GB2379220A

GB2379220A - Antibodies to HPV E2 protein

Info

Publication number: GB2379220A
Application number: GB0119682A
Authority: GB
Inventors: Norman Maitland; Mark Stevenson
Original assignee: University of York
Current assignee: University of York
Priority date: 2001-08-13
Filing date: 2001-08-13
Publication date: 2003-03-05
Also published as: GB0119682D0

Abstract

An assay for the early detection of papillomavirus infection; antibodies capable of binding the papillomavirus E2 polypeptide; antigenic epitopes which bind said antibodies; hybridoma cell lines producing monoclonal antibodies to said E2 polypeptide; and nucleic acid probes capable of detecting nucleic acid encoding the E2 polypeptide.

Description

CERVICAL CANCER SCREEN The invention relates to an assay for the early detection of papillomavirus infection; antibodies capable of binding the papillomavirus E2 polypeptide; antigenic epitopes which bind said antibodies; hybridoma cell lines producing monoclonal antibodies to said E2 polypeptide; and nucleic acid probes capable of detecting nucleic acid encoding the E2 polypeptide.

Papillomaviruses cause benign and malignant tumours in the skin and mucosa. Certain types of papillomaviruses (human papillomaviruses (HPVs) ) are associated with human cancers which include by example and not by way of limitation, respiratory papillomas, skin cancers in patients with epidermodysplasia veuciformis, and anogenital carcinomas, specifically cervical cancers. Cancer of the cervix is reported to be the most common cancer in developing countries and the second most common in women worldwide. Papillomaviruses are associated with greater than 90% of all cases of cervical cancers.

Papillomaviruses are small, non-enveloped, icosahedral DNA viruses that replicate in the nucleus of squamous epithelial cells. Papillomaviruses consist of a single molecule of double stranded circular DNA approximately 8. 0kb in size.

Papillomaviruses are classified by the species they infect and by the type within species. There are over 80 distinct human papillomaviruses many of which have been sequenced. There is a high degree of sequence divergence between papillomaviruses, however, all papillomaviruses share some common features of genome organisation. For example, the genome is sub-divided into an early region containing proteins E1-E8, a late region, containing genes LI and L2, and a so called long control region (LCR) of transcription which include the promoter and enhancer for viral early genes and the origin of replication. The early region encodes genes required for DNA replication, cellular proliferation and cellular transformation. The

El and E2 genes encode El and E2 polypeptides that bind to the LCR and induce replication from the origin of replication.

As noted above there are over 80 HPV viruses known of which over 20 are able to infect the male or female anogenital tract. While most HPV-associated lesions will remain benign or will regress spontaneously, approximately 15% of all cervical HPV- positive cases will progress to high-grade cervical intraepithelial neoplasia (CIN) (Fowler, 1993; Disaia & Creasman, 1989) and cancers. These almost invariably contain DNA of high-risk HPV types, eg HPV-16 (Zur Hausen, 1994; Richart et al, 1998) in more than 80% of cases in the UK.

HPV infection occurs in the basal epithelial cells (Graham & Herrington, 1998).

Viral genomes are maintained at low copy numbers as extrachromosomai episomes in the undifferentiated basal stem cells and in higher copy numbers in the more differentiated superficial cells. Since detection limits are normally higher than 20 HPV genome copies per cell, positive in situ hybridisation (ISH) is often an indicator of HPV genome replication and is most frequently associated with koilocytes within CIN I and II legions (Schneider et al, 1987; Resnick et al, 1996; Ziol et al, 1998).

The HPV E2 transcription factor plays a critical role in both the activation and repression of virus transcription (Bouvard et al, 1994) and viral DNA replication (Chow & Broker, 1994). It consists of a C-terminal DNA binding/dimerisation domain, linked by a flexible hinge region to an N-terminal transactivation domain (Hann et al, 1991 ; Sanders et al, 1995).

In any diagnostic assay it is desirable to detect the presence of an infective agent at as early a stage as feasibly possible. The early detection of an infectious agent will then allow a quick diagnosis and remedial action before the infection is able to establish and cause disease.

We have carried out HPV detection on cervical tissue and on cervical smears which have been characterised histologically. The smears are classified as normal, various grades of CIN or invasive squamous cell carcinoma. The biopsies were examined by using an antibody to the HPV-16 E2 polypeptide; HPV -16 DNA in situ hybridisation; and microdissection/PCR of the E2 open reading frame. The biopsy data indicates that E2 protein expression is highest in koilocytes in low-grade CIN1, but decreases with increasing grade, whereas the detection of HPV DNA is delayed until CIN I/II rising to the highest levels in carcinoma cells. Our assay indicates that one of the earliest events in HPV infection is the expression of the E2 polypeptide and is therefore a target for the early diagnosis of HPV infection.

We therefore provide an assay which allows the early detection or determination of HPV infection, particularly but not exclusively HPV 16.

According to an aspect of the invention there is provided an assay for the determination of a papillomavirus infection in an animal comprising: (i) contacting a cell sample with an antibody, or an antibody fragment, capable of binding an E2 polypeptide; and (ii) detecting for the presence of an E2 polypeptide by the antibody.

In a preferred method of the invention the papillomavirus is a human papillomavirus.

Human papillomaviruses vary in their pathological effects. For example, in humans so called low risk HPVs such as HPV-6 and HPV-11 cause benign hyperplasias such as genital warts, (also referred to as condyloma acuminata) while high risk HPVs, for example, HPV-16, HPV-18, HPV-31, HPV-33, HPV-52, HPV-54 and HPV-56, can cause cancers such as cervical or penile carcinoma. HPV-1 causes verruca vulgaris.

