FR2697851A1 - Detecting target nucleic acid by restriction enzyme amplification - Google Patents

Abstract

System for detecting a target nucleic acid sequence by restriction enzymatic amplification comprises 2 probes, partly double stranded and fixed to a solid support. These probes have a first strand contg. an endonuclease recognition site and extending up to the enzyme cleavage site, and a second strand with a region complementary to the first strand, extending from at least the recognition site to the cleavage site. This second strand extends (as a single strand) beyond the cleavage site to produce a region which, for one probe, is complementary to the target, and, for the other probe, substantially (pref. perfectly) complementary to the product of single-strand cleavage of the first probe. One of the single-stranded regions has a 5'-end, the other a 3'-end. The endonuclease is of type II; it has a double stranded fixing site; cuts to produce an overhanging end and has a cleavage site outside its recognition site.

Description

 The present invention provides a system and method for determining the presence of target nucleic acid sequences according to a solid phase enzymatic restriction amplification method. In particular, the present invention consists of a method for assaying or detecting a specific target nucleic acid sequence within a sample containing an unknown amount of said sequence, and makes preference to different types of nucleic probes for such a method.

 It is often necessary in nucleic acid and genetic material technologies to determine whether a gene, a part of a gene or a nucleotide sequence is present in a living organism or a cellular extract of the genetic material of that organism. Since any gene or part of a gene is, in theory, a specific sequence of nucleotide bases forming all or part of a nucleotide molecule, it is possible to directly search for the presence of a specific nucleotide sequence within a specific nucleotide sequence. sample containing polynucleotides.

The interest of searching for specific nucleotide sequences is immense for the detection of pathogenic organisms, the determination of the presence of alleles, the detection of the presence of lesions in a host genome and the detection of the presence of an mRNA. or modification of a cellular host, if only to give some illustrative examples. Genetic diseases such as Hutington's disease, myopathy
Duchenne, phenylketonuria and B-thalassemia can be diagnosed through DNA analysis of individuals. In addition, the diagnosis or identification of viruses, viricides, bacteria, fungi, protozoa or any other plant or animal life form can be achieved by hybridization experiments with nucleic probes.

Different types of nucleic acid detection methods are described in the literature. These methods, and particularly those requiring the detection of polynucleotides, rely on the purine-pyrimidine pairing properties of the complementary nucleic acid strands in the DNA-DNA, DNA-RNA and RNA-RNA duplexes. This pairing process is accomplished by establishing hydrogen bonds between the adenosine-thymine (AT) and guanosine-cytosine (GC) bases of the double-stranded DNA; adenosine-uracil (AU) base pairs can also be formed by hydrogen bonding in duplexes
DNA-RNA or RNA-RNA. The pairing of nucleic acid strands for determining the presence or absence of a given nucleic acid molecule is commonly referred to as "nucleic acid hybridization" or simply by "hybridization".

 Various amplification methods have been developed to increase the detection power by these hybridization techniques. The amplification process may occur at different stages of a nucleic probe detection method. These stages can be classified into three categories: target, probe or signal amplification.

 Target amplification involves specifically multiplying a nucleic acid fragment present in a sample. It makes it possible to considerably increase the number of copies of a target nucleic sequence to be detected.

 The most widely used method is Polymerase Chain Reaction (PCR), a target amplification technique that relies on the repetition of DNA synthesis cycles in vitro by extension of nucleotide primers hybridized to the target sequence.

Another target amplification technique is for example the "Self-Sustained
Sequence Replication "(3SR), (International Patent WO 90/06995) which uses the combination of three enzymes: reverse transcriptase, RNase H and T7 RNA polymerase.

 Its basic principle is based on a continuous cycle of reverse transcription and transcription reactions in order to replicate an RNA target via cDNA.

 Nevertheless, these techniques have significant limitations. PCR for example requires the realization of many temperature cycles, which is a major drawback for the automation of the technique. In addition, it has many risks of false positives due to its sensitivity. A technique such as 3SR has the advantage of being isothermal, but is less sensitive and requires many enzymatic activities. It is therefore, on the one hand, expensive in terms of reagents and, secondly, difficult to optimize, given the number of enzymatic activities required (three or more) for its implementation.

 The present invention overcomes the aforementioned drawbacks. It enables the presence of a nucleic acid sequence to be sensitively detected through a Solid Phase Restriction Amplification (ARPS) system. It is well known per se that restriction enzymes or "endonucleases" cleave the double-stranded structure within a DNA molecule. These enzymes are prevalent in bacteria. DNA cleavage occurs at specific sites within or adjacent to the enzyme recognition site. More than 500 restriction enzymes have been isolated at present. These restriction enzymes have been characterized with respect to the nucleic acid sequences that the enzymes recognize and their cleavage specificity. The majority of restriction enzymes or endonucleases recognize a sequence of 4-6 nucleotides in length, but some possess a recognition site of 7 to 8 bases.

The use of restriction enzymes at their specific cleavage sites is well known. Enzymes are used for DNA mapping, cloning, and characterization of DNA sequences. They have been used in many methods using nucleic probes. European Patent No. 0 234 781 describes a method of "universal" cleavage of a single-stranded nucleic acid fragment, using an oligonucleotide adapter mimicking the restriction endonuclease recognition site. Similarly, US Patent No. 4,683,194 discloses a method of demonstrating the presence or absence of a specific restriction site in a nucleic acid sequence by hybridization with a nucleic acid probe. complementary to one of the strands of the nucleic acid and covering the restriction site. The hybridized sequence is then cleaved with an endonuclease and the cut or uncut products are separated by gel electrophoresis and then detected by means of the labeling of this probe. In a similar manner, the patent
European N 0 455 517 filed by Oncor Inc. discloses a more sensitive method of detection by digestion using type II endonucleases (it is recalled that a type II endonuclease recognizes a particular site and cuts the nucleic acid in this site or near this site).

The introduction into the reaction medium of a second oligonucleotide to recycle the target sequence makes it possible to increase the signal intensity due to the cleaved oligonucleotide probe.

