ <0 φ <0 Λ -μ <0 φ LD C <0 Φ Cn Φ tD Ό <0 Φ 44 C0 φ C0 4) <0 φ <0 04 <0

<0 LD <0 <0 Ο 04 ο ω

<0 LO

L0

CN

C0

Ο <0

Ο

C0

ΙΌ

<0 <0

Ο ΙΓ)

SHOOT

<0 lO <0 <0LO \ \ \ \\

Ο CN Ο L0τ — I <0 LO <0 <0 10

<0 <0 LT)

SHOOT

0χ] 4J ο τ ~ 1 < -U ι-1 ff) Ο Ό Q Ν μ η 'fd ο \ ° 'Φ Ο Ί5 □ ι-1 * ο C0 Η-ι ί-ι φ ω > - Ο η Ό ό5 τ-Η rh 1 τ "Η CN Φ X r-H Ο Ο Ζ Η-ι γΗ +4 CN '<3 τ-1 t-H IL Ό CO 4_> Ν <-1 Γ-I I-I 1 --------- 1 φ · | - | • Η Τί SHE ε ω φ α - ' - ' + 4- - ' 0 όι C0 C 1-I g ο \ ° ο \ ° ο \ ο ο \ ° 0? φ '05 LD κ Ο Ο Ο Ο Ο 1-1 Ν Ο • Η Ο ϊ-1 στ j-4 Ο φ • Η ! -1 γ-1 ! -1 S C C0 > - X 0 CN C \] 04 1 CN cn g C 1 1 I Ζ 1 I g τ-1 Η Ρ) ff. S 1-I Η 1-1 Μ 1-4 Η

• ·

101

ARC. spreadsheet

Tumor development in DBA / 2 mice

Number of weeks a Immunizations (2x) after implantation of tumors (1 x ΙΟ ³ m-3 cells) 12 3 4 1 x 10 ⁵ M-3 No immunization 0/6 2/6 6/6 6/6 pSP (dll014) 0/6 1/6 3/6 4/6 IL-2 100% (dll014) 0/6 0/6 0/6 0/6 IL-2 4% (dll014) 0/5 0/5 1/5 1/5 3 x 10 ⁵ M-3 IL-2 100% (dll014) 0/5 0/5 0/5 2/5 IL-2 4% (dll014) 0/5 2/5 3/5 4/5 1 x 10 ⁶ M-3 IL-2 100% (dll014) 0/4 0/4 1/4 1/3 IL-2 4% (dll014) 1/5 3/5 4/5 4/5 1 x 10 ⁵ KLN 205 IL-2 100% (dll014) 0/6 2/6 6/6 6/6

• ·

nd: not detectable

RTJ C I '<D 0 I I 0 | | Ό CJ I N ⁰ 1 co co 4J 1 1 'Γ-Ί

g N φ 1 <U u U) 1 1 -------- 1 ή 0 c Φ 1 'SHE Ή (t U l i ti r | the P i c Φ 4) -P Λ 1 <D r-1 1 -1 «J r ~ l <0 i tP 0) CO 1 ® ¹ 5> > 'Φ 1 N +> p 1 14 1 Ό «J -P CN 1 44 N 0 1 i-1 1 '01 P P σί 1 i-1 N I-i h 1.. Λ 10 the 1P '<3 (0 the φ 1 C P • 0 '<t ε p c co 1 ⁰ d> 0 i 6 > wood rc n 1 -H

