ES2819277T3 - Directed Sequencing and UID Filtering - Google Patents

Abstract

A method of generating a polynucleotide library comprising: (a) generating a first complement sequence (CS) of a target polynucleotide from a sample using a first primer, the first primer comprising a target specific sequence; (b) linking by ligation to the first CS an adapter comprising a first primer binding sequence (PBS) or a part thereof, thereby forming a modified complement sequence (MCS); (c) extending a second primer hybridized to the MCS, thereby forming a second CS, wherein the second primer comprises: (i) a specific target region, and (ii) a second PBS; and (d) amplifying the second CS using primers that hybridize to the first PBS and the second PBS respectively, wherein the first or second primer comprises a unique identification sequence (UID).

Description

DESCRIPTION

Directed Sequencing and UID Filtering

BACKGROUND

Many current next generation sequencing (NGS) technologies use a form of sequencing by synthesis (SBS). NGS technologies have the ability to massively sequence millions of DNA templates in parallel. To achieve high throughput, many millions of single-stranded molds are grouped together on one chip and the sequence of each mold is read independently. Second generation NGS platforms clonally amplify DNA templates on a solid support, followed by cyclic sequencing. Third-generation NGS platforms employ single-molecule PCR-free and cycle-free chemistry-free protocols (Schadt et al., Hum Mol Genet., 19 (R2): R227-40, (2010)).

The main limitations of NGS procedures and other high-throughput sequencing procedures include sequencing and amplification errors and biases. Due to errors and biases associated with amplification and sequencing, these sequencing technologies deviate from the ideal uniform distribution of readings and can affect many medical and scientific applications. For clinical applications, laboratories must verify the accuracy of a mutation or a single nucleotide polymorphism (SNP) reading before reporting a patient. Typically, sequence verification is performed by making a Sanger library of the target after obtaining the sequences and "Sanger scoring" the next generation sequencing (NGS) results. To overcome the higher error rate of NGS platforms compared to traditional Sanger sequencing, a high level of redundancy or sequence coverage is required to accurately read nucleotide sequences. Typically, 30-50x coverage is required for accurate nucleotide reads, although this may vary based on the accuracy of the sequencing platform, variant detection procedures, and the material being sequenced (Koboldt DC et al. , Brief Bioinform., 11: 484-98 (2010)). In general, all second-generation platforms produce data of similar accuracy (98-99.5%), relying on adequate sequence depth (eg, coverage) to perform nucleotide sequences of higher accuracy.

Sequencing bias can manifest as coverage bias (deviation from a uniform distribution of reads) and error bias (deviations from uniform mismatch, insertion, and deletion rates). Current sequencing technologies are limited because the chemistries used in high-throughput sequencing procedures are inherently biased. Some nucleotide sequences are read more frequently than other sequences and have an inherent error rate. Depending on many factors, including the sequencing platform used, misreadings (most of which are misidentified bases due to poor quality nucleotide sequences) can occur anywhere in the range of one error per 100- 2000 bases. While coverage bias is an important sequencing measure, variations in sequence accuracy are also important.

Another important limitation is PCR amplification bias, because conditions during construction of the nucleotide template library for sequencing can significantly influence sequencing bias. PCR amplification for library construction has been shown to be a source of sequencing data error (Keohavong P et al., PnAs 86: 9253-9257 (1989); Cariello et al., Nucleic Acids Res., 19 : 4193-4198 (1991); Cline et al., Nucleic Acids Res., 24: 3546-3551 (1996)). Library construction procedures can affect the uniformity of coverage. For example, PCR amplification is also a known source of GC end region undercoverage during library construction (Aird et al., Genome Biol., 12: R18 (2011); Oyola et al., BMC Genomics, 13: 1; 22 (2012); Benjamini et al., Nucleic Acids Res., 40: e72 (2012)). Similar biases can also be introduced during bridge PCR for cluster amplification, and on some NGS platforms, strand-specific errors can lead to coverage biases by affecting aligner performance (Nakamura et al., Nucleic Acids Res., 39: e90 (2011)). Other platforms using terminator-free chemistry may be limited in their ability to accurately sequence long homopolymers, and may also be sensitive to coverage biases introduced by emulsion PCR in library construction (Rothberg et al., Nature, 475: 348-352 (2011); Margulies et al., Nature 2005, 437: 376-380 (2005); Huse et al., Genome Biol., 8: R143 (2007); Merriman et al., Electrophoresis , 33: 3397-3417 (2012)). Hashimony et al., Cell reports vol. 2, No. 3 pp. 666-673 (2012), Head et al. BIOTECHNIQUES vol. 56, No. 2, p. 61 (2014), and WO2013 / 13051 2 A2 have recently suggested improvements.

SUMMARY

The present invention provides a method of generating a polynucleotide library comprising:

(a) generating a first complement sequence (CS) of a target polynucleotide from a sample using a first primer, the first primer comprising a target specific sequence;

(b) linking by ligation to the first CS an adapter comprising a first primer binding sequence (PBS) or a part thereof, thereby forming a modified complement sequence (MCS);

(c) extending a second primer hybridized to the MCS, thereby forming a second CS, wherein the second primer comprises:

(i) a specific target region, and

(ii) a second PBS; Y

(d) amplifying the second CS using primers that hybridize to the first PBS and the second PBS respectively, wherein the first or second primer comprises a unique identification sequence (UID).

The first primer can comprise a universal ligation sequence (ULS). The second primer further comprises a universal priming sequence (UPS). The adapter may further comprise a sample bar code (SBC) sequence. The MCS may further comprise an affinity molecule or a capture sequence.

In one embodiment, the UID comprises the sequence NNNNNNNNNNNNNNN (SEQ ID NO: 1), where N is any nucleic acid residue. In another embodiment, the UID comprises the sequence NNNNNWNNNNNWNNNNN (SEQ ID NO: 2), where N is any nucleic acid residue and W is adenine or thymine.

BRIEF DESCRIPTION OF THE DRAWINGS

The novel characteristic features described herein are set forth with particularity in the appended claims. A better understanding of the characteristic features and advantages of the characteristic features described herein will be obtained by referring to the following detailed description which sets out illustrative examples, using the principles of the characteristic features described herein, and the accompanying drawings, in which:

FIG. 1 depicts a schematic of an exemplary procedure for targeted sequencing described herein.

FIG. 2 depicts a schematic of an exemplary procedure for targeted sequencing described herein.

FIG. 3 depicts a schematic of an exemplary process for generating improved targeted sequencing procedures. Processing times are represented.

FIG. 4 depicts a table showing percent target specificity using the indicated primer panels from the unimproved and enhanced targeted sequencing procedures described herein and compared to other primer panels known in the art (Other # 1 and another No. 2). The Tex-1 panel is a panel carrying 23 genes (all exon). CS-23 is a primer panel focused on rsSNP for 18 genes.

FIG. 5 represents a coverage chart of target reading with the indicated reaction conditions. The fraction of genes above coverage versus depth of reading is shown with the indicated reaction conditions. Conditions that have a positive effect on sequence coverage are shown in bold.

FIG. 6A depicts schemes of ramping and hybridization conditions for the indicated steps of an exemplary procedure for targeted sequencing under less stringent conditions used for a panel of 30 primers.

FIG. 6B represents the primer concentrations in a panel of approximately 350 primers used under the 6A ramping and hybridization conditions that were insufficient to generate sufficient target production.

FIG. 7 depicts exemplary procedure schemes for targeted sequencing under less stringent ramping and hybridization conditions (top) and more stringent (bottom). Stringency was increased by decreasing the ramp rates for the second primer extension stage. Stringency was increased by adding a 68 ° C retention step for the first primer extension step. The stringency was increased by reducing the minimum annealing temperature to 55 ° C.

FIG. 8 represents the primer concentrations and the results where the concentration per primer was set (Group 1) and where the total concentration of primers (Group 2) was set using the complete, middle, fourth or small fraction of primers from a panel of approximately 350 primers under the less stringent conditions depicted in FIG.

8.

FIG. 9A depicts the products after the indicated PCR cycles of an exemplary targeted sequencing procedure on an agarose gel along with a 100 base pair (bp) ladder with no added additives. I know show the target product and the dimer product.

FIG. 9B depicts the products after the indicated PCR cycles of an exemplary targeted sequencing procedure on an agarose gel along with a 100 base pair (bp) ladder with the additive betaine. The target product and the dimer product are shown. FIG. 9C represents the products after the indicated PCR cycles of an exemplary targeted sequencing procedure on an agarose gel along with a 100 base pair (bp) ladder with the additive trehalose. The target product and the dimer product are shown. FIG. 9D depicts the products after the indicated PCR cycles of an exemplary targeted sequencing procedure on an agarose gel along with a 100 base pair (bp) ladder with the additive magnesium chloride. The target product and the dimer product are shown. FIG. 9E represents the products after the indicated PCR cycles of an exemplary directed sequencing procedure on an agarose gel along with a 100 base pair (bp) ladder with the additive ammonium sulfate. The target product and the dimer product are shown.

FIG. 10 depicts the products after 33 indicated PCR cycles of an exemplary targeted sequencing procedure on an agarose gel along with a 100 base pair (bp) ladder under the indicated conditions.

FIG. 11 depicts a dimer sequence analysis plot of sequence length versus sequence length. The sequenced corresponding dimer products are shown on the agarose gel to the right. FIG. 12 depicts a diagram depicting the proposed mechanism of unwanted product formation during the second primer extension step as determined by dimer sequencing analysis. Dimer formation is facilitated by high melting temperature primers at low annealing temperature. Dimer formation is facilitated by high GC primers that interact with UID. The figure discloses SEQ ID NO: 90-91, 92, 91 and 93, respectively, in order of appearance.

FIG. 13 represents a table showing the genes and associated diseases, the number of exons and the number of probe sets of the exemplary CS-350 primer panel. The list of unprimed exons to the right indicates exons for which no primer sequences were produced using primer design procedures other than those described herein.

FIG. 14 depicts a diagram of exclusion criteria used to generate primer subpanels from a primer panel containing approximately 350 primers.

FIG. 15A depicts a graph showing target specificity and coverage uniformity at a 100x cutoff of the indicated primer panel of approximately 350 primers and subpanels generated therefrom using the exclusion criteria shown in FIG. 14.

FIG. 15B represents a table showing target specificity, coverage uniformity, and mean reading depth per amplicon at a 100x cutoff of the indicated primer panel of approximately 350 primers and subpanels generated therefrom using the exclusion criteria. shown in FIG. 14.

FIG. 16 represents a graph showing the uniformity of coverage over the in silico cutoff range of the indicated panel of approximately 350 primers and subpanels generated therefrom using the exclusion criteria shown in FIG. 14.

FIG. 17A depicts a graph showing the target specificity of an exemplary procedure for targeted sequencing, described herein using three different UIDs (BC_01, BC_02, BC_03).

FIG. 17B depicts the post-PCR products of an exemplary targeted sequencing procedure described herein using three different UIDs.

FIG. 17C represents a table with the corresponding values from FIG. 17A.

FIG. 18 represents a graph of the percent amplicons greater than 20% of the mean over the indicated in silico cutoff interval showing the uniformity of coverage of an exemplary procedure for targeted sequencing, described herein using three different UIDs.

FIG. 19 represents a graph that compares raw reads (without UID) with the improved accuracy of UID. FIG. 20 depicts a schematic of the SNP detection and sequence analysis workflow using an exemplary procedure for targeted sequencing.

FIG. 21 depicts a graph and a corresponding table showing the relative percentage of SNP nucleotide sequences that match between samples using an exemplary method for targeted sequencing, described herein using the indicated UIDs. Cycle reduction with BC_6 resulted in a greater number of unique molecules.

FIG. 22A depicts a graph of percent read from each amplicon versus% GC content of amplicon using an exemplary procedure for targeted sequencing, described herein. A large number of underperforming executors are present in Group A.

FIG. 22B depicts a graph of each amplicon percent read versus% GC content of amplicon using an exemplary procedure for targeted sequencing, described herein.

FIG. 23A represents a graph of low-yield amplicons mapped by their respective primer melting temperature.

FIG. 23B represents a graph of low-yield amplicons mapped by their respective primer melting temperature.

FIG. 24 represents a graph of low, medium and high yield amplicons mapped by their respective primer melting temperature.

FIG. 25 depicts a table summarizing the setup for an improved primer design for use in procedures for targeted sequencing.

FIG. 26 depicts schemes of improved off-target hit reading criteria for use in procedures for targeted sequencing.

FIG. 27 depicts an improved primer design scheme for use in directed sequencing procedures. An improved primer design is to add an intron buffer sequence of approximately 20 nt. An improved primer design consists of evenly divided exons for better coverage and greater flexibility.

FIG. 28 represents a graph showing an improved primer panel (v.3.0) designed using the primer design procedure described herein compared to the primer panel designed using a prior art procedure (v. 1.0). The improved panel results in higher amplification efficiency and increases the number of unique molecules detected, leading to improved SNP read capabilities, a reduction in sequencing coverage requirements, and reduced sample input requirements.

FIG. 29 depicts a graph comparing the uniformity of coverage of primers in the indicated sub-panel that meet the improved primer design criteria versus the primers in the same sub-panel that do not meet the improved primer design criteria. Primers in the subpanel that meet the improved primer design criteria demonstrate greater uniformity of coverage, greater target specificity, and higher read counts.

FIG. 30A depicts a graph showing whole blood sample performance with respect to uniformity and coverage and target specificity compared to a DNA sample drawn from whole blood.

FIG. 30B depicts the products after the indicated PCR cycles of an exemplary targeted sequencing procedure using the indicated volumes of a whole blood sample on an agarose gel along with a 100 base pair (bp) ladder. As little as 1 pL of whole blood can be used.

FIG. 31 represents a graph (top) and the corresponding table (bottom) of an analysis comparing the number of amplicons with more than 10 unique molecules from a whole blood sample and a DNA sample drawn from whole blood. The 3x whole blood sample combines first three primer extension reactions prior to adapter ligation.

FIG. 32 represents graphs showing differences in SNP readings between a whole blood sample and a DNA sample drawn from whole blood. The top graph shows the SNP readings missed using the whole blood sample. The top graph shows the missed SNP readings using the DNA sample drawn from whole blood. The figure discloses SEQ ID NO: 94-95, 94-96 and 96-97, respectively, in order of appearance.

FIG. 33 represents a graph showing the performance of the FFPE prostate tissue sample with respect to uniformity and coverage and target specificity compared to a whole blood sample and a DNA sample drawn from whole blood.

FIG. 34 depicts the products of an exemplary targeted sequencing procedure using a variety of samples on an agarose gel along with a 100 base pair (bp) ladder. The procedures described herein can be adapted to a variety of samples including direct entry of whole blood or saliva in the first primer extension reaction without prior nucleotide extraction, buccal samples and samples. by FFPE.

FIG. 35 represents a graph (top) and the corresponding table (bottom) of an analysis comparing the number of amplicons with more than 10 unique molecules from a FFPE sample, a whole blood sample, and a DNA sample drawn from whole blood . The 3x whole blood sample combines first three primer extension reactions prior to adapter ligation.

FIG. 36 represents a graph of the number of unique molecules detected using the indicated number of PCR cycles and the indicated UIDs. The graph demonstrates that reducing the number of PCR cycles prevents the formation of larger overamplified products, reduces PCR duplication, can allow reductions in the required sequencing depth, can improve data for low-input samples, and can take advantage of the linear amplification to compensate for reduced PCR cycles.

FIG. 37 depicts a graph depicting the quality of sequencing data using a library produced from an exemplary targeted sequencing procedure that has been gel purified compared to a library that has been Ampure purified.

FIG. 38 represents a graph of an in silico read titration showing the percentage of amplicons with single molecule coverage greater than or equal to 10. Sequencing at an average reading depth of 500x per amplicon provided adequate single molecule coverage for the 95% of the amplicon in primer panel Tex_01 (336 amplicons). This can allow multiplexing of 90 samples per run (336 x 500 = 168,000 reads).

FIG. 39 represents a table of the expected and actual number of sequences for each barcoded sample and the percentage of total sequence reads per barcoded sample.

FIG. 40 represents a copy number quantification graph showing the proportion of unique molecules captured per gene. The ratio of unique reads (filtered by UID) for a given gene was compared for genes on autosomal versus X chromosomes. The ratio of reads between a male reference patient and three test patients is depicted. This demonstrates the quantitative ability of using UID analysis for targeted sequencing.

FIG. 41 depicts a schematic of an exemplary RNA-based procedure for directed primer extension sequencing with a demonstrated ability to amplify products greater than 700 bp in length.

FIG. 42A depicts the products of an exemplary RNA directed sequencing procedure following the indicated PCR cycles using the indicated RNA input amounts on an agarose gel along with a 100 base pair (bp) ladder.

FIG. 42B represents an exemplary list of targets to which the exemplary directed RNA sequencing procedures described herein have been successfully applied.

FIG. 43 depicts the products of an exemplary directed sequencing procedure on an agarose gel along with a 100 base pair (bp) ladder performed as technical repeats. This demonstrates the reproducibility of the procedures described herein.

FIG. 44 depicts an exemplary primer design software scheme developed to produce primer panels.

FIG. 45A represents an amplicon percentage curve greater than 20% of the mean over the indicated in silico cutoff interval that shows the uniformity of coverage of an exemplary procedure for targeted sequencing described herein using a primer sub-panel in the coverages. indicated fold readings normalized to an average of 100x.

FIG. 45B depicts a graph comparing the uniformity of coverage of the indicated primer panel of approximately 350 primers and a sub-panel generated therefrom using the exclusion criteria shown in FIG. 15 and other procedures described in this document.

FIG. 46 represents a graph that summarizes the quality measures of the procedures described in this document.

FIG. 47 depicts the products of the directed DNA sequencing procedure on a 2% agarose gel along with a 100 base pair (bp) ladder. Samples from 2 patients (B1 and B2) are shown after the indicated PCR amplification cycles.

FIG. 48 represents products of a directed RNA sequencing procedure on a 2% agarose gel together with a 100 bp straight. Samples from 2 patients (B1 and B2) are shown after the indicated PCR amplification cycles. For each patient, a titration of the starting RNA input material was made from 1000 ng to 1 ng.

FIG. 49 depicts histograms of results using a Next Generation Post Sequencing (NGS) data filtering process using a directed sequencing procedure. The histogram in FIG. 49B is a logarithmic scale version of 49A. NGS was performed using a paired end reading approach (R1 and R2), providing a total of ~ 6 million readings for the sample shown. Sequences with a Q phred score of 30 or higher (R1 and R2 approved quality) were also analyzed. The sequence data was then queried to determine the presence of an expected primer panel used in the DNA directed library protocol (approved primer R1 and R2). Any sequence read that did not start with one of the expected primer sequences was discarded. For each read with a known or expected primer sequence in R1, the expected primer in R2 (paired R1 and R2) was scored. Therefore, when a known R1 primer does not match a different target primer in R2 (or vice versa), it corresponds to a non-specific amplification product (shown in light gray). If a known R1 primer does not match a different target primer on R2 (or vice versa), it corresponds to a specific amplification product (shown in dark gray).

FIGS. 50A-50C represent graphs of DNA targeted panel sequencing read counts. Each indicated gene was driven by a specific primer pair used in DNA sample preparation. FIG. 50A shows graphs of DNA targeted panel sequencing read counts using a first pair of primers (BC3) without a UID (left) and with a UID (right). FIG. 50B shows graphs of DNA targeted panel sequencing read counts using a second primer pair (BC1) without a UID (left) and with a UID (right) using a targeted sequencing procedure. FIG. 50C shows a plot of DNA targeted panel sequencing read counts using a targeted sequencing procedure with subsequent UID filtering.

FIGS. 51A-51B depict RNA targeted panel sequencing read count using a UID filtering targeted sequencing procedure. Each indicated gene transcript was driven by a specific primer pair used in RNA sample preparation. FIG. 51A depicts a plot of RNA targeted panel sequencing read counts (left) and a plot of sequencing read frequencies (right). FIG.51B is a logarithmic scale version of the graph shown in FIG.51A (left) of sequencing read frequencies. Data shown here represents post-count read / expression filtering.

FIG. 52 depicts a graph of the results of a target specificity analysis for the indicated targets and conditions using a targeted sequencing procedure. Various protocol conditions (number of cycles, buffers, hybridization conditions, etc.) were tested. As shown, 99.2% target specificity was achieved under some conditions. (eg 99.2% of the sequencing reads were the desired target with minimal non-specific amplification).

FIG. 53 represents a UID distribution plot for the indicated targets and conditions using a directed sequencing procedure with UID filtering. Various protocol conditions (number of cycles, buffers, hybridization conditions, etc.) were tested. The number of raw sequences per UID may vary depending on the conditions used.

FIG. 54 represents a graph of the assumed increase in the sequencing accuracy phred score (Q) relative to the number of reads per UID sequence using a directed sequencing procedure with UID filtering.

FIG. 55 depicts a graph showing improvement in accuracy for each indicated target using a targeted sequencing procedure when UID filtering is applied.

FIG. 56 depicts a graph of UID consensus analysis and SNP genotyping analysis accuracy using a UID filtering directed sequencing procedure. Various DNA target regions (y-axis) were tested against various experimental conditions (x-axis). The consensus sequence for each indicated target is shown in gray, and the mutation / SNP is shown in white. Homozygous genes are dominated by gray. Heterozygous genes are indicated by approximately ~ 50% of their sequences showing a common sequence blank. Mutations and indels caused by PCR or sequencing errors are shown in black.

FIG. 57 depicts a GBA gene sequence analysis using a UID filtering directed sequencing procedure. Both alleles of the GBA gene from a patient sample were aligned using Clustal W. The patient shows heterozygosity after UID filtering. Both alleles were compared to the Ensembl human genome reference. The lack of a "*" denotes a mismatch alignment between one of the 3 sequences. The GBA gene from the patient presented here has an allele identical to the human reference genome, and a second allele with 6 observed sequence polymorphisms / mutations. The figure discloses SEQ ID NO: 98-100, respectively, in order of appearance.

FIG. 58 represents the SNP genotyping analysis of the GBA gene in the same patient analyzed in FIG. 12.

The data presented here show the location of a pathogenic SNP present on the GBA gene target (rs1064644) discovered using the directed sequencing procedures with UID filtering described herein.

FIG. 59 is a block diagram illustrating a first exemplary architecture of a computer system that can be used in connection with exemplary embodiments of the present invention.

FIG. 60 is a diagram illustrating a computer network that can be used in connection with exemplary embodiments of the present invention.

DETAILED DESCRIPTION

As used herein, amplification comprises performing an amplification reaction. A product of a primer extension reaction can comprise the primer sequence together with the template complement produced during primer extension. In some embodiments, the amplification reactions comprise the extension of two primers, each hybridized to a complementary strand of a polynucleotide. Polynucleotide amplification can be accomplished by any means known in the art. Polynucleotides can be amplified by polymerase chain reaction (PCR) or by isothermal DNA amplification.

An amplification reaction can comprise one or more additives. In some embodiments, the one or more additives are dimethylsulfoxide (DMSO), glycerol, betaine (mono) hydrate (W, W, W-trimethylglycine = [caroxymethyl] trimethylammonium), trehalose, 7-Deaza-2'-deoxyguanosine triphosphate (dC7GTP or 7-deaza-2'-dGTP), BSA (bovine serum albumin), formamide (methanamide), ammonium sulfate, magnesium chloride, tetramethylammonium chloride (TMAC), other tetraalkylammonium derivatives (e.g. chloride tetraethylammonium (TEA-Cl) and tetrapropylammonium chloride (TPrA-Cl), non-ionic detergent (for example, Triton X-100, Tween 20, Nonidet P-40 (NP-40)) or PREXCEL-Q. In some modes In embodiment, an amplification reaction may comprise 0, 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 different additives. In other cases, an amplification reaction may comprise at least 0, 1,2 , 3, 4, 5, 6, 7, 8, 9 or 10. In some embodiments, an extension, reverse transcription or amplification reaction comprising one or more additives is can be characterized by an increase.