HPV-5 and HPV-8 cause malignant squamous cell carcinomas of the skin. HPV-2 is found in malignant and non malignant lesions in cutaneous (skin) and squamous (oral) epithelium.

In a further preferred method of the invention the HPV is selected from the following: HPV-2; HPV-6; HPV-ll ; HPV-16, HPV-18, HPV-31, HPV-33, HPV-52, HPV-54; HPV-56; HPV-5 and HPV-8. More preferably still the HPV is HPV-16.

In a further preferred method of the invention said cell sample comprises cells selected from the following: koilocytes; keratinocytes; stem cells; cervical epithelial cells. More preferably still said cell sample comprises koilocytes. Ideally said method detects the presence of the E2 polypeptide in koilocytes, or cells which differentiate into koilocytes.

Koilocytes are present in the upper (supra basal) layers of the cervix. During an HPV infection the cervical epithelium undergoes a number of morphological changes

including keratinisation, muitinucleation and koilocytic atypia. Koilocytic atypia Is characterised by perinuclear cytoplasmic vacuolation, nuclear enlargement, hyperchromasia.

In a further preferred method of the invention said antibody is a monoclonal antibody. Preferably the monoclonal antibody is capable of binding to the amino terminal region (amino acids 1-198) of the E2 polypeptide. Alternatively the monoclonal antibody is capable of binding to the carboxy-terminal region of the E2 polypeptide (amino acids 280-365).

According to a further aspect of the invention there is provided an immunogenic composition comprising an immunogenic polypeptide selected from the group consisting of E2 polypeptides and immunogenic fragments thereof. Ideally the composition further comprises a carrier and/or adjuvant.

In a preferred embodiment of the invention said polypeptide is an oligopeptide of 8- 30 amino acid residues. Preferably the oligopeptide is 9-18 amino acid residues.

More preferably still said oligopeptide is 9 or 10 amino acid residues. It is well known in the art that peptide antigens presented by major histocompatibility complex

(MHC/HLA) molecules on antigen presenting cells are 9 or 10 amino acid residues in length. Typically, these are referred to as nonapeptides or decapeptides respectively.

The terms adjuvant and carrier are construed in the following manner. Some polypeptide or peptide antigens contain B-cell epitopes but no T cell epitopes. Immune responses can be greatly enhanced by the inclusion of a T cell epitope in the polypeptide/peptide or by the conjugation of the polypeptide/peptide to an immunogenic carrier protein such as key hole limpet haemocyanin or tetanus toxoid which contain multiple T cell epitopes. The conjugate is taken up by antigen presenting cells, processed and presented by human leukocyte antigens (HLA's) class II molecules. This allows T cell help to be given by T cells specific for carrier derived epitopes to the B cell which is specific for the original antigenic polypeptide/peptide.

This can lead to increase in antibody production, secretion and isotype switching.

An adjuvant is a substance or procedure which augments specific immune responses to antigens by modulating the activity of immune cells. Examples of adjuvants include, by example only, agonsitic antibodies to co-stimulatory molecules, Freund's adjuvant, muramyl dipeptides, liposomes.

An adjuvant is therefore an immunomodulator. A carrier is an immunogenic molecule which, when bound to a second molecule augments immune responses to the latter.

According to a further aspect of the invention there is provided an antibody, or active binding part thereof (Fab fragment) capable of binding the polypeptide sequence presented in Figure 1. Preferably the antibody is a monoclonal antibody or Fab fragment thereof.

Antibody fragments smaller than Fab fragments which bind the E2 polypeptide are also within the scope of the invention. For example, single chain Fv molecules (scFv). These are engineered antibody fragments composed of a variable region of

the heavy chain and a variable region of the light chain which are coupled via a linker sequence, see Adams and Schier (1999) Journal of Immunological Methods 249-260 which is incorporated by reference.

According to a further aspect of the invention there is provided a vector comprising the nucleic acid molecule as represented in Figure 2, or part thereof.

In a preferred embodiment of the invention the vector is an expression vector adapted for recombinant expression of the E2 polypeptide, or part thereof.

Typically said adaptation includes, the provision of transcription control sequences (promoter sequences) which mediate cell/tissue specific expression. These promoter sequences may be cell/tissue specific, inducible or constitutive.

Promoter is an art recognised term and, for the sake of clarity, includes the following features which are provided by example only, and not by way of limitation. Enhancer elements are cis acting nucleic acid sequences often found 5'to the transcription initiation site of a gene (enhancers can also be found 3'to a gene sequence or even located in intronic sequences and is therefore position independent). Enhancers function to increase the rate of transcription of the gene to which the enhancer is linked. Enhancer activity is responsive to trans acting transcription factors (polypeptides) which have been shown to bind specifically to enhancer elements. The binding/activity of transcription factors (please see Eukaryotic Transcription Factors, by David S Latchman, Academic Press Ltd, San Diego) is responsive to a number of environmental cues which include, by example and not by way of limitation, intermediary metabolites (eg glucose, lipids), environmental effectors (eg light, heat,).

Promoter elements also include so called TATA box and RNA polymerase initiation selection (RIS) sequences which function to select a site of transcription initiation.

These sequences also bind polypeptides which function, inter alia, to facilitate transcription initiation selection by RNA polymerase.