CO 1 'L 1 ° i CN 1 CN I <n! She

the 1 1 1 1 1 1 1 'Φ 1 1 1 1 1 1 1 44 _Λ 1 1 1 1 1 1 1 4-> o \ o 1 1 σ 1 She 1 co 1 1 Φ —- 1 1 0Ί 1 She 1 σ 1 σ rh 1 1 1 rí 1 1 1 'Φ 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 'Φ 1 1 1 1 1 1 co £ 1 ! 1 1 1 1 1 co "RTJ 1 1 1 1 1 1 1 Φ N O 1 r ^- 1 1 ο I 1 σ » 1 CO 1 CL CO r-d 1 1 1 1 1 X 1 'Φ JJ 1 CO 1 co l 1 CN 1 CN 1 44 • m X 1 1 1 1 1 1 44 Φ 1 1 1 1 1 Φ co 1 1 1 1 1 1 i-1 1 1 1 1 1 £ 1 1 1 1 1 1 Φ 1 Ό 1 + 1 1 1 1 XI 1 II 4-> U 1 L-L + She 1+ O l 1 She 1 1 1 • N Φ 1 s co l < CO 1 1 co CO co 1 co co i CL co Ό 1 dl She s 1 co S l i ω M s i ω Cl 1 'Φ φ r-11 CD d Q 1 X 0 1 1 X Φ 0 1 X Φ 1 44 0 1 1 1 1 cn 1 cn I 4J CP CL 1 o \ o o \ o o \ o 1 c * o cAO 1 1 the oP 1 o \ o C 1 Φ Φ 'φ 1 She She She 1 o O 1 1 CN • H LT) 1 CN • Η 1 Ή d 4-) 1 CN i-1 1 «—I 1 1 Γ-Η CD + 1 <—f X 1 'Φ

• ·

- 103 VI. spreadsheet

44 • m Φ CQ CQ She 'Φ She σ> τ> SHE σ> r- ol * 0 «-1 LD co c 1 N \ 0 hC Φ Ό ·· ·· 1 I-1 • r ~ i Ό '0 u Φ Ψ4 04 co • H OJ 42 ω aJ CD c D® D® D® D® D® D® 05 She She She She She SHE '0 Λ lT) w She She r- 4) Ό t-1 r-1 co 4) • rn N Φ Φ CQ • • · • «· * ·· N CQ the Ό Ό Ό Ό Ό Ό 'Φ r "H c the 00 co co Ή i-1 ol ol ol d ° Φ M-J 4-> • r ~ i Φ CQ CQ stone ol 'Φ η ^ r kU TJ SHE stone co * 0 r-H c: 04 N 0 1 Φ '0 * < .. 1 J • rc Ό '0 u M Φ U l OJ co • H 04 vr 42 ω j 05 the M 05 D® cK> D® D® D® D® Ό n She SHE m m SHE She 4) Ό 1D tendon σι σ> stone stone 4) • m N 04 Φ Φ CQ • • ♦ · » • · • «· N CQ Ό Ό Ό Ό '0 '0 '<D Ri c : □ co • tn co co • H i-1 04 04 04 Op Φ Ψ4 44 • ΓΊ Φ tendon CT) CQ σ> stone 'Φ Ω r ~ l She You She t-H Γ * 0 t-1 t-1 C ol N 0 1 Φ '0 .. >> 1 T-C • rc '0 Ό u 1-1 Φ Ψ4 ol 00 • H OJ 42 ω CD Φ M Ψ4 Ό o \ ® D® D® D® D® D® D® D® td the SHE She She She SHE She She She She 05 t-1 t-1 r- co ol ol 'T 4) Λ Φ 4) Ό • •. •. «· • •. • »· N N Ό Ό Ό '0 '0 Ό '0 Ό -Φ CQ the "□ X co 'tp co co • H r-1 04 OJ ol OJ 0? Z i-1 + c c 42 <D + the) Φ Φ > Ό + ü She Λ 4) 44 4-> 4) hl ca She She ca 1 • m N, 4J N 05 71 u ca < ca ca CQ > 1 ca CQ Φ c σι a CQ τ) CU l U s ca s ω M Q M ω 0 Φ 0 05 i-1 CD Q X Q X Φ CC Φ Ή CL > 1 0 D® σ> cc u 'Φ * 0 ix D® 0 \ ° d ° D® D® d ° C m d ° c S ^u needle 73 j '05 She SHE SHE SHE SHE 04 H ol • H CQ-H CXJ 4-1 She 04 r-1 ol t-1 1- ( CD + i-1 od

• *

104

VII. spreadsheet

Vaccine

expression

1.Immun./2.Immun.