As used herein, a polymerase chain reaction (PCR) comprises an in vitro amplification reaction of specific polynucleotide sequences by simultaneous extension of complementary strand primers of a double-stranded polynucleotide. PCR reactions produce copies of a template polynucleotide flanked by primer binding sites. The result, with two primers, is an exponential increase in the number of copies of the template polynucleotide of both strands with each cycle, because with each cycle both strands replicate. The polynucleotide duplex has ends corresponding to the ends of the primers used. PCR can comprise one or more repeats of denaturing a template polynucleotide, hybridizing primers at primer binding sites, and extending the primers via a DNA or RNA polymerase in the presence of nucleotides. The particular temperatures, the durations in each stage and the rates of change between stages depend on many factors well known to those of skill in the art. (McPherson et al., IRL Press, Oxford (1991 and 1995)). For example, in a conventional PCR using Taq DNA polymerase, a double-stranded template polynucleotide can be denatured at a temperature> 90 ° C, the primers can hybridize at a temperature in the range of 50-75 ° C, and the primers they can be extended at a temperature in the range of 72-78 ° C. In some embodiments, the PCR comprises reverse transcription PCR (RT-PCR), real-time PCR, PCR with internal primers, quantitative PCR, multiplexed PCR, or the like. In some embodiments, the PCR does not comprise RT-PCR. (US Patent Nos. 5,168,038, 5,210,015, 6,174,670, 6,569,627, and 5,925,517; Mackay et al., Nucleic Acids Research, 30: 1292-1305 (2002)). RT-PCR comprises a PCR reaction preceded by a reverse transcription reaction and a resulting cDNA is amplified, PCR with internal primers comprises a two-stage PCR in which an amplicon from a first PCR reaction using a first set of primers are converted into the sample for a second PCR reaction using a second set of primers, at least one of which binds to an interior location of an amplicon from a first PCR reaction. Multiplexed PCR comprises a PCR reaction, in which a plurality of polynucleotide sequences are subjected to PCR in the same reaction mixture simultaneously. PCR reaction volumes can be anywhere from 0.2 nL-1000 pL. Quantitative PCR comprises a PCR reaction designed to measure an absolute or relative amount, abundance, or concentration of one or more sequences in a sample. Quantitative measurements can include comparing one or more reference or standard sequences to a polynucleotide sequence of interest. (Freeman et al., Biotechniques, 26: 112-126 (1999); Becker-Andre et al., Nucleic Acids Research, 17: 9437-9447 (1989); Zimmerman et al., Biotechniques, 21: 268-279 ( 1996); Diviacco et al., Gene, 122: 3013-3020 (1992); Becker-Andre et al., Nucleic Acids Research, 17: 9437-9446 (1989)).

As used herein, an allele can be a specific genetic sequence within a cell, individual, or population that differs from other sequences of the same gene in the sequence of at least one variant site within the sequence of the gene. Variant site sequences that differ between different alleles can be variants, such as polymorphisms or mutations. Variants can comprise point mutations, polymorphisms, single nucleotide polymorphisms (SNPS), single nucleotide variations (SNV), translocations, insertions, deletions, amplifications, inversions, interstitial deletions, copy number variations (CNV), loss heterozygosity or any combination thereof. A sample is "heterozygous" at one chromosomal locus if it has two different alleles at that locus. A sample is "homozygous" at a chromosomal locus if it has two identical alleles at that locus.

In some embodiments, variants can include changes that affect a polypeptide, such as a change in the level of expression, sequence, function, location, ligands, or any combination thereof. In some embodiments, a genetic variation can be a frame shift mutation, terminator mutation, amino acid mutation, neutral mutation, or silent mutation. For example, sequence differences, when compared to a reference nucleotide sequence, can include the insertion or deletion of a single nucleotide, or of more than one nucleotide, resulting in a reading frame shift; the change of at least one nucleotide, resulting in a change in the encoded amino acid; the change of at least one nucleotide, resulting in the generation of a premature stop codon; the deletion of several nucleotides, resulting in a deletion of one or more amino acids encoded by the nucleotides; the insertion of one or more nucleotides, such as by uneven recombination or gene conversion, resulting in a break in the coding sequence of a reading frame; duplication of all or part of a sequence; transposition; or a rearrangement of a nucleotide sequence. Such sequence changes can alter the polypeptide encoded by the nucleic acid, for example, if the change in the nucleic acid sequence causes a reading frame shift, the reading frame shift may result in a change in the encoded amino acids. and / or may result in the generation of a premature stop codon, which causes the generation of a truncated polypeptide. In some embodiments, a variant can be a synonymous change in one or more nucleotides, eg, a change that does not result in a change in amino acid sequence. Such polymorphism can, for example, alter splice sites, affect the stability or transport of mRNA, or otherwise affect the transcription or translation of an encoded polypeptide. In some embodiments, a synonymous mutation can result in the polypeptide product having an altered structure due to the use of rare codons that affects the folding of the polypeptide during translation, which in some cases can alter its function and / or properties. drug binding if it is a drug target. In some embodiments, changes that can alter DNA increase the possibility of structural changes, such as amplifications or deletions, occurring at the somatic level.

As used herein, a polymorphism can be an occurrence of two or more alternative genetically determined sequences or alleles in a population. A polymorphic or site comprises the locus at which the divergence occurs. In some embodiments, the polymorphisms occur at a frequency of less than 0.5%, 1%, 2%, or 5%. In some embodiments, the polymorphisms occur at a frequency greater than 1%, 5%, 10%, 20%, or 30%. In some embodiments, the biomarkers have at least two alleles, each of which occurs at a frequency greater than 1%, 5%, 10%, or 20% in a selected population. In some embodiments, the polymorphisms comprise viral or bacterial sequences and occur at a frequency of less than 0.5%, 1%, 2%, or 5% in a selected population. A polymorphism can include one or more variants that include base changes, insertions, repeats, or deletions of one or more bases. Polymorphisms can include single nucleotide polymorphisms (SNPs). Copy number variants (CNVs), transversions, and other rearrangements are also forms of variants. Polymorphisms include restriction fragment length polymorphisms, variable number of tandem repeats (VNTRs), hypervariable regions, minisatellites, dinucleotide repeats, trinucleotide repeats, tetranucleotide repeats, single sequence repeats, and insert elements. The most frequent allele sequence in a selected population may be the wild-type allele. Diploid organisms can be homozygous or heterozygous for alleles.

As used herein, genotyping comprises determining the genetic sequence of a subject at one or more genomic positions. For example, genotyping may include determining which allele or alleles a subject has for a single SNP or two or more Np s. A diploid subject can be homozygous for each of the two possible alleles or heterozygous. Heterozygous normal cells at one or more loci can give rise to homozygous tumor cells at those loci. This loss of heterozygosity (LOH) can be the result of the deletion of normal genes, the loss of the chromosome that carries the normal gene, mitotic recombination or the loss of a chromosome with a normal gene, and the duplication of a chromosome with a gene deleted or inactivated. LOH can be copy-neutral or it can be the result of a deletion or amplification.

As used herein, a subject, an individual, and a patient include living organisms such as mammals. Examples of subjects and hosts include, but are not limited to, horses, cows, camels, sheep, pigs, goats, dogs, cats, rabbits, guinea pigs, rats, mice (eg, humanized mice), gerbils, non-human primates. (eg, macaques), humans, and the like, non-mammals, including, for example, non-mammalian vertebrates, such as birds (eg, chickens or ducks), fish (eg, sharks), or frogs (eg, Xenopus ) and non-mammalian invertebrates, as well as transgenic species thereof. In certain respects, a subject refers to a single organism (eg, human). In certain aspects, either a group of individuals is provided that make up a small cohort having an immune factor common to the study and / or disease, and / or a cohort of individuals without the disease (eg, negative / normal control). A sampled subject may be given a disease and / or disorder (eg, one or more allergies, infections, cancers, or autoimmune disorders or the like) and can be compared to a negative control subject that is not seen affected by the disease.

GENERAL DIRECTED SEQUENCING PROCEDURES

The procedures described herein can be used to generate a polynucleotide library for sequencing. The determined sequence for a polynucleotide in a sample can be determined with high accuracy and confidence in nucleotide sequences from sequencing. The methods can specifically comprise, target, encode, modify, amplify, sequence and / or uniquely quantify DNA or RNA sequences present in the sample. These procedures allow the addition of sequences that can format a library of polynucleotide amplicons for sequencing or other molecular analysis. The sequencing library produced by these procedures can incorporate a UID that can allow pooling of sequence reads derived from the same initial RNA or DNA molecule in the sample. These procedures can make it possible to determine whether an observed sequence variant found in a population of a Rn or Dn molecules is a true polymorphism or mutation, or the sequence variant observed as a result of an amplification artifact, such as an error or bias of amplification. In any of the procedures described herein, it is contemplated that UID is optional. Therefore, any mention of "UID" refers to an optional UID.

These include procedures for preparing a library of polynucleotides generated using target specific primers to be sequenced on an NGS platform. Many biological targets, such as those from a biological patient sample, can be analyzed from the NGS compatible library after sequencing. The procedures allow the identification of target frequencies (eg, gene expression or allelic distribution). The methods also allow the identification and mutations or SNPs in a genome or transcriptome, such as those of a diseased or non-diseased subject, from which exact sequence information can be derived. The methods also allow the presence or absence of contamination or infections to be determined in a biological sample from a subject, such as by using primers specific to target for exogenous organisms or viruses, such as a bacterium or a fungus.

The procedures described herein offer an advantageous balance of sensitivity and specificity and advantages conferred by linear primer extension and / or UID labeling reactions. In some embodiments, the procedures are designed for smaller panel sizes, such as panels of clinical interest. These procedures can have very low initial costs, can be performed quickly, and can be modified for RNA or DNA targets. Furthermore, the design of primers for use in these procedures is not cumbersome and is similar to the ease of designing primers for standard PCR reactions. The procedures can be used to format polynucleotide libraries for a variety of sequencing and other molecular analyzes. Additionally, various applications can be carried out individually or simultaneously. For example, sequencing of targets required for cancer mutation profiling, SNP and mutation analysis, carrier testing, infection detection, disease diagnosis, and gene expression analysis can be performed on an individual basis. or simultaneous.

Initial targeting: formation of UID-labeled polynucleotides complementary to the target polynucleotides

Depending on the type of target polynucleotide to be analyzed, the procedures can use reverse transcription (RT) or primer extension (PE). A primer extension reaction can be a single primer extension step. A primer extension reaction can comprise extending one or more individual primers once. A primer extension reaction can comprise extending one or more individual primers in a single step. In some embodiments, polynucleotides complementary to DNA targets can be generated by performing primer extension reactions. For example, UID-labeled polynucleotides complementary to DNA targets can be generated by performing primer extension reactions. In some embodiments, complement sequences of target polynucleotides, such as UID-labeled polynucleotides complementary to RNA targets, can be generated by performing reverse transcription reactions. Complement sequences of target polynucleotides, such as UID-labeled polynucleotides complementary to RNA targets, can be generated by performing reverse transcription reactions. A target polynucleotide includes polynucleotides present in a sample initially.

As used herein, a "target polynucleotide complement sequence" is a polynucleotide comprising a sequence complementary to a target sequence or a complement thereof (complement of a sequence complementary to a target sequence). In some embodiments, a target polynucleotide complement sequence comprises a first complement sequence. A "first complement sequence" is a polynucleotide reverse transcribed from a target polynucleotide or formed from a primer extension reaction on a target polynucleotide. In some embodiments, a target polynucleotide complement sequence comprises a modified complement sequence. A "modified complement sequence" is a polynucleotide reverse transcribed from a target polynucleotide or formed from a primer extension reaction on a target polynucleotide, comprising an adapter. In some embodiments, a target polynucleotide complement sequence comprises a second complement sequence. A "second complement sequence" is a polynucleotide comprising a sequence complementary to a first complement sequence or modified complement sequence. In some modes In embodiment, a target polynucleotide complement sequence comprises a UID. For example, a first sequence of the complement may comprise a UID. For example, a modified complement sequence can comprise a UID. For example, a second sequence of the complement may comprise a UID. For example, a second complement sequence may comprise a sequence complementary to a UID of a first complement sequence or modified complement sequence. In some embodiments, a target polynucleotide complement sequence does not comprise a UID. For example, a first complement sequence may not comprise a UID. For example, a modified complement sequence may not comprise a UID. For example, a second complement sequence may not comprise a UID.

The procedures can comprise a reaction of RT or PE in a first step. The procedures may comprise a linear primer extension reaction at a later stage. A linear primer extension reaction can result in linear amplification rather than exponential amplification. For targeted sequencing of many polynucleotides, each individual target-specific primer may have some degree of variation in efficiency caused by variations in extension by various enzymes, or differences in the efficiency of hybridization to their respective targets. This can create a bias that can be exponentially extended by PCR. The procedures described herein may use linear primer extension to reduce or avoid this bias, which results in a reduction or avoidance of the frequency of variation of the targets relative to each other and can provide greater confidence and frequency, or analysis and accuracy of nucleotide sequences from sequencing. The procedures described herein have been found to avoid these bias problems and can maintain a true frequency representation of the initial set of targets. In some embodiments, the only exponential amplification reaction, such as a PCR reaction, performed in the procedures is in a final stage of library generation and may use a universal primer set. In these embodiments, all targets can be uniformly amplified during an exponential amplification step without introducing gene-specific variation or bias.

Reverse transcription ( RT of target polynucleotides to form UID-labeled complementary polynucleotides )

Using primers described herein, RNA polynucleotides can be reverse transcribed using suitable reagents known in the art. The RNA can comprise mRNA.

In some embodiments, a method comprises reverse transcription of a target RNA polynucleotide to form cDNA using one or more primers (RT primers). In some embodiments, an RT primer comprises an oligo-dT primer or a sequence specific primer. In some embodiments, a plurality of RT primers comprise one or more oligo-dT primers or one or more sequence-specific primers. In some embodiments, a reverse transcription reaction is the first step in generating a polynucleotide library from a sample containing a target polynucleotide. In some embodiments, a target polynucleotide is not subjected to RT-PCR. In some embodiments, a target polynucleotide does not undergo exponential amplification. In some embodiments, exponential amplification is not performed in the next step after reverse transcription. In some embodiments, exponential amplification is not performed in the next 2 steps after reverse transcription. In some embodiments, exponential amplification is not performed in the next 3 steps after reverse transcription. In some embodiments, the target polynucleotide cDNA produced from the reverse transcription step is not amplified further during this step. In some embodiments, the method comprises only one reverse transcription cycle. In other embodiments, the method comprises repeated reverse transcription of the target RNA molecule to produce multiple cDNA molecules, such as a first complement sequence that may contain a UID.

An RT primer may further comprise a region that is not complementary to a region of the RNA. In some embodiments, the RT primers may further comprise a UID. For example, each RT primer of a plurality of RT primers can comprise a different UID. This can allow a unique barcode for each of the cDNAs copied from the RNA molecules that are reverse transcribed. In some embodiments, the region of an RT primer that is not complementary to a region of the target RNA may comprise a UID. In some embodiments, the region of each RT primer of a plurality of RT primers that is not complementary to a region of the target RNA may comprise a UID. In some embodiments, the RT primers may further comprise a known sequence, such as a universal primer binding site or a sequence complementary to a universal primer site. In some embodiments, the RT primers may further comprise a phosphorylated 5 'end. In some embodiments, the RT primers may further comprise a known sequence, such as a universal primer binding site or a sequence complementary to a universal primer site, at the 5 'end. In some embodiments, the region that is not complementary to a region of the RNA is 5 'to a region of the primer that is complementary to the RNA. In some embodiments, the region that is not complementary to a region of a Rn is a 5 'overhang region. In some embodiments, the region that is not complementary to a region of the target RNA comprises a priming site for amplification and / or a sequencing reaction.

In some embodiments, an RT primer can comprise a universal ligation sequence. In some embodiments, the universal ligation sequence is 5 'to the UID. In some embodiments, the universal ligation sequence is 5 'to the specific target region. In some embodiments, the ligation sequence universal is 5 'to the UID and 5' to the target specific region. In some embodiments, the universal ligation sequence is at the 5 'end of the RT primer. In some embodiments, a plurality of RT primers may comprise a first RT primer with a first universal ligation sequence and one or more second RT primers comprising at least one second universal primer sequence.

Primer extension of single or double-stranded DNA target polynucleotides to form UID-labeled complementary polynucleotides

Using primers described herein, DNA polynucleotides can be hybridized to a primer and primer extension (gPE or PE) can be performed using suitable reagents known in the art. In some embodiments, the primer extension comprises a single extension of a primer. In some embodiments, the primer extension does not comprise multiple extensions of a primer. In some embodiments, the primer extension does not comprise a single extension of a primer. In some embodiments, the primer extension comprises multiple extensions of a primer. In some embodiments, a method comprises performing primer extension on a target DNA polynucleotide to form a target polynucleotide complement sequence, such as a first complement sequence, using one or more primers (PE primers). In some embodiments, a PE primer comprises a sequence specific primer. In some embodiments, a plurality of PE primers comprise one or more sequence specific primers. In some embodiments, a primer extension reaction is the first step in generating a polynucleotide library from a sample containing a target polynucleotide. In some embodiments, a target polynucleotide is not subjected to PCR. In some embodiments, a target polynucleotide does not undergo exponential amplification. In some embodiments, exponential amplification is not performed in the next step after primer extension. In some embodiments, exponential amplification is not performed in the next 2 steps after primer extension. In some embodiments, exponential amplification is not performed in the next 3 steps after primer extension. In some embodiments, the polynucleotide complementary to the target polynucleotide produced from the primer extension step is not further amplified during this step. In some embodiments, the method comprises only one primer extension cycle. In other embodiments, the method comprises repeated extension or linear amplification of a primer hybridized to a target DNA molecule to produce multiple copies of the DNA molecules, such as the complement sequence of the target polynucleotide that may contain a UID. .

The one or more PE primers may comprise a region complementary to a region or sequence of a target DNA, such as a target-specific region that hybridizes to a target polynucleotide, such as a biomarker. The one or more PE primers may comprise a region complementary or substantially complementary to a region of the target DNA. In some embodiments, the one or more PE primers may comprise a first PE primer with a region complementary to a sequence of a first target polynucleotide, and a second PE primer with a region complementary to the sequence of a second polynucleotide. Diana. For example, the first target polynucleotide can be a first DNA molecule and the second target polynucleotide can be a second DNA molecule. In some embodiments, the one or more PE primers may comprise a first PE primer with a region complementary to a sequence of a first DNA, and one or more second PE primers, each with a region complementary to a sequence. of one or more seconds DNA. In some embodiments, the first and second target sequences are the same. In some embodiments, the first and second target sequences are different.

A PE primer may further comprise a region that is not complementary to a region of DNA. The PE primers may further comprise a UID. For example, each PE primer of a plurality of PE primers may comprise a different UID. This can allow a unique barcode for each of the complementary DNAs copied from the DNA molecules that are undergoing a primer extension reaction. In some embodiments, the region of a PE primer that is not complementary to a region of the target DNA may comprise a UID. In some embodiments, the region of each PE primer of a plurality of PE primers that is not complementary to a region of the target DNA may comprise a UID. In some embodiments, the PE primers may further comprise a known sequence, such as a universal primer binding site or a sequence complementary to a universal primer site. In some embodiments, the PE primers may further comprise a phosphorylated 5 'end. In some embodiments, the PE primers may further comprise a known sequence, such as a universal primer binding site or a sequence complementary to a universal primer site, at the 5 'end. In some embodiments, the region that is not complementary to a region of DNA is 5 'to a region of the primer that is complementary to DNA. In some embodiments, the region that is not complementary to a DNA region is a 5 'overhang region. In some embodiments, the region that is not complementary to a region of the target DNA comprises a priming site for amplification and / or a sequencing reaction.

In some embodiments, a PE primer library can be used during the primer extension step.

In some embodiments, a PE primer can comprise a universal ligation sequence. In some embodiments, the universal ligation sequence is 5 'to the UID. In some embodiments, the sequence Universal ligation is 5 'to the specific target region. In some embodiments, the universal ligation sequence is 5 'to the UID and 5' to the specific target region. In some embodiments, the universal ligation sequence is at the 5 'end of the PE primer. In some embodiments, a plurality of PE primers may comprise a first PE primer with a first universal ligation sequence and one or more second PE primers comprising at least one second universal primer sequence.

In some embodiments, a annealing temperature of 55 ° C is used to accommodate lower primer melting temperatures. In some embodiments, a 68 ° C retention step is used for the initial PE step. In some embodiments, the overall concentration of the primers is set to one concentration. In some embodiments, magnesium chloride, ammonium sulfate, D - (+) - trehalose, betaine, or a combination thereof is used during the primer extension step.

Partial Formatting of UID-Labeled Polynucleotides Complementary to Targets

After generating target polynucleotide complement sequences, eg, first complement sequences, a polynucleotide adapter sequence can be added to the first complement sequences. A target polynucleotide complement sequence, such as the first complement sequence that can contain a UID, to which an adapter sequence has been added, can be a modified complement sequence (MCS). In some embodiments, a polynucleotide adapter sequence can be added to target polynucleotide complement sequences, such as the first complement sequences that may contain a UID, in the next step after generating target polynucleotide complement sequences. In some embodiments, a polynucleotide adapter sequence can be added to target polynucleotide complement sequences, such as the first complement sequences that may contain a UID, in the second step after generating target polynucleotide complement sequences that contain UIDs. In some embodiments, a polynucleotide adapter sequence can be added to target polynucleotide complement sequences, such as the first complement sequences that may contain a UID, in the third step after generating target polynucleotide complement sequences that contain UIDs. In some embodiments, a polynucleotide adapter sequence does not contain a UID.

In some embodiments, a polynucleotide adapter sequence can be added to the complement sequences of target polynucleotides, such as the first complement sequences that can contain a UID by ligation (US Patent Nos. 4,883,750, 5,476,930, 5,593,826, 5,426,180, 5,871,921; and United States Patent Publication No. 2004/0110213). Ligation techniques can comprise blunt end ligation and adhesive end ligation. Ligation reactions can include DNA ligases such as DNA ligase I, DNA ligase III, DNA ligase IV, and DNA ligase T4. Ligation reactions can include RNA ligases such as RNA ligase I T4 and RNA ligase II T4. Methods include the use of T4 DNA ligase which catalyzes the formation of a phosphodiester bond between the 5 'ends of the phosphate and the 3' of the hydroxyl juxtaposed in sticky blunt-ended double-stranded DNA or RNA; Taq DNA ligase that catalyzes the formation of a phosphodiester bond between the juxtaposed 5 'phosphate and 3' hydroxyl ends of two adjacent oligonucleotides that hybridize to a complementary target DNA; E. coli DNA ligase that catalyzes the formation of a phosphodiester bond between the juxtaposed 5'-phosphate and 3'-hydroxyl ends at the sticky ends containing double-stranded DNA; and T4 RNA ligase which catalyzes the ligation of a 5 'phosphoryl-terminated nucleic acid donor to a 3' hydroxyl-terminated nucleic acid acceptor through the formation of a 3 'to 5' phosphodiester bond, substrates include also single-stranded RNA and DNA, as well as dinucleoside pyrophosphates.

In some embodiments, a polynucleotide adapter sequence is not added to target polynucleotide complement sequences, such as first complement sequences that may contain a UID, by ligation. In some embodiments, a polynucleotide adapter sequence can be added to complement sequences of target polynucleotides, such as first complement sequences that may contain a UID, by an amplification reaction. In some embodiments, a polynucleotide adapter sequence can be added to complement sequences of target polynucleotides, such as first complement sequences that may contain a UID, by an amplification reaction with one or more primers containing the adapter sequence. . In some embodiments, a polynucleotide adapter sequence is not added to target polynucleotide complement sequences, such as first complement sequences that may contain a UID, by an amplification reaction. In some embodiments, a polynucleotide adapter sequence is not added to the complement sequences of target polynucleotides, such as first complement sequences that may contain a UID, by an amplification reaction with one or more primers containing the adapter sequence. . In some embodiments, a polynucleotide adapter sequence can be added to complement sequences of target polynucleotides, such as second complement sequences that may contain a UID, during a PCR enrichment step as described below.

In some embodiments, a polynucleotide adapter sequence can be added to target polynucleotide complement sequences, such as first complement sequences that may contain a UID, by ligation in the next step after generating target polynucleotide complement sequences. . In some embodiments, an adapter can be a single stranded polynucleotide. In some embodiments, an adapter can be a double stranded polynucleotide. In some embodiments, an adapter can be a bridging polynucleotide that contains a double-stranded region and a single-stranded region, such as an overhang region. In some embodiments, an adapter may be a bridging polynucleotide containing a double-stranded region and a single-stranded region, wherein the strand containing the single-stranded region is not linked to complement sequences of target polynucleotides, such as the first sequences. plugin that can contain a UID. In some embodiments, an adapter may be a bridging polynucleotide containing a double-stranded region and a single-stranded region, wherein the strand that does not contain the single-stranded region is linked to complement sequences of target polynucleotides, such as first sequences of the plugin that can contain a UID. In some embodiments, an adapter can be a bridging polynucleotide containing a double-stranded region and a single-stranded region, wherein the strand that does not contain a region complementary to the complement sequences of target polynucleotides, such as first complement sequences that may contain a UID, it is linked to the complement sequences of target polynucleotides. In some embodiments, an adapter can be a bridging polynucleotide containing a double-stranded region and a single-stranded region, wherein the strand containing a region complementary to complement sequences of target polynucleotides, such as first complement sequences that can contain a UID, it is not linked to the complement sequences of target polynucleotides. In some embodiments, an adapter can be a bridging polynucleotide containing a double-stranded region and a single-stranded region, wherein the strand containing a region complementary to complement sequences of target polynucleotides, such as first complement sequences that can containing a UID, hybridizes to target polynucleotide complement sequences. In some embodiments, an adapter can be a bridging polynucleotide containing a double-stranded region and a single-stranded region, wherein the strand that does not contain a region complementary to the complement sequences of target polynucleotides, such as first complement sequences that may contain a UID, it does not hybridize to target polynucleotide complement sequences.