Nevertheless, although the mentioned technique makes it possible to detect in a more sensitive manner the presence of a target having a restriction site, the method is not very powerful. It induces indeed a linear increase of the signal which would require a long duration of enzymatic reaction to be consequent. This incubation time is incompatible with the life of the restriction enzymes and require significant amounts of enzymes, thus greatly increasing the cost of an experiment. In addition, the detection of the restriction of the target DNA must then be carried out by separation of the cleaved probe and the uncleaved probe. The separation methods envisaged, such as electrophoresis, are long to implement and further delay the time of establishment of a result.

 The present invention has the advantage of allowing a rapid, sensitive and non-radioactive detection of a nucleic acid sequence by means of an homogeneous phase hybridization and enzyme restriction method. It uses, as the previous technique, a restriction enzyme. However, unlike the previous technique, it uses a type II restriction enzyme which cuts outside its recognition site, and on any sequence, located at a determined distance from the recognition site. were used to cut a single-stranded target DNA specifically on any sequence (European Patent No. 234,781) by hybridizing a sequence complementary to the target DNA. It is therefore possible, following restriction by such an endonuclease, to determine the presence of a target DNA, regardless of its nucleotide sequence. In addition, the same enzyme can be used to highlight any target DNA, allowing the results to be optimized and compared for quantitative purposes.

 The present invention utilizes two partially double-stranded capture probes that are immobilized on one solid phase. The first probe is substantially complementary to one sequence of the target nucleic acid and the other probe is complementary to the first.

The combined use of these two types of probes in the same assay allows for exponential cleavage of the capture probes, leading to significant amplification of the signal from a hybridized target nucleic acid copy on a capture probe (Figure 1). ). The present invention enables the recycle of a cleaved nucleic acid strand by a type II restriction endonuclease by hybridization of the cleaved fragment to the complementary capture probe.

The proposed method therefore allows a highly sensitive, reliable and rapid detection of the presence of a nucleic acid strand in a biological sample. It has the advantage of being isothermal, so easily automated, to use only one enzyme, so easily optimizable, and to have a reduced cost. The use of a type II endonuclease whose cleavage site is distinct from the recognition site makes it possible to detect any nucleic acid sequence, the restriction specificity being conferred by the sequence of the capture probes. The interest of solid phase fixed capture probes is to allow the rapid discrimination of the cleaved products of the initial probes without resorting to the traditional electrophoretic or chromatographic separation methods that are difficult and time consuming to implement.

 The subject of the invention is therefore a system for detecting a target nucleic acid sequence according to an enzymatic restriction amplification method, characterized in that it comprises a set of two partially double-stranded nucleic probes fixed on a support solid, said probes comprising a first strand which contains the sequence of the recognition site of an endonuclease and which extends to the site of cleavage of said first strand by said endonuclease, and a second strand comprising a complementary part of said first strand extending from at least said recognition site to the cut-off site of the first strand, said second strand extending beyond said cut-off site by a single-strand portion, said single-strand portion being, for one of the probes ( or first probe) substantially complementary to the target nucleic acid sequence, and for the other probe (or second probe) substantially complementary, and preferably perfect complementary to the single-strand cleavage product of said first probe by said endonuclease, said single-stranded portions of said probes having a free end 3 'for one of the probes and 5' for the other probe, and said endonuclease being an endonuclease of Type II restriction at a double-stranded and protruding cut-off site, with a cleavage site located outside the recognition site.

 In view of the fact that the endonuclease used acts with the formation of a protruding cut, it is obvious that the single-ended portions of the two probes will be of unequal length, the difference in length being equal to the length of the segment situated between the endonuclease cleavage of one of the strands and the cleavage point of the other strand, when the endonuclease cleaves a double-stranded nucleic acid.

 Preferably, the single-strand portion of the probe having the shortest single-strand portion has at least 6 nucleotides. Generally, the single-strand portion of the two probes comprises at most 100 nucleotides.

 The invention also relates to a method for detecting the presence of a target nucleic acid sequence in a sample, in a liquid medium, characterized in that it comprises bringing the sample into contact with the sample system. probes as defined above, and with the endonuclease, incubating at an appropriate temperature for a time sufficient to allow the endonuclease-cleaved fragments to be recycled until the desired amplification rate is achieved, and the detection according to the usual methods, the cleavage of the capture probes resulting from the hybridization of the target sequence when this was present in the sample.

 Preferably, one operates at a constant temperature, close to the optimum temperature of activity of the endonuclease.

 It is understood that the target sequence hybridizes with the single-strand portion of one of the probes (probe 1), which allows cleavage under the action of the endonuclease. This cleavage provides two fragments, one of which, resulting from the cleavage of the target, can again be fixed on an intact probe 1, by initiating a new cycle, and the other of which is complementary to the single-rod part of the other probe. (probe 2) and can therefore hydride with said probe 2, which triggers the cleavage of said probe 2. This latter cleavage provides a recyclable fragment on another probe 2, and a second fragment substantially identical to the target sequence and therefore recyclable on another probe 1. An exponential amplification of target-like sequences and complementary sequences of the target resulting from successive cleavages of probes 1 and 2 are thus obtained. When the target is a DNA comprising two complementary strands, the phenomenon is further accelerated because, as can easily be verified, the complementary strand gives rise to similar cyclic reactions, with the probe 2 acting as the probe 1, and vice versa. Of course, the monobiin part of the probe 1 is not necessarily strictly complementary to the target: it suffices that they are sufficiently complementary to be able to hybridize under the conditions of the process. Thus, the same probe may optionally be used to detect a target sequence or a mutated neighboring sequence. The same remark also applies to probe 2. The probes can be fixed on the solid support either by passive attachment or covalently, according to known methods. They can also be fixed by covalence to a ligand having a good affinity for the solid support. The covalent attachment to the solid support may be effected via a coupling agent, which may also act as a spacer arm.