GM-CSF (High)

GM-CSF (Medium)

GM-CSF (Low)

IL-2 (high)

IL-2 (Medium)

IL-2 (Low)

IFN-γ (high)

IFN-γ (Medium)

IFN-γ (low)

13/6

241/184

24/18

2.4 / 1.8

4302/4624

860/925

86/93

129/63

1.3 / 0.6

105

SEQUENCE LIST

SEQ ID NO: 1

Length of sequence: 1664 bp

Type of sequence: nucleic acid

The sequence type is single-stranded

Topology: linear

Type of molecule: mRNA from cDNA

Hypothetical: no

Antisense: No

Origin: Rabies virus

Description Tickets, Key: 5'UTR (Positions 1-6)

CDS (position 7-1581) signal peptide (position 7-63) sticker peptide (position 64-1578)

Description of SEQ ID NO: 1:

TCTAAT ATG GTT CCT CAG GCT CTC CTG TTT GTA CCC CTT CTG GTT TTT 48

Met Val Pro Gin Ma Leu Leu Phe Val Pro Leu Leu Val Phe

-19 -15 -10

CCA TTG TGT Pro Leu Cys -5 TTT Phe GGG AAA TTC CCT ATT TAC ACG ATC CCA GAC AAG CTT 96 Gly Lys 1 Phe Pro He Tyr Thr lle Pro Asp Lys Leu 5 10 GGT CCC TGG AGC CCG ATT GAC OVER THE CAT CAC CTC AGC TGC CCA AAC AAT 144 Gly Pro Trp Ser Pro He asp Ile His His Leu Ser Cys Pro Asn Asn 15 20 25 TTG GTA GTG GAG GAC GAA GGA TGC ACC AAC CTG TCA GGG TTC TCC TAC 192 Leu With With Glu asp Glu Gly Cys Thr Asn Leu Ser Gly Phe Ser Tyr 30 35 40 ATG GAA CTT AAA GTT GGA TAC ATC TTA GCC OVER THE AAA ATG AAC GGG TTC 240 Met Glu Leu Lys With Gly Tyr Ile Leu below Ile Lys Met Asn Gly Phe 45 50 55 ACT TGC ACA GGC GTT GTG ACG GAG GCT GAA ACC TAC ACT AAC TTC GTT 288 Thr Cys Thr Gly Val With Thr Glu below Glu Thr Tyr Thr Asn Phe With 60 65 70 75 GGT TAT GTC ACA ACC ACG TTC AAA AGA AAG CAT TTC CGC CCA ACA CCA 336 Gly Tyr With Thr Thr Thr Phe Lys Arg Lys His Phe Arg Pro Thr Pro 80 85 90