In some embodiments, the 5 'overhang region may be complementary to one or more complement sequences of target polynucleotides, such as those containing UIDs. In some embodiments, the 5 'overhang region may be complementary to a 5' region of one or more polynucleotide complement sequences, such as those containing UIDs. In some embodiments, the 5 'overhang region may comprise a sequence complementary to a universal ligation sequence, such as a universal ligation sequence of an RT primer or a PE primer. In some embodiments, the 5 'overhang region may be complementary to a 5' region of one or more target polynucleotide complement sequences, such as those containing UID, where the 5 'region is 5' to the UID . In some embodiments, an adapter may be a bridging polynucleotide that contains a double-stranded region and a single-stranded region, such as a 5 'overhang region or end. In some embodiments, an adapter can be a bridging polynucleotide containing a double-stranded region and a single-stranded region, such as a 3 'overhang region or end. In some embodiments, an adapter may be a bridging polynucleotide containing a double-stranded region and two single-stranded regions, such as a 3 'leading end or region and a 5' leading region or end. In some embodiments, the 5 'overhang region may be complementary to a 5' region of one or more target polynucleotide complement sequences, such as those containing UIDs, where the adapter may be linked to the one or more target polynucleotide complement sequences, such as those that contain UIDs when hybridized. In some embodiments, the 5 'overhang region may be complementary to a 5' region of one or more target polynucleotide complement sequences, such as those containing UID, where the adapter may be very close to or adjacent to the 5 'end of one or more UID-containing target polynucleotide complement sequences when hybridized. In some embodiments, the 5 'overhang region may be complementary to a 5' region of one or more target polynucleotide complement sequences, such as those containing UID, where the adapter may be very close to or adjacent to the 5 'phosphate end of one or more target polynucleotide complement sequences, such as those containing UID, when hybridized. In some embodiments, the 5 'overhang region can be the same length, or substantially the same length, as the sequence to which it is complementary in the one or more complement sequences of target polynucleotides, such as those containing UIDs.

In some embodiments, a polynucleotide adapter sequence comprising a primer binding site or a complement of a primer binding site can be added to the target polynucleotide complement sequences, such as the first complement sequences that they can contain a UID. In some embodiments, a target polynucleotide complement sequence, such as first complement sequences that may contain a UID, that contains a first primer binding site of a primer binding set, such as for exponential amplification or sequencing , may be a partially formatted target polynucleotide complement sequence, such as a modified complement sequence that may contain a UID. In some embodiments, a target polynucleotide complement sequence, such as a first complement sequence, that contains a first primer binding site from a first primer set and a first primer binding site from a second primer set. Primer binding, such as for exponential amplification or sequencing, can be a fully formatted target polynucleotide complement sequence, such as a modified complement sequence that may contain a UID. In some embodiments, the primer binding site or complement thereof is added to each of a plurality of target polynucleotide complement sequences, such as first complement sequences that may contain a UID. In some embodiments, the primer binding site or complement thereof is added to each of a plurality of target polynucleotide complement sequences, such as first sequences of the plugin that can contain a UID, it is the same sequence. In some embodiments, the primer binding site or complement thereof that is added to each of a plurality of target polynucleotide complement sequences, such as first complement sequences that may contain a UID, is a different sequence. . In some embodiments, the primer binding site or complement thereof that is added to each of a plurality of target polynucleotide complement sequences in a first amplicon or set of amplicon is the same sequence as a binding site. primer or complement thereof that is added to each of a plurality of complement sequences of target polynucleotides, in a second amplicon or set of amplicons. As used herein, an amplicon comprises a polynucleotide product of an amplification reaction. A set of amplicons comprises a clonal population of polynucleotides produced from an amplification reaction. In some embodiments, the amplicon pools are formed by amplifying a single starting sequence. In some embodiments, a set of amplicons comprises a population of polynucleotides derived from a single polynucleotide in an amplification reaction. In some embodiments, a set of amplicons comprises a population of polynucleotides derived from a single polynucleotide or amplicons of that polynucleotide in an amplification reaction. Amplicons can be produced by a variety of amplification reactions. Amplicons can comprise copies of one or more nucleic acids. In some embodiments, the amplicons or sets of amplicons are produced by PCR. In some embodiments, the amplicons or sets of amplicons are not produced by PCR.

In some embodiments, the primer binding site or complement thereof that is added to each of a plurality of target polynucleotide complement sequences in a first amplicon or set of amplicons is a different sequence than a binding site. primer or complement thereof that is added to each of a plurality of complement sequences of target polynucleotides, in a second amplicon or set of amplicons. In some embodiments, the primer or complement binding site that is added to each of a plurality of UID-containing polynucleotides from a first sample is a different sequence than a primer or complement binding site of the same that is added to each of a plurality of sequences of the complement of target polynucleotides, from a second sample. In some embodiments, the primer or complement binding site added to each of a plurality of target polynucleotide complement sequences from a first sample is the same sequence as a primer binding site. or complement thereof added to each of a plurality of target polynucleotide complement sequences, from a second sample. In some embodiments, the primer or complement binding site thereof comprises a known sequence. In some embodiments, the primer binding site or complement thereof comprises a primer binding site for amplification. In some embodiments, the primer or complement binding site comprises a universal primer sequence. In some embodiments, the primer binding site or complement thereof comprises a first primer binding for a first primer of a set of primers. In some embodiments, the primer binding site or complement thereof comprises a first primer binding to perform an exponential amplification reaction, such as PCR, for example, for use in a PCR enrichment step as described. then. In some embodiments, the primer binding site or complement thereof comprises a first primer binding to perform a non-exponential amplification reaction. In some embodiments, the primer binding site or complement thereof comprises a primer binding site for sequencing. In some embodiments, the primer binding site or complement thereof comprises a primer binding site for analysis.

In some embodiments, a polynucleotide adapter sequence further comprises a sample barcode (SBC) sequence. In the procedures described, the sample barcode in a generic adapter sequence can eliminate the need for multiple sets of probes for each UID employed. As used herein, a sample barcode (SBC) on a polynucleotide comprises a sequence that can be used to identify a source from which a polynucleotide is derived. For example, a nucleic acid sample can be a group of polynucleotides derived from a plurality of different samples (for example, polynucleotides derived from different individuals, different tissues or cells, or isolated polynucleotides at different times), where the polynucleotides from each sample different from the plurality are marked with a unique SBC. Thus, an SBC provides a correlation between a polynucleotide and its source. (US Patent Nos. 7,537,897, 7,544,473, and 7,393,665). In some embodiments, the same SBC can be used to label a different sample that is being run in a different experiment. In some embodiments, a different SBC can be used to label each different sample or a subset of samples that are being run in an experiment. For example, samples from one or more subjects with a disease or condition may have a first SBC and samples from one or more subjects without a disease or condition may have a different second SBC. For example, different samples derived from the same sample can be marked with different SBCs.

In some embodiments, a polynucleotide adapter sequence further comprises an SBC or complement thereof that lies between a primer binding site sequence or complement thereof of the adapter, and a region of the adapter, such as an overhang region. 'which is complementary to a sequence of the one or more target polynucleotide complement sequences. In some embodiments, a polynucleotide adapter sequence further comprises an SBC, wherein the SBC is within a duplicated region of the adapter. In some embodiments, a polynucleotide adapter sequence further comprises an SBC, wherein the SBC is not within a duplicated region of the adapter. In some embodiments, a sequence The polynucleotide linker further comprises an SBC, wherein the SBC is within a single-stranded region of the linker. In some embodiments, a polynucleotide adapter sequence further comprises an SBC, wherein the SBC is on a different strand than the strand that contains a region of complementarity to the one or more target polynucleotide complement sequences, such as a 5 'overhang region. In some embodiments, a polynucleotide adapter sequence further comprises an SBC, wherein the SBC is on the same strand as the strand that contains a region of complementarity, such as a 5 'overhang region, to one or more sequences of the complement of target polynucleotides, such as first complement sequences. In some embodiments, a polynucleotide adapter sequence further comprises an SBC, wherein the SBC is on the strand that does not contain a region of complementarity, such as a 5 'overhang region, to one or more polynucleotide complement sequences. target, such as first complement sequences. In some embodiments, the primer or complement binding site that is added to a plurality of target polynucleotide complement sequences, such as first complement sequences, is 5 'to an adapter SBC sequence. In some embodiments, the primer or complement binding site that is added to a plurality of target polynucleotide complement sequences, such as first complement sequences, is 3 'to an adapter SBC sequence.

A method may further comprise combining a first and a second sample before carrying out any of the one or more reactions. In some embodiments, a method further comprises combining polynucleotides generated from a first and a second sample. In some embodiments, a method further comprises combining polynucleotides generated from a first and a second sample after performing a primer extension reaction. In some embodiments, a method further comprises combining polynucleotides generated from a first and a second sample after binding an adapter to polynucleotides in the first or second sample. In some embodiments, a method further comprises combining polynucleotides generated from a first and a second sample after attaching an adapter comprising an SBC to polynucleotides in the first or second sample. In some embodiments, a method further comprises combining target polynucleotide complement sequences, generated from a first and a second sample. In some embodiments, a method further comprises combining polynucleotides generated from a first and a second sample comprising one or more primer binding sites, such as one or more universal primer binding sites. In some embodiments, a method further comprises combining polynucleotides generated from a first and a second sample after performing an exponential amplification of the polynucleotides in the first and / or second sample. In some embodiments, the sample origin of polynucleotides originating from a first sample and a second sample can be determined using an SBC. In some embodiments, the sample origin of polynucleotides originating from a first sample and a second sample can be determined using a UID. The sample origin of polynucleotides originating from a first sample and a second sample can be determined using a primer binding site sequence. The sample origin of polynucleotides originating from a first sample and a second sample can be determined using a specific target sequence.

Optional cleaning

In some embodiments, a method further comprises optionally purifying one or more of the adapter-tagged polynucleotides, such as modified complement sequences that may contain a UID. In some embodiments, the adapter added to a plurality of target polynucleotide complement sequences, such as first complement sequences, comprises an affinity tag. An affinity tag can bind to a ligand and molecules that do not bind to the ligand (for example, molecules without the affinity tag) can be washed away, or affinity-tagged molecules can be isolated from the molecules without a affinity mark. In some embodiments, an affinity tag can be a first molecule that specifically binds to a second molecule. In some embodiments, the affinity tag can be a known nucleotide sequence. In some embodiments, the affinity tag can be a chemical moiety. In some embodiments, the affinity tag can be biotin or streptavidin. In some embodiments, the affinity tag can be a peptide or a protein, such as an antibody. Thus, the adapter can comprise a protein-nucleic acid complex. Any affinity label known in the art can be used. In some embodiments, the affinity tag can be used to purify complement sequences of adapter-modified target polynucleotides (eg, ligated or amplified), such as modified complement sequences that may contain a UID, from one or more than other polynucleotides. A support or surface can be used that contains one or more immobilized polynucleotide, chemical, or protein molecules that bind an affinity tag. For example, the affinity tag can be used to purify the complement sequences of adapter target polynucleotides, such as modified complement sequences that may contain a UID, from one or more other polynucleotides by binding a biotin of the sequences. of the complement of adapter-modified target polynucleotides to a surface or substrate comprising a streptavidin residue. As used herein, immobilization comprises direct or indirect attachment to a solid support through one or more covalent or non-covalent bonds. In some embodiments, immobilization comprises direct or indirect binding to a solid support by hybridization. In some embodiments, the affinity tag can be used to purify adapter target polynucleotide complement sequences, such as modified complement sequences that may contain a UID, from one or more polynucleotide sequences that are not of interest, such as a non-target polynucleotide. In some embodiments, the affinity tag can be used to purify adapter target polynucleotide complement sequences, such as modified complement sequences that may contain a UID, from one or more primers used in a reaction or step. prior procedure. In some embodiments, the affinity tag can be used to purify adapter target polynucleotide complement sequences, such as modified complement sequences that may contain a UID, from one or more primers used in a reaction or step. from previous procedure, or from one or more polynucleotide sequences that are not of interest, such as a non-target polynucleotide. In some embodiments, an affinity tag is not used in the described procedures. For example, in some embodiments, an adapter does not comprise an affinity tag. For example, in some embodiments, an affinity tag is not used in the described procedures when the target molecule is RNA.

Linear primer extension / linear amplification

A method may further comprise performing a second single round of primer extension or linear primer extension (also called linear amplification). In some embodiments, one or more primers used for linear extension / amplification are isolated in one or more separate reactions from the one or more RT or PE primers used in the reverse transcription or primer extension step. By separating the primer pairs in this manner, unwanted primer interactions can be reduced. As used herein, linear amplification or linear primer extension refers to a process of non-exponential extension of product copy number. In some embodiments, only the template strand replicates during each cycle of a linear amplification. In some embodiments, the primer extension itself is not copied during linear amplification. When a single unpaired primer is used instead of two primers, the result is linear growth in extension product copy number rather than exponential growth of both strands as in PCR.

Using primers described herein, DNA polynucleotides produced from one or more of the above procedures or procedural steps can be hybridized to a primer (LPE primer) and linear primer extension can be performed using suitable reagents. known in the art. For example, one or more target polynucleotide complement sequences, such as modified complement sequences that may contain a UID, can be hybridized to an LPE primer and linear primer extension can be performed. For example, one or more complement sequences of target polynucleotides, such as first complement sequences that may contain a UID, to which an adapter has been added, such as by ligation or amplification, can be hybridized to an LPE primer and linear primer extension can be performed. In some embodiments, an LPE comprises a UID. In some embodiments, an LPE comprises a UID, and an RT or PE primer does not contain a UID. In some embodiments, an LPE comprises a UID, and an RT or PE primer comprises a UID. In some embodiments, an LPE and an RT primer comprise a UID, and a PE primer does not contain a UID. In some embodiments, an LPE and a PE primer comprise a UID, and an RT primer does not contain a UID.

In some embodiments, the linear primer extension comprises multiple extensions of an LPE primer. In some embodiments, the linear primer extension comprises multiple extensions of each LPE primer in a plurality of LPE primers. In some embodiments, the linear primer extension comprises multiple extensions of each LPE primer in a plurality of LPE primers, wherein each LPE primer in the plurality targets a different polynucleotide. In some embodiments, the linear primer extension comprises multiple extensions of each LPE primer in a plurality of LPE primers, wherein each LPE primer in the plurality targets the same polynucleotide. In some embodiments, a second round of primer extension comprises a single extension of an LPE primer. In some embodiments, the linear primer extension does not comprise multiple extensions of a primer. In some embodiments, a method comprises performing a linear primer extension on one or more target polynucleotide complement sequences, such as modified complement sequences that may contain a UID, comprising an adapter, to form a complementary polynucleotide, such as as DNA, using one or more primers (LPE primers). In some embodiments, a method comprises performing a linear primer extension on one or more complement sequences of target polynucleotides, wherein the one or more complement sequences of target polynucleotides do not comprise a linker, such as first complement sequences. that can contain a UID. In some embodiments, an LPE primer comprises a sequence specific primer. In some embodiments, a plurality of LPE primers comprise one or more sequence specific primers. In some embodiments, a linear primer extension reaction is the first, second, third, or fourth step in generating a polynucleotide library from a sample containing a target polynucleotide. In some embodiments, a linear primer extension reaction is the third step in generating a polynucleotide library from a sample containing a target polynucleotide. In some embodiments, a linear primer extension reaction is the fourth step in generating a polynucleotide library from a sample containing a target polynucleotide. In some embodiments, a linear primer extension reaction is performed after an RT or PE reaction. In some embodiments, a linear primer extension reaction is performed after a reaction that adds an adapter to a complement sequence of target polynucleotides, such as a first complement sequence that may contain a UID. In some embodiments, a linear primer extension reaction is performed after an RT or PE reaction and after a reaction that adds an adapter to a complement sequence of target polynucleotides, such as a first complement sequence that can contain a UID. In some embodiments, a linear primer extension reaction is performed prior to performing an exponential amplification reaction, such as PCR. In some embodiments, exponential amplification is performed in the next step after linear primer extension. In some embodiments, exponential amplification is not performed in the next step after linear primer extension. In some embodiments, exponential amplification is not performed in the next 2 steps after linear primer extension. In some embodiments, exponential amplification is not performed in the next 3 steps after linear primer extension. In some embodiments, a polynucleotide complementary to the target polynucleotide complement sequence, such as a second complement sequence that may contain a UID, produced from the linear primer extension step is no longer amplified after this step. . In some embodiments, the method comprises only one cycle of linear primer extension. In other embodiments, the method comprises repeatedly extending a primer hybridized to a target polynucleotide complement sequence to produce multiple copies of the target polynucleotide complement sequences, such as second complement sequences that may contain a UID. The procedures may comprise carrying out at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 reactions. linear primer extension cycles or linear primer extension cycles. In some embodiments, less sample input can be used in procedures that use linear amplification / extension as described herein than in a similar procedure that employs a non-linear amplification step. In some embodiments, fewer cycles of PCR can be used in procedures that use linear amplification / extension as described herein than in a similar procedure that employs a non-linear amplification step. For example, 20 cycles of PCR may be sufficient for procedures that use linear amplification / extension, while 24 cycles of PCR may be required for a similar procedure that employs a non-linear amplification step.

The one or more LPE primers may comprise a sequence complementary to a complement sequence or complement sequence of a target polynucleotide complement sequence, such as a first complement sequence or modified complement sequence. For example, the one or more LPE primers may comprise a sequence complementary to a complement sequence or sequence of a target polynucleotide complement sequence, such as a first complement sequence or modified complement sequence or a target polynucleotide in a sample. initial. For example, the one or more LPE primers may comprise a sequence complementary to a complement sequence or complement sequence of a target polynucleotide complement sequence, such as a first complement sequence or modified complement sequence that is a product of a reaction. amplification, ligation reaction, primer extension, or combinations thereof.

In some embodiments, the one or more LPE primers comprise a sequence complementary to a complement sequence of a target polynucleotide. In some embodiments, the one or more LPE primers may comprise a sequence complementary to a sequence of a target polynucleotide complement sequence, such as a first complement sequence or modified complement sequence. In some embodiments, the one or more LPE primers comprise a first sequence complementary to a complement sequence of a target polynucleotide and a second sequence complementary to a sequence of a complement sequence of target polynucleotides, such as a first sequence of the target polynucleotide. complement or modified complement sequence. In some embodiments, the first and second sequences are the same sequence. In some embodiments, the first and second sequences are different sequences. In some embodiments, the sequence complementary to a target polynucleotide complement sequence, such as a first complement sequence or modified complement sequence, of one or more LPE primers is not complementary to a target sequence. In some embodiments, the sequence complementary to a polynucleotide containing UID of one or more LPE primers is not complementary to any polynucleotide that does not contain a UID. In some embodiments, sequences complementary to a target polynucleotide complement sequence, such as a first complement sequence or modified complement sequence, of one or more LPE primers are not complementary to any other polynucleotide in a sample.

In some embodiments, the target polynucleotide complement sequence is a single stranded polynucleotide. In some embodiments, the target polynucleotide complement sequence is a double stranded polynucleotide. In some embodiments, the target polynucleotide complement sequence, such as a first complement sequence, is an extension product of a PE or RT reaction. In some embodiments, the target polynucleotide complement sequence further comprises an adapter sequence, such as a linked adapter sequence or a modified complement sequence. In some embodiments, the target polynucleotide complement sequence is an extension product of a PE or RT reaction that further comprises an adapter sequence, such as a modified complement sequence. In some embodiments, the target polynucleotide complement sequence is an extension product of a PE or RT reaction that further comprises a first primer site, such as a universal primer or PCR sequencing site. In some embodiments, the target polynucleotide complement sequence, such as a first, second, or modified complement sequence, is immobilized on a substrate or surface. In some embodiments, the complement sequence of target polynucleotides, such as a complement sequence first or modified, it comprises an SBC.

In some embodiments, the sequence complementary to a target polynucleotide complement sequence, such as a first or modified complement sequence of one or more LPE primers, is not a sequence complementary to a first strand of any target polynucleotide. In some embodiments, the sequence complementary to a target polynucleotide complement sequence, such as a first or modified complement sequence, of one or more LPE primers is complementary to a sequence generated during an RT or PE reaction. In some embodiments, the sequence complementary to a target polynucleotide complement sequence, such as a first or modified complement sequence, of one or more LPE primers is complementary to a hybridizable target polynucleotide complement sequence. with a target polynucleotide sequence that is 5 'to the target polynucleotide sequence complementary to an RT or PE primer. In some embodiments, the sequence complementary to a target polynucleotide complement sequence of one or more LPE primers is complementary to a target polynucleotide complement sequence that hybridizes to a target sequence 3 'to the sequence of the target polynucleotide complementary to an RT or PE primer. In some embodiments, a target polynucleotide sequence containing a variant or region for analysis by any of the methods described herein may be among the target polynucleotide sequence complementary to one or more RT or PE primers. and the sequence of the target polynucleotide whose complement is complementary to one or more LPE primers.

In some embodiments, the sequence complementary to a target polynucleotide complement sequence, such as a first or modified complement sequence, of one or more LPE primers is not a sequence complementary to a sequence of one or more PE primers. or RT. In some embodiments, the sequence complementary to a complement sequence of target polynucleotides, a first or modified complement sequence, of one or more LPE primers is not a sequence complementary to a specific target sequence of one or more primers of PE or RT.

In some embodiments, the one or more LPE primers comprise a first LPE primer with a region complementary to a sequence from a first template polynucleotide and a second LPE primer with a region complementary to a sequence from a second template polynucleotide. For example, the first template polynucleotide can be a first DNA molecule and the second template polynucleotide can be a second DNA molecule. For example, the first template polynucleotide can be a first DNA molecule derived from a first target polynucleotide in a sample and the second template polynucleotide can be a second DNA molecule derived from a second target polynucleotide in a sample. In some embodiments, the one or more LPE primers comprise a first LPE primer with a region complementary to a sequence of a first DNA, and one or more second LPE primers, each with a region complementary to a sequence of one or more second DNA. In some embodiments, the sequences of the first and second DNAs are the same. In some embodiments, the sequences of the first and second DNAs are different. In some embodiments, the first and second template sequences are the same. In some embodiments, the first and second template sequences are different. In some embodiments, the first and second target sequences are the same. In some embodiments, the first and second target sequences are different.

An LPE primer may further comprise a region that is not complementary to a template region. In some embodiments, the LPE primers may further comprise a known sequence, such as a universal primer binding site or a sequence complementary to a universal primer site. In some embodiments, the LPE primers may further comprise a known sequence, such as a universal primer binding site or a sequence complementary to a universal primer site, at the 5 'end. In some embodiments, the region that is not complementary to a template region is 5 'to a primer region that is complementary to the template. In some embodiments, the region that is not complementary to a template region is a 5 'overhang region or a 3' overhang region. In some embodiments, the region that is not complementary to a template region comprises a priming site for amplification and / or a sequencing reaction. In some embodiments, the region that is not complementary to a template region comprises a priming site for a second primer of a set of primers for amplification and / or a sequencing reaction, such as a PCR reaction or enrichment step. by PCR. Optionally, the region that is not complementary to a template region comprises a universal sequence for clustering on a high throughput sequencing platform. In some embodiments, the region that is not complementary to a template region comprises a priming site for a second primer of a set of primers for amplification and / or a sequencing reaction, wherein the priming site for a The first primer of the primer set is contained within the LPE template. In some embodiments, the priming site for a first primer set contained within the LPE template is added in a previous RT, Pe, LPE, or adapter addition reaction (eg, ligation). In some embodiments, an LPE reaction is performed using a DNA polymerase.

In some embodiments, the LPE primers may further comprise a second UID. For example, each LPE primer of a plurality of LPE primers may comprise a different second UID. This can allow the barcode of each of the copied DNAs of the DNA molecules that are undergoing a linear primer extension reaction with a second UID. In some embodiments, the second UID is the same as the UID in DNA molecules that are undergoing a linear primer extension reaction. On In some embodiments, the second UID is different from the UID in DNA molecules that are undergoing a linear primer extension reaction. In some embodiments, the region of an LPE primer that is not complementary to a template region comprises a second UID. In some embodiments, the region of each LPE primer of a plurality of LPE primers that is not complementary to a region of the target DNA comprises a second UID.

In some embodiments, slow ramp rates are used for the linear extension / amplification stage. In some embodiments, linear extension / amplification primers are used at a fixed overall concentration. In some embodiments, magnesium chloride, ammonium sulfate, D - (+) - trehalose, betaine, or a combination thereof is used during the linear amplification / extension step.