Adaptations also include the provision of selectable markers and autonomous replication sequences which both facilitate the maintenance of said vector in either the eukaryotic cell or prokaryotic host. Vectors which are maintained autonomously are referred to as episomal vectors.

Adaptations which facilitate the expression of vector encoded genes include the provision of transcription termination/polyadenylation sequences. This also includes the provision of internal ribosome entry sites (IRES) which function to maximise expression of vector encoded genes arranged in bicistronic or multi-cistronic expression cassettes.

Prokaryotic expression systems are well known in the art and comprise vectors adapted for high level constitutive and inducible expression. Inducible expression systems are particularly advantageous if the recombinant polypeptide is toxic to the bacterial cell. Induction of expression is tightly regulated by promoters responsive to various inducers (eg IPTG inducible). Bacterial cells can be grown to stationary phase before induction thereby reducing harmful effects of toxic polypeptides.

Vectors used for transformation of prokaryotic cells are well known in the art and include plasmids, phagemids and phages. Examples of these vectors can be found in Sambrook et al (1989) Molecular Cloning: A Laboratory Manual, Cold Spring Harbour Laboratory, Cold Spring Harbour, NY and references therein and Spertini et al BioTechniques 27: 328-334, (1999).

Additionally it is also well known in the art that certain polypeptides are difficult to manufacture recombinantly due, for example, to protein instability or problems of aggregation. It is well known that genetically modified bacterial strains are available

which are mutated in genes (eg bacterial proteases) which facilitate the production of native and recombinant bacterial polypeptides.

These adaptations are well known in the art. There is a significant amount of published literature with respect to expression vector construction and recombinant DNA techniques in general. Please see, Sambrook et al (1989) Molecular Cloning: A Laboratory Manual, Cold Spring Harbour Laboratory, Cold Spring Harbour, NY and references therein; Marston, F (1987) DNA Cloning Techniques: A Practical Approach Vol III IRL Press, Oxford UK; DNA Cloning: F M Ausubel et al, Current Protocols in Molecular Biology, John Wiley & Sons, Inc. (1994).

According to a yet further aspect of the invention there is provided an immunogenic composition comprising a cell transformed or transfected with nucleic acid encoding an immunogenic polypeptide selected from the group consisting of E2 polypeptides and immunogenic fragments thereof.

In a preferred embodiment of the invention said cell is transformed with an expression vector adapted for recombinant expression of an E2 polypeptide.

According to a further aspect of the invention there is provided a method to identify an E2 epitope comprising : i) preparing fragments of nucleic acid encoding parts of the E2 polypeptide; ii) subcloning the fragments into a vector according to the invention; iii) transfecting or transforming the vector including E2 nucleic acid into a cell; iv) growing and selecting cells including said vector; and v) contacting cells expressing E2 polypeptide fragments with antisera directed to an E2 polypeptide or part thereof.

The above aspect is generally termed epitope mapping, see Spertini et al BioTechniques 27: 328-334, (1999). It will be apparent that alternative methods to

generate fragments of E2 polypeptides for use in generating antibodies or for the purpose of epitope mapping are known in the art. These include the use of Sl nuclease or exonuclease III to generate nested deletions and/or polymerase chain reaction to produce truncated and mutated proteins.

According to a further aspect of the invention there is provided a hybridoma cell-line characterised in that said cell-line produces monoclonal antibodies capable of binding the papillomavirus E2 polypeptide.

According to yet a further aspect of the invention there is provided a method for the production of monoclonal antibodies capable of binding papillomavirus E2 polypeptide comprising: (i) providing a hybridoma cell-line according to the invention; (ii) providing conditions conducive to the production of monoclonal antibodies according to the invention; and optionally (iii) purifying said monoclonal antibody from said cells or their growth medium.

According to yet a further aspect of the invention there is provided a method to produce antibodies capable of binding the papillomavirus E2 polypeptide; comprising : (i) immunising an animal with at least part of a polypeptide sequence presented in Fig 1 ; (ii) testing said animal for the production of antibodies direct to the E2 polypeptide; and optionally (iii) providing at least one further immunisation of said animal with said polypeptide; and (iv) isolating from said animal serum comprising antibodies directed to said polypeptide.

In a preferred method of the invention said immunisation is by intradermal; intramuscular; intraperitoneal, or foot pad administration of the polypeptide.

In a further preferred method of the invention said animal is selected from: mouse; rabbit; rat; sheep; goat; pig; guinea pig.

In a preferred method of the invention said method is used for the isolation of cells producing monoclonal antibodies. Preferably said cells are used in the production of the hybridoma cell-line according to the invention, (for example antibody producing spleen cells, lymph node antibody producing cells).

According to a further aspect of the invention there is provided an assay to detect the presence of nucleic acid encoding the papillomavirus E2 polypeptide comprising : (i) contacting a cell sample with at least one nucleic acid probe capable of hybridising to said nucleic acid; and (ii) detecting for the presence of the nucleic acid by using the nucleic acid probe.

In a preferred method of the invention said nucleic acid probe is at least one oligonucleotide. More preferably still said assay is a polymerase chain reaction.

More preferably still the oligonucleotide probes are selected from the following sequences: 5'GAGGACGAGGACAAGGAA 3' ; 5'GTCACGTAGGTCTGTTACTATC 3' ; 5'AATACAATGCATTATACAAACT 3' ; 5'GTGCTGCCTAATAATTTCAGGAGAG 3' ; 5'TATTATGTCCTACATCTGTGTT 3' ; 5'AGTGTTACTATTACAGTTAATCCGTCC3' 5'CAGAGACTCAGTGGACAGTG 3' 5'CCAATGCCATGTAGACG3'

In a preferred embodiment of the assay of the invention the cell-sample is a cervical smear.