106

DAM GCA TGT AGA GCC GCG TAC AAC TGG AAG ATG GCC GGT GAC CCC AGA 384 asp below Cys Arg below below Tyr Asn Trp Lys Met below Gly Asp Pro Arg 95 100 105 TAT GAA GAG TCT CTA CAC AAT CCG TAC CCT GAC TAC CGC TGG CTT CGA 432 Tyr Glu Glu Ser Leu His Asn Pro Tyr Pro asp Tyr Arg Trp Leu Arg 110 115 120 ACT GTA AAA ACC ACC AAG GAG TCT CTC GTT ATC OVER THE TCT CCA AGT GTA 480 Thr With Lys Thr Thr Lys Glu Ser Leu With Ile Ile Ser Pro Ser With 125 130 135 GCA DAM TTG GAC CCA TAT GAC AGA TCC CTT CAC TCG AGG GTC TTC CCT 528 below asp Leu asp Pro Tyr Asp Arg Ser Leu His Ser Arg. Val Phe Pro 140 145 150 155 AGC GGG AAG TGC TCA GGA GTA GCG GTG TCT TCT ACC TAC TGC TCC ACT 576 Ser Gly Lys Cys Ser Gly Val below With Ser Ser Thr Tyr Cys Ser Thr 160 165 170 AAC CAC DAM TAC ACC ATT TGG ATG CCC GAG AAT CCG AGA CTA GGG ATG 624 Asn His asp Tyr Thr Ile Trp Met Pro Glu Asn Pro Arg Leu Gly Met 175 180 185 TCT TGT GAC ATT TTT ACC AAT AGT AGA GGG AAG AGA GCA TCC AAA GGG 672 Ser Cys asp Ile Phe Thr Asn Ser Arg Gly Lys Arg Alá Ser Lys Gly 190 195 200 AGT GAG ACT TGC GGC TTT GTA DAM GAA AGA GGC CTA TAT AAG TCT TTA 720 Ser Glu Thr Cys Gly Phe With asp Glu Arg Gly Leu Tyr Lys Ser Leu 205 210 215 AAA GGA GCA TGC AAA CTC AAG TTA TGT 'GGA GTT CTA GGA CTT AGA CTT 768 Lys Gly Ala Cys Lys Leu Lys Leu Cys Gly Val Leu Gly Leu Arg Leu 220 225 230 235 ATG DAM GGA ACA TGG GTC GCG ATG CAA ACA TCA AAT GAA ACC AAA TGG 816 Met Asp Gly Thr Trp With below Met Gin Thr Ser Asn Glu Thr Lys Trp 240 245 250 TGC CCT CCC DAM CAG TTG GTG AAC CTG CAC GAC TTT CGC TCA GAC GAA 864 Cys Pro Pro asp Gin Leu With Asn Leu His asp Phe Arg Ser asp Glu 255 260 265 ATT GAG CAC CTT GTT GTA GAG GAG TTG GTC AGG AAG AGA GAG GAG TGT 912 Ile Glu His Leu With With Glu Glu Leu With Arg Lys Arg Glu Glu Cys 270 275 280 CTG DAM GCA CTA GAG TCC ATC ATG ACA ACC AAG TCA GTG AGT TTC AGA 960 Leu asp below Leu Glu Ser Ile Met Thr Thr Lys Ser Val Ser Phe Arg 285 290 295 CGT CTC AGT CAT TTA AGA AAA CTT GTC CCT GGG TTT GGA AAA GCA TAT 1008 Arg Leu Ser His Leu Arg Lys Leu With Pro Gly Phe Gly Lys below Tyr 300 305 310 315

• «• f ·· <·« · · · · · · · · · · ···

107

ACC ATA TTC AAC AAG ACC TTG ATG GAA GCC GAT GCT CAC TAC AAG TCA 1056 Thr Ile Phe Asn Lys Thr 320 Leu Met Glu below 325 Asp Alá His Tyr Lys 330 Ser GTC AGA ACT TGG AAT GAG ATC CTC CCT TCA AAA GGG TGT TTA AGA GTT 1104 With Arg Thr Trp 335 Asn Glu Ile Leu Pro 340 Ser Lys Gly Cys Leu 345 Arg With GGG GGG AGG TGT CAT CCT CAT GTG AAC GGG GTG TTT TTC AAT GGT OVER THE 1152 Gly Gly Arg 350 Cys His Pro His With 355 Asn Gly Val Phe Phe 360 Asn Gly Ile OVER THE TTA GGA CCT GAC GGC AAT GTC TTA ATC CCA GAG ATG CAA TCA TCC 1200 Ile Leu 365 Gly Pro Asp Gly Asn 370 With Leu Ile Pro Glu 375 Met Gin Ser Ser CTC CTC CAG CAA CAT ATG GAG TTG TTG GAA TCC TCG GTT ATC CCC CTT 1248 Leu 380 Leu Gin Gin His Met 385 Glu Leu Leu Glu Ser 390 Ser With Ile Pro Leu 395 GTG CAC CCC CTG GCA GAC CCG TCT ACC GTT TTC AAG GAC GGT GAC GAG 1296 With His Pro Leu below 400 asp Pro Ser Thr With 405 Phe Lys Asp Gly Asp 410 Glu GCT GAG DAM TTT GTT GAA GTT CAC CTT CCC DAM GTG CAC AAT CAG GTC 1344 below Glu asp Phe 415 With Glu With His Leu 420 Pro asp With His Asn 425 Gin With TCA GGA GTT GAC TTG GGT CTC CCG AAC TGG GGG AAG TAT GTA TTA CTG 1392 Ser Gly With 430 asp Leu Gly Leu Pro 435 Asn Trp Gly Lys Tyr 440 With Leu Leu AGT GCA GGG GCC CTG ACT GCC TTG ATG TTG ATA ATT TTC CTG ATG ACA 1440 Ser below 445 Gly below Leu Thr below 450 Leu Met Leu Ile Ile 455 Phe Leu Met Thr TGT TGT AGA AGA GTC AAT CGA TCA GAA CCT ACG CAA CAC AAT CTC AGA 1488 Cys 460 Cys Arg Arg With Asn 465 Arg Ser Glu Pro Thr 470 Gin His Asn Leu Arg 475 GGG ACA GGG AGG GAG GTG TCA GTC ACT CCC CAA AGC GGG AAG ATC OVER THE 1536 Gly Thr Gly Arg Glu 480 With Ser With Thr Pro 485 Gin Ser Gly Lys Ile 490 Ile TCT Ser TCA Ser TGG GAA Trp Glu TCA Ser CAC His AAG Lys AGT Ser GGG GGT Gly Gly GAG Glu ACC Thr AGA CTG Arg Leu TGAGGACTGG 1588

495,500,505

CCGTCCTTTC AACGATCCAA GTCCTGAAGA TCACCTCCCC TTGGGGGGTT CTTTTTGAAA 1648

ΑΑΑΆΑΑΑΑΑΑ YEAH

1664

SEQ ID NO: 2

The sequence length is 524 amino acids

Type of sequence: amino acid

Topology: linear

Type of molecule: protein

108

• · '·· ···· * · · V « • 4 • · · « • · ♦ • · • • ♦ ·· ·· • • «

Description of SEQ ID NO: 2:

Met Val -19 Pro Gin Leá Leu Le Phe Val Pro Leu Leu Val Phe Pro Leu -15 -10 -5 Cys Phe Gly Lys Phe Pro lle Tyr Thr to Pro Asp Lys Leu Gly Pro 1 5 10 Trp Ser Pro lle Asp lle His His Leu Ser Cys Pro Asn Asn Leu Val 15 20 25 Val Glu Asp Glu Gly Cys Thr Asn Leu Ser Gly Phe Ser Tyr Met Glu 30 35 40 45 Leu Lys Val Gly Tyr lle Leu Alá lle Lys Met Asn Gly Phe Thr Cys 50 55 60 Thr Gly Val Val Thr Glu Alá Glu Thr Tyr Thr Asn Phe Val Gly Tyr 65 70 75 Val Thr Thr Thr Phe Lys Arg Lys His Phe Arg Pro Thr Pro Asp Alá 80 85 90 Cys Arg Ala Ala Tyr Asn Trp Lys Met Alá Gly Asp Pro Arg Tyr Glu 95 100 105 Glu Ser Leu His Asn Pro Tyr Pro Asp Tyr Arg Trp Leu Arg Thr Val 110 115 120 125 Lys Thr Thr Lys Glu Ser Leu Val lle lle Ser Pro Ser Val Alá Asp 130 135 140 Leu Asp Pro Tyr Asp Arg Ser Leu His Ser Arg Val Phe Pro Ser Gly 145 150 155 Lys Cys Ser Gly Val Alá Val Ser Ser Thr Tyr Cys Ser Thr Asn His 160 165 170 Asp Tyr Thr lle Trp Met Pro Glu Asn Pro Arg Leu Gly Met Ser Cys 175 180 185 Asp He Phe Thr Asn Ser Arg Gly Lys Arg Alá Ser Lys Gly Ser Glu 190 195 200 205 Thr Cys Gly Phe Val Asp Glu Arg Gly Leu Tyr Lys Ser Leu Lys Gly