PCR enrichment

A method may further comprise performing an exponential amplification reaction. In some embodiments, a method may further comprise performing PCR. For example, an exponential amplification reaction can use a plurality of forward / reverse primers and one reverse primer. In some embodiments, an exponential amplification reaction can comprise two or more exponential amplifications. In some embodiments, a first and / or second PCR reaction can use a plurality of forward / reverse primers and a plurality of reverse primers. A first and / or second primer of a plurality of forward / reverse primers can be a forward / reverse primer containing a region complementary to the template polynucleotides, such as DNA or cDNA molecules. In some embodiments, a plurality of forward / reverse primers comprises one or more forward / reverse primers wherein each of the forward / reverse primers in the plurality of forward / reverse primers comprises a region complementary to one or more sites of upstream or downstream primer binding, such as universal primer binding sites.

In some embodiments, an exponential amplification reaction is not performed before a primer extension or a reverse transcription reaction. In some embodiments, an exponential amplification reaction is not performed before or after generating a target polynucleotide complement sequence, such as a first complement sequence.

In some embodiments, an exponential amplification reaction is not performed before, or is performed after, binding an adapter to a template polynucleotide. In some embodiments, an exponential amplification reaction is not performed before, or is performed after, attaching an adapter by ligation to a template polynucleotide. In some embodiments, an exponential amplification reaction is not performed before, or is performed after, binding an adapter to a complement sequence of target polynucleotides, such as a first complement sequence. In some embodiments, an exponential amplification reaction is not performed before, or is performed after, attaching an adapter by ligation to a target polynucleotide complement sequence, such as a first complement sequence.

In some embodiments, an exponential amplification reaction is not performed before, or is performed after, binding a first priming site to a template sequence or complement thereof, for exponential amplification. For example, an exponential amplification reaction may not be performed before, or may be performed after, binding a priming site for a first primer of a set of primers to a template sequence or complement thereof. In some embodiments, an exponential amplification reaction is not performed before, or is performed after, binding a first priming site to a target polynucleotide complement sequence, such as a first complement sequence. In some embodiments, an exponential amplification reaction is not performed before, or is performed after, binding a first priming site by ligation to a polynucleotide comprising a complement sequence of target polynucleotides, such as a first complement sequence. .

In some embodiments, an exponential amplification reaction is not performed before, or is performed after, binding an SBC to a template sequence or complement thereof. In some embodiments, an exponential amplification reaction is not performed before, or is performed after, binding an SBC to a complement sequence of target polynucleotides, such as a first complement sequence. In some embodiments, an exponential amplification reaction is performed while introducing an SBC by amplification into a template sequence or complement thereof. In some embodiments, an exponential amplification reaction is performed while introducing an SBC by amplification into a complement sequence of target polynucleotides, such as a second complement sequence.

In some embodiments, an exponential amplification reaction is not performed before, or is performed after, joining a universal primer sequence to a template or complement sequence thereof. In some embodiments, an exponential amplification reaction is not performed before, or is performed after, binding a universal primer sequence to a target polynucleotide complement sequence. In some embodiments, an exponential amplification reaction is not performed before, or is performed after, joining a universal primer sequence by ligation to a template sequence or complement thereof. In some embodiments, an exponential amplification reaction is not performed before, or is performed after, joining a universal primer sequence by ligation to a target polynucleotide complement sequence.

In some embodiments, an exponential amplification is not performed before, or is performed after, a linear amplification reaction. In some embodiments, an exponential amplification reaction is not performed before, or is performed after, binding an adapter to a linear amplification template sequence. In some embodiments, an exponential amplification reaction is not performed before, or is performed after, attaching an adapter by ligation to a linear amplification template sequence. In some embodiments, an exponential amplification reaction is not performed before, or is performed after, binding a first priming site to a linear amplification template sequence. In some embodiments, an exponential amplification reaction is not performed before, or is performed after, binding an SBC to a linear amplification template sequence. In some embodiments, an exponential amplification reaction is not performed before, or is performed after, binding a universal primer sequence to a linear amplification template sequence.

For example, an exponential amplification reaction cannot be performed before a linear primer extension reaction. For example, an exponential amplification reaction can be performed after a linear primer extension reaction. In some embodiments, an exponential amplification reaction is not performed before, or is performed after, generating one or more copies of a target polynucleotide complement sequence, such as a second complement sequence. In some embodiments, an exponential amplification reaction is not performed before, or is performed after, generating one or more copies of a target polynucleotide complement sequence, such as a second complement sequence, using an LPE primer. In some embodiments, an exponential amplification reaction is not performed before, or is performed after, generating one or more copies of a plurality of target polynucleotide complement sequences, such as second complement sequences, using a plurality of primers. of LPE. In some embodiments, an exponential amplification reaction is not performed before, or is performed after, joining a first and a second priming site for exponential amplification. For example, an exponential amplification reaction may not be performed before, or may be performed after, binding a first primer site for a first primer of a set of primers and a second primer site for a second primer of the set of primers. In some embodiments, an exponential amplification reaction is not performed before, or is performed after, joining a first primer site by ligation and a second primer site for exponential amplification. In some embodiments, an exponential amplification reaction is not performed before, or is performed after, joining a first priming site and a second priming site by a linear primer extension reaction for exponential amplification. In some embodiments, an exponential amplification reaction is not performed before, or is performed after, binding a first or complement primer site by ligation and a second primer site by a linear primer extension reaction for the exponential amplification. For example, the first and second priming sites can be priming sites for a pair of primers used for the exponential amplification reaction. For example, the first and second priming sites can be universal priming sites. For example, the first and second priming sites can be priming sites for sequencing.

In some embodiments, an exponential amplification reaction is not performed before, or is performed after, immobilizing a polynucleotide on a surface or support. In some embodiments, an exponential amplification reaction is performed on a copy of a polynucleotide immobilized on a surface or support. In some embodiments, an exponential amplification reaction is performed on a copy of a polynucleotide immobilized on a surface or support generated from a linear primer extension reaction.

In some embodiments, an exponential amplification reaction is not performed before, or is performed after, immobilizing one or more target polynucleotide complement sequences on a surface or support. In some embodiments, an exponential amplification reaction is not performed before, or is performed after, performing a linear primer reaction on one or more immobilized target polynucleotide complement sequences. In some embodiments, an exponential amplification reaction is performed on a polynucleotide copied from a polynucleotide attached to a surface or solid support. In some embodiments, an exponential amplification reaction is performed on a polynucleotide complement sequence, such as a second complement sequence, copied from a target polynucleotide complement sequence, such as a first complement sequence or complement sequence. that can contain a UID, attached to a surface or solid support.

In some embodiments, an exponential amplification reaction is performed on a SBC-containing polynucleotide copied from a UID-containing polynucleotide bound to a surface or solid support. In some embodiments, an exponential amplification reaction is performed on a polynucleotide containing a first primer binding site, a second primer binding site, or both, that was copied from a UID-containing polynucleotide bound to a surface. or solid support. In some embodiments, an exponential amplification reaction is performed on a polynucleotide that contains a first primer binding site, a second primer binding site, a first universal primer site, a second universal primer site, or any combination thereof, which was copied from a UID-containing polynucleotide, attached to a surface or solid support.

In some embodiments, an exponential amplification reaction is performed on a SBC-containing polynucleotide copied from a SBC-containing polynucleotide bound to a surface or solid support. In some embodiments, an exponential amplification reaction is performed on a polynucleotide containing UID copied from a polynucleotide containing SBC bound to a surface or solid support. In some embodiments, an exponential amplification reaction is performed on a polynucleotide containing a first primer binding site, a second primer binding site, or both, that was copied from a surface-bound SBC-containing polynucleotide. or solid support. In some embodiments, an exponential amplification reaction is performed on a polynucleotide that contains a first primer binding site, a second primer binding site, a first universal primer site, a second universal primer site, or any combination thereof, which was copied from a polynucleotide containing SBC, attached to a surface or solid support.

In some embodiments, an exponential amplification reaction is performed on a polynucleotide containing a first and / or second primer site copied from a polynucleotide containing a first and / or second primer site attached to a surface or solid support. In some embodiments, an exponential amplification reaction is performed on a polynucleotide containing SBC copied from a polynucleotide containing a first and / or second primer site attached to a surface or solid support. In some embodiments, an exponential amplification reaction is performed on a polynucleotide containing UID copied from a polynucleotide containing a first and / or second primer site bound to a surface or solid support. In some embodiments, an exponential amplification reaction is performed on a polynucleotide containing a first universal primer binding site, a second universal primer binding site, or both, that was copied from a polynucleotide containing a first and / or second primer site attached to a surface or solid support. In some embodiments, an exponential amplification reaction is performed on a polynucleotide that contains a first primer binding site, a second primer binding site, a first universal primer site, a second universal primer site, or any combination thereof, which was copied from a polynucleotide containing a first and / or second primer site attached to a surface or solid support.

Using primers described herein, DNA polynucleotides produced from one or more of the above procedures or procedural steps can be hybridized to a set of primers (eg, a set of PCR primers or a set of primers exponential amplification) and exponential amplification can be performed using suitable reagents known in the art. For example, one or more second complement sequences can hybridize to the first primer of a set of primers (such as a reverse primer) and primer extension can be performed; A second primer from a set of primers (such as a forward primer) can then be hybridized to an extension reaction product and primer extension can be performed.

In some embodiments, exponential amplification comprises multiple cycles. In some embodiments, the same first and second primers from a set of primers are used for the exponential amplification reaction of multiple template polynucleotides. In some embodiments, one or more of the exponential amplification primers are not target specific primers. In some embodiments, both primers in a set of exponential amplification primers are not target specific primers. In some embodiments, the same first and second primers from a set of primers are used for the exponential amplification reaction of multiple template polynucleotides in the same reaction vessel. In some embodiments, the same first and second primers from a set of primers are used for the exponential amplification reaction of multiple template polynucleotides in the same reaction. In some embodiments, the same first and second primers from a set of primers are used for the exponential amplification reaction of multiple template polynucleotides simultaneously. For example, the same first and second primers from a set of primers can be used to exponentially amplify a plurality of complement sequences of target polynucleotides, such as a plurality of second complement sequences derived from a different target sequence. For example, the same first and second primers from a set of primers can be used to exponentially amplify a plurality of complement sequences of target polynucleotides, such as a plurality of second complement sequences derived from a different target sequence. For example, the same first and second primers of a set of primers can be used to exponentially amplify a plurality of complement sequences of target polynucleotides, such as a plurality of second complement sequences, which comprise the same target sequence or complement of the herself. For example, the same first and second primers from a primer set can be used to exponentially amplify a plurality of sequences from the target polynucleotide complement of an amplicon. For example, the same first and second primers from a set of primers can be used to exponentially amplify a plurality of complement sequences of target polynucleotides, such as a plurality of second complement sequences from a set of amplicons. For example, the same first and second primers from a set of primers can be used to exponentially amplify each of a plurality of target polynucleotide complement sequences generated using any of the methods described herein. For example, the same first and second primers from a set of primers can be used to exponentially amplify each of a plurality of target polynucleotide complement sequences that contain an adapter sequence. For example, the same first and second primers from a set of primers can be used to exponentially amplify each of a plurality of complement sequences of target polynucleotides containing an SBC. For example, the same first and second primers from a set of primers can be used to exponentially amplify each of a plurality of target polynucleotide complement sequences containing a first and second universal priming site.

In some embodiments, the first and second primers of a set of primers can be used to exponentially amplify a UID, an SBC, a target region, any complement thereof, or any combination thereof. For example, the first and second primer binding sites can hybridize 5 'and 3', respectively, to a UID, an SBC, a target region, any complement thereof, or any combination thereof.

In some embodiments, an exponential amplification reaction is the second, third, fourth, or fifth step to generate a polynucleotide library from a sample containing a target polynucleotide. In some embodiments, an exponential amplification reaction is not the second step in generating a polynucleotide library from a sample containing a target polynucleotide. In some embodiments, an exponential amplification reaction is not the first amplification reaction performed in a method of generating a polynucleotide library from a sample containing a target polynucleotide. In some embodiments, an exponential amplification reaction is the third step in generating a polynucleotide library from a sample containing a target polynucleotide. In some embodiments, an exponential amplification reaction is the fourth step in generating a polynucleotide library from a sample containing a target polynucleotide. In some embodiments, an exponential amplification reaction is the fifth step in generating a polynucleotide library from a sample containing a target polynucleotide. In some embodiments, an exponential amplification reaction is performed after an RT or PE reaction. In some embodiments, an exponential amplification reaction is performed after a reaction that adds an adapter to a complement sequence of target polynucleotides, such as a first complement sequence. In some embodiments, an exponential amplification reaction is performed after an RT or PE reaction and after a reaction that adds an adapter to a complement sequence of target polynucleotides, such as a first complement sequence. In some embodiments, an exponential amplification reaction is performed prior to performing a second exponential amplification reaction, such as PCR. In some embodiments, exponential amplification is performed in the next step after linear primer extension. In some embodiments, exponential amplification is not performed in the next step after linear primer extension. In some embodiments, exponential amplification is not performed in the next step after an RT or PE reaction. In some embodiments, exponential amplification is not performed in the next 2 steps after an RT or PE reaction. In some embodiments, exponential amplification is not performed in the next 3 steps after an RT or PE reaction. In some embodiments, a library of polynucleotide sequences, which may contain a UID, produced from an exponential amplification step, is not amplified further after this step. In some embodiments, the method comprises only one exponential amplification cycle. In some embodiments, the method comprises repeatedly extending both primers of a set of primers to produce multiple copies of the polynucleotide sequences that may contain a UID.

Exponential amplification primers can comprise a sequence complementary to a sequence, or a complement sequence to a complement sequence of target polynucleotides. For example, the one or more exponential amplification primers may comprise a sequence complementary to a sequence or complement sequence of a target polynucleotide complement sequence or a target polynucleotide in an initial sample. For example, the one or more exponential amplification primers may comprise a sequence complementary to a sequence or complement sequence of a target polynucleotide complement sequence that is a product of an amplification reaction, ligation reaction, primer extension, extension of linear primer or combinations thereof. For example, the one or more exponential amplification primers may comprise a sequence complementary to a sequence or complement sequence of a first or second or modified sequence.

In some embodiments, the one or more exponential amplification primers do not comprise a sequence complementary to a sequence or complement sequence of a target polynucleotide. In some embodiments, the one or more exponential amplification primers do not comprise a sequence complementary to a sequence or complement sequence to a target polynucleotide complement sequence. In some embodiments, the one or more exponential amplification primers do not comprise a sequence that is complementary to a sequence or complement sequence of a target polynucleotide and do not comprise a sequence that is complementary to a sequence or complement sequence of a sequence. of the complement of target polynucleotides.

In some embodiments, the one or more exponential amplification primers comprise a sequence complementary to a sequence or complement sequence of a target polynucleotide. In some embodiments, the one or more exponential amplification primers comprise a sequence complementary to a sequence or complement sequence of a UID-containing polynucleotide. In some embodiments, the one or more exponential amplification primers comprise a sequence that is complementary to a complement sequence or sequence of a target polynucleotide and comprise a sequence that is complementary to a complement sequence or sequence of a polynucleotide containing UID.

In some embodiments, the sequence complementary to a UID-containing polynucleotide of one or more exponential amplification primers is not complementary to a target sequence. In some embodiments, the sequence complementary to a polynucleotide containing UID of one or more exponential amplification primers is not complementary to any polynucleotide that does not contain a UID. In some embodiments, sequences complementary to a UID-containing polynucleotide of one or more exponential amplification primers are not complementary to any other polynucleotide in a sample.

In some embodiments, the exponentially amplified target polynucleotide complement sequence is a single stranded polynucleotide. In some embodiments, the exponentially amplified target polynucleotide complement sequence is a double stranded polynucleotide. In some embodiments, the exponentially amplified target polynucleotide complement sequence is a copy of an extension product of a PE or RT reaction. In some embodiments, the exponentially amplified target polynucleotide complement sequence further comprises an adapter sequence, such as a linked adapter sequence. In some embodiments, the exponentially amplified target polynucleotide complement sequence is a complement of an extension product of a PE or RT reaction that further comprises an adapter sequence. In some embodiments, the exponentially amplified target polynucleotide complement sequence is a complement of a complement sequence from an extension product of a PE or RT reaction that further comprises a first and / or second primer binding site, such as a universal priming, sequencing or PCR site. In some embodiments, the exponentially amplified target polynucleotide complement sequence is immobilized on a substrate or surface. In some embodiments, the exponentially amplified target polynucleotide complement sequence comprises an SBC.

In some embodiments, the sequence complementary to an exponentially amplified target polynucleotide complement sequence of one or more exponential amplification primers is not a sequence in a target polynucleotide. In some embodiments, the sequence complementary to an exponentially amplified target polynucleotide complement sequence of one or more exponential amplification primers is complementary to a complement sequence of a sequence generated during an RT or PE reaction. In some embodiments, the sequence complementary to an exponentially amplified target polynucleotide complement sequence of one or more exponential amplification primers is complementary to a target polynucleotide sequence that hybridizes to a target sequence 5 'to the sequence. of the target polynucleotide complementary to an RT or PE primer. In some embodiments, the sequence complementary to an exponentially amplified target polynucleotide complement sequence of one or more exponential amplification primers is complementary to a target polynucleotide sequence that hybridizes to a target sequence 3 'to the sequence. of the target polynucleotide complementary to an RT or PE primer. In some embodiments, a target polynucleotide sequence containing a variant or region for analysis by any of the methods described herein may be among the target polynucleotide sequence complementary to one or more RT or PE primers. and the sequence of the target polynucleotide complementary to one or more exponential amplification primers.

In some embodiments, the sequence complementary to an exponentially amplified target polynucleotide complement sequence of one or more exponential amplification primers is not a sequence complementary to a sequence of one or more PE or RT primers. In some embodiments, the sequence complementary to an exponentially amplified target polynucleotide complement sequence of one or more exponential amplification primers is not a sequence complementary to a target specific sequence of one or more PE or RT primers.

In some embodiments, the one or more exponential amplification primers comprise a first exponential amplification primer with a region complementary to a sequence of a first template polynucleotide, and a second exponential amplification primer with a region complementary to a sequence of a second template polynucleotide. For example, the first template polynucleotide can be a first DNA molecule and the second template polynucleotide can be a second DNA molecule. For example, the first template polynucleotide can be a first DNA molecule derived from a first target polynucleotide in a sample and the second template polynucleotide can be a second DNA molecule derived from a second target polynucleotide in a sample. In some embodiments, the one or more exponential amplification primers comprise a first exponential amplification primer with a region complementary to a sequence of a first DNA, and one or more second exponential amplification primers, each with a region complementary to a sequence of one or more second DNA. In some embodiments, the sequences of the first and second DNAs are the same. In some embodiments, the sequences of the first and second DNAs are different. In some embodiments, the first and second template sequences are the same. In some embodiments, the first and second template sequences are different. In some embodiments, the first and second target sequences are the same. In some embodiments, the first and second target sequences are different.

Sequencing

After performing one or more of the procedures or process steps described herein, a library of generated polynucleotides can be sequenced.

Sequencing can be performed by any sequencing procedure known in the art. On In some embodiments, sequencing can be performed with high throughput. Suitable next generation sequencing technologies include the 454 Life Sciences platform (Roche, Branford, CT) (Margulies et al., Nature, 437, 376-380 (2005)); Illumina Genome Analyzer, GoldenGate Methylation Assay, or Infinium Methylation Assays, i.e. Infinium HumanMethylation 27K BeadArray or VeraCode GoldenGate Methylation Array (Illumina, San Diego, CA; Bibkova et al., Genome Res. 16, 383-393 (2006); and US Patents No. 6,306,597, 7,598,035, 7,232,656) or DNA sequencing by ligation, SOLiD system (Applied Biosystems / Life Technologies; US Patents No. 6,797,470 , 7,083,917, 7,166,434, 7,320,865, 7,332,285, 7,364,858 and 7,429,453); or Helico True single molecule DNA sequencing technology (Harris et al., Science, 320, 106-109 (2008); and US Patent Nos. 7,037,687, 7,645,596, 7,169,560 and 7,769,400), Pacific Biosciences' real-time, single molecule technology (SMRTTm), and sequencing (Soni et al., Clin. Chem. 53, 1996-2001 (2007)). A method may further comprise sequencing one or more polynucleotides in the library. A method may further comprise aligning one or more polynucleotide sequences, sequence reads, amplicon sequences, or sequences from sets of amplicons in the library to each other.

As used herein, alignment comprises comparing a test sequence, such as a read sequence, with one or more test sequences, reference sequences, or a combination thereof. In some embodiments, the alignment can be used to determine a consensus sequence from a plurality of aligned sequences or sequences. In some embodiments, the alignment comprises determining a consensus sequence from a plurality of sequences each having an identical UID. In some embodiments, the length of an aligned sequence for comparison purposes is at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least the 80%, at least 90% or at least 95% of the length of a reference sequence. The actual comparison of the two or more sequences can be achieved by well known procedures, for example, using a mathematical algorithm. A non-limiting example of such a mathematical algorithm is described in Karlin, S. and Altschul, S., Proc. Natl. Acad. Sci. United States, 90-5873-5877 (1993). Said algorithm is incorporated into the NBLAST and XBLAST programs (version 2.0), as described in Altschul, S. et al., Nucleic Acids Res., 25: 3389-3402 (1997). When using the BLAST and Gapped BLAST programs, any relevant parameters from the respective programs can be used (eg, NBLAST). For example, the parameters for the sequence comparison can be set to score = 100, word length = 12, or can be varied (for example, W = 5 or W = 20). Other examples include the Myers and Miller algorithm, CABIOS (1989), ADVANCE, AdAm, BLAT, and FASTA. In some embodiments, percent identity between two amino acid sequences can be achieved using, for example, the GAP program in the GCG software package (Accelrys, Cambridge, UK).

In some aspects, determining the number of polynucleotides, amplicons, or sets of amplicons with different sequences may comprise determining the sequences of the polynucleotides, amplicons, or sets of amplicons. In some aspects, determining the number of different UID-containing polynucleotides, amplicons, or sets of amplicons may comprise determining the sequence of the UID-containing polynucleotides, amplicons, or sets of amplicons. Determining the sequence of a polynucleotide may comprise carrying out a sequencing reaction to determine the sequence of at least a part of the target region, UID, SBC, at least a part of the polynucleotide, a complement thereof, a reverse complement thereof or any combination thereof. In some embodiments, only the UID or a part of the UID is sequenced. In some embodiments, only the SBC or a portion of the SBC is sequenced. In some embodiments, only the target region or a portion of the target region is sequenced. In some embodiments, a sequencing reaction can occur on a support as described herein, in continuous monitoring, in a dilution, or in one or more physically separate volumes.

The sequencing can comprise at least about 200, 300, 400, 500, 600, 700, 800, 900, 1000, or more sequencing reads per run. As used herein, a sequence read comprises a nucleotide sequence determined from a sequence or stream of data generated by a sequencing technique. In some embodiments, the sequencing comprises sequencing at least about 1500, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10,000, or more sequencing reads per run. Sequencing may comprise more than, less than or equal to about 1,000,000,000 sequencing reads per run. Sequencing can comprise more than, less than or equal to about 200,000,000 reads per run.

One method may comprise determining a sequence of a target polynucleotide by determining a consensus sequence from two or more sequence reads. In some embodiments, an average of 5-50 or 20-30 raw reads per UID provides a desired balance of consensus sequence accuracy and sufficient sequencing depth (higher raw read counts may require a greater depth of sequencing). In some embodiments, accuracy (eg, aggregate normal distribution) can be improved by aligning and collapsing sequence reads into consensus sequences using UID information. A hallmark of UID consensus accuracy is the enhanced ability to accurately determine the presence or absence of a mutation or SNP in a second allele, resulting in an accurate reading of the heterozygosity of a patient with a detected SNP. .

A method may comprise generating a consensus sequence from one or more alignments, such as one or more alignments of one or more polynucleotide sequences, sequence reads, amplicon sequences, or sequences from sets of amplicons in the library to each other. A consensus sequence determined using the procedures and libraries produced, as described herein, can improve the accuracy of nucleotide sequences from sequencing. For example, a given consensus sequence may have an improved quality score compared to other procedures in the art. As used herein, a quality score comprises a measure of the probability that a base assignment at a particular sequence location is correct. Thus, a quality score value can be related to a probability of an automatic nucleotide reading. The procedures described herein can be used to determine a target polynucleotide sequence with a quality score of about, or at least about 10. The procedures described herein can decrease or use a lower number of sequence reads to achieve the same or greater confidence in the accuracy of the sequence. In some embodiments, fewer sequence reads are used in a procedure described herein that employs the use of UID than a similar procedure without the use of UID to determine a sequence with equal or similar confidence regarding accuracy. of automatic nucleotide reading.