An embodiment of the invention will now be described by example only and with reference to the following figures and table: Figure I represents the protein sequence of HPV 16 E2; Figure 2 represents the nucleic acid sequence which encodes the HPV16 E2 polypeptide; Figure 3 represents HPV16 DNA characterisation using in situ hybridisation (ISH) in cervical biopsies; Figure 4 represents detection of HPV16 E2 using immunocytochemistry; Figure 5a represents detection of HPV16 E2 DNA in cervical biopsies: location of primers for polymerase chain reaction in the E2 open reading frame; Figure 5b represents detection of HPV16 E2 DNA in cervical biopsies: detection frequency in a series of microdissected human cervical tissue biopsies; Figure 6 is a graphical representation of HPV16 E2 in cervical biopsies of varying degrees of severity; Figure 7 a summary of 138 cervical smear tests; and Table I represents a summary of HPV-16 detection by in situ hybridisation, immunohistochemistry and PCR analysis.

Materials and Methods Preparation of Cervical Smears Each cytology was prepared by applying cellular material from a sampling spatula to an 3-aminopropyltriethoxysilane (APES) coated slide. This was performed following the preparation of the cytology destined for routine screening.

Each preparation was fixed in 10% formalin, dried and stored at RT for immunocytochemical analysis. The cytology slides were re-hydrated in Ix Tris Buffered Saline (TBS) for 10 min, incubated in 0.5% (v/v) Triton, lxTBS at room temperature for 15 min and then washed in 1 xTBS for 10 min. Each slide was then

incubated in 0. 01% pepsin (in 0. 01M HCI) at 37 C for 10 min, before being washed 3x in lxTBS for 5 min each.

The cytological preparations were then incubated in 10% Boehringer blocking agent at room temperature for 30 min. 400ml of primary antibody (anti-E2) diluted 1: 80 with 1% Boehringer blocking agent was added to the slides and a coverslip applied prior to incubation overnight at room temperature.

The next day the slides were washed with IxTBS at RT for 1 hour changing the TBS every 5-10 min.

Each cytological preparation was then incubated in 1 % Boehringer blocking agent at room temperature for 30 min. 400ml of secondary antibody (568Alexa goat antirabbit) diluted 1: 300 with 1% Boehringer blocking agent was added to the slides and a coverslip applied. The cytologies were then incubated at RT for 30 min.

Each slide was washed 3x with lxTBS for 5 min each before being rinsed with distilled water. The preparations were then air dried and mounted with a minimal volume of Vectashield (Vector Laboratories Ltd).

Example 1 To determine the relationship between the expression patterns of HPV 16 E2 and the centres of HPV DNA replication as revealed by ISH, a panel of forty three formalin fixed, paraffin embedded cervical biopsy specimens were obtained with relevant pathological diagnosis. Twenty five biopsies were chosen for the diagnosis of cervical intraepithelial neoplasia grade I, II or III and eight for invasive squamous cell carcinoma (SCC). The remaining ten specimens were histologically normal.

Several individual 5 urn sections were cut from each formalin-fixed block and mounted on 3-aminopropyltriethoxysilane (APES) coated slides. Sections of human tonsil were cut for use as a negative control.

HPV16 DNA characterisation was performed by ISH using a FITC labelled HPV16 probe (BioGenex) as described by the manufacturers. Typical results are shown in Figure 3 and are summarised in Table 1. Following ISH a strong signal covering the entire nucleus was observed in nine sections (all high grade CIN and SCC) with a further nine sections having weaker punctate nuclear staining. The remaining twenty five sections, including the ten normal cervical samples, were unstained. In CIN, the strongest staining was observed in the koilocytes (see Figure 3c. ) which are morphologically characteristic of HPV infection, and indicate sites of viral DNA replication in the superficial layers of the epithelium. Invasive SCC exhibited homogeneous nuclear staining in foci of infected cells throughout the sections. No evidence of HPV16 DNA was detected in the tonsil sections (data not shown). Overall the ISH signal intensity increased from punctate nuclear staining in the parabasal and intermediate layers (see Figure 3g inset) to homogeneous strong nuclear staining in the superficial layers, confirming an increase in viral copy number as has been reported previously (Schneider et al, 1987; Resnick et al, 1996; Ziol et al, 1998).

Example 2 Serial sections to those used above were incubated with a polyclonal anti-E2 antiserum, with reactivity against the entire E2 molecule, prepared as described by Sanders et al (1995). The antiserum detected a single species in western blotting and labelled insect cells infected with E2 expressing recombinant baculoviruses (data not shown). Immunohistochemistry (IHC) was performed using the streptavidin-biotin- peroxidase complex technique as described by Maitland et al (1998). Following IHC with the polyclonal anti-E2 antiserum (see Figure 4), high levels of E2 protein expression were detected in seven sections, whilst low level expression was detected in six sections (see Table 1). Unlike the observations following ISH, the strongest immunoreactivity was generally observed in areas of CIN grades I and II with weaker immunoreactivity in CIN grade III. No immunoreactivity was observed in areas of invasive carcinoma, although two invasive sections (samples 41 and 45) had associated areas of lower grade CIN which were immunoreactive. In the CIN lesions expression was confined to the superficial layers of the epithelium and specifically to the koilocytic nuclei with little immunoreactivity of the intermediate or basal layers.