 In order to detect whether the amplification reaction has indeed taken place, one can either look for the presence in the liquid phase of fragments resulting from the cleavage of the probes, or evaluate the quantity of cleaved probes (or intact probes) on the solid support. For this purpose, it is possible, in the first case, to search for said fragments in the liquid phase, for example according to a standard sandwich hybridization test with the aid of an appropriate capture probe and a labeled detection probe. second case, it is possible, for example, at the end of the amplification reaction, to put the solid support (after rinsing) in contact with an appropriate labeled probe (complementary to the single-strand portion of one of the two fixed probes, by for example the probe 1), and, by comparing the signal obtained with that obtained with said labeled probe and said solid support before the amplification reaction, determine the proportion of remaining fixed intact probes 1 or the decrease in the amount of probes 1 intact fixed. In addition, it is possible, if desired, to verify the proportion of cleavage on the other probe (probe 2).

Normally, the amounts of cleaved probes 1 and 2 should be substantially the same.

 The target nucleic acid is preferably subjected to a prior denaturation operation, this step being of course obligatory when the target is double-stranded DNA.

The present invention therefore notably proposes a method for detecting the presence of a nucleic acid sequence from a biological sample, said method comprising the steps of:
(a) attachment of partially double-stranded oligonucleotide sequences called capture probes, on a solid phase. These sequences are, one substantially complementary to a portion of the target sequence whose presence is to be detected, and the other substantially identical to said target sequence, and they further contain a recognition site of an endonuclease of the type II. Both types of capture probe must be fixed on solid phase, to allow an exponential amplification of the signal. The complementary part of the target sequence, as well as the part substantially identical to the target, must be single-stranded, while the region of endonuclease binding is double stranded.

 (i) the obtaining of the double-strand structure can be carried out in particular in two ways independently of the subsequent mode of fixing on a solid support.

 1 - a first route involves a nucleic acid fragment in the form of a derivative resulting from the covalent coupling in the 5 'or 3' end position of said nucleic acid fragment with a ligand having a molecular weight of less than 5000 and comprising at least one polar functional group, it being understood that when said ligand is a nucleotide or an oligonucleotide, it comprises at least one nucleotide modified so as to introduce said polar functional group. This derivative is then hybridized with a nucleic acid fragment longer or shorter and complementary in the region forming a duplex. The complex thus obtained, and comprising a homologous duplex region, is then fixed on a solid support.

 2 - a second way of forming said nucleic acid complex comprises the covalent coupling of two pentaethylene glycol groups separated by an amino3-propanediol-1,2 group between the two nucleic acid fragments. The two nucleic acid fragments are chosen such that the smallest of them is complementary to the 5 'or (exclusive) 3' end of the large nucleic acid fragment, thus leading to the formation of a nucleic acid fragment. homoduplex. Said formation path has the advantage of orienting the attachment of said capture probes by their side corresponding to their homoduplex region.

(ii) the immobilization of partially solid double-stranded oligonucleotide structures can be obtained for example according to one of the following approaches:
1 - passive binding on a solid support of a complex of nucleic acid fragments comprising less than 100 nucleotides, on which said support is brought into contact with said complex in the form of a derivative resulting from the covalent coupling of said complex with a ligand having a molecular weight of less than 5000 and comprising at least one polar functional group, said derivative not being capable of reacting on said support with formation of a covalent bond under the conditions of said contact, it being understood that when said ligand is a nucleotide or an oligonucleotide, it comprises at least one nucleotide modified so as to introduce said polar functional group (French patent application N 91 09057 of July 17, 1991). The functional group is chosen in particular from amine, hydroxy, amido, carbamoyl, alkylthio and arylthio groups. The ligand is in particular a compound comprising at least one hydrophobic group.

 2 - fixation on a solid support by covalent bonding. The complex of nucleic acid fragments in the form of a derivative resulting from the covalent coupling of said complex with a ligand comprising at least one polar functional group, said derivative being capable of reacting on said support with formation of a covalent bond. This reaction of a specific reactive function present on the support and the reactive function of said derivative is in the presence or absence of a coupling reagent.

(b) addition of the sample supposed to contain the denatured target sequence by appropriate treatment (thermal or alkaline), and type II restriction endonuclease such as Alw I, Bbs I, Bbv I, Bcg I, Bpm I, Bsa I, Bsg I, BsmA I, BspM I, Ear I, Fok I, Hga I, Hph I,
Mbo 11, MnI I, Ple I, or SfaN I (obviously non-limiting list), cleaving the capture probe if the duplex region is reconstituted during the hybridization of a denatured target sequence on the single-strand portion of the capture probe .

 (c) incubating the reaction thus formed at a temperature suitable for endonuclease activity and selective hybridization of a target sequence on its capture probe, for a period of up to, for example, up to three hours. The target sequence thus defined refers to a single-stranded nucleic acid strand that has not been restricted or induces restriction of the capture probe. Thus, said target sequence has a longer hybridization region than said sequence having undergone such a restriction. This results in a difference in thermodynamic stability sufficient to separate, under the given conditions, the cleaved target nucleic acid strand, as well as the cleaved capture probe, and reinitiation of the reaction on capture probes in large molar excess. .

 (d) detecting nucleic acid fragments resulting from cleavage of the cleaved capture probe following hybridization of the target sequence on said capture probe. Said detection of the nucleic acid fragments thus released in solution is carried out by separation of the solid phase from the liquid phase and analysis of the liquid phase by means of a capture / detection system on a second solid phase, involving a system of cold probes labeled with marker enzymes such as alkaline phosphatase or horseradish peroxidase.

According to another embodiment, the invention relates to a method for detecting a nucleic acid sequence comprising:
(a) optionally the denaturation of a target nucleic acid sequence, especially when it is a double-stranded sequence, in the presence of a system of two probes as defined above, one of the probes being linked to a marker;
(b) adding a restriction enzyme to the reaction mixture;
(c) performing a hybridization reaction at a suitable temperature allowing the restriction endonuclease to cleave the reconstituted DNA duplexes, thereby leading to the release of the labeled single-stranded fragments from the capture probes;
(d) and detecting labeled cleaved fragments in the liquid medium, or probes labeled intact on the solid support.