In some embodiments, sequence reads without both exponential amplification priming sites or complements thereof, an adapter sequence, an SBC, an optional UID, two universal priming sequences, or any combination thereof, can be erroneous readings. A procedure may comprise sequencing erroneous reads. One method may comprise determining the number of erroneous reads, such as to determine a reaction condition or design primer sequences. Comparison of the number of erroneous reads generated under one or more first conditions or sets of conditions can be used to determine a preferred condition or set of conditions. For example, a first procedure can be carried out at a high salt concentration during a PCR reaction, and a second procedure can be carried out at a low salt concentration during a PCR reaction, in which the first and Second procedure are carried out in substantially the same way regardless of the difference in salt concentration. If the first procedure results in a greater number of erroneous reads, such as a greater number of erroneous reads for a particular target polynucleotide sequence or primer, it can be determined that a lower salt reaction condition is preferred for that sequence or primer. of particular target polynucleotides.

In some embodiments, only sequence reads with both exponential amplification priming sites or complements thereof, an adapter sequence, an SBC, an optional UID, two universal priming sequences, or any combination thereof, are used to align or determine a consensus sequence. In some embodiments, one or more sequence reads without both exponential amplification priming sites or complements thereof, an adapter sequence, an SBC, an optional UID, two universal priming sequences, or any combination thereof, they are not used to align or determine a consensus sequence.

In some embodiments, one or more sequence reads without both exponential amplification priming sites or complements thereof are not used to align or determine a consensus sequence. In some embodiments, one or more sequence reads without a single exponential amplification priming site (eg, PCR priming site) or complement thereof are not used to align or determine a consensus sequence. In some embodiments, one or more sequence reads comprising two exponential amplification priming sites or complements thereof are not used to align or determine a consensus sequence, when the two exponential amplification priming sites are not binding sites. corresponding exponential amplification primers for a pair of primers used, such as a pair of primers used in a PCR reaction.

In some embodiments, only sequence reads with both exponential amplification priming sites or complements thereof are used to align or determine a consensus sequence. In some embodiments, only sequence reads with two exponential amplification priming sites or complements thereof that correspond to exponential amplification priming sites for a used primer pair, such as a primer pair used in a reaction PCR, are used to align or determine a consensus sequence. In some embodiments, one or more sequence reads without an SBC are not used to align or determine a consensus sequence. In some embodiments, only sequence reads with an SBC are used to align or determine a consensus sequence. In most embodiments, one or more sequence reads without a UID are not used to align or determine a consensus sequence. In most embodiments, only sequence reads with a UID are used to align or determine a consensus sequence. In some embodiments, one or more sequence reads without an adapter sequence are not used to align or determine a consensus sequence. In some embodiments, only sequence reads with an adapter sequence are used to align or determine a consensus sequence. In some embodiments, one or more sequence reads without two universal primer sequences are not used to align or determine a consensus sequence. In some embodiments, only sequence reads with two universal primer sequences are used to align or determine a consensus sequence.

In some embodiments, a sequence can be determined as accurate when at least 5% of the sequences containing the same UID, the sequences in an amplicon, or the sequences in a set of amplicons are present. For example, a sequence can be determined as exact when at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65 are present. %, 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, 99% or more of the sequences containing the same UID, the sequences in an amplicon, or the sequences in a set of amplicons. For example, a sequence can be determined to be accurate when at least about 75% to about 99% of the sequences containing the same UID, the sequences in an amplicon, or the sequences in a set of amplicons are present. For example, a sequence can be determined as accurate when at least about 85% to about 99% of the sequences containing the same UID, the sequences in an amplicon, or the sequences in a set of amplicons are present. For example, a sequence can be determined as accurate when at least about 92% to about 99% of the sequences containing the same UID, the sequences in an amplicon, or the sequences in a set of amplicons are present.

In some embodiments, sequencing chemistries that have relatively high error rates are employed. In such embodiments, the average quality scores produced by said chemistries are monotonically decreasing functions of sequence read lengths. In one embodiment, said decrease corresponds to 0.5 percent of the sequence reads that have at least one error in positions 1-75; 1 percent of sequence reads have at least one error at positions 76-100; and 2 percent of sequence reads have at least one error at positions 101-125.

Target polynucleotides

The procedures described herein can be used to generate a polynucleotide library from one or more target polynucleotides for sequencing. Target polynucleotides include any polynucleotide of interest that is not the product of an amplification reaction. For example, a target polynucleotide can include a polynucleotide in a biological sample. For example, target polynucleotides do not include products of a PCR reaction. For example, target polynucleotides can include a polynucleotide template used to generate products of an amplification reaction, but do not include the amplification products themselves. For example, target polynucleotides include polynucleotides of interest that can be subjected to a reverse transcription reaction or a primer extension reaction. For example, target polynucleotides include RNA or DNA. In some embodiments, the target RNA polynucleotides are mRNA. In some embodiments, the target RNA polynucleotides are polyadenylated. In some embodiments, the RNA polynucleotides are not polyadenylated. In some embodiments, the target polynucleotides are DNA polynucleotides. The DNA polynucleotides can be genomic DNA. DNA polynucleotides can comprise exons, introns, untranslated regions, or any combination thereof.

In some embodiments, libraries can be generated from two or more regions of a target polynucleotide. In some embodiments, method libraries can be generated from two or more target polynucleotides. In some embodiments, the target polynucleotides are genomic nucleic acids or DNA derived from chromosomes. In some embodiments, the target polynucleotides include sequences that comprise a variant, such as a polymorphism or mutation. In some embodiments, the target polynucleotides include DNA and not RNA. In some embodiments, the target polynucleotides include RNA and not DNA. In some embodiments, the target polynucleotides include DNA and RNA. In some embodiments, a target polynucleotide is an mRNA molecule. In some embodiments, a target polynucleotide is a DNA molecule. In some embodiments, a target polynucleotide is a single stranded polynucleotide. In some embodiments, a target polynucleotide is a double stranded polynucleotide. In some embodiments, a target polynucleotide is a single-stranded double-stranded polynucleotide.

Target polynucleotides can be obtained from any biological sample and prepared using procedures known in the art. In some embodiments, the target polynucleotides are isolated directly without amplification. Procedures for direct isolation are known in the art. Non-limiting examples include the extraction of genomic DNA or mRNA from a biological sample, organism or cell.

In some embodiments, one or more target polynucleotides are purified from a biological sample. In some embodiments, a target polynucleotide is not purified from the biological sample in which it is contained. In some embodiments, a target polynucleotide is isolated from a biological sample. In some embodiments, a target polynucleotide is not isolated from the biological sample in which it is contained. For example, in some embodiments, a target polynucleotide is not extracted or purified from the sample. For example, in some embodiments, a target mRNA is not purified from a sample, such as through a poly-A purification procedure. In some embodiments, a target polynucleotide can be a cell-free nucleic acid. In some embodiments, a target polynucleotide can be a fragmented nucleic acid. In some embodiments, a target polynucleotide can be a transcribed nucleic acid. In some embodiments, a target polynucleotide is a modified polynucleotide. In some embodiments, a target polynucleotide is an unmodified polynucleotide.

In some embodiments, a target polynucleotide is a single cell polynucleotide. In some embodiments, the target polynucleotides are from single cells. In some embodiments, a target polynucleotide is a polynucleotide from a sample containing a plurality of cells.

In some embodiments, a target polynucleotide encodes a biomarker sequence. In some modes of In embodiment, a target polynucleotide encodes 2 or more biomarker sequences. In some embodiments, a plurality of target polynucleotides encode a biomarker sequence. In some embodiments, a plurality of target polynucleotides encode 2 or more biomarker sequences.

Diagnostics

In some embodiments, a method may further comprise diagnosing, predicting, monitoring, treating, ameliorating, and / or preventing a disease, disorder, symptom, and / or condition in a subject. In some embodiments, a method may further comprise diagnosing, predicting, monitoring, treating, ameliorating, and / or preventing a disease, disorder, symptom, and / or condition in a subject, based on the presence, absence, or level of a polynucleotide. Diana. In some embodiments, a method may further comprise diagnosing, predicting, monitoring, treating, ameliorating, and / or preventing a disease, disorder, symptom, and / or condition in a subject, based on the presence, absence, or level of one or more target polynucleotides.

In some embodiments, a method may further comprise diagnosing, predicting, monitoring, treating, ameliorating, and / or preventing a disease, disorder, symptom, and / or condition in a subject based on the presence, absence, level, or sequence of a or more of the sequences obtained using the procedures described herein. For example, a diagnosis of a disease can be made based on the presence, absence, level, or sequence of a variant sequence obtained using the procedures described herein. In some embodiments, a method may further comprise diagnosing, predicting, monitoring, treating, ameliorating, and / or preventing a disease, disorder, symptom, and / or condition in a subject based on the presence, absence, level, or sequence, of one or more of the sequence reads obtained using the procedures described herein. In some embodiments, a method may further comprise diagnosing, predicting, monitoring, treating, ameliorating, and / or preventing a disease, disorder, symptom, and / or condition in a subject based on the presence, absence, level, or sequence of a or more of the consensus sequences obtained using the procedures described herein. In some embodiments, a method may further comprise diagnosing, predicting, monitoring, treating, ameliorating, and / or preventing a disease, disorder, symptom, and / or condition in a subject based on determination of a level (e.g., a amount or concentration) of a target polynucleotide in a sample. A level of a target polynucleotide in a sample can be determined based on one or more sequence reads, sequences, consensus sequences, or any combination thereof. A level of each of a plurality of target polynucleotides in a sample can be determined using the procedures described herein. A level of each of a plurality of target polynucleotides in a sample can be determined based on a number of sequence reads, sequences, consensus sequences, or any combination thereof of each target polynucleotide in the plurality. For example, a level of a first target polynucleotide and a level of a second target polynucleotide can be determined using the procedures described herein.

In some embodiments, the first and second target polynucleotides of a plurality of target polynucleotides are the same. For example, a first target polynucleotide can comprise a first copy of an mRNA molecule and a second target polynucleotide can comprise a second copy of an mRNA molecule. In some embodiments, the first and second target polynucleotides are different. For example, a first target polynucleotide can comprise a first mRNA molecule and a second target polynucleotide can comprise a second mRNA molecule transcribed from a different gene to the first mRNA molecule. For example, a first target polynucleotide can comprise a first allele and a second target polynucleotide can comprise a second allele. For example, a first target polynucleotide can comprise a natural sequence and a second target polynucleotide can comprise a variant sequence.

A panel of target polynucleotides can comprise a plurality of biomarkers. A panel of biomarkers can comprise a plurality of target polynucleotides. In some embodiments, a panel of biomarkers comprises a sequence from each of a plurality of different target polynucleotides. For example, a panel of biomarkers can comprise a sequence of a first and a second target polynucleotide that are different. For example, a panel of target polynucleotides can comprise a plurality of biomarkers, such as variant sequences, that are known to be associated with a disease or that are known not to be associated with a disease. For example, a panel of target polynucleotides can comprise at least one biomarker for each of a plurality of genetic loci. In some embodiments, the types of two or more target polynucleotides in a target polynucleotide panel are different. For example, a panel of target polynucleotides may comprise a plurality of target polynucleotides comprising a first target mRNA molecule and a second target DNA molecule. For example, a panel of target polynucleotides can comprise a plurality of target polynucleotides comprising a first target that is RNA and a second target that is DNA. For example, a panel of target polynucleotides can comprise a plurality of target polynucleotides comprising a first target that is mRNA and a second target that is genomic DNA. In some embodiments, the types of two or more target polynucleotides in a target polynucleotide panel are the same. For example, a panel of target polynucleotides may comprise a plurality of target polynucleotides comprising a first target that is RNA and a second target that is RNA. For example, a panel of target polynucleotides may comprise a plurality of target polynucleotides comprising a first target that is mRNA and a second target that is mRNA. For example, a panel of target polynucleotides may comprise a plurality of target polynucleotides comprising a first target that is mRNA and a second target that is miRNA. For example, a panel of target polynucleotides may comprise a plurality of target polynucleotides comprising a first target that is DNA and a second target that is DNA. For example, a panel of target polynucleotides can comprise a plurality of target polynucleotides comprising a first target that is genomic DNA and a second target that is genomic DNA. For example, a panel of target polynucleotides can comprise a plurality of target polynucleotides comprising a first target that is cellular DNA and a second target that is circulating DNA.

In some embodiments, the types of biomarkers of two or more target polynucleotides in a target polynucleotide panel are different. For example, a panel of target polynucleotides can comprise a plurality of biomarkers comprising a first biomarker for a genetic locus, a second biomarker for a variant sequence. For example, a panel of target polynucleotides can comprise a plurality of biomarkers comprising a first biomarker for a SNP and a second biomarker for a mutation. In some embodiments, the types of biomarkers of two or more target polynucleotides in a target polynucleotide panel are the same. For example, a panel of target polynucleotides can comprise a plurality of biomarkers comprising a first biomarker from one genetic locus, a second biomarker for another genetic locus. For example, a panel of target polynucleotides can comprise a plurality of biomarkers comprising a first biomarker for a SNP, a second biomarker for a SNP.

In some embodiments, a method may further comprise diagnosing or predicting a disease, disorder, symptom, and / or condition in a subject with at least 50% confidence. In some embodiments, the presence, absence, level, sequence, or any combination thereof, of a target polynucleotide in the subject, such as a biomarker, can be determined with at least 50% confidence. In some embodiments, the presence, absence, level, sequence, or any combination thereof, of a target polynucleotide in the subject can be determined with 50% - 100% confidence.

Samples

As used herein, a sample comprises a biological, environmental, medical, or patient source or sample that contains a polynucleotide, such as a target polynucleotide. Any biological sample containing polynucleotides can be used in the procedures described herein. For example, a sample can be a biological sample from a subject that contains RNA or DNA. The polynucleotides can be extracted from the biological sample, or the sample can be directly subjected to the procedures without extraction of the polynucleotides. The sample can be DNA or RNA extracted or isolated. A sample can also be total RNA or DNA extracted from a biological sample, a cDNA library, viral or genomic DNA. In one embodiment, the polynucleotides are isolated from a biological sample that contains a variety of other components, such as proteins, lipids, and non-template nucleic acids. Nucleic acid template molecules can be obtained from any cellular material, obtained from an animal, plant, bacterium, fungus, or any other cellular organism. In certain embodiments, the polynucleotides are derived from a single cell. Polynucleotides can be obtained directly from an organism or from a biological sample obtained from an organism. Any body fluid or tissue sample can be used as a source of nucleic acid for use in the invention. Polynucleotides can also be isolated from cultured cells, such as a primary cell culture or a cell line. The cells or tissues from which the template nucleic acids are obtained can be infected with a virus or other intracellular pathogen.

DNA extraction procedures are well known in the art. A classic DNA isolation protocol is based on extraction using organic solvents such as a mixture of phenol and chloroform, followed by ethanol precipitation (J. Sambrook et al., "Molecular Cloning: A Laboratory Manual," 1989, 2. a ed., Cold Spring Harbor Laboratory Press: New York, NY). Other procedures include: DNA extraction by saline precipitation (P. Sunnucks et al., Genetics, 1996, 144: 747-756; SM Aljanabi and I. Martínez, Nucl. Acids Res. 1997, 25: 4692-4693), extraction DNA using trimethylammonium bromide salts (S. Gustincich et al., BioTechniques, 1991, 11: 298-302) and DNA extraction using guanidinium thiocyanate (JBW Hammond et al., Biochemistry, 1996, 240: 298-300 ). A variety of kits are commercially available to extract DNA from biological samples (for example, BD Biosciences Clontech (Palo Alto, CA): Epicenter Technologies (Madison, WI); Gentra Systems, Inc. (Minneapolis, MN); MicroProbe Corp. ( Bothell, WA); Organon Teknika (Durham, NC); and Qiagen Inc. (Valencia, CA)).

RNA extraction procedures are also well known in the art (see, for example, J. Sambrook et al., "Molecular Cloning: A Laboratory Manual" 1989, 211st Ed., Cold Spring Harbor Laboratory Press: New York) and Various kits for the extraction of RNA from body fluids are commercially available (for example, Ambion, Inc. (Austin, TX); Amersham Biosciences (Piscataway, NJ); BD Biosciences Clontech (Palo Alto, CA); BioRad Laboratories (Hercules, CA) CA); Dynal Biotech Inc. (Lake Success, NY); Epicenter Technologies (Madison, WI); Gentra Systems, Inc. (Minneapolis, MN); GIBCO BRL (Gaithersburg, MD); Invitrogen Life Technologies (Carlsbad, CA); MicroProbe Corp. (Bothell, WA); Organon Teknika (Durham, NC); Promega, Inc. (Madison, WI); and Qiagen Inc. (Valencia, CA)).

One or more samples can be from one or more sources. One or more of the samples can be from two or more sources. One or more of the samples can be from one or more subjects. One or more of the samples can be from two or more subjects. One or more of the samples can be from the same subject. One or more subjects can be of the same species. One or more subjects can be of different species. One or more subjects may be healthy. One or more subjects may have a disease, disorder, or condition.

In some embodiments, a sample is a fluid, such as blood, saliva, lymph, urine, cerebrospinal fluid, seminal fluid, sputum, feces, or tissue homogenates.

A sample can be taken from a subject with a condition. In some embodiments, the subject from which a sample is taken may be a patient, for example, a cancer patient or a patient suspected of having cancer. The subject can be a mammal, for example, a human, and can be male or female. In some embodiments, the woman is pregnant. The sample can be a tumor biopsy. The biopsy can be performed, for example, by a healthcare provider, including a physician, physician assistant, nurse, veterinarian, dentist, chiropractor, paramedic, dermatologist, oncologist, gastroenterologist, or surgeon.

In some embodiments, the disease or condition is a pathogenic infection. The target polynucleotides can be from a pathogen. The pathogen can be a virus, bacteria, fungus, or protozoan. In some embodiments, the pathogen can be a protozoan, such as Acanthamoeba (eg, A. astronyxis, A. castellanii, A. culbertsoni, A. hatchetti, A. polyphaga, A. rhysodes, A. healyi, A. divionensis), Brachiola (eg B connori, B. vesicularum), Cryptosporidium (eg C. parvum), Cyclospora (eg C. cayetanensis), Encephalitozoon (eg E. cuniculi, E. hellem, E intestinali s), Entamoeba (for example, E. histolytica), Enterocytozoon (for example, E. bieneusi), Giardia (for example, G. lamblia), Isospora (for example, I. belli), Microsporidium (for example, M. africanum, M. ceylonensis), Naegleria (eg, N. fowleri), Nosema (eg, N. algerae, N. ocularum), Pleistophora, Trachipleistophora (eg, T. anthropophthera, T. hominis), and Vittaforma (for example, V. corneae). The pathogen can be a fungus, such as Candida, Aspergillus, Cryptococcus, Histoplasma, Pneumocystis, and Stachybotrys. The pathogen can be a bacterium. Exemplary bacteria include, but are not limited to, Bordetella, Borrelia, Brucella, Campylobacter, Chlamydia, Chlamydophila, Clostridium, Corynebacterium, Enterococcus, Escherichia, Francisella, Haemophilus, Helicobacter, Legionella, Leptospira, Listeria, Mycobacteria, Mycobacteria, mica. , Rickettsia, Salmonella, Shigella, Staphylococcus, Streptococcus, Treponema, Vibrio or Yersinia. The virus can be a reverse transcription virus. Examples of reverse transcription viruses include, but are not limited to, single-stranded RT-RNA viruses (ssRNA-RT) and double-stranded RT-DNA viruses (dsDNA-RT). Non-limiting examples of RT-ssRNA viruses include retroviruses, alpharetroviruses, betaretroviruses, gammarretroviruses, deltarretroviruses, epsilonretroviruses, lentiviruses, foamy viruses, metaviruses, and pseudoviruses. Non-limiting examples of RT-dsDNA viruses include hepadenovirus and caulimovirus. The virus can be a DNA virus. The virus can be an RNA virus. The DNA virus can be a double-stranded DNA virus (dsDNA). In some embodiments, the dsDNA virus is an adenovirus, herpes virus, or smallpox virus. Examples of adenoviruses include, but are not limited to, adenoviruses and infectious canine hepatitis viruses. Examples of herpes viruses include, but are not limited to, herpes simplex virus, varicella-zoster virus, cytomegalovirus, and Epstein-Barr virus. A non-limiting list of smallpox viruses includes smallpox virus, cowpox virus, sheep pox virus, monkeypox virus, and vaccinia virus. The DNA virus can be a single stranded DNA virus (ssDNA). The ssDNA virus can be a parvovirus. Examples of parvoviruses include, but are not limited to, parvovirus B19, canine parvovirus, mouse parvovirus, porcine parvovirus, feline panleukopenia, and mink enteritis virus.

The virus can be an RNA virus. The RNA virus can be a double-stranded RNA virus (dsRNA), a sense (+) single-stranded RNA virus (ssRNA (+)), or a sense (-) single-stranded virus (ssRNA (-)). A non-limiting list of ssRNA viruses includes reovirus, orthoreovirus, cipovirus, rotavirus, bluetongue virus, and phytorreovirus. Examples of ssRNA (+) viruses include, but are not limited to, picornaviruses and togaviruses. Examples of picornaviruses include, but are not limited to, enteroviruses, rhinoviruses, hepatoviruses, cardioviruses, aphtoviruses, polioviruses, parechoviruses, erboviruses, kobuviruses, teschoviruses, and coxsackie. In some embodiments, the togavirus is a rubella virus, Sindbis virus, eastern equine encephalitis virus, western equine encephalitis virus, Venezuelan equine encephalitis virus, Ross river virus, O'nyong'nyong virus, Chikungunya or Semliki forest virus. A non-limiting list of ssRNA viruses (-) includes orthomyxoviruses and rhabdoviruses. Examples of orthomyxoviruses include, but are not limited to, influenza A viruses, influenza B viruses, influenza C viruses, isaviruses, and thogotoviruses. Examples of rhabdoviruses include, but are not limited to, cytorrabdoviruses, dicorrabdoviruses, ephemeroviruses, lyssaviruses, novirrabdoviruses, and vesiculoviruses.

A sample can be a biological sample of any organism or virus. Samples for use in the present invention include viral particles or preparations. In some embodiments, the starting material can be a nucleic acid-containing sample from any organism from which genetic material can be obtained. One or more of the samples can be from a mammal, bacteria, virus, fungus, or plant. One or more samples can be from a human, horse, cow, chicken, pig, rat, mouse, monkey, rabbit, guinea pig, sheep, goat, dog, cat, bird, fish, frog, and fruit fly.

In some embodiments, the polynucleotides are attached to other target molecules such as proteins, enzymes, substrates, antibodies, binding agents, microspheres, small molecules, peptides, or any other molecule. In general, nucleic acid can be extracted from a biological sample by a variety of techniques (Sambrook et al., Molecular Cloning: A Laboratory Manual, 3rd Edition, Cold Spring Harbor, N.Y. (2001)).

In some embodiments, the sample is saliva. In some embodiments, the sample is whole blood. In some embodiments, to obtain a sufficient amount of polynucleotides for testing, a blood volume of at least about 0.001, 0.005, 0.01, 0.05, 0.1, 0.5, 1, 2 is drawn. , 3, 4, 5, 10, 20, 25, 30, 35, 40, 45 or 50 ml. In some embodiments, blood can be collected in an apparatus containing a magnesium chelator including, but not limited to, EDTA, and stored at 4 ° C. Optionally, a calcium chelator can be added, including, but not limited to, EGTA.

In some embodiments, a cell lysis inhibitor is added to the blood that includes, but is not limited to, formaldehyde, formaldehyde derivatives, formalin, glutaraldehyde, glutaraldehyde derivatives, a protein crosslinker, a nucleic acid crosslinker, a protein and nucleic acid crosslinker, primary amine reactive crosslinker, sulfhydryl reactive crosslinker, sulfhydryl addition or disulfide reduction, carbohydrate reactive crosslinker, carboxyl reactive crosslinker, photoreactive crosslinker or cleavable crosslinker. In some embodiments, the non-nucleic acid materials can be removed from the starting material using enzymatic treatments (such as protease digestion).

In some embodiments, the starting material may be a tissue sample comprising a tissue, with non-limiting examples including brain, liver, lung, kidney, prostate, ovary, spleen, lymph node (including tonsil), thyroid. , pancreas, heart, skeletal muscle, intestine, larynx, esophagus, stomach, bone, heart, thymus, artery, blood vessel, lung, muscle, stomach, intestine, liver, pancreas, spleen, kidney, gallbladder, thyroid gland, gland adrenal, mammary gland, ovary, prostate gland, testicle, skin, adipose tissue, eye, or brain. In other cases, the starting material can be cells containing nucleic acids. The tissue can comprise infected tissue, diseased tissue, malignant tissue, calcified tissue, or healthy tissue. A sample can comprise at least one cell from one or more biological tissues. For example, a sample can comprise one or more malignant cells.