E2 expression was localised to both nuclear and cytoplasmic regions of superficial cells, in contrast to our previous results with the antisera against the C terminus of E2, where the immunoreactivity was predominantly nuclear (Maitland et al, 1998).

Example 3 PCR analysis on microdissected areas was carried out as described by Macintosh et al (1998) using overlapping HPV16 E2-specific primers (see Figure 5A. ), to indicate the status of the E2 ORF in the same areas of cervical epithelium which had previously been screened by ISH and IHC. Of the forty three samples, thirty eight gave a PCR product of the expected size (267bp) with a cellular gene control hypoxanthine phosphoribosyl transferase (HPRT). The latter thirty eight samples were then analysed using four primer pairs covering the E2 ORF (see Figure 5B and Table 1.). DNA extracted from CaSki cells (which have 500-600 copies of the HPV

16 genomes, shown in figure 5) or SiHa (1 copy ofHPV16, not shown) were used as positive controls. Primer sensitivity varied only 2-fold between the primers detecting the N and C-termini of the E2 ORF, when assayed on both Caski DNA and SiHa DNA. The sensitivity was equivalent to less than one copy/cell of HPV16 DNA without further enhancement, and was reproducible.

The PCR data is summarised in Table l, and indicates a good correlation between the presence of HPV DNA (by both PCR and ISH) and positive E2 staining using the polyclonal antibody. Significantly, all ten normal cervical samples failed to generate a PCR product with any of the E2 primer pairs, and of four samples exhibiting CIN I, only one produced positive results with all four E2 specific primer pairs. This was taken as confirmation that the E2 ORF was intact in this lesion. With increasing CIN grade, the situation became more complex, even after microdissection. Lack of detection of internal E2 fragments was taken as evidence of E2 ORF rearrangement or deletion in 2/7 CINII and 1/10 CINIII tissues. However, of the eight DNA samples extracted from areas of invasive SCC four were positive with all of the E2 primers, and a further 3 with the C-terminal primers only.

Example 4 The combined IHC, ISH and PCR results can be summarised as follows. HPV 16 was undetectable in 9/10 (90%) of the normal biopsies, whereas 25/33 (76%) CIN/cancer samples were positive for HPV16 detection by at least one detection method. All ten (100%) normal samples were negative for viral HPV 16 DNA detection by both PCR and ISH.

There was good agreement between the PCR-determined status of the E2 gene and the detection of viral DNA by ISH. A positive result was generated from both assays in 15/33 (45%) CIN/cancer samples examined. A further 3 (9%) CIN II samples (23, 27,29) were positive with at least one E2 primer pair following PCR but produced no ISH signals. Presumably here the viral copy number in these lesions has fallen

below the level of detection of the ISH method. The converse (ISH positive but PCR negative) in only 2 (6%) samples (14,31). However when these two samples were immunostained, E2 expression was observed.

Three samples (8,18, 41) in which E2 protein was detected by IHC, failed to generate E2 PCR products and revealed no hybridisation signals following ISH. The positive immunoreactivity may be due to the cross-reaction of the antisera with E2 proteins of other high risk HPVs, since the anti-HPV16 E2 antisera does not cross react with low risk HPV E2.

When the trend in detection with increasing severity of the lesions is plotted as shown in figure 6, the frequency of HPV DNA detection rises in the koilocytic cells while the frequency of E2 protein detection declines, although the E2 ORF is still present. Thus, despite the higher frequency of HPV 16 DNA detection due to the amplification of HPV genomes with increased severity of lesion, E2 protein expression is apparently downregulated in CIN grade III and carcinoma in situ.

Detectable ISH and IHC signal was coincident in only 7/33 (21 %) abnormal biopsies (all koilocytes in CIN) and was not found in either normal or SCC tissues. The differentiation state in SCC may therefore be incompatible with E2 expression, since in experimental systems transfection of the HPV 16 E2 ORF has been shown to induce apoptosis in both HPV-transformed and non-transformed cell lines either via either a p53 dependent (Webster et al, 2000) or independent (Desaintes et al, 1999) pathway. Thus it is possible that squamous epithelial cells which express high levels of E2 in early CIN lesions may subsequently undergo apoptosis. Significantly, overexpression of E2 has not been detected in human tissue cultures by immunohistochemistry although the biological activity can be detected by gel shift analysis of E2 binding site DNA, and by transactivation assays. The reduction in E2 expression with increasing grade of CIN is supported by the change in anti-E2 IgA from high levels in low grade CIN, to low or undetectable levels in high grade CIN (Rocha-Zavaleta, 1997), and in our own previous results with a separate antiserum against the HPV16 E2 C terminus (Maitland et al, 1998).

Previous attempts to relate HPV DNA replication to patterns of HPV E2 gene expression have been restricted by the poor sensitivity of antibodies to E2 and the difficulties posed by overlapping reading frames and complex HPV transcription patterns (for E2 and E4) in the design of probes for RNA detection (Higgins et al, 1991).