The detection method of the invention comprises in particular:
(a) hybridizing a target molecule allowing the formation of a probe-target duplex reconstituting the restriction endonuclease cleavage site in the presence of a set of two types of capture probes as previously described, fixed on a solid support, leading to the cleavage of said probes exponentially by a restriction endonuclease, if a target nucleic acid molecule is present in the reaction medium.

 (b) cleavage of DNA duplexes immobilized on solid support by a restriction endonuclease.

 (c) recycling the nucleic acid fragments resulting from cleavage of the capture probes, by hybridization on the excess intact capture probes, followed by cleavage of said capture probes by said restriction endonuclease.

 (d) detecting oligonucleotides resulting from cleavage of capture probes.

 The amplification process may be carried out from purified or unpurified, single-stranded or double-stranded target nucleic acids, or from a mixture of nucleic acids, provided that said nucleic acids are of sufficient quality to be digested with a restriction endonuclease, under standard conditions as described by Sambrook et al.

in Molecular Cloning (1989). The sources of nucleic acids can be various biological samples made in humans, animals and plants. Microorganisms, in particular bacteria, yeasts, viruses, may also constitute sources of nucleic acids that can be analyzed using the present invention.

 The temperature at which the reaction is to be performed may vary depending on the type of endonuclease used. Taking into account the composition (GC%) of the capture probes defined for a test, it is possible to determine theoretically, according to known methods, or with the aid of routine experiments, the length of the probes which will make it possible to operate the chosen temperature.

The majority of the restriction enzymes have an optimal activity at 37 ° C., but others have the advantage of working at a higher temperature, for example, the Bsa I endonuclease used in Examples 1 to 3 has an optimum temperature. 55 "C. The use of such an enzyme involves defining capture probes of greater length, allowing stable pairing of the target nucleic acid molecule on said probe at the given temperature. The reaction temperature must, in fact, in a reaction medium of adequate salt concentration, allow stable hybridization of the target on the capture probe, and dissociation of the target-probe duplex once cleaved by the endonuclease used.

 The reaction time may vary depending on the composition of the reaction buffer, the concentration of capture probe and target, the stringency of the reaction medium, the length of the capture probes and the type of endonuclease used. It is important to choose sufficient incubation time for the theoretically exponential probe recycling process to produce a large amount of cleaved probes from a small number of nucleic acid copies. target. The reaction time is usually 1 to 3 hours. In each case, it is possible to determine, by routine experiments, the time to obtain a determined amplification rate.

 The term "nucleic acid fragment" as used in the present application refers to a fragment of DNA or natural RNA or a natural or synthetic oligonucleotide or an unmodified synthetic DNA or RNA fragment or comprising one or more modified bases such as inosine, methyl-5-deoxycytidine, dimethylamino-5-deoxyuridine, deoxyundine, diamino-2,6-purine, bromo-5-deoxyuridine, pseudouridine, pseudoisocytidine or any other modified base allowing hybridization.

 The term "solid support" as used herein includes all materials on which a nucleic acid fragment can be immobilized for use in diagnostic assays, affinity chromatography, and separation processes. Natural materials, synthetic, porous or non-porous, magnetic or non-modified, or non-chemically modified, can be used as a solid support, in particular polysaccharides such as cellulose materials, for example paper, cellulose derivatives such as acetate cellulose and nitrocellulose; polymers such as vinyl chloride, polyethylene, polystyrenes, polyacrylate or copolymers such as vinyl chloride and propylene polymer, vinyl chloride polymer and vinyl acetate; copolymers based on styrenes; natural fibers such as cotton and synthetic fibers such as nylon; ceramics; silica.

 The solid supports used in the present invention are a polystyrene polymer, a butadiene-styrene copolymer or a butadiene-styrene copolymer mixed with one or more polymers or copolymers chosen from polystyrene, styrene-acrylonitrile or styrene-methyl methyl methacrylate copolymers. polypropylene, polycarbonates or the like. Advantageously, the supports of the present invention are a polystyrene or a styrene-based copolymer comprising between 10 and 90% by weight of styrene units or silica. The solid supports according to the invention may be, without limitation, under the form of a microtiter plate, a sheet, a cone, a tube, a well, beads or the like.

 The term "coupling agent" as used herein refers to a molecule containing at least two "ends" or reactive groups. The coupling agent may be homobifunctional or heterobifunctional.

 The ligands used in the present invention may be commercially available compounds or compounds synthesized according to methods known per se.

 Another object of the present invention is to provide a kit for the diagnosis of various diseases, using the method described above. Such a kit comprises in particular a plurality of solid supports on which the two probes are fixed, and possibly in appropriate containers, the endonuclease, buffer solutions, etc.

 Figure 1 is a schematic representation of the principle of the present invention, which is a Solid Phase Restriction Amplification (ARPS) method.

FIG. 1 shows that after hybridization of the target with the probe 1 fixed on the support 3, and digestion with BsaI, a fragment 4 is obtained which is recyclable on a probe 1 and a fragment 5 capable of hybridizing with the probe 2 to form a duplex whose digestion for
BsaI provides a fragment 6 recyclable on a probe 1 and fragment 5 released and again recyclable on a probe 2.

 Figure 2 is a representation of the various oligonucleotide complexes and reactions used in the experimental part below.

Figure 3A is a photograph of a non-denaturing acrylamide gel stained with ethidium bromide, showing the different samples and combinations
oligonucleotides used in the experimental part (Example 1).

 FIG. 3B and FIG. 3C correspond to the results obtained (example 1) following the nylon membrane electrotransfer of the samples analyzed on polyacrylamide gel (FIG. 3A), and their revelation by selective hybridization using probes. Nuclei labeled with horseradish peroxidase.

 Figure 4A is a photograph of an etidium ethidium bromide denaturing acrylamide gel of several samples used in Example 1 below.