The one or more malignant cells can be derived from a tumor, carcinoma, sarcoma, or leukemia. Sarcomas are cancers of the bone, cartilage, fat, muscle, blood vessels, or other connective or supporting tissue. Sarcomas include, but are not limited to, bone cancer, fibrosarcoma, chondrosarcoma, Ewing's sarcoma, malignant hemangioendothelioma, malignant schwannoma, bilateral vestibular schwannoma, osteosarcoma, soft tissue sarcomas (eg, alveolar soft tissue sarcoma, angiosarcoma, Phylloid cystosarcoma, dermatofibrosarcoma, desmoid tumor, epithelioid sarcoma, extraskeletal osteosarcoma, fibrosarcoma, hemangiopericytoma, hemangiosarcoma, Kaposi's sarcoma, leiomyosarcoma, liposarcoma, lymphangiosarcoma, lymphosarcoma, histiocytoma, malignant fibrous rhabofibrosarcoma, neurofibrosarcoma, and malignant neurofibrosarcoma). Carcinomas are cancers that begin in epithelial cells, which are cells that cover the surface of the body, produce hormones, and form glands. By way of non-limiting example, carcinomas include breast cancer, pancreatic cancer, lung cancer, colon cancer, colorectal cancer, rectal cancer, kidney cancer, bladder cancer, stomach cancer, prostate cancer, cancer. liver, ovarian cancer, brain cancer, vaginal cancer, vulvar cancer, uterine cancer, oral cancer, penile cancer, testicular cancer, esophageal cancer, skin cancer, fallopian tube cancer, head and neck cancer, Gastrointestinal stromal cancer, adenocarcinoma, cutaneous or intraocular melanoma, cancer of the anal region, cancer of the small intestine, cancer of the endocrine system, cancer of the thyroid gland, cancer of the parathyroid gland, cancer of the adrenal gland, cancer of the urethra, renal pelvis cancer, ureter cancer, endometrial cancer, cervical cancer, pituitary gland cancer, central nervous system (CNS) neoplasms, primary CNS lymphoma, glioma of the central nervous system Ephalic and Spinal Axis Tumors. In some embodiments, the cancer is a skin cancer, such as basal cell carcinoma, squamous cell carcinoma, melanoma, non-melanoma, or actinic (solar) keratosis. In some embodiments, the cancer is lung cancer. Lung cancer can start in the airways that branch off from the windpipe to supply the lungs (bronchi) or the small air sacs in the lung (the alveoli). Lung cancers include non-small cell lung carcinoma (NSCLC), small cell lung carcinoma, and mesotheliomia. Examples of NSCLC include squamous cell carcinoma, adenocarcinoma, and large cell carcinoma. Mesothelioma can be a cancerous tumor of the lining of the lung and chest cavity (pleura) or of the abdominal mucosa (peritoneum). Mesothelioma can be due to asbestos exposure. The cancer can be a brain cancer, such as a glioblastoma. In some embodiments, the cancer can be a central nervous system (CNS) tumor. CNS tumors can be classified as gliomas or non-gliomas. The glioma can be a malignant glioma, high-grade glioma, diffuse intrinsic pontine glioma. Examples of gliomas include astrocytomas, oligodendrogliomas (or mixtures of oligodendroglioma and astrocytoma elements), and ependymomas. Astrocytomas include, but are not limited to, low-grade astrocytomas, anaplastic astrocytomas, glioblastoma multiforme, pilocytic astrocytoma, pleomorphic xanthoastrocytoma, and subependymal gigantocellular astrocytoma. Oligodendrogliomas include low-grade oligodendrogliomas (or oligoastrocytomas) and anaplastic oligodendriogliomas. Nongliomas include meningiomas, pituitary adenomas, primary CNS lymphomas, and medulloblastomas. In some embodiments, the cancer is a meningioma. The leukemia can be acute lymphocytic leukemia, acute myeloid leukemia, chronic lymphocytic leukemia, or chronic myeloid leukemia. Additional types of leukemias include hairy cell leukemia, chronic myelomonocytic leukemia, and juvenile myelomonocytic leukemia. Lymphomas are cancers of the lymphocytes and can develop from B or T lymphocytes. The two main types of lymphoma are Hodgkin lymphoma, previously known as Hodgkin's disease, and non-Hodgkin lymphoma. Hodgkin lymphoma is marked by the presence of the Reed-Sternberg cell. Non-Hodgkin's lymphomas are all lymphomas that are not Hodgkin's lymphomas. Non-Hodgkin's lymphomas can be indolent lymphomas and aggressive lymphomas. Non-Hodgkin's lymphomas include, but are not limited to, diffuse large B-cell lymphoma, follicular lymphoma, mucosa-associated lymphatic tissue (MALT) lymphoma, small-cell lymphocytic lymphoma, mantle cell lymphoma, Burkitt's lymphoma, Large B-cell mediastinal lymphoma, Waldenstrom's macroglobulinemia, B-cell marginal zone lymphoma (NMZL), splenic marginal zone lymphoma (SMZL), extranodal B-cell marginal zone lymphoma, intravascular B-cell lymphoma large, primary effusion lymphoma and lymphomatoid granulomatosis.

A plurality of samples can comprise at least 5, 10, 20, 30, 40, 50, 60, 70, 80, 90 or 100 or more samples. The plurality of samples can comprise at least about 100, 200, 300, 400, 500, 600, 700, 800, 900 or

1000 or more samples. The plurality of samples may comprise at least about 1000, 2000, 3000, 4000,

5000, 6000, 7000, 8000 samples, 9000 or 10,000 samples or 100,000 samples or 1,000,000 or more samples. The plurality of samples can comprise at least about 10,000 samples.

The one or more polynucleotides in a first sample may be different from one or more polynucleotides in a second sample. The one or more polynucleotides in a first sample can be different from one or more polynucleotides in a plurality of samples. One or more polynucleotides in a sample can comprise at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity. In some embodiments, one or more polynucleotides in a sample may differ by less than about 100, 90,

80, 70, 60, 50, 40, 30, 25, 20, 25, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 nucleotide (s) or base pair (s). A plurality of polynucleotides in one or more samples of the plurality of samples can comprise two or more identical sequences.

At least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40 %, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, or 100% of the total polynucleotides in one or more of the plurality of samples may comprise the same sequence. A plurality of polynucleotides in one or more samples of the plurality of samples can comprise at least two different sequences. At least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80 %,

81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97% , 98%, 99%,

100% of the total polynucleotides in one or more of the plurality of samples can comprise at least two different sequences. In some embodiments, one or more polynucleotides are variants of each other. For example, one or more polynucleotides may contain single nucleotide polymorphisms or other types of mutations. In another example, one or more polynucleotides are splice variants.

A first sample can comprise one or more cells and the second sample can comprise one or more cells.

The one or more cells in the first sample may be of the same cell type as the one or more cells in the second sample. The one or more cells of the first sample can be of a different cell type such as one or more different cells of the plurality of samples.

The plurality of samples can be obtained simultaneously. A plurality of samples can be obtained at the same time. The plurality of samples can be obtained sequentially. A plurality of samples can be obtained over the course of years, 100 years, 10 years, 5 years, 4 years, 3 years, 2 years, or 1 year after obtaining one or more different samples. One or more samples can be obtained within about a year after obtaining one or more different samples. One or more samples can be obtained within 12 months, 11 months, 10 months, 9 months, 8 months, 7 months, 6 months, 4 months, 3 months, 2 months, or 1 month after obtaining one or more different samples . One or more samples can be obtained within 30 days, 28 days, 26 days, 24 days, 21 days, 20 days, 18 days, 17 days,

16 days, 15 days, 14 days, 13 days, 12 days, 11 days, 10 days, 9 days, 8 days, 7 days, 6 days, 5 days, 4 days, 3 days, 2 days, or one day after you get one or more different samples. One or more samples can be obtained in approximately

24 hours, 22 hours, 20 hours, 18 hours, 16 hours, 14 hours, 12 hours, 10 hours, 8 hours, 6 hours, 4 hours, 2 hours, or 1 hour after obtaining one or more different samples. One or more samples can be obtained within approximately 60 seconds, 45 seconds, 30 seconds, 20 seconds, 10 seconds, 5 seconds, 2 seconds, or 1 second after obtaining one or more different samples. One or more samples can be obtained in less than a second after obtaining one or more different samples.

Different polynucleotides in a sample can be present in the sample at different concentrations or amounts. For example, the concentration or amount of one polynucleotide may be greater than the concentration or amount of another polynucleotide in the sample. In some embodiments, the concentration or amount of at least one polynucleotide in the sample is at least about 1.5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30,

35, 40, 45, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, or more times greater than the concentration or amount of at least one other polynucleotide in the sample. In another example, the concentration or amount of one polynucleotide is less than the concentration or amount of another polynucleotide in the sample. The concentration or amount of at least one polynucleotide in the sample can be at least about 1.5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20 ,

25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000 or more times less than the concentration or quantity of al minus one other polynucleotide in the sample.

In some embodiments, two or more samples may contain different amounts or concentrations of the polynucleotides. In some embodiments, the concentration or amount of a polynucleotide in one sample may be greater than the concentration or amount of the same polynucleotide in a different sample. For example, a blood sample may contain a greater amount of a particular polynucleotide than a urine sample. Alternatively, a single sample can be divided into two or more subsamples. Subsamples can contain different amounts or concentrations of the same polynucleotide. The concentration or amount of at least one polynucleotide in a sample can be at least about 1.5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20 , 25, 30, 35, 40, 45,

50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000 or more times greater than the concentration or amount of the same polynucleotide in another sample. Alternatively, the concentration or amount of a polynucleotide in a sample may be less than the concentration or amount of the same polynucleotide in a different sample. For example, the concentration or amount of at least one polynucleotide in a sample can be at least about 1.5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000 or more times less than the concentration or amount of the same polynucleotide in another sample.

Whole blood samples

In some embodiments, the sample is whole blood. In some embodiments, the percentage of amplicons, containing 10 or more UIDs, generated from a whole blood sample is equal to the percentage of amplicons, containing 10 or more UIDs, generated from a sample of purified polynucleotides. . In some embodiments, the percentage of amplicons, containing 10 or more UIDs, generated from a whole blood sample is only less than about 1%, 2%, 3%, 4%, 5%, 6%. , 7%, 8%, 9%, or at most 10% less than the percentage of amplicons, containing 10 or more UIDs, generated from a sample of purified polynucleotides. In some embodiments, the target specificity observed from a whole blood sample is equal to the target specificity observed from a purified polynucleotide sample. In some embodiments, the target specificity observed from a whole blood sample is only less than about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9% or at most 10% less than the target specificity observed from a purified polynucleotide sample. In some embodiments, the uniformity of coverage observed from a whole blood sample is equal to the uniformity of coverage observed from a purified polynucleotide sample. In some embodiments, the uniformity of coverage observed in a whole blood sample is only less than about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, or at most 10% less than the uniformity of coverage observed from a purified polynucleotide sample.

FFPE samples

In some embodiments, the sample is a formalin-fixed paraffin embedded (FFPE) sample. In some embodiments, the percentage of amplicons, containing 10 or more UIDs, generated from a sample of FFPE is equal to the percentage of amplicons, containing 10 or more UIDs, generated from a sample of purified polynucleotides. In some embodiments, the percentage of amplicons, containing 10 or more UIDs, generated from a FFPE sample is only less than about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, or at most 10% less than the percentage of amplicons, containing 10 or more UIDs, generated from a sample of purified polynucleotides. In some embodiments, the target specificity observed from a FFPE sample is equal to the target specificity observed from a purified polynucleotide sample. In some embodiments, the target specificity observed from a FFPE sample is only less than about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9 % or at most 10% less than the target specificity observed from a purified polynucleotide sample. In some embodiments, the uniformity of coverage observed from a FFPE sample is equal to the uniformity of coverage observed from a purified polynucleotide sample. In some embodiments, the observed coverage uniformity in a FFPE sample is only less than about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, or at most 10% less than the uniformity of coverage observed from a purified polynucleotide sample.

Libraries

The libraries disclosed herein can be used in a variety of applications. As used herein, a library comprises a plurality of molecules. In some embodiments, a library comprises a plurality of polynucleotides. In some embodiments, a library comprises a plurality of primers. In some embodiments, a library comprises a plurality of RT primers. In some embodiments, a library comprises a plurality of PE primers. In some embodiments, a library comprises a plurality of linear primer extension (LPE) primers. In some embodiments, a library comprises a plurality of adapters. In some embodiments, a library comprises a plurality of primers for non-exponential amplification, such as linear amplification. In some embodiments, a library comprises a plurality of primers for exponential amplification, such as PCR. In some embodiments, a library comprises a plurality of polynucleotides for sequencing. For example, the library could be used to sequence applications. In some embodiments, a library comprises a plurality of sequence reads of one or more polynucleotides, amplicons, or sets of amplicons. A library can be stored and used multiple times to generate samples for analysis. Some applications include, for example, the genotyping of polymorphisms, the study of RNA processing, and the selection of clonal representatives for sequencing according to the procedures provided herein. Libraries can be generated that comprise a plurality of polynucleotides, such as primers or libraries for sequencing or amplification, wherein a plurality of polynucleotides comprise at least about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800 or 900 UID or single polynucleotides. In some embodiments, the polynucleotide libraries comprise a plurality of at least about 1000, 1500, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10,000, 11,000, 12,000, 13,000, 14,000, 15,000, 16,000 , 17,000, 18,000, 19,000, 20,000, 30,000, 40,000, 50,000, 60,000, 70,000, 80,000, 90,000, 100,000, 200,000, 300,000, 400,000, 500,000, 600,000, 700,000, 800,000, 900,000, 1,000,000, 50,000,000, 100,000,000 or more unique polynucleotides, in which each Single polynucleotide comprises a UID. In some embodiments, polynucleotide libraries comprise a plurality of sets of amplicons, where each set of amplicons comprises a plurality of polynucleotides with the same UID. In some embodiments, the polynucleotide libraries comprise a plurality of at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80 , 90, 100, 100, 200, 300, 40, 500, 600, 700, 800, 900, 1000, 1500, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10,000, 11,000, 12,000, 13,000, 14,000 , 15,000, 16,000, 17,000, 18,000, 19,000, 20,000, 30,000, 40,000, 50,000, 60,000, 70,000, 80,000, 90,000, 100,000, or more amplicons, wherein each polynucleotide in the one or more amplicons comprises a plurality of polynucleotides with the same UID. In some embodiments, the polynucleotide libraries comprise a plurality of at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80 , 90, 100, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1500, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10,000, 11,000, 12,000, 13,000 , 14,000, 15,000, 16,000, 17,000, 18,000, 19,000, 20,000, 30,000, 40,000, 50,000, 60,000, 70,000, 80,000, 90,000, 100,000 or more sets of amplicons, wherein each set of amplicons comprises a plurality of polynucleotides or amplicons with the same UID. In some embodiments, the polynucleotide libraries comprise a plurality of at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80 , 90, 100, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1500, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10,000, 11,000, 12,000, 13,000 , 14,000, 15,000, 16,000, 17,000, 18,000, 19,000, 20,000, 30,000, 40,000, 50,000, 60,000, 70,000, 80,000, 90,000, 100,000 or more polynucleotides, amplicons, or sets of amplicons, wherein each polynucleotide, amplicon, or set of amplicons comprise a plurality of polynucleotides, amplicons or sets of amplicons with the same template sequence or part thereof. In some embodiments, the polynucleotide libraries comprise a plurality of at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80 , 90, 100, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1500, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10,000, 11,000, 12,000, 13,000 , 14,000, 15,000, 16,000, 17,000, 18,000, 19,000, 20,000, 30,000, 40,000, 50,000, 60,000, 70,000, 80,000, 90,000, 100,000 or more polynucleotides, amplicons, or sets of amplicons, wherein each polynucleotide, amplicon, or set of amplicons comprise a plurality of polynucleotides, amplicons, or sets of amplicons with a template sequence or part thereof that differs from one or more other polynucleotides, amplicons, or sets of amplicons by one or more bases caused by amplification error or bias or sequencing.

Primers

Performing the one or more reactions of the methods disclosed herein may comprise the use of one or more primers. As used herein, a primer comprises a double-stranded, single-stranded, or partially single-stranded oligonucleotide that is sufficiently complementary to hybridize to a template polynucleotide. A primer can be single-stranded DNA prior to binding to a template polynucleotide. In some embodiments, the primer initially comprises a double-stranded sequence. A primer site includes the area of the template to which a primer hybridizes. In some embodiments, the primers are capable of acting as a starting point for template-directed nucleic acid synthesis. For example, primers can initiate template-directed nucleic acid synthesis when four different nucleotides and a polymerizing agent or enzyme, such as DNA or RNA polymerase or reverse transcriptase. A primer pair includes 2 primers: a first primer with a 5 'leading region that hybridizes to a 5' end of a template sequence, and a second primer with a 3 'trailing region that hybridizes to the complement of the end. 3 'of the template sequence. In some embodiments, a primer comprises a target specific sequence and a UID sequence. In some embodiments, a primer comprises a barcode sequence. In some embodiments, a primer comprises a UID sequence. In some embodiments, a primer comprises a sample barcode sequence. In some embodiments, a primer comprises a universal primer sequence. In some embodiments, a primer comprises a PCR priming sequence. In some embodiments, a primer comprises a PCR priming sequence used to initiate amplification of a polynucleotide. (Dieffenbach, PCR Primer: A Laboratory Manual, 2nd edition (Cold Spring Harbor Press, New York (2003)). The universal primer binding site or sequence allows the binding of a universal primer to a polynucleotide and / or amplicon Universal primers are well known in the art and include, but are not limited to, -47F (M13F), alphaMF, AOX3 ', AOX5', BGHr, CMV-30, CMV-50, CVMf, LACrmt, lambda gt10F, lambda gt 10R, lambda gt11F, lambda gt11R, M13 rev, M13Forward (-20), M13Reverse, male, p10SEQPpQE, pA-120, pet4, pGAP Forward, pGLRVpr3, pGLpr2R, pKLAC14, pQEFS, pQERS, pucU2U1, revers, pucU1 seqIREStam, seqIRESzpet, seqori, seqPCR, seqpIRES-, seqpIRES +, seqpSecTag, seqpSecTag +, seqretro + PSI, SP6, T3-prom, T7-prom, and T7-termInv. As used herein, binding can refer to both binding covalent interactions as well as non-covalent interactions Universal primer binding to the universal primer binding site can be used for amplification, detection and / or sequencing. iation of the polynucleotide and / or amplicon. The universal primer binding site can comprise at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, or 1000 nucleotides or base pairs. In another example, the universal primer binding site comprises at least about 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000, 5500, 6000, 6500, 7000, 7500, 8000, 8500, 9000, 9500, or 10000 nucleotides or base pairs. In some embodiments, the universal primer binding site comprises 1-10, 10-20, 10-30, or 10-100 nucleotides or base pairs. In some embodiments, the universal primer binding site comprises from about 1-90, 1-80, 1-70, 1-60, 1-50, 1-40, 1 30, 1-20, 1-10 , 2-90, 2-80, 2-70, 2-60, 2-50, 2-40, 2-30, 2-20, 2-10, 1-900, 1-800, 1-700, 1 -600, 1-500, 1-400, 1-300, 1 200, 1-100, 2-900, 2-800, 2-700, 2-600, 2-500, 2-400, 2-300, 2-200, 2-100, 5-90, 5-80, 5-70, 5-60, 5-50, 5-40, 5-30, 5-20, 5-10, 10-90, 10-80, 10-70, 10-60, 10-50, 10-40, 10-30, 10-20, 10-10, 5-900, 5-800, 5- 700, 5-600, 5-500, 5-400, 5-300, 5 200, 5-100, 10-900, 10-800, 10-700, 10-600, 10-500, 10-400, 10 -300, 10-200, 10-100, 25-900, 25-800, 25-700, 25-600, 25-500, 25-400, 25-300, 25-200, 25-100, 100-1000 , 100-900, 100-800, 100-700, 100-600, 100-500, 100-400, 100-300, 100-200, 200-1000, 200-900, 200-800, 200-700, 200 -600, 200-500, 200-400, 200-300, 300-1000, 300-900, 300-800, 300-700, 300-600, 300-500, 300-400, 400-1000, 400-900, 400-800, 400-700, 400-600, 400-500, 500-1000, 500-900, 500-800, 500-700, 500-600, 600-1000, 600-900, 600-800, 600- 700, 700-1000, 700-900, 700-800, 800-1000, 800-900, or 900-1000 nucleotides or base pairs.

The primers can be of a length compatible with their use in the synthesis of primer extension products. A primer can be a polynucleotide that is 8 to 200 nucleotides in length. The length of a primer can depend on the sequence of the template polynucleotide and the template locus. For example, the length and / or melting temperature (Tm) of a primer or set of primers can be optimized. In some cases, a primer may be about, more than about, or less than about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, or 60 nucleotides in length. In some embodiments, the primers are approximately 8-100 nucleotides in length, eg, 10-75, 15-60, 15-40, 18-30, 20-40, 21-50, 22-45, 25- 40, 7 9, 12-15, 15-20, 15-25, 15-30, 15-45, 15-50, 15-55, 15-60, 20-25, 20-30, 20-35, 20 -45, 20-50, 20-55 or 20-60 nucleotides in length and any length in between. In some embodiments, the primers have a maximum of approximately 10, 12, 15, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 nucleotides in length.

In general, one or more primer pairs can be used in an exponential amplification reaction; a primer pair primer can be a forward primer and a primer pair primer can be a reverse primer. In some embodiments, a first primer pair can be used in the exponential amplification reaction; a first pair primer can be a forward primer complementary to a sequence of a first template polynucleotide molecule and a first pair primer can be a reverse primer complementary to a second sequence of the first template polynucleotide molecule, and a first template locus it can reside between the first sequence and the second sequence. In some embodiments, a second primer pair can be used in the amplification reaction; a second pair primer can be a forward primer complementary to a first sequence of a second target polynucleotide molecule and a second pair primer can be a reverse primer complementary to a second sequence of the second target polynucleotide molecule, and a second locus target can reside between the first sequence and the second sequence. In some embodiments, the second target locus comprises a variable light chain antibody sequence. In some embodiments, a third primer pair can be used in the exponential amplification reaction; a third pair primer can be a forward primer complementary to a sequence of a third template polynucleotide molecule and a third pair primer can be a reverse primer complementary to a second sequence of the third template polynucleotide molecule, and a third template locus it can reside between the first sequence and the second sequence. In some embodiments, a first, second, or third template locus comprises a barcode, such as a UID.

The one or more primers can hybridize to at least a portion of a plurality of template polynucleotides. The one or more primers can hybridize to the 3 'end and / or the 5' end of the plurality of template polynucleotides. The one or more primers can hybridize to an internal region of the plurality of template polynucleotides. The inner region can be at least about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 , 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 100, 150, 200, 220, 230 , 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480 , 490, 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600, 650, 700, 750, 800, 850, 900 or 1000 nucleotides of the 3 'ends or the 5' ends of the plurality of template polynucleotides. The one or more primers can comprise a fixed panel of primers. The one or more primers can comprise at least one or more custom primers. The one or more primers can comprise at least one or more control primers. The one or more primers may comprise at least one or more housekeeping gene primers. The one or more primers can comprise a universal primer. The universal primer can hybridize to a universal primer binding site. In some embodiments, the one or more custom primers do not hybridize to a UID. In some embodiments, the one or more custom primers hybridize to an SBC, a specific target region, complements thereof, or any combination thereof. The one or more primers may comprise a universal primer and a UID-containing primer. The one or more primers can be designed to amplify or perform primer extension, reverse transcription, linear extension, non-exponential amplification, exponential amplification, PCR, or any other method of amplification of one or more target polynucleotides or template.

The target specific region can comprise at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 100, 150, 200, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600, 650, 700, 750, 800, 850, 900 or 1000 nucleotides or base pairs. In another example, the target specific region comprises at least about 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000, 5500, 6000, 6500, 7000, 7500, 8000, 8500, 9000, 9500, or 10000 nucleotides or Base pairs. In some embodiments, the target specific region comprises approximately 5-10, 10-15, 10-20, 10-30, 15-30, 10-75, 15-60, 15-40, 18-30, 20-40, 21-50, 22-45, 25-40, 7-9, 1215, 15-20, 15-25, 15-30, 15-45, 15-50, 15-55, 15-60, 20-25, 20-30, 20-35, 20-45, 20-50, 20-55, 20-60, 2-900, 2-800, 2 700, 2-600, 2-500, 2-400, 2-300, 2-200, 2-100, 25-900, 25-800 , 25-700, 25-600, 25-500, 25-400, 25-300, 25-200, 25-100, 100-1000, 100-900, 100-800, 100-700, 100-600, 100 -500, 100-400, 100-300, 100-200, 200-1000, 200-900, 200-800, 200 700, 200-600, 200-500, 200-400, 200-300, 300-1000, 300-900, 300-800, 300-700, 300-600, 300-500, 300-400, 400-1000, 400-900, 400-800, 400-700, 400-600, 400-500, 500- 1000, 500-900, 500-800, 500-700, 500-600, 600-1000, 600-900, 600 800, 600-700, 700-1000, 700-900, 700-800, 800-1000, 800 -900 or 900-1000 nucleotides or base pairs.