It remains unclear why some cervical lesions clear, persist, or progress from a productive infection to a neoplastic process. Progression from low grade to high grade neoplasia is often accompanied by integration of the virus genome into the host chromosome, disrupting or deleting the E2 open reading frame (Schwarz and Freese, 1985; Yee et al, 1985, Krajinovic et al, 1993; Kalantari et al, 1998) with inactivation of the E2 regulatory protein. However, many tumours have also been reported to contain multiple copies of circular, episomal non-disrupted viral genomes (Matsukara, 1989). Our PCR analysis confirms the existence of intact E2 ORF in seven pre-invasive and four invasive lesions (all in ISH positive cells). While the ISH signals could be the result of tandem copies of HPV integrated within the chromosome (as in Caski cells), the diffuse pattern of the positive signal in most cases (e. g. figure 3 panel e), but not all (figure 3 panel g) and the change from a punctate to a pan-nuclear signal towards the more differentiated superficial layers of epithelium is more indicative of pan-nuclear episomal replicating HPV copies.

The results have important implications for HPV testing in the context of a cervical screening programme. We have shown that detectable E2 protein levels are indicative of the presence of a high risk HPV infection, certainly in advance of our ability to detect multiple copies of HPV DNA in CIN lesions. This could therefore provide an earlier marker of at risk patients and potential neoplastic progression in HPV infected cells.

Example 5 138 satisfactory cytological preparations from cervical smear tests for routine cytology were fully analysed by anti-HPV 16 E2 staining and cytopathological screening. 83 (60. 1 %) of cytologies were classified as normal and were all negative following HPV16 E2 immunostaining. 20 (14.5%) of normal smears were E2 immunoreactive, but 5 (3.6%) had only a single reactive cell.

Nine (6.5%) cytologies were classified as normal, but had a history of HPV/abnormality and were E2 positive (although 2 had only a single reactive cell).

20 (10 borderline and 10 dyskaryotic) smears were E2 immunostaining negative.

Significantly, 6 (4.3%) cytologies classified as abnormal (all borderline) were HPV16 E2 immunoreactive. However, all 10 cytologies classified as mildly or moderately dyskaryotic were negative for E2 expression, in agreement with the downregulation of E2 during cervical cancer progression. These smears were clearly abnormal, and would be picked up by routine visual examination. Thus the biological window in which E2 expression offers an added value to cervical smear testing appears to be the borderline cases, where, of 16 in this study, the presence of the high risk HPV 16 was

identified by E2 staining in 6, justifying further investigation. The potentially false positives (normal smears that are HPV16 -positive at 14. 5%) is very much in agreement with HPV DNA detection data as is the overall HPV16 positivity for a randomly screened population of young females (24.5%). A summary of the screen is provided in Figure 7.

Table 1. Summary of HPV-16 detection by ISH, IHC and PCR analysis Observations are scored as: +, strong positive; ~. weak positive ;-, negative; ND, not detennined.

Abbreviations : Norm, normal tissue sample; Inv, invasive carcinoma; term. ; terminus.

PCR ' E2 hinge N E2 hinge C Sample Grade ISH IHC HPRT E2 N term. term. term. E2 C term.

1 Norm--±--- 2 Norm--±--- 3 Norm--±--- 4 Norm--±--- 5 Norm--±--- 6 Norm--±--- 7 Norm--±--- 8 Norm - ~ + - - - - 9 Norm--±--- 10 Norm--±--- 12 CINI---ND ND ND ND 13 CINI + + + + + + 14 CIN I : + - - - - 15 CINI-±ND ND ND NO 17 CINI---ND ND ND ND 18 CIN I-+ + 19 ONI--±--- 22 CINII + + + + + + + 23 CIN II - ~ + + - - - ~ 24 CIN II - - + - - - - 25 CINII + + + ±+ + 27 Ces ±--+ 28 CINII-±ND ND ND ND 29 CIN II - - + + + + + 30 CIN II - - + - - - - 31 CIN II ~ ~ + - - - - 32 CIN III + - + + + + + 33 CIN II ~ - + + - - ~ 34 CINIII--±--- 35 CIN III - - + - - - - 36 CIN III - - + - - - - 37 CIN III ~ + + + + + + 38 CINIII ±+ + + + + 39 CINIII --ND ND ND NO 40 CINIII ±+ + + + + 41 Lnv - +* + - - - - 42 Inv ±+ + + + + 43 Inv ±+ + + + + 44 Inv ±+ + + + + 45 Inv + +* ±--+ 46 Inv + - + ~ ~ ~ + 47 Inv ±±--+ 48 Inv + - + - - - ~

Claims

CLAIMS I. An assay for the determination of papillomavirus infection in an animal comprising : i) contacting a cell sample with an antibody, or fragment thereof, capable of binding the E2 polypeptide; and ii) detecting for the presence of the E2 polypeptide by using the antibody.
2. An assay according to Claim I wherein the papillomavirus is a human papillomavirus.
3. An assay according to Claim I or 2 wherein the human papillomavirus is selected from the following : HPV-2 ; HPV-6 ; HPV-11 ; HPV-16, HPV-18, HPV-31, HPV-33, HPV-52, HPV-54; HPV-56; HPV-5; HPV-8;.
4. An assay according to Claim 3 wherein the human papillomavirus is HPV-16.
5. An assay according to any of Claims 1-4 wherein the cell sample comprises cells selected from the following : koilocytes ; keratinocytes; stem cells; cervical epithelial cells.
6. An assay according to Claim 5 wherein the cell sample comprises koilocytes.
7 An assay according to Claim 5 or 6 wherein the assay detects the presence of the E2 polypeptide in koilocytes.
8 An assay according to any of Claims 1-7 wherein the antibody is a monoclonal antibody.
9 An assay according to Claim 8 wherein the monoclonal antibody is capable of binding to the amino terminal region of the E2 polypeptide.