 FIG. 4B and FIG. 4C correspond to the results obtained as a result of the nylon membrane electrotransfer of the samples analyzed on polyacrylamide gel (FIG. 4A), and of their revelation by selective hybridization using nucleic acid probes labeled with horseradish peroxidase.

 The following examples illustrate the invention without limiting it.

EXAMPLES
Example 1
In this example, the cleavage with the restriction enzyme Bsa I was studied on different nucleic complexes that may be involved in the amplification reaction that is the subject of the present invention.

Oligonucleotides used:
Oligonucleotides used were synthesized on Applied biosystem 381A automatic apparatus using phosphoramidite chemistry, according to a method previously described in WO 91/19812.

The following oligonucleotides were used to form the various complexes on which the activity of the Bsa I restriction enzyme was tested:
The oligonucleotide (1) consists of the 5 'sequence
GCTGCTGCTGCTGCTGCTGGTCTCC 3 '(25 mer).

The oligonucleotide (2) consists of the sequence AGAGAATTATGCAUTGCTGCCATAACCATGAGrnATAAGGAGACCAGCAGCAGCA
GCAGCAGC 3 '(63 mer).

 Oligonucleotide (3) consists of the sequence 5 'TTATCACTCATGGTTATGGCAGCACTGCATAATTCTCT 3' (38 mer).

The oligonucleotide (5) consists of the 5 'sequence
AAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCT 3 '(57 mer).

The oligonucleotide (6) consists of the 5 'sequence
GCTGCTGCTGCTGCTGCTGGTCTCCTTATCACTCATGGITATGGCAGCACTGCATAAT
TCTCT 3 '(63 mer).

The following two oligonucleotides were used to specifically detect the reaction products:
The oligonucleotide (au9) consists of the sequence 5 'XTGCCATAACCATGAGTG 3' (17 mer).

 The oligonucleotide (A28) consists of the sequence 5 'XCACTCATGGTTATGGCA 3' (17 mer).

 The oligonucleotides (A28) and (AI 9) are coupled in 5 'to horseradish peroxidase (X) according to a process previously described in the patent WO 91/19812.

The following oligonucleotide was used as a specific capture agent:
The oligonucleotide (A25) consists of the sequence 3'TCTCTTAATACGTCACG5 '(17 mer).

 The hybridization reactions involved in Example 1 are reactions 1, 2, and 3 described in FIG.

All reactions contain, in a final volume of 20 μl after addition of the enzyme, oligonucleotides each at a concentration of 1 pmol, 61, in a 20 mM buffer
Tris-acetate, 10 mM magnesium acetate, 50 mM potassium acetate, 1 mM DTT, pH 7.9 at 25 ° C. Three different reactions are prepared (Figure 2), reaction 1 comprises oligonucleotide 6 and oligonucleotide 2. Reaction 2 comprises oligonucleotide 1, oligonucleotide 3 and oligonucleotide 2. Reaction 3 comprises oligonucleotide 1, oligonucleotide 5 and oligonucleotide 2.Before adding the restriction enzyme, the tests, with a volume equal to 18 μl, are incubated at 95 ° C. for 5 minutes and then gradually cooled in 15 minutes at room temperature. After preincubation for 1 minute at 55 ° C., 10 units of the restriction enzyme Bsa I (Biolabs) are added in a volume of 21 liters, bringing the final volume of each reaction to 20 μl. Without Bsa I enzyme, the reactions are incubated at 55 ° C for 60 minutes and then frozen at -20 ° C.

 The reaction products are studied on polyacrylamide gels, denaturing or non-denaturing, prepared according to the method described by Sambrook et al., Molecular Cloning, 1982. The non-denaturing gels are formed by polymerization of a solution containing 15% of acrylamide, 0.26% bisacrylamide, 0.6NcOsulfate ammonium, 90 mM Tris-borate, 2 mM EDTA, pH 8.3, in the presence of 1% oTEMED, while the denaturing gels contain more urea at the concentration 7M. The gels have a thickness of 1 mm and were cast in electrophoresis devices "mini-protean II electrophoresis cell" from Biorad.

 The samples analyzed by non-denaturing polyacrylamide gel electrophoresis are prepared by mixing 5 ml of sample, 4 ml of distilled water, and 2 ml of a 0.25% xylene cyanol, 0.25% bromophenol blue and 30% solution. glycerol. The samples analyzed by denaturing polyacrylamide gel electrophoresis were prepared by mixing 5 1 of sample and 5111 of 0.035% xylene cyanol solution, 0.035% bromophenol blue, 1 mM EDTA, 10M urea. Just prior to gel deposition, these samples are denatured at 650C for 2 minutes and then rapidly cooled in ice. The electrophoresis is carried out at 150 volts until the bromophenol blue migrates to 1 cm from the bottom of the gel. The gels are then stained for 10 minutes in a solution of ethydium bromide at 0.66 g / ml. and photographed on a UV table with a polaroid camera.

 The non-denaturing gels are immersed in boiling water for 5 minutes before transfer. The transfer of Hybond N membrane samples from Amersham is carried out in a "mini trans-blot electrophoretic transfer cell" apparatus from Biorad, in 45 mM Tris-borate buffer, 1 mM EDTA, pH 8.3, at 4 ° C. under an electric field of 35.5 volts / hour.

cm-l. The filters are then dried for 5 minutes at 80 ° C., and the nucleic acids are then fixed on the membrane by exposure to UV radiation for 3 minutes.

The membranes are pre-hybridized by incubation at 37 ° C for 60 minutes in 4 ml of 0.1 M sodium phosphate buffer pH 7.0, 0.5M sodium chloride, 1 mM EDTA, 0.65% SDS, Salmon DNA 0.14 mg / ml, and polyethylene glycol 6000 2% The hybridization is carried out by incubation for 60 minutes at 37 ° C. in 5 ml of the same buffer containing, at the concentration of 200 ng / ml, either horseradish peroxidase-labeled oligonucleotide (A19), ie horseradish peroxidase-labeled oligonucleotide (A28). After 3 washes for 30 seconds in 50 ml of 1X PBS buffer (Sambrook et al., Molecular Cloning, 1982) The hybridized oligonucleotide is revealed by the activity of peroxidase in the presence of 10 mg of diaminobenzidine tetrachlorohydrate dihydrate in 20 ml of 20 mM sodium phosphate buffer pH 7.2, sodium chloride 150. mM, bovine serum albumin 2 mg / ml. After incubation at room temperature and protected from light for 15 minutes, the reaction is
stopped by rinsing with distilled water.