Primers can be designed according to known parameters to avoid secondary structures and self-hybridization. In some embodiments, different primer pairs can hybridize and melt at approximately the same temperatures, for example, within 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 ° C of another pair. of primers. In some embodiments, one or more primers in a plurality of primers can hybridize and melt at approximately the same temperatures, for example, within 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 ° C of another primer in the plurality of primers. In some embodiments, one or more primers in a plurality of primers may hybridize and melt at different temperatures relative to another primer in the plurality of primers.

A plurality of primers for one or more steps of the procedures described herein may comprise a plurality of primers comprising about, at most about, or at least about 1,2,3,4,5,6,7,8 , 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600 , 700, 800, 900, 1000, 1500, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10,000, 11,000, 12,000, 13,000, 14,000, 15,000, 16,000, 17,000, 18,000, 19,000, 20,000, 30,000 , 40,000, 50,000, 60,000, 70,000, 80,000, 90,000, 100,000, 200,000, 300,000, 400,000, 500,000, 600,000, 700,000, 800,000, 900,000, 1,000,000, 50,000,000, 100,000. 000, different primers. For example, each primer in a plurality of primers can comprise a UID. For example, each primer in a plurality of primers may comprise a different specific target or template region or sequence. For example, each primer in a plurality of primers may comprise a different UID and a different specific target or template region or sequence. For example, each primer in a plurality of primers can comprise a different UID and the same target region or sequence or specific template.

Primer panels

In some embodiments, the primer panels used for the procedures described herein comprise or consist of primers with a melting temperature range of between 60 ° C and 68 ° C. In some embodiments, the primer panels used for the procedures described herein comprise or consist of primers 21 to 32 nucleotides in length. In some embodiments, the primer panels used for the methods described herein comprise or consist of primers that do not contain 4 or more pyrimidines in the last 5 nucleotides at the 3 'end. In some embodiments, the primer panels used for the procedures described herein comprise or consist of primers designed to produce an amplicon containing between 30% and 70% GC content. In some embodiments, the primer panels used for the procedures described herein comprise or consist of primers designed to produce amplicons between 225 and 300 base pairs in length. In some embodiments, the primer panels used for the procedures described herein comprise or consist of primers from an initial panel that excludes the primers with the highest number of misreadings (caused by mispriming) during the priming step. Initial RT / Pe or the linear extension / amplification stage. In some embodiments, the primer panels used for the procedures described herein comprise or consist of primers from an initial panel that excludes dimer prevalent primers. In some embodiments, the primer panels used for the procedures described herein comprise or consist of primers from an initial panel that exclude primers that are responsible for generating one or more of the largest number of total reads for a target (boosters ). Any or a combination of the above measures can be used to generate primer panels for use in the procedures described.

UID

In some embodiments, the barcodes, such as an SBC or UID, can be in the range of 4 to 36 nucleotides, or 6 to 30 nucleotides, or 8 to 20 nucleotides in length. In certain aspects, the fusing temperatures of barcodes within a set are within 10 ° C of each other, within 5 ° C of each other, or within 2 ° C of each other. In other aspects, the barcodes are members of a minimally cross-hybridization set. For example, the nucleotide sequence of each member of such a set may be sufficiently different from that of each other member of the set that no member can form a stable duplex with the complement of any other member under stringent hybridization conditions. In some embodiments, the nucleotide sequence of each member of a minimally cross-hybridization set differs from that of any other member by at least two nucleotides. Bar code technologies are described in Winzeler et al. (1999) Science 285: 901; Brenner (2000) Genome Biol. 1: 1 Kumar et al. (2001) Nature Rev. 2: 302; Giaever et al. (2004) Proc. Natl. Acad. Sci. United States 101: 793; Eason et al. (2004) Proc. Natl. Acad. Sci. United States 101: 11046; and Brenner (2004) Genome Biol. 5: 240.

As used herein, a unique identification mark (UID) comprises information that is unique for a single molecule, or two or more molecules from a plurality or library of molecules. A barcode can be a UID. In some embodiments, the unique information comprises a unique nucleotide sequence. For example, the sequence of the UID can be determined by determining the identity and order of the unique or random sequence of nucleotides that comprise the UID. In some embodiments, the unique information cannot be used to identify the sequence of a target polynucleotide. In some embodiments, the unique information is not a known sequence linked to the sequence identity of a target polynucleotide. For example, a UID can be linked to one or more target polynucleotides, but the UID cannot be used to determine which of the one or more target polynucleotides it is bound to. In some embodiments, the unique information comprises a random sequence of nucleotides. In some embodiments, the unique information comprises one or more unique nucleotide sequences in a polynucleotide. In some embodiments, the unique information comprises a degenerate nucleotide sequence or a degenerate barcode. A degenerate barcode can comprise a variable nucleotide composition or base sequence. For example, a degenerate barcode can be a random sequence. In some embodiments, a sequence of the complement of a UID is also a sequence of UIDs.

A UID can comprise any length of nucleotides. For example, a UID can comprise at least about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 60, 70, 80, 90, 100, 200, 500, or 1000 nucleotides. For example, a UID can comprise at most about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 2526, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 60, 70, 80, 90, 100, 200, 500 or 1000 nucleotides. In some embodiments, a UID has a particular nucleotide length. For example, a UID can be approximately 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22 , 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47 , 48, 49, 50, 60, 70, 80, 90, 100, 200, 500, or 1000 nucleotides in length.

In some embodiments, each UID in a plurality of UIDs is at least about 2 nucleotides. For example, each UID in a plurality of UIDs can be at least about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21,22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 60, 70, 80, 90, 100, 200, 500, or 1000 nucleotides in length. In some embodiments, each UID in a plurality of UIDs is at most about 1000 nucleotides. For example, each UID in a plurality of UIDs can be at most about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 60, 70, 80, 90, 100, 200, 500, or 1000 nucleotides in length. In some embodiments, each UID in a plurality of UIDs is the same nucleotide length. For example, each UID in a plurality of UIDs can be 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 , 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45 , 46, 47, 48, 49, 50, 60, 70, 80, 90, 100, 200, 500, or 1000 nucleotides in length. In some embodiments, one or more UIDs in a plurality of UIDs have a different nucleotide length. For example, one or more first UIDs in a plurality of UIDs may have approximately, or at least approximately 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 , 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49, 50, 60, 70, 80, 90, 100, 200, 500 or 1000 nucleotides and one or more second UIDs in a plurality of UIDs can have approximately 2 , 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27 , 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 60, 70 , 80, 90, 100, 200, 500, or 1000 nucleotides, wherein the nucleotide number of the first one or more UIDs is different from the one or more second UIDs.

The number of UIDs can exceed the number of molecules to be tagged. In some embodiments, the number of UIDs is at least about 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90 or 100 times greater than the number of molecules to be labeled.

The number of different UIDs can exceed the number of different molecules to be tagged. In some embodiments, the number of different UIDs is at least about 1, 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5, 6, 7, 8, 9, 10 , 15, 20, 30, 40, 50, 60, 70, 80, 90 or 100 times greater than the number of different molecules to be labeled.

In some embodiments, at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30 %, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, or 100% of UIDs different have the same concentration. In some embodiments, at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30 %, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, or 100% of UIDs different have a different concentration.

UIDs in a UID population can have at least 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700 , 800, 900, 1000 or more different sequences. For example, UIDs in a population can have at least 2,000, 3,000, 4,000, 5,000, 6,000, 7,000, 8,000, 9,000, 10,000, 15,000, 20,000, 25,000, 30,000, 35,000, 40,000, 45,000, 50,000, 60,000, 70,000, 80,000, 90,000, 100,000, 200,000, 300,000, 400,000, 500,000, 600,000, 700,000, 800,000, 900,000, 1,000,000, or more different sequences. Therefore, a plurality of UIDs can be used to generate at least 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000 or more different sequences from one or more polynucleotides, such as target polynucleotides. For example, you can use a plurality of UIDs to generate at least 2,000, 3,000, 4,000, 5,000, 6,000, 7,000, 8,000, 9,000, 10,000, 15,000, 20,000, 25,000, 30,000, 35,000, 40,000, 45,000, 50,000, 60,000, 70,000, 80,000, 90,000, 100,000, 200,000, 300,000, 400,000, 500,000, 600,000, 700,000, 800,000, 900,000, 1 x 106, 2 x 106, 3 x 106, 4 x 106, 5 x 106, 6 x 106, 7 x 106, 8 x 106,

9 x 106, 1 x 107, 2 x 107, 3 x 107, 4 x 107, 5 x 107, 6 x 107, 7 x 107, 8 x 107, 9 x 107, 1 x 108, 2 x 108, 3 x 108, 4 x 108, 5 x

108, 6 x 108, 7 x 108, 8 x 108, 9 x 108, 1 x 109, 2 x 109, 3 x 109, 4 x 109, 5 x 109, 6 x 109, 7 x 109, 8 x 109, 9 x 109, 1 x 1010,

2 x 1010, 3 x 1010, 4 x 1010, 5 x 1010, 6 x 1010, 7 x 1010, 8 x 1010, 9 x 1010, 1 x 1011, 2 x 1011, 3 x 1011, 1011, 7 x 1011, 8x1011, 9x1011, 1x1012, 2x1012, 3x1012, 4x1012, 5x1012, 6x1012, 7x1012, 8x1012, 9x1012 or more different sequences from one or more polynucleotides, such as target polynucleotides. For example, a plurality of UIDs can be used to generate at least about 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100,

200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10,000, 15,000, 20,000, 25,000, 30,000, 35,000, 40,000, 45,000, 50,000, 60,000, 70,000, 80,000, 90,000, 100,000, 200,000, 300,000, 400,000, 500,000, 600,000, 700,000, 800,000, 900,000, 1 x 106, 2 x 106, 3 x 106, 4 x 106, 5 x 106, 6 x 106, 7x106, 8x106, 9x106,

1 x 107, 2 x 107, 3 x 107, 4 x 107, 5 x 107, 6 x 107, 7 x 107, 8 x 107, 9 x 107, 1 x 108, 2 x 108, 3 x 108, 4 x 108, 5 x 108, 6 x

108, 7 x 108, 8 x 108, 9 x 108, 1 x 109, 2 x 109, 3 x 109, 4 x 109, 5 x 109, 6 x 109, 7 x 109, 8 x 109, 9 x 109, 1 x 1010, 2 x 1010,

3 x 1010, 4 x 1010, 5 x 1010, 6 x 1010, 7 x 1010, 8 x 1010, 9 x 1010, 1 x 1011, 2 x 1011, 3 x 1011, 4 x 1011, 5 x 1011, 6 x 1011.7x

1011, 8 x 1011, 9 x 1011, 1 x 1012, 2 x 1012, 3 x 1012, 4 x 1012, 5 x 1012, 6 x 1012, 7 x 1012, 8 x 1012, 9 x 1012 or more different sequences to starting from at least about 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 200, 300, 400,

500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10,000, 15,000, 20,000, 25,000, 30,000, 35,000, 40,000, 45,000, 50,000, 60,000, 70,000, 80,000, 90,000, 100,000, 200,000, 300,000, 400,000, 500,000, 600,000, 700,000, 800,000, 900,000, 1 x 106, 2 x 106, 3 x 106, 4 x 106, 5 x 106, 6 x 106, 7 x 106, 8 x 106, 9 x 106, 1 x 107, 2 x 107, 3

10 x 107, 4 x 107, 5 x 107, 6 x 107, 7 x 107, 8 x 107, 9 x 107, 1 x 108, 2 x 108, 3 x 108, 4 x 108, 5 x 108, 6 x 108 , 7 x 108, 8 x 108,

9 x 108, 1 x 109, 2 x 109, 3 x 109, 4 x 109, 5 x 109, 6 x 109, 7 x 109, 8 x 109, 9 x 109, 1 x 1010, 2 x 1010, 3 x 1010, 4 x 1010, 5

1010, 6 x 1010, 7 x 1010, 8 x 1010, 9 x 1010, 1 x 1011, 2 x 1011, 3 x 1011, 4 x 1011, 5 x 1011, 6 x 1011, 7 x 1011, 8 x 1011 , 9 x

1011, 1x1012, 2x1012, 3x1012, 4x1012, 5x1012, 6x1012, 7x1012, 8x1012, 9x1012 or more target polynucleotides.

In some embodiments, one or more UIDs are used to group or contain sequences. In some embodiments, one or more UIDs are used to group or contain sequences, where the sequences in each container contain the same UID. In some embodiments, one or more UIDs are used to group or contain sequences,

wherein the sequences in each container comprise a set of amplicons. In some embodiments,

one or more UIDs are used to group or contain sequences, where the sequences in each container comprise

a plurality of sequences in which the polynucleotides from which the plurality of sequences were generated

they were derived from the same polynucleotide in an amplification reaction. For example, one or more UIDs can be used to group or contain sequences in an amplicon or a set of amplicons, or both. In some embodiments, one or more UIDs are not used to align sequences.

In some embodiments, one or more UIDs are not used to align sequences. In some embodiments, one or more UIDs are not used to align sequences and are used to group or contain sequences. In some embodiments, one or more UIDs are not used to align sequences and a specific target region is used to align sequences. In some embodiments, one or more UIDs are used to group or contain sequences and a

target specific region to align sequences. In some embodiments, one or more UIDs are not used to

align sequences, one or more UIDs are used to group or contain sequences, and a specific target region is used

to align sequences.

In some embodiments, one or more UIDs are used to align sequences. In some embodiments,

they use one or more UIDs to align sequences, where the aligned sequences contain the same UID. In some

embodiments, one or more UIDs are used to align sequences, wherein the aligned sequences comprise

two or more sequences from a set of amplicons. In some embodiments, one or more UIDs are used to

align sequences, wherein the aligned sequences comprise a plurality of sequences in which the polynucleotides from which the plurality of sequences were generated were derived from the same polynucleotide in

an amplification reaction.

Enzymes

The methods and kits disclosed herein may comprise one or more enzymes. The examples

Enzymes include, but are not limited to, ligases, reverse transcriptases, polymerases, and restriction nucleases.

In some embodiments, the binding of an adapter to polynucleotides comprises the use of one or more ligases.

Examples of ligases include, but are not limited to, DNA ligases such as DNA ligase I, DNA ligase III, DNA ligase

IV and T4 DNA ligase, and RNA ligases such as T4 RNA ligase I and T4 RNA ligase II.

The methods and kits disclosed herein may further comprise the use of one or more reverse transcriptases. In some embodiments, the reverse transcriptase is an HIV-1 reverse transcriptase, M-MLV reverse transcriptase, AMV reverse transcriptase, and telomerase reverse transcriptase. In some embodiments, the reverse transcriptase is the M-MLV reverse transcriptase.

In some embodiments, the methods and kits disclosed herein comprise the use of

one or more polymerases. Examples of polymerases include, but are not limited to, DNA polymerases and RNA polymerases. In some embodiments, the DNA polymerase is a DNA polymerase I, DNA polymerase II, DNA polymerase III holoenzyme, and DNA polymerase IV. Commercially available DNA polymerases include, but are not limited to, Bst 2.0 DNA polymerase, WarmStart ™ Bst 2.0 DNA polymerase, Bst DNA polymerase, Sulfolobus IV DNA polymerase, Taq DNA polymerase, 9 ° N ™ m DNA polymerase, (exo-) Deep VentR ™ DNA polymerase, Deep VentR ™ DNA polymerase, Heme KlenTaq ™, Taq LongAmp® DNA polymerase, OneTaq® DNA polymerase, Phusion® DNA polymerase, a high fidelity Q5 ™ DNA polymerase, Therminator ™ DNA polymerase and, Therminator DNA polymerase ™, Therminator ™ II DNA polymerase, Therminator ™ III DNA polymerase, VentR® DNA polymerase, VentR® (exo-) DNA polymerase, Bsu DNA polymerase, phi29 DNA polymerase, T4 DNA polymerase, T7 DNA polymerase, terminal transferase, Titanium® polymerase Taq, KAPA Taq DNA polymerase and KAPA Taq hot start DNA polymerase.

In some embodiments, the polymerase is an RNA polymerase such as RNA polymerase I, RNA polymerase II, RNA polymerase III, E. coli Poly (A) polymerase, RNA phi6 polymerase (RdRP), Poly (U) polymerase, RNA SP6 polymerase and T7 RNA polymerase.

Additional reagents

The methods and kits disclosed herein may comprise the use of one or more reagents. Examples of reagents include, but are not limited to, PCR reagents, ligation reagents, reverse transcription reagents, enzymatic reagents, hybridization reagents, sample preparation reagents, affinity capture reagents, solid supports such as microspheres, and reagents for the purification and / or isolation of nucleic acids.

A solid support can comprise virtually any insoluble or solid material, and a solid support composition is often selected that is insoluble in water. For example, a solid support may comprise or consist essentially of silica gel, glass (eg controlled pore glass (CPG)), nylon, Sephadex®, Sepharose®, cellulose, a metallic surface (eg steel, gold , silver, aluminum, silicon, and copper), a magnetic material, a plastic material (eg, polyethylene, polypropylene, polyamide, polyester, polyvinylidene difluoride (PVDF)), and the like. Examples of microspheres for use in accordance with the embodiments can include an affinity moiety that allows the microsphere to interact with a nucleic acid molecule. A solid phase (eg, a microsphere) may comprise a member of a binding pair (eg, avidin, streptavidin, or a derivative thereof). For example, the microsphere can be a streptavidin-coated microsphere and a nucleic acid molecule for immobilization on the microsphere can include a biotin moiety. In some cases, each polynucleotide molecule can include two affinity moieties, such as biotin, to further stabilize the polynucleotide. The microspheres may include additional characteristic features for use in nucleic acid immobilization or that can be used in subsequent screening or selection processes. For example, the microsphere can include a binding moiety, a fluorescent marker, or a fluorescent suppressor. In some cases, the microsphere can be magnetic. In some cases, the solid support is a microsphere. Examples of microspheres include, but are not limited to, streptavidin microspheres, agarose microspheres, magnetic microspheres, Dynabeads® microspheres, MACS® microspheres, antibody-conjugated microspheres (eg, anti-immunoglobulin microsphere), protein A-conjugated microspheres, microspheres protein G conjugated, protein A / G conjugated microspheres, protein L conjugated microspheres, oligo-dT conjugated microspheres, silica microspheres, silica-like microspheres, antibiotin microspheres, antifluorochrome microspheres and BcMag ™ carboxy-terminated magnetic microspheres. The microspheres or particles can be swellable (eg, polymeric microspheres such as Wang resin) or non-swellable (eg, CPG). In some embodiments, a solid phase is substantially hydrophilic. In some embodiments, a solid phase (eg, a microsphere) is substantially hydrophobic. In some embodiments, a solid phase comprises a member of a binding pair (eg, avidin, streptavidin, or derivative thereof) and is substantially hydrophobic or substantially hydrophilic. In some embodiments, a solid phase comprises a member of a binding pair (eg, avidin, streptavidin, or derivative thereof) and has a binding capacity greater than about 1350 pmol of free trapping agent (eg, free biotin) per mg of solid support. In some embodiments, the binding capacity of the solid phase comprising a member of a binding pair is greater than 800, 900, 1000, 1100, 1200, 1250, 1300, 1350, 1400, 1450, 1500, 1600, 1800, 2000 pmol of free capture agent per mg of solid support. Other examples of microspheres that are suitable for the invention are gold colloids or microspheres such as polystyrene microspheres or silica microspheres. Substantially any microsphere radius can be used. Examples of microspheres can include microspheres that have a radius ranging from 150 nanometers to 10 microns. Other sizes can also be used.

The procedures and kits disclosed herein may comprise the use of one or more buffers. Examples of buffers include, but are not limited to, wash buffers, ligation buffers, hybridization buffers, amplification buffers, and reverse transcription buffers. In some embodiments, the hybridization buffer is a commercially available buffer, such as TMAC Hyb solution, SSPE hybridization solution, and ECONOTM hybridization buffer. The buffers disclosed herein may comprise one or more detergents.

The methods and kits disclosed herein may comprise the use of one or more vehicles. Vehicles can enhance or improve the efficacy of one or more reactions disclosed herein (e.g. eg, ligation reaction, reverse transcription, amplification, hybridization). The carriers can decrease or prevent the non-specific loss of the molecules or any product thereof (eg, a polynucleotide and / or amplicon). For example, the vehicle can decrease the non-specific loss of a polynucleotide through absorption on surfaces. The vehicle can decrease the affinity of a polynucleotide for a surface or substrate (eg, container, Eppendorf tube, pipette tip). Alternatively, the carrier can increase the affinity of a polynucleotide for a surface or substrate (eg, microsphere, matrix, glass, slide, or chip). Carriers can protect the polynucleotide from degradation. For example, carriers can protect an RNA molecule from ribonucleases. Alternatively, the carriers can protect a DNA molecule from a DNase. Examples of carriers include, but are not limited to, polynucleotides such as DNA and / or RNA or polypeptides. Examples of DNA carriers include plasmids, vectors, polyadenylated DNA, and DNA oligonucleotides. Examples of RNA carriers include polyadenylated A r N, phage RNA, MS2 phage RNA, E. coli RNA, yeast RNA, yeast tRNA, mammalian RNA, mammalian tRNA, short polyadenylated synthetic ribonucleotides and oligonucleotides of RNA. The RNA vehicle can be a polyadenylated RNA. Alternatively, the RNA carrier can be a non-polyadenylated RNA. In some embodiments, the vehicle is from a bacterium, yeast, or virus. For example, the carrier can be a polynucleotide or polypeptide derived from a bacterium, yeast, or virus. For example, the carrier is a protein from Bacillus subtilis. In another example, the carrier is an Escherichia coli polynucleotide. Alternatively, the carrier is a polynucleotide or peptide from a mammal (eg, human, mouse, goat, rat, cow, sheep, pig, dog, or rabbit), avian, amphibian, or reptile.

The procedures and kits disclosed herein may comprise the use of one or more control agents. Control agents can include control polynucleotides, inactive enzymes, and non-specific competitors. Alternatively, control agents comprise bright hybridization, bright probe controls, nucleic acid templates, spiking controls, PCR amplification controls. PCR amplification controls can be positive controls. In other cases, the PCR amplification controls are negative controls. Nucleic acid template controls can be of known concentrations. Control agents can comprise one or more markers.

Addition controls can be templates that are added to a reaction or sample. For example, an addition template can be added to an amplification reaction. The addition template can be added to the amplification reaction at any time after the first cycle of amplification. In some embodiments, the addition template is added to an amplification reaction after cycle number 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 45 or 50. The addition template can be added to the amplification reaction at any time before the last amplification cycle. The addition template may comprise one or more nucleotides or nucleic acid base pairs. The addition template can comprise Dn, RNA, or any combination thereof. The addition template can comprise one or more markers.

Computer-implemented aspects

As understood by those skilled in the art, the procedures and information described herein may be implemented, in whole or in part, as computer-executable instructions on known computer-readable media. For example, the procedures described in this document can be implemented in hardware. Alternatively, the procedures can be implemented in software stored in, for example, one or more memories or other computer-readable medium and implemented in one or more processors. As is known, the processors can be associated with one or more controllers, computing units and / or other units of a computer system, or implanted in firmware as desired. If implemented in software, the routines can be stored in any computer-readable memory, such as RAM, ROM, flash memory, a magnetic disk, a laser disk, or other storage medium, as is also known. Also, this software can be delivered to a computing device by any known delivery method, including, for example, through a communication channel such as a telephone line, the Internet, a wireless connection, etc., or through from a transportable medium, such as a computer-readable disc, flash drive, etc.

More generally, and as understood by those skilled in the art, the various steps described above can be implemented as various blocks, operations, tools, modules, and techniques that, in turn, can be implemented in hardware, firmware, software, or whatever. combination of hardware, firmware and / or software. When implemented in hardware, some or all of the blocks, operations, techniques, etc. can be implemented in, for example, a custom integrated circuit (IC), an application-specific integrated circuit (ASIC), a programmable logic matrix in situ (FPGA), a programmable logic matrix (PLA), etc.

The results of data sequencing can be stored on a data storage unit, such as a data carrier, including computer databases, data storage disks, or other convenient data storage media. In certain embodiments, the computer database is an object database, a relational database, or a post-relational database. The data can be retrieved from the data storage unit using any convenient data query procedure.