<Desc/Clms Page number 21>
10. An assay according to Claim 8 wherein the monoclonal antibody is capable of binding to the carboxyl terminal region of the E2 polypeptide.
11. An immunogenic composition comprising a papillomavirus E2 polypeptide or part thereof.
12. An immunogenic composition according to Claim 11 wherein the composition further comprises a carrier and/or adjuvant.
13. An immunogenic composition according to Claim 11 or 12 wherein the polypeptide is an oligopeptide of 8-30 amino acid residues in length.
14. An immunogenic composition according to Claim 13 wherein the oligopeptide is 9-18 amino acid residues in length.
15 An immunogenic composition according to Claim 14 wherein the oligopeptide is 9 or 10 amino acid residues in length.
16. An immunogenic composition comprising a cell transformed or transfected with the nucleic acid encoding a papillomavirus E2 polypeptide.
17 An immunogenic composition according to Claim 16 wherein the cell is transformed/transfected with an expression vector adapted for recombinant expression of a papillomavirus E2 polypeptide.
18. An antibody, or active binding part thereof (Fab fragment) capable of binding the polypeptide sequence presented in Figure 4.
19. An antibody according to Claim 18 wherein the antibody is a monoclonal antibody or Fab fragment thereof.

<Desc/Clms Page number 22>
20. An antibody fragment according to Claim 18 or 19 wherein the fragment is a single chain Fv molecule.
21. A hybridoma cell-line characterised in that said cell-line produces monoclonal antibodies capable of binding the papillomavirus E2 polypeptide.
22. A method for the production of monoclonal antibodies capable of binding papillomavirus E2 polypeptide comprising: i) providing a hybridoma cell-line according to Claim 21; ii) providing conditions conducive to the production of monoclonal antibodies according to claim 19; and optionally iii) purifying said monoclonal antibody from said cells or their growth medium.
23. A method to produce antibodies capable of binding the papillomavirus E2 polypeptide comprising: i) immunising an animal with at least part of the polypeptide sequence presented in Fig 1 ; ii) testing said animal for the production of antibodies direct to a papillomavirus E2 polypeptide; and optionally iii) providing at least one further immunisation of said animal with said polypeptide; and iv) isolating from said animal serum comprising antibodies directed to said polypeptide.
24. A method according to Claim 22 or 23 wherein the immunisation is by intradermal; intramuscular; intraperitoneal, or foot pad administration of a papillomavirus E2 polypeptide or part thereof.

<Desc/Clms Page number 23>
25. A method according to any of Claims 22-24 wherein the animal is selected from: mouse; rabbit; rat; sheep; goat; pig; guinea pig.
26. A method according to Claim 22 wherein the method is used for the isolation of cells producing monoclonal antibodies.
27. A method according to Claim 26 wherein the cells are used for the production of the hybridoma cell-line according to Claim 21.
28. An assay to detect the presence of nucleic acid encoding the papillomavirus E2 polypeptide comprising: i) providing a cell sample to be assayed; ii) providing suitable conditions for the detection of the nucleic acid encoding the E2 polypeptide; iii) contacting the cell sample with at least one nucleic acid probe capable of hybridising to said nucleic acid; and iv) detecting the presence of the nucleic acid by the nucleic acid probe.
29. An assay accoridng to Claim 26 wherein the assay comprises a polymerase chain reaction.
30. An assay according to Claim 27 wherein the assay uses oligonucleotide probes selected from the following sequences: 5'GAGGACGAGGACAAGGAA3' ; 5'GTCACGTAGGTCTGTTACTATC 3' ; 5'AATACAATGCATTATACAAACT 3' ; 5'GTGCTGCCTAATAATTTCAGGAGAG 3' ; 5'TATTATGTCCTACATCTGTGTT 3' ; 5'AGTGTTACTATTACAGTTAATCCGTCC3' 5'CAGAGACTCAGTGGACAGTG3' 5'CCAATGCCATGTAGACG3'

<Desc/Clms Page number 24>
31. An assay according to any of Claims 1-10 or any of Claims 28-30 wherein the cell-sample is a cervical smear.

32. A method to identify an E2 epitope comprising: i) preparing fragments of nucleic acid encoding parts of an E2 polypeptide; ii) subcloning the fragments into a vector; iii) transfecting or transforming the vector, including E2 nucleic acid into a cell; iv) growing cells including said vector; and v) contacting cells expressing E2 polypeptide fragments with antisera or antibodies directed to an E2 polypeptide, or part thereof.
32. A method to identify an E2 epitope comprising: i) transfecting or transforming a vector mcluding fragments of nucleic acid encoding parts of an E2 polypeptide into a cell; ii) growing cells including said vector; and iii) contacting cells expressing E2 polypeptide fragments with antisera or antibodies directed to an E2 polypeptide, or part thereof.

32. A method to identify an E2 epitope comprising : i) transfecting or transforming a vector including fragments of nucleic acid encoding parts of an E2 polypeptide into a cell; ii) growing cells including said vector; and iii) contacting cells expressing E2 polypeptide fragments with antisera or antibodies directed to an E2 polypeptide, or part thereof.

<Desc/Clms Page number 25>

Amended claims have been filed as follows CLAIMS 1. An assay for the determination of papillomavirus infection in an animal comprising: i) contacting a cell sample wherein said sample is a cervical smear with an antibody, or fragment thereof, capable of binding the E2 polypeptide; and ii) detecting for the presence of the E2 polypeptide by using the antibody.