Figures 3 and 4 show the results obtained on the different tests. Figures 3A and 4A are photographs of acrylamide gels stained with ethydium bromide. The figure
3A corresponds to a non-denaturing gel. Figure 4A corresponds to a denaturing gel. The
FIGS. 3B, 3C, 4B, and 4C are gel electrotransfer membranes such as those shown in FIGS. A, analyzed by hybridization with peroxidase-labeled nucleic acid probes, and then revealing the hybridized probes by color reaction. Figures 3B and 3C correspond to
electrotransfer on a non-denaturing gel. Figures 4B and 4C correspond to a
electrotransfer on a denaturing gel. The membranes shown in FIGS. 3B and 4B were hybridized with the peroxidase-labeled oligonucleotide probe (A19). The membranes shown in FIGS. 3C and 4C were hybridized with the peroxidase labeled oligonucleotide probe (A28). Line 1: control without Bsa I of the reaction 1. Line 2: reaction 1 in the presence of
10 units of Bsa I. Line 3: control without Bsa I of the reaction 2. Line 4: reaction 2 in the presence
10 units of Bsa L Line 5: control without Bsa I of the reaction 3. Line 6: reaction 3 in the presence of 10 units of Bsa I. Line 7: oligonucleotide (1). Lane 8: oligonucleotide (2). Line
9: oligonucleotide (3). Lane 10: oligonucleotide (5).

Figure 3A and Figure 4A show that by non-acrylamide gel electrophoresis
denaturing or denaturing, and ethydium bromide staining, new bands appear
when the DNAs are incubated in the presence of Bsa I, compared to those incubated in the absence of
Bsa I. The intensity of the bands that appear in reaction 1 is about 30% of the intensity
of the initial band. The intensity of the bands that appear in reaction 2 and in the reaction
3 is about 30% relative to the intensity of the bands that appear in reaction 1. The bands that appear in reaction 2, have, as expected, the same electrophoretic mobility as the bands appearing in reaction 1.By electrotransfer and hybridization with the oligonucleotide probes (A19) and (A28) (FIGS. 3B, 3C, 4B, 4C), it is shown that the bands which appear in reaction 2, have, as expected, the same
hybridization capabilities with (au9) and (A28) as the bands appearing in reaction 1. The smaller DNA fragments appearing by digestion with Bsa I in reaction 3, shows, as expected, the same electrophoretic mobility that the smallest of the fragments
appearing in reaction 1 and not hybridizing with either of the two probes (A19) and (A28). The second fragment appearing in reaction 3 has an electrophoretic mobility that is unpredictable because of the single-stranded nucleotide tail, which appears to be slightly lower than that of the oligonucleotide (2) / oligonucleotide (6) complex.

 These results make it possible to conclude that, with respect to the double-stranded continuous DNA reaction (lanes 1 and 2), the double-stranded DNA reaction 2 having no phosphate bond at the cleavage site closest to the recognition site of the restriction enzyme Bsa I (lanes 3 and 4), and reaction 3 on double-stranded DNA carrying a nucleotide tail initiating at the cleavage site closest to the site of recognition of the enzyme Bsa I restriction (lines 5 and 6), have an efficiency of about 30% (lines 5 and 6).

Since the cutoff efficiency of Bsa I in reaction 1 can be estimated at 30%, the efficiency in reaction 2 or 3 can be estimated at about 10%.

Example 2
In this example, cleavage with the restriction enzyme Bsa I was studied on the same complexes as those used in Example 1, but passively attached to the walls of a microtiter plate well.

Oligonucleotides used:
The oligonucleotides used for this example have all already been described in the example
1.

The hybridization reactions involved in this example are reactions 1, 2, and
3 described in Figure 2.

The oligonucleotide (2) is substituted at the 3 'position with a primary amine function according to the method described by Asseline et al. (1990) Tetrahedron Lett. 31, 81-84. This amine function will allow microplate fixation. This oligonucleotide is hybridized with either the oligonucleotide
(1), or with the oligonucleotide (6), by incubation at 37 ° C. for 60 minutes in 3X PBS buffer described in patent FR 9109057, in the presence of the oligonucleotides concerned at the concentration of 11 M. The oligonucleotide complex thus formed is passively attached to the wells of a Maxisorp Nunc-Immuno flat microtiter plate according to the method already described in patent FR 9109057, allowing the attachment of about 5 pmoles of the complex to a well.After fixation, three Washings with PBS Tween 1X buffer are performed A final wash in 20 mM Tris-acetate buffer, 10 mM magnesium acetate, 50 mM potassium acetate, 1 mM
DTT, pH 7.9, which corresponds to the maximum activity buffer of Bsa I, is then produced. For reaction 1, oligonucleotide complex (2) oligonucleotide (6), 100 μM 20 mM Tris-acetate buffer, 10 mM magnesium acetate, 50 mM potassium acetate, 1 mM DIT, pH was added to the well where the oligonucleotide oligonucleotide complex (6) was adsorbed. 7.9, without oligonucleotide. For the reaction 2.5 pmoles of oligonucleotide (3) are added in a final volume of 100U1 of 20 mM Tris-acetate buffer, 10 mM magnesium acetate, 50 mM potassium acetate, 1 mM DIT, pH 7.9, in the wells where the oligonucleotide (2) / oligonucleotide (1) complex is adsorbed. For reaction 3, the oligonucleotide (5) is added at the same concentration and in the same buffer to equivalent wells. After preincubation for 5 minutes in an oven at 55 ° C., 50 units of Bsa I are added in a volume of 10 in. For each reaction, a control without addition of Bsa I is carried out The reactions are carried out by incubation at 55 ° C. for 60 minutes and then are stopped by adding EDTA at the final concentration of 25 mM.