210 215 220 ·· ···· · «··

109

711a Cys Lys Leu Lys Leu 225 Cys Gly Val Leu Gly Leu Arg Leu Met Asp 230 235 Gly Thr Trp With below Met Gin Thr Ser Asn Glu Thr Lys Trp Cys Pro 240 245 250 Pro asp Gin Leu With Asn Leu His asp Phe Arg Ser asp Glu Ile Glu 255 260 265 His Leu With With Glu Glu Leu With Arg Lys Arg Glu Glu Cys Leu asp 270 275 280 285 below Leu Glu Ser Ile Met Thr Thr Lys Ser With Ser Phe Arg Arg Leu 290 295 300 Ser His Leu Arg Lys Leu With Pro Gly Phe Gly Lys below Tyr Thr Ile 305 310 315 Phe Asn Lys Thr Leu Met Glu below asp below His Tyr Lys Ser With Arg 320 325 330 Thr Trp Asn Glu Ile Leu Pro Ser Lys Gly Cys Leu Arg With Gly Gly 335 340 345 Arg Cys His Pro His With Asn Gly Val Phe Phe Asn Gly Ile Ile Leu 350 355 360 365 Gly Pro asp Gly Asn With Leu Ile Pro Glu Met Gin Ser Ser Leu Leu 370 375 380 Gin Gin His Met Glu Leu Leu Glu Ser Ser With Ile Pro Leu With His 385 390 395 Pro Leu below asp Pro Ser Thr With Phe Lys Asp Gly Asp Glu below Glu 400 405 410 asp Phe With Glu With His Leu Pro asp With His Asn Gin With Ser Gly 415 420 425 With asp Leu Gly Leu Pro Asn Trp Gly Lys Tyr With Leu Leu Ser below 430 435 440 445 Gly Ala Leu Thr below Leu Met Leu Ile Ile Phe Leu Met Thr Cys Cys 450 455 460 Arg Arg With Asn Arg Ser Glu Pro Thr Gin His Asn Leu Arg Gly Thr 465 470 475 Gly Arg Glu With Ser With Thr Pro Gin Ser Gly Lys Ile Ile Ser Ser 480 485 490

Trp Glu Ser His Lys Ser Gly Gly Glu Thr Arg Leu

495,500,505

110

SEQ ID NO: 3

Length of sequence: 24 base pairs

Type of sequence: nucleic acid

The sequence type is single-stranded

Topology: linear

Type of molecule: cDNA

Description Tickets, Key: 5 'UTR (Positions 1-24)

Description of SEQ ID NO: 3:

GTCAACAGCG CACCCACTTC AAGC 24

SEQ ID NO: 4

Length of sequence: 24 base pairs

Type of sequence: nucleic acid

The sequence type is single-stranded

Topology: linear

Type of molecule: cDNA

Description Tickets, Key: 5'UTR (Positions 1-24)

Description of SEQ ID NO: 4:

GCTTGTTGAG ATGATGCTTT GACA 24

SEQ ID NO: 5

Length of sequence: 21 bp

Type of sequence: nucleic acid

The sequence type is single-stranded

Topology: linear

Type of molecule: cDNA

Description Tickets, Key: 5'UTR (Positions 1-21)

Description of SEQ ID NO: 5:

GGTCCTGTGT CTGAACCTGA G • · · · · ·

111

SEQ ID NO: 6

Length of sequence: 21 bp

Type of sequence: nucleic acid

Fiber type of sequence: single-stranded Topology: linear

Type of molecule: cDNA

Description Tickets, Key: 5 'UTR (Positions 1-21)

Description of SEQ ID NO: 6:

TTATGGCCTG GGGCGTTTAC A

SEQ ID NO: 7

Length of sequence: 41 amino acids

Type of sequence: amino acid Topology: linear

Type of molecule: protein

Tags: peptide (positions 1-41) modified site (17), Xaa = Nle modified site (25), Xaa = Nle

Description of SEQ ID NO: 7:

Gly Leu Phe Glu Alá Ile Glu Gly Phe 15

Ile Glu Asn Gly Trp Glu Gly

15

Xaa Ile Asp Gly Lys Gly Asp

Ile Xaa Gly Glu Trp Gly Asn Glu Ile

2530

Phe Gly Glu Ile Alá Glu Phe Leu Gly

Claims (53)