2. An assay according to Claim 1 wherein the papillomavirus is a human papillomavirus.

3. An assay according to Claim I or 2 wherein the human papillomavirus is selected from the following: HPV-2; HPV-6; HPV-11 ; HPV-16, HPV-18, HPV-31, HPV-33,

HPV-52, HPV-54 ; HPV-56 ; HPV-5 ; HPV-8 ;.

4. An assay according to Claim 3 wherein the human papillomavirus is HPV-16. 5. An assay according to any of Claims 1-4 wherein the cell sample comprises cells selected from the following: koilocytes; keratinocytes; stem cells; cervical epithelial cells.

6. An assay according to Claim 5 wherein the cell sample comprises koilocytes.

7 An assay according to Claim 5 or 6 wherein the assay detects the presence of the E2 polypeptide in koilocytes.

8 An assay according to any of Claims 1-7 wherein the antibody is a monoclonal antibody.

9 An assay according to Claim 8 wherein the monoclonal antibody is capable of binding to the amino terminal region of the E2 polypeptide.

10. An assay according to Claim 8 wherein the monoclonal antibody is capable of binding to the carboxyl terminal region of the E2 polypeptide.

11. An immunogenic composition comprising a papillomavirus E2 polypeptide or part thereof.

<Desc/Clms Page number 26>

12. An immunogenic composition according to Claim I I wherein the composition further comprises a carrier and/or adjuvant.

13. An immunogenic composition according to Claim 11 or 12 wherein the polypeptide is an oligopeptide of 8-30 amino acid residues m length.

14. An immunogenic composition according to Claim 13 wherein the oligopeptide is 9- 18 amino acid residues in length.

15 An immunogenic composition according to Claim 14 wherein the oligopeptide is 9 or 10 amino acid residues in length.

16. An immunogenic composition comprising a cell transformed or transfected with the nucleic acid encoding a papillomavirus E2 polypeptide.

17 An immunogenic composition according to Claim 16 wherein the cell is transformed/transfected with an expression vector adapted for recombinant expression of a papillomavirus E2 polypeptide.

18. An antibody, or active binding part thereof (Fab fragment) capable of binding the polypeptide sequence presented in Figure 4.

19. An antibody according to Claim 18 wherein the antibody is a monoclonal antibody or Fab fragment thereof.

20. An antibody fragment according to Claim 18 or 19 wherein the fragment is a single chain Fv molecule.

21. A hybridoma cell-line characterised in that said cell-line produces monoclonal antibodies capable of binding the papillomavirus E2 polypeptide.

22. A method for the production of monoclonal antibodies capable of binding papillomavirus E2 polypeptide comprising: i) providing a hybridoma cell-line according to Claim 21 ;

<Desc/Clms Page number 27>

ii) providing conditions conducive to the production of monoclonal antibodies according to claim 19; and optionally iii) purifying said monoclonal antibody from said cells or their growth medium.

23. A method to produce antibodies capable of binding the papillomavirus E2 polypeptide comprising: i) immunising an animal with at least part of the polypeptide sequence presented in Fig

1 ; ii) testing said animal for the production of antibodies direct to a papillomavirus E2 polypeptide; and optionally hi) providing at least one further immunisation of said animal with said polypeptide; and iv) isolating from said animal serum comprising antibodies directed to said polypeptide.

24. A method according to Claim 22 or 23 wherein the immunisation is by intradermal; intramuscular; intraperitoneal, or foot pad administration of a papillomavirus E2 polypeptide or part thereof.

25. A method according to any of Claims 22-24 wherein the animal is selected from: mouse; rabbit; rat; sheep; goat; pig; guinea pig.

26. A method according to Claim 22 wherein the method is used for the isolation of cells producing monoclonal antibodies.

27. A method according to Claim 26 wherein the cells are used for the production of the hybridoma cell-line according to Claim 21.

28. An assay to detect the presence of nucleic acid encoding the papillomavirus E2 polypeptide comprising: i) providing a cell sample to be assayed; ii) providing suitable conditions for the detection of the nucleic acid encoding the E2 polypeptide ; iii) contacting the cell sample with at least one nucleic acid probe capable of hybridising to said nucleic acid; and

<Desc/Clms Page number 28>

IV) detecting the presence of the nucleic acid by the nucleic acid probe.

29. An assay accoridng to Claim 26 wherein the assay comprises a polymerase chain reaction.

30. An assay according to Claim 27 wherein the assay uses ohgonucleotide probes selected from the following sequences: 5'GAGGACGAGGACAAGGAA 3' ;

5'GTCACGTAGGTCTGTTACTATC 3' ; 5'AATACAATGCATTATACAAACT 3' ; 5'GTGCTGCCTAATAATTTCAGGAGAG 3' ; 5'TATTATGTCCTACATCTGTGTT 3' ; 5'AGTGTTACTATTACAGTTAATCCGTCC 3' 5'CAGAGACTCAGTGGACAGTG 3' 5'CCAATGCCATGTAGACG 3' 31. A method to identify an E2 epitope comprising : i) preparing fragments of nucleic acid encoding parts of an E2 polypeptide; ii) subcloning the fragments into a vector; iii) transfecting or transforming the vector, including E2 nucleic acid into a cell; iv) growing cells including said vector; and v) contacting cells expressing E2 polypeptide fragments with antisera or antibodies directed to an E2 polypeptide, or part thereof.