The amount of restriction fragment released into the medium was estimated by the detection technique previously described in patent FR 91 09057. A 70U1 volume of the reaction is transferred into an eppendorf tube, where the nucleic acids contained in this sample are denatured by addition of 71 of 2M sodium hydroxide at room temperature, and neutralized after 3 minutes by addition of 711l of 2M acetic acid. For control and calibration, two ranges of oligonucleotide dilution are performed, one of the oligonucleotide (2), the other oligonucleotide complex (2) / oligonucleotide (6) .The samples are then deposited in the well of the oligonucleotide. a microtiter plate in which the oligonucleotide capture probe (A25) has been previously fixed. Either 50 μl undiluted sample or the same sample volume diluted 10th or 100th. Immediately, the detection oligonucleotide probe (A28) coupled to the horseradish peroxidase is added in a volume of 501 of buffer. 0.2 M sodium phosphate pH 7.0, 1M sodium chloride,
2mM EDTA, 1.3% SDS, 0.24mg / ml salmon DNA, 4% polyethylene glycol 6000. After incubation for 60 minutes at 37 ° C., the wells are washed with PBS Tween IX. The revelation of the probe
A28-peroxidase hybridized to the restriction fragment of the oligonucleotide (2) is carried out by adding 1001 of a solution containing the ortho-phenylene diamine substrate. The color reaction is stopped after 20 minutes by addition of 100% 1M sulfuric acid. The optical density at 492 nm is read with an AXIA microreader reader (bioMérieux).

 The results (Table 1) obtained on the dilution ranges of the oligonucleotide (2) and the oligonucleotide (2) / oligonucleotide complex (6) show that the rehybridization of the two oligonucleotides after denaturation weakens the signal. The signal of the products of reactions 1, 2 and 3 must therefore be compared with the signal of the oligonucleotide (2) / oligonucleotide (6) complex. The measured values show that about 1.5 pmoles of 5 'region of oligonucleotide (2) are released by digestion of 5 pmoles of oligonucleotide (2) / oligonucleotide (6) complex in reaction 1. Cutoff Efficiency therefore, the restriction enzyme Bsa I on solid-stranded double-stranded continuous DNA is about 30% under these conditions. This result is comparable to the cutoff efficiency on the same complex in solution. The digestion efficiency for solid-phase-fixed double-stranded DNA reaction 2 lacking a phosphate bond at the site of the nearest cleavage site. of recognition of the restriction enzyme Bsa I and the digestion efficiency for nucleotide tail-supported solid phase double-stranded DNA reaction 3 initiated at the cut-off site closest to the recognition site of the Bsa I restriction enzyme is approximately 3 times less than for reaction 1. For these two last complexes fixed on solid phase, the efficiency of digestion with Bsa I is therefore about 10%, which corresponds to the efficiency of digestion of the same enzyme on the same complexes in solution.

TABLE 1

<tb><SEP> DO <SEP> to <SEP> 492 <SEP> nm
<tb><SEP> 50 <SEP> l <SEP> 5 l <SEP> 0.5 l
<tb><SEP> 10 <SEP> U <SEP> Bsa <SEP> I <SEP>> 2
<tb> reaction2 <SEP> OUBsaI <SEP> o <SEP> O <SEP> O <SEP>
<tb><SEP> lOUBsaI <SEP> 1.8 <SEP> 0.2 <SE> O <SEP>
<tb> reaction3 <SEP> 0 <SEP> UBsa <SEP> I <SEP> O <SEP> O <SEP> O <SEP>
<tb><SEP> 10 <SEP> U <SEP> Bsa <SEP> I <SEP> 2.0 <SEP> 0.2 <SE> O <SEP>
<tb> oligo <SEP> (2) <SEP> 50 <SEP> pmoles <SEP>> 2 <SEP>> 2 <SEP>> 2
<tb> oligo <SEP> (2) <SEP> 5 <SEP> pmoles <SEP>> 2 <SEP>> 2 <SEP> 1,7
<tb> oligo <SEP> (2) <SEP> 0.5 <SEP> pmoles <SEP>> 2 <SEP> ~ <SEP><SEP> 1.6 <SEP> 0.2
<tb> oligo <SEP> 0 (2) 0.05 <SEP> pmoles <SEP> 1.5 <SEP><SEP> 0.2 <SE> O <SEP>
<tb> oligo <SEP> (2) + <SEP> (6) <SEP> 50 <SEP> pmoles <SEP>> 2 <SEP>> 2 <SEP> 1,8
<tb> oligo <SEP> (2) + <SEP> (6) <SEP> 5 <SEP> pmoles <SEP>> 2 <SEP> 1.7 <SEP> 0.2
<tb> oligo <SEP> (2) <SEP> + <SEP> (6) <SEP> 0.5 <SEP> pmoles <SEP> 1,9 <SEP> 0,2 <SE> O <SEP>
<tb> oligo <SEP> (2) <SEP> + <SEP> (6) <SEP> 0.05 <SEP> pmoles <SEP> 0.5 <SEP> O <SEP> O <SEP>
<Tb>
Example 3
The solid support amplification method can be implemented according to the following protocol:
Oligonucleotides used:
The oligonucleotides described for Example 1 are used for this example. An additional oligonucleotide intervenes:
The oligonucleotide (7) consists of the sequence 5'ATAAGGAGACCAGCAGCAGCAGCAGCAGC3 '(29 mer).

 The hybridization reactions involved in this example are the reactions 2, 3 and 4 described in FIG. 2.