CLAIMS 1. A method of producing cancer vaccines containing autologous tumor cells, comprising culturing the tumor cells or fibroblasts and transforming the cultured cells ex vivo with a composition comprising the following components: (ai) a DNA molecule comprising one or more sequences capable of expression in a cell encoding one or more identical or different immunostimulatory polypeptides or multiple DNA molecules comprising sequences encoding different immunostimulatory polypeptides; aii) optionally an additional DNA molecule which is free of sequences encoding a polypeptide that is functionally active in the cell to be transformed; bi) a conjugate between a DNA binding molecule and an adenovirus containing at least one mutation in the E4 region; or bii) a conjugate in which an endosomal malicidal peptide is ionically bound to a DNA binding molecule; in that particular case c) a DNA binding molecule, preferably conjugated to an internalizing factor that binds to and internalizes to a surface molecule of cells to be transformed; wherein components (b) and (c) form a substantially electronutral complex with the DNA defined in (a), 113 that the transformed cells are inactivated by losing their ability to divide while retaining the ability to express DNA as defined in (ai), where they are mixed with untransformed and inactivated tumor cells when transfected with fibroblasts, and that the cell population is optionally a pharmaceutically acceptable adjuvant. materials. The method of claim 1, wherein the DNA as defined in (ai) is an expression plasmid comprising one or more sequences encoding a cytokine. The method of claim 2, wherein the DNA as defined in (ai) comprises the coding sequence for human interleukin-2. The method of claim 2, wherein the DNA as defined in ai) comprises the coding sequence for human IFN-γ. The method of claim 2, wherein two plasmids are introduced as DNA as defined in (i), one of which contains a sequence encoding human interleukin-2 and an IFN-γ. The method of claim 2, wherein the DNA as defined in (ai) comprises the coding sequence for human granulocyte macrophage colony stimulating factor (GM-CSF). The method of claim 1, wherein the DNA defined in (ai) is an expression plasmid comprising one or more sequences encoding a stimulating molecule. 114 The method of claim 7, wherein said DNA comprises a sequence encoding a heat stable antigen (HSA). The method of claim 1, wherein the DNA as defined in ai) is an expression plasmid comprising one or more sequences encoding a neoantigen. 10. The method of claim 9, wherein the neoantigen is a viral protein or fragment thereof. 11. The method of claim 10, wherein the viral protein is a Rabies glycoprotein. 12. A 2-11. A method according to any one of claims 1 to 3, characterized in that a plasmid which is free of sequences encoding a polypeptide that is functionally active in the transformed cell is introduced as a DNA molecule as defined in aii). 13. The process of claim 1, wherein the polylysine is preferably from about 200 to about 300 lysine monomers as the DNA binding molecule b) and optionally c). 14. The method of claim 13, wherein the polylysine contained in c) is conjugated to human transferrin as an internalizing factor. 15. The method of claim 13, wherein the polylysine contained in c) is conjugated to human EGF as an internalizing factor. 16. The method of claim 1 wherein component b) is a conjugate comprising at least an E4 defective adenovirus. 17. The method of claim 16, wherein 115 Adenovirus d11014 was introduced as the Ε4 mutant. 18. The method of claim 1, wherein the component b) is a conjugate comprising an adenovirus inactivated by β-propiolactone. 19. The process of claim 1, wherein the component b) is a conjugate wherein The peptide described in SEQ ID NO: 11 is ionically bound to polylysine. 20. The method of claim 1, wherein said transformed cells are inactivated by X-ray or gamma radiation. 21. The method of claim 1, wherein the tumor cells are melanoma cells. 22. The method of claim 1, wherein the tumor cells are colon carcinoma cells. 23. The method of claim 1, wherein the fibroblasts are transformed and inactivated. 24. The method of claim 23, wherein the fibroblasts are autologous fibroblasts. 