When implemented in software, the software can be stored on any known computer-readable medium, such as magnetic disk, optical disk, or other storage medium, in RAM or ROM or flash memory of a computer, processor, hard drive, optical disc drive, tape drive, etc. Likewise, the software may be delivered to a user or a computer system by any known delivery method, including, for example, on a computer-readable disk or other transportable computer storage mechanism.

The claimed process steps may be operative with many other general purpose or special purpose computer system configurations or environments. Examples of well known computer systems, environments and / or configurations that may be suitable for use with the methods or systems of the claims include, but are not limited to, personal computers, servers, portable or handheld devices, multiprocessor systems, microprocessor-based systems, set-top boxes, programmable consumer electronics, network computers, minicomputers, mainframes, distributed computing environments including any of the above systems or devices, and the like.

The steps of the claimed methods can be described in the general context of computer-executable instructions, such as program modules, that are executed by a computer. In general, program modules include routines, programs, objects, components, and / or data structures that perform particular tasks or implement particular abstract data types. The procedures can also be implemented in distributed computing environments where tasks are performed by remote processing devices that are linked through a communications network. In integrated and distributed computing environments, program modules can be located on both local and remote computing storage media including memory storage devices. Numerous alternative embodiments could be implemented, using current technology or technology developed after the filing date of this application, which would still be within the scope of the claims defining the disclosure.

While the procedures and other elements have been described as preferably implemented in software, they can be implemented in hardware, firmware, etc., and can be implemented by any other processor. Thus, the elements described herein can be implemented in a standard multipurpose CPU or in specifically designed hardware or firmware, such as an application-specific integrated circuit (ASIC) or other hard-wired device as desired. When implemented in software, the software routine can be stored in any computer-readable memory, such as a magnetic disk, laser disk, or other storage medium, in a RAM or ROM of a computer or processor, on any basis. data, etc. In addition, this software may be delivered to a user or to a screening system by any known or desired delivery method, including, for example, on a computer-readable disk or other transportable computer storage mechanism or through a communication channel. communication, for example, a telephone line, the Internet or wireless communication. Modifications and variations may be made to the techniques and structures described and illustrated herein without departing from the spirit and scope of the present disclosure.

FIG. 58 is a block diagram illustrating a first exemplary architecture of a computer system 100 that may be used in connection with exemplary embodiments of the present invention. As depicted in FIG.

58 , the exemplary computer system may include a processor 102 for processing instructions. Non-limiting examples of processors include: an Intel Xeon ™ processor, AMD Opteron ™ processor, Samsung 32-bit RISC ARM1176JZ (F) -S v1.0 ™ processor, ARM Cortex-A8 Samsung S5PC100 ™ processor, ARM Cortex-A8 processor Apple A4 ™, Marvell PXA930 ™ processor, or functionally equivalent processor. Multiple threads of execution can be used for parallel processing. In some embodiments, multiple processors or multi-core processors can also be used, either in a single computer system, in a group, or distributed across systems over a network comprising a plurality of computers, mobile phones, and / or personal data assistant devices.

As illustrated in FIG. 59 , a high-speed cache memory 104 may be connected to, or incorporated into, the processor 102 to provide a high-speed memory for instructions or data that have recently been used, or are used frequently, by the processor 102 . Processor 102 is connected to a north bridge 106 via a processor bus 108 . North bridge 106 is connected to random access memory (RAM) 110 via memory bus 112 and manages access to RAM 110 by processor 102 . The north bridge 106 is also connected to a south bridge 114 by a chipset bus 116 . The south bridge 114 is, in turn, connected to a peripheral bus 118 . The peripheral bus can be, for example, PCI, PCI-X, PCI Express or other peripheral bus. The North Bridge and South Bridge are often referred to as the processor chipset and handle the transfer of data between the processor, RAM, and peripheral components on the peripheral bus 118 . In some alternative architectures, the north bridge functionality can be incorporated into the processor instead of using a separate north bridge chip.

In some embodiments, system 100 may include an accelerator card 122 attached to peripheral bus 118 . The accelerator can include programmable gate arrays (FPGAs) or other hardware to speed up certain processing. For example, an accelerator can be used for adaptive restructuring of data or to evaluate algebraic expressions used in extended set processing.

Software and data are stored in external storage 124 and can be loaded into RAM 110 and / or cache 104 for use by the processor. System 100 includes an operating system for managing system resources; the Non-limiting examples of operating systems include: Linux, Windows ™, MACOS ™, BlackBerry OS ™, iOS ™, and other functionally equivalent operating systems, as well as application software that runs on top of the operating system to manage storage and data optimization in accordance with exemplary embodiments of the present invention.

In this example, system 100 also includes network interface cards (NICs) 120 and 121 connected to the peripheral bus to provide network interfaces for external storage, such as network-attached storage (NAS) and other computer systems that can be connected. use for distributed parallel processing.

FIG. 59 is a diagram showing a network 200 with a plurality of computer systems 202a and 202b , a plurality of mobile phones and personal data assistants 202c , and network attached storage (NAS) 204a and 204b . In exemplary embodiments, systems 202a , 202b, and 202c can manage data storage and optimize data access to data stored in network attached storage (NAS) 204a and 204b . A mathematical model can be used for the data and evaluated using distributed parallel processing through computer systems 202a and 202b , and personal data assistant and mobile phone systems 202c . Computer systems 202a and 202b , and personal data assistant and mobile phone systems 202c may also provide parallel processing for adaptive restructuring of data stored in network attached storage (NAS) 204a and 204b . FIG. 59 illustrates just one example, and a wide variety of other computer systems and architectures can be used in conjunction with the various embodiments of the present invention. For example, a single card server can be used to provide parallel processing. Single processor cards can be connected through a backplane to provide parallel processing. The storage can also be attached to the backplane or as Network Attached Storage (NAS) through a separate network interface.

In some exemplary embodiments, the processors can maintain separate memory spaces and transmit data over network interfaces, backplane, or other connectors for parallel processing by other processors. In other embodiments, some or all of the processors may use a shared virtual address memory space.

FIG. 60 is a block diagram of a multiprocessor computing system 300 using a shared virtual address memory space in accordance with an exemplary embodiment. The system includes a plurality of processors 302a-f that can access a shared memory subsystem 304 . The system incorporates a plurality of programmable hardware memory algorithm (MAP) processors 306a-f in memory subsystem 304 . Each MAP 306a-f may comprise a memory 308a-f and one or more in situ programmable gate arrays (FPGA) 310a-f . The MAP provides a configurable functional unit and particular algorithms or parts of algorithms can be provided to FPGAs 310a-f for processing in close coordination with a respective processor. For example, MAPs can be used to evaluate algebraic expressions against the data model and to perform adaptive data restructuring in exemplary embodiments. In this example, all processors have global access to each MAP for these purposes. In one configuration, each MAP can use direct memory access (DMA) to access associated memory 308a-f , allowing it to execute tasks independently of, and asynchronously from, the respective microprocessor 302a-f . In this configuration, an m Ap can send results directly to another MAP for pipelining and parallel execution of algorithms.

The above computer architectures and systems are only examples, and a wide variety of other computer, mobile phone, and personal data assistant computer architectures and systems may be used in connection with exemplary embodiments, including systems using any combination of processors. general, coprocessors, FPGAs and other programmable logic devices, system-on-chips (SOC), application-specific integrated circuits (ASICs), and other logic and processing elements. In some embodiments, all or part of the data management and optimization system can be implemented in software or hardware and any variety of data storage media can be used in connection with exemplary embodiments, including random access memory, hard drives, flash memory, tape drives, disk arrays, network attached storage (NAS), and other local or distributed data storage systems and devices.

In exemplary embodiments, the data management and optimization system can be implemented using software modules running on any of the above or other computer systems and architectures. In other embodiments, the system functions can be partially or fully implemented in firmware, programmable logic devices such as field programmable gate arrays (FPGAs), system-on-chips (SOC), application-specific integrated circuits (ASICs). or other logical and processing elements. For example, the processor and optimizer assembly can be implemented with hardware acceleration through the use of a hardware accelerator card, such as an accelerator card.

One skilled in the art will appreciate that, although only one of each of the components identified above is depicted in the figures, any number of any of these components can be provided. Furthermore, one skilled in the art will recognize that one or more components of any of the disclosed systems can be combined or incorporated into another component shown in the figures. One or more of the components represented in the Figures can be implemented in software on one or more computer systems. For example, they may comprise one or more applications, which may comprise one or more computer readable instruction units which, when executed by a processor, cause a computer to perform the steps of a procedure. Computer-readable instructions can be stored on a computer-readable medium, such as memory or disk. Such media typically provide non-transient storage. Alternatively, one or more of the components depicted in the figures may be hardware components or combinations of hardware and software such as, for example, special purpose computers or general purpose computers. A computer or computer system can also comprise an internal or external database. The components of a computer or computer system can be connected via a local bus interface.

One skilled in the art will appreciate that the steps described above can be incorporated into various software modules. Although the disclosed components have been described above as separate units, one skilled in the art will recognize that the functionalities provided by one or more units can be combined. As one skilled in the art will appreciate, one or more of the units may be optional and may be omitted from implementations in certain embodiments.

Kits

Kits useful in the methods of the disclosure comprise components useful in any of the methods described herein, including, for example, primers for nucleic acid amplification, hybridization probes for detecting genetic variation or other marker detection, enzymes nucleic acid probes, optionally labeled with suitable labels, allele-specific oligonucleotides, antibodies that bind to an altered polypeptide encoded by a nucleic acid of the disclosure as described herein, or to a natural polypeptide encoded by an acid nucleic acid of the disclosure as described herein, means for amplifying genetic variations or fragments thereof, means for analyzing the nucleic acid sequence of nucleic acids comprising genetic variations as described herein, means for analyze amino sequence of a polypeptide encoded by a genetic variation, or a nucleic acid associated with a genetic variation, etc. Kits may, for example, include necessary buffers, nucleic acid primers to amplify nucleic acids, solid supports, and reagents for allele-specific detection of amplified fragments using such primers and necessary enzymes (e.g., DNA polymerase), such as any of those described in this document. Additionally, the kits can provide reagents for assays to be used in combination with the methods of the present disclosure, for example, reagents for use with other screening assays for a disease or condition.

In some embodiments, the disclosure relates to a kit for analyzing a nucleic acid sample from a subject for the presence of a genetic variation, wherein the kit comprises reagents necessary to selectively detect at least one particular genetic variation in the genome of the individual. In some embodiments, the disclosure relates to a kit for analyzing a nucleic acid sample from a subject for the presence of at least one particular allele of at least one polymorphism associated with a genetic variation in the subject's genome. In some embodiments, the reagents comprise at least one contiguous oligonucleotide that hybridizes to a fragment of the individual's genome that comprises at least genetic variation. In some embodiments, the reagents comprise at least one pair of oligonucleotides that hybridize to opposing strands of a genomic segment obtained from a subject, wherein each pair of oligonucleotide primers is designed to selectively amplify a fragment of the individual's genome. that includes at least one genetic variation or a fragment of a genetic variation. Such oligonucleotides or nucleic acids can be designed using the procedures described herein. In some embodiments, the kit comprises one or more labeled nucleic acids capable of allele-specific detection of one or more polymorphic markers or specific haplotypes with a genetic variation, and reagents for the detection of the marker. In some embodiments, a kit for detecting SNP markers may comprise an oligonucleotide detection probe, which hybridizes to a template DNA segment containing a SNP polymorphism to be detected, an enhancer oligonucleotide probe, a detection probe, primer and / or endonuclease, eg, as described by Kutyavin et al. (Nucleic Acid Res. 34: el28 (2006)).

In some embodiments, the DNA template is amplified by any means of the present disclosure, prior to evaluation for the presence of specific genetic variations as described herein. Standard procedures well known to one of skill in the art can be used to perform these procedures and are within the scope of the disclosure. In one such embodiment, reagents to perform these procedures can be included in the reagent kit.

In a further aspect of the present disclosure, a pharmaceutical package (kit) is provided, the package comprising a therapeutic agent and a set of instructions for administration of the therapeutic agent to humans screened for one or more variants of the present disclosure, such as is disclosed in this document. The therapeutic agent can be a small molecule drug, an antibody, a peptide, an antisense or RNAi molecule, or other therapeutic molecules as described herein. In some embodiments, an individual identified as a carrier of at least one variant of the present disclosure is instructed to take a prescribed dose of the therapeutic agent. In one such embodiment, an individual identified as a The carrier of at least one variant of the present disclosure is instructed to take a prescribed dose of the therapeutic agent. In some embodiments, an individual identified as a non-carrier of at least one variant of the present disclosure is instructed to take a prescribed dose of the therapeutic agent.

Also provided herein are articles of manufacture, comprising a probe that hybridizes to a region of the human chromosome as described herein and can be used to detect a polymorphism described herein. For example, any of the probes for detecting polymorphisms described herein can be combined with packaging material to generate articles of manufacture or kits. The kit may include one or more of other items including: instructions for use; and other reagents such as a label or an agent useful for binding a label to the probe. Instructions for use may include instructions for probe screening applications to make a diagnosis, prognosis, or theranosis of a disease or condition in a procedure described herein. Other instructions may include instructions for attaching a marker to the probe, instructions for performing in situ analysis with the probe, and / or instructions for obtaining a nucleic acid sample to be analyzed from a subject. In some cases, the kit may include a labeled probe that hybridizes to a region of the human chromosome as described herein.

The kit can also include one or more additional control or reference probes that hybridize to the same chromosome or another chromosome or part thereof that may have an abnormality associated with a particular endophenotype. A kit that includes additional probes can further include labels, for example, one or more of the same or different labels for the probes. In other embodiments, the additional probe (s) provided with the kit may be a labeled probe (s). When the kit further includes one or more additional probes or probes, the kit may further provide instructions for the use of the additional probe (s). Kits can also be provided for use in self-diagnosis. Such test kits can include devices and instructions that a subject can use to obtain a nucleic acid sample (eg, buccal cells, blood) without the assistance of a healthcare provider. For example, mouth cells can be obtained using a mouth swab or brush or using a mouth rinse.

The kits provided herein may also include a prepaid envelope (for example, a postage-paid envelope or shipping package) that can be used to return the nucleic acid sample for analysis, for example, to a laboratory. . The kit can include one or more containers for the nucleic acid sample, or the nucleic acid sample can be in a standard blood collection vial. The kit may also include one or more informed consent forms, a test request form, and instructions on how to use the kit in a procedure described herein. Procedures for using such kits are also included herein. One or more of the forms (for example, the test request form) and the container containing the nucleic acid sample can be encoded, for example, with a barcode to identify the subject who provided the nucleic acid sample .

In some embodiments, an in vitro screening test may comprise one or more devices, tools, and equipment configured to collect a nucleic acid sample from an individual. In some embodiments of an in vitro screening test, the tools for collecting a nucleic acid sample may include one or more of a swab, scalpel, syringe, scraper, container, and other devices and reagents designed to facilitate the collection, storage, and transportation of a nucleic acid sample. In some embodiments, an in vitro screening test can include reagents or solutions to collect, stabilize, store, and process a nucleic acid sample.

Such reagents and solutions for nucleotide harvesting, stabilization, storage and processing are well known to those of skill in the art and can be indicated by specific procedures used by an in vitro screening test as described herein. In some embodiments, an in vitro screening test as disclosed herein may comprise a microarray and reagent apparatus, a flow cell and reagent apparatus, a multiplexing and reagent nucleotide sequencer, and hardware and Additional software required to analyze a nucleic acid sample for certain genetic markers and to detect and visualize certain genetic markers.

EXAMPLES

Example 1 : RNA-directed sequencing protocol

CDNA synthesis

1 ng to 1000 ng of RNA was combined with 5 µl of the following primer mix containing 5 pmol of each primer (SEQ ID NO: 3-7, respectively, in order of appearance):

The 12 µl reaction was heated for 1 minute at 95 ° C, followed by 65 ° C for 1 minute and a hold at 4 ° C. 4 µl of 5x first strand buffer (Life Technologies, Carlsbad, CA.), 1 µl of 10 mM dNTP, 1 µl of 0.1 M DTT, 1 µl of RNase inhibitor (Enzymatics, Beverly, MA.) And then , 1 µl of Superscript III (Life Technologies, Carlsbad, CA.) was added to the reaction. This reaction was incubated for 45 minutes at 55 ° C followed by an additional 5 minutes at 85 ° C. The reaction was then incubated at 37 ° C after the addition of 1 µl of RNase H (Enzymatics, Beverly, MA). The reaction was purified with Ampure (Beckman Coulter Genomics, Danvers, MA).

Adapter ligation

3 µl of cDNA were combined with 2 µl of P7 / C710 µM adapter, 1 µl of T4 DNA ligase (Enzymatics, MA), 2 µl of fast ligase buffer, and 2 µl of nuclease-free dH2Ü. Reactions were incubated for 1 hour at room temperature. The reaction was then heat inactivated by incubating for 10 minutes at 65 ° C, and then purified with Ampure XP (Beckman Coulter Genomics, Danvers, MA).

Primer extension reaction

10 µl of adapter-ligated DNA was added to 8.4 µl of dH2Ü, 0.3 µl of 10 mM dNTP, 5 µl of Phusion HF buffer, 0.3 µl of Phusion Hotstart II polymerase (Thermo Fischer, Chicago, IL) and 0.5 pmol of each of the following primers in a volume of 1 µl:

The reaction was incubated for 1 minute at 98 ° C, followed by 5 cycles of 98 ° C, 20 seconds at 60 ° C, 30 seconds at 72 ° C followed by a hold at 4 ° C. The reaction was then purified with Ampure.

PCR amplification

5 µl of purified primer extension product was combined with 10 µl of 5x Phusion Hotstart buffer, 0.6 µl of 10 mM dNTP, 2 µl of 12.5 pM C5 PCR primer (AATGATACGGCGACCACCGAGATCT) (SEQ ID NO: 28) , 2 µl of 12.5 µM C7 PCR primer (CAAGCAGAAGACGGCATACGAGAT) (SEQ ID NO: 29) 29.8 µl of dH20 and 0.6 µl of Phusion Hotstart II polymerase. The reaction was incubated for 1 minute at 98 ° C followed by 25 cycles of 98 ° C for 10 seconds, 60 ° C for 20 seconds, and 72 ° C for 30 seconds.

Clustered reactions

The PCR products were separated on an agarose gel. Gel bands were excised and purified with Qiagen's Minelute Gel Purification Kit. Purified samples were analyzed by Agilent Tapestation analysis, diluted, and pooled by library band quanta prior to sequencing on the Illumina MiSeq platform.

Example 2: DNA directed sequencing preparation

Genomic primer extension

4 µg of human genomic DNA, extracted from the patient's blood, was combined with 0.6 µl of 10 mM dNTP, 1 µl of BST 2.0 polymerase (New England Biolabs, Ipswich, MA), 5 µl of isothermal amplification buffer ( NEB) 10x and 1 µl of primer CS-300.5 pM containing the sequences below.

Adapter ligation

20 µl of the eluted primer extension reaction was combined with 1.5 µl of P7 / C75 pM adapter (hybridized duplex of oligo 1 upper and 1 lower strand described above with correct barcode pairing), 1 µl of T4 DNA ligase, 6 µl of 5x fast ligase buffer (New England Biolabs, Ipswich, MA) and 1.5 µl of nuclease-free dhhO. Reactions were incubated for 1 hour at room temperature. The reaction was heat inactivated by incubating for 10 minutes at 68 ° C. The reaction was then purified with Ampure XP (Beckman).

Capture of microspheres

180 µl of my One C1 SA microspheres (Dynal, Lifetech) were washed with 1 ml of 1x B&W. The microspheres were washed with 2 additional 1x B&W washes at 200 µl each. The total elution volume of the Ampure purified adapter ligation was 65 ul. An equal volume (65 µl) of 2x B&W and an additional 100 µl of 1x B&W were added for a total volume of 230 µl per binding. The reaction was placed on the incubator shaker for 20 minutes. After sample binding, the microspheres were washed with 200 µl of NSX and the liquid was removed.

The samples were then resuspended in 200 µl 0.1N NaOH and rotated for 20 minutes at room temperature. The NaOH was removed and a second wash was performed with an additional 200 µl of 0.1 N NaOH. The microspheres were washed 2 times with 600 µl of TE followed by removal of NaOH. The microspheres were washed 2 times with NSX. The microspheres were placed in 100 µl of Tex (TE with 0.01% Triton X) and stored overnight at 4 C. Before primer extension, the microspheres were washed 2 times with 200 µl of 1x Phusion HF (with 0.01% Triton X) and once with 1x HF without Triton X.

Primer extension reaction

The microsphere mixture was resuspended in 21.1 µl dH2O, 0.6 µl 10 mM dNTP, 6 µl Phusion HF buffer, 0.3 µl Phusion Hotstart II polymerase (Thermo Fischer, Chicago, IL), and 0.5 pmol of each of the following primers in a volume of 2 µl:

The reaction was incubated for 1 minute at 98 ° C, followed by 5 cycles of 98 ° C, 20 seconds at 60 ° C, 30 seconds at 72 ° C followed by a hold at 4 ° C. The reaction was then purified with Ampure.

PCR amplification

5 µl of purified primer extension product was combined with 10 µl of 5x Phusion Hotstart (HF) buffer, 0.6 µl of 10 mM dNTP, 2 µl of 12.5 pM C5 PCR primer (AATGATACGGCGACCACCGAGATCT) (SEQ ID NO : 28), 2 µl of 12.5 µM C7 PCR primer (CAAGCAGAAGACG GCATACGAGAT) (SEQ ID NO: 29) 29.8 µl of dH20 and 0.6 µl of Phusion Hotstart II polymerase. The reaction was incubated for 1 minute at 98 ° C followed by 25 cycles of 98 ° C for 10 seconds, 60 ° C for 20 seconds, and 72 ° C for 30 seconds.

The gel bands were excised and purified with the Qiagen Minelute Gel Purification Kit according to the manufacturer's instructions. Purified samples were analyzed by Agilent Tapestation analysis, and diluted and pooled by library band quanta prior to sequencing on the Illumina MiSeq.

Example 3: Improved Primer Panel Creation - Primer Dimer Formation Analysis

To create primer panels for use in the directed sequencing procedures described, the stability and robustness of amplified targets. Additionally, uniformity of coverage and sequence accuracy were evaluated to create primer panels and improve assay performance.

To improve these parameters, several measures were evaluated, including the quality of the final amplified targets, the amplification cycle requirements, the cleanliness of the amplified products, and the performance of the amplified products. Sequence analysis of amplified products was also performed to improve target specificity, uniformity of coverage, depth of sequencing, and accuracy of SNP reads. Iterative cycles of protocol modification, product build analysis, and sequence quality were used to improve assay performance.

Using sequence analysis, a 75 bp unwanted product was determined to be related to the primers used during the linear extension / amplification step. A larger 125-200 bp doublet or triplet product was determined to be related to the C7 / P7 adapter and primers used during the linear extension / amplification step. Larger dimer products> 150 bp were determined to be related to primers used during the initial RT / PE step.

The main dimer product lengths detected with sequence analysis were 143, 155 and 160 and corresponded to dimer products. Sequence analysis revealed that the 143 bp product was associated with primer MCOLN1_11_1_f_PE2_5, which occurred 132 times, and primer GAA_14_1_0_Pe 2_7, which occurred 660 times. Sequence analysis revealed that the 155 bp product was associated with primer GAA_14_1_o_PE2_7, which was produced 1146 times. Sequence analysis revealed that the 160 bp product was associated with the primer IKBKAP_32_1_CPE2_6, which was produced 464 times. As a result of this analysis, these primers were removed from the primer panel.

From these analyzes, it was found that dimer formation is not desired is facilitated by primers with high melting temperatures (e.g., T ^m of 70 ° C) and low annealing temperatures (eg 60 ° C), primers with high Gc content by interacting with the primer / UID regions, and the 3 'exoactivity of some DNA polymerases (eg, Phusion). As a result of these analyzes and conclusions, primer panels have been created with primers that do not have a high percentage of GC in their last 5 nucleotides at their 3 'end. As a result of these analyzes and conclusions, the formation of dimer product has been considerably reduced compared to the use of initial primer panels and the improvements obviated the need for gel purification of the target product.

Various primer exclusion criteria were created from the above experiments and used to generate subpanels from panel CS-350. The subpanels were created using one or a combination of these exclusion parameters. First, the primers with the highest number of erroneous reads (caused by priming errors) during the initial RT / PE stage or the linear extension / amplification stage. Second, dimer prevalent primers as defined by sequence analysis were excluded from the sub-panels. Third, the primers that were responsible for generating one or more of the largest number of total reads for a target (boosters) were excluded from the subpanels.

Example 4: Improved primer panels - analysis of% GC content in amplicon and primer melting temperatures

To create primer panels for use in the directed sequencing procedures described, the stability and robustness of the amplified targets were evaluated in comparison to the% GC content of the amplicons and the melting temperatures of the primers used. The number of reads generated for a