 The oligonucleotide (2), substituted in the 3 'position with a primary amine function, is hybridized with the Poligonucleotide (1) as described in Example 2. Similarly, the oligonucleotide (7) is substituted at the 3' position with a primary amine function, and hybridized with Voligonucleotide (6). These two complexes of oligonucleotides are then passively fixed on the same wells of a microtiter plate as described in Example 2. As in Example 2, three washes in PBS Tween 1X are carried out, followed by a last wash in 20 mM Tris-acetate buffer, 10 mM magnesium acetate, 50 mM potassium acetate, 1 mM DIT, pH 7.9. Then, each well contains different concentrations of the oligonucleotide (5), which mime the target sequence whose presence in a sample is to be highlighted. The final volume of the reaction is 1001ri, in 20mM Trisacetate buffer, 10mM magnesium acetate, 50mM potassium acetate, 1mM DIT, pH 7.9. As in Example 2, 50 units of Bsa I are added in a volume of 101 after preincubation for 5 minutes in an oven at 55 ° C. For each reaction, a control without addition of Bsa I is carried out. are incubated at 55 ° C. for 3 hours and are stopped by adding EDTA at the final concentration of 25 mM.

 The amount of restriction fragment released into the medium is estimated, as in Example 2, by the detection technique previously described in patent FR 91 09057: a certain reaction volume is taken, denatured at alkaline pH, the pH is neutralized and 501l1 samples at different dilutions are deposited in the wells of a microtiter plate on whose walls the capture oligonucleotide (A25) is fixed. The peroxidase-coupled oligonucleotide detection probe (A28) is added, and, after incubation and washing, the (A28) -peroxidase probe hybridized to the restriction fragment of Voligonucleotide (2) is revealed by reaction with the ortho phenylene diamine, and the optical density at 492 nm is measured.

By introducing into the reaction 5 pmoles of the target oligonucleotide (5), all 5 pmoles of oligonucleotide (1) / oligonucleotide (2) capture complex undergoes a restriction of about 10% of the molecules. The signal obtained is equal to the signal produced by 0.5 pmoles of oligonucleotide (2) and oligonucleotide (6). The method produces at least 10 times more oligonucleotide complex (oligonucleotide (2) cut than target introduced into the medium, since the introduction of 0.5 pmoles of target oligonucleotide (5) produces the same maximum signal. the method produces at least 100 times more target-cut oligonucleotide (1) / oligonucleotide (2) complex introduced into the medium, since the introduction of 0.05 pmoles of target oligonucleotide (5) produces the same maximum signal. The method produces even at least 1000-fold more oligonucleotide complex (cut-off oligonucleotide (2) than target introduced into the medium, since the introduction of 0.005 pmoles of target oligonucleotide (5) produces the same maximum signal. 0.0005 pmol of oligonucleotide target (5) induces a signal two times weaker than the maximum signal, which proves that in fact the amplification of the number of oligonucleotide complexes (Yoligonucleotide (2) cut compared to the name number of target molecules is a factor of 5. 103
TABLE 2

<tb><SEP> DO <SEP> to <SEP> 492 <SEP> nm
<tb><SEP> no <SEP> diluted <SEP> 1/10 <SEP> 1/100
<tb><SEP> 0 <SEP> 0 <SEP> 0 <SEP> 0
<tb> concentrations <SEP> 5 <SEP> 1.9 <SEP> 0.2 <SEP> 0
<tb> Oligonucleotide <SEP> (5) <SEP> 0.5 <SEP> 1.9 <SEP> 0.2 <SE> O <SEP>
<tb> pmoles / 50 <SEP> Cll <SEP> 0.05 <SEP> 1.9 <SEP> 0.2 <SE> O <SEP>
<tb><SEP> 0.005 <SEP> 1.9 <SEP> 0.2 <SE> O <SEP>
<tb><SEP> 0.0005 <SEP> 0.9 <SEP> 0.1 <SE> O <SEP>
<tb> concentration <SEP> 50 <SEP>> 2 <SEP>> 2 <SEP> 1,8
<tb> Oligonucleotide <SEP> (2) <SEP> + <SEP> (6) <SEP> 5 <SEP>> 2 <SEP> 1.7 <SEP> 0.2
<tb> pmoles / 50 l <SEP> 0.5 <SEP> 1.9 <SEP> 0.2 <SEP> 0 <SEP>
<tb><SEP> 0.05 <SEP> 0.5 <SEP> O <SE> O <SEP>
<Tb>

Claims (5)

 1. System for detecting a target nucleic acid sequence according to an enzymatic restriction amplification method, characterized in that it comprises a set of two partially double-stranded nucleic acid probes (1,2) fixed on a solid support (3), said probes comprising a first strand which contains the sequence of the endonuclease recognition site and which extends to the site of cleavage of said first strand by said endonuclease, and a second strand comprising a complementary portion of said first endonuclease strand extending from at least said recognition site to the cut-off site of the first strand, said second strand extending beyond said cut-off site by a single-strand portion, said single-strand portion being, for one of probes (or first probe) (1) substantially complementary to the target nucleic acid sequence, and for the other probe (or second probe) (2) substantially complementary, and preferably perfectly compliant said single-stranded cleavage product of said first probe by said endonuclease, said single-stranded portions of said probes having a free end 3 'for one of. probes and 5 'for the other probe, and said endonuclease being a double-stranded and protruding cutoff type II restriction endonuclease, and whose cleavage site is located outside the recognition site.  2. Detection system according to claim 1, characterized in that the single-strand portion of said probes comprises at least 6 nucleotides.  3. System according to claim 1 or 2, characterized in that the single-strand portion of said probes comprises at most 100 nucleotides.  4. A method for detecting the presence of a target nucleic acid sequence in a sample, in a liquid medium, characterized in that it comprises:  contacting the sample with the probe system (1,2) as defined in any one of claims 1 to 3, and with the endonuclease,  incubating at an appropriate temperature for a time sufficient to allow the endonuclease-cleaved fragments to be recycled until the desired amplification rate is achieved,  and detection, according to the usual methods, of the cleavage of the capture probes resulting from the hybridization of the target sequence when this was present in the sample.  5. Method according to the preceding claim, characterized in that one operates at a  constant temperature, close to the optimum activity temperature of said endonuclease.