25. The method of claim 22, wherein the fibroblasts are cells of a fibroblast cell line. 26. A 23-25. The method of any one of claims 1 to 3, wherein the transformed and inactivated fibroblasts are mixed with autologous, inactivated tumor cells. 27. The method of claim 26, wherein the tumor cells are melanoma cells. 28. The method of claim 26, wherein 116 tumor cells are colon carcinoma cells. 29. The cancer vaccine of claims 1-28. A process according to any one of claims 1 to 6. 30. A transfection complex for the preparation of cancer vaccines comprising the following components: (ai) a DNA molecule comprising one or more sequences capable of being expressed in a cell encoding one or more identical or different immunostimulatory polypeptides or multiple DNA molecules comprising sequences encoding different immunostimulatory polypeptides; aii) optionally an additional DNA molecule which is free of sequences encoding a polypeptide that is functionally active in the cell to be transformed; bi) a conjugate between a DNA binding molecule and an adenovirus containing at least one mutation in the E4 region; or bii) a conjugate in which an endosomal malicidal peptide is ionically bound to a DNA binding molecule; in that particular case c) a DNA binding molecule, preferably conjugated to an internalizing factor that binds to and internalizes to a surface molecule of the cells to be transformed; wherein components b) and c) form a substantially electronutral complex with DNA as defined in a). 31. The complex of claim 30, wherein the DNA as defined in (ai) is an expression plasmid that is one or more of the following: It contains 117 coding sequences for multiple cytokines. 32. The complex of claim 31, wherein the DNA as defined in ai) comprises the coding sequence for human interleukin-2. 33. The complex of claim 31, wherein the DNA as defined in ai) comprises the coding sequence for human IFN-γ. 34. The complex of claim 31, wherein the DNA as defined in ai) comprises the coding sequence for human GM-CSF. 35. The complex of claim 31, wherein the DNA as defined in (ai) consists of two plasmids, one of which contains a sequence encoding human interleukin-2 and an IFN-γ. 36. The complex of claim 30, wherein the DNA defined in (ai) is an expression plasmid comprising one or more sequences encoding a co-stimulatory molecule. 37. The complex of claim 36, wherein said DNA comprises a sequence encoding a heat-stable antigen (HSA). 38. The complex of claim 30, wherein the DNA defined in (ai) is an expression plasmid comprising one or more sequences encoding a neoantigen. 39. The complex of claim 38, wherein the neoantigen is a viral protein or fragment thereof. 40. The complex of claim 39, wherein: 118 the viral protein is the Rabies glycoprotein. 41. A 30-40. The complex of any one of claims 1 to 5, further comprising a plasmid free of sequences encoding a polypeptide functionally active in the transformed cell as a DNA molecule as defined in (iii). 42. A 30-41. A complex according to any one of claims 1 to 5, characterized in that the DNA contained therein is substantially free of lipopolysaccharide. 43. The complex of claim 30 wherein the b) and optionally c) DNA binding molecule preferably comprises about 200-300 lysine monomers. 44. The complex of claim 43, wherein the polylysine in c) is conjugated to human transferrin as an internalizing factor. 45. The complex of claim 43, wherein the polylysine is conjugated to human EGF as an internalizing factor. 46. The complex of claim 30 wherein component b) comprises a conjugate comprising at least an E4 region defective adenovirus. 47. The complex of claim 46, wherein the E4 mutant comprises adenovirus dll014. 48. The complex of claim 30, wherein component b) comprises a conjugate comprising a β-propiolactone inactivated adenovirus. 49. The complex of claim 30, wherein 119 b) as component, a conjugate in which the peptide described in SEQ ID NO: 7 is ionically bound to polylysine. 50. Human tumor cells as described in any one of claims 30-49. A complex as defined in any one of claims 1 to 6. 51. Human fibroblasts as defined in any one of claims 30-49. A complex as defined in any one of claims 1 to 6. 52. The fibroblasts of claim 51 in admixture with human tumor cells. 53. A pharmaceutical composition comprising cells according to claim 50 or 52 and pharmaceutically acceptable nutritional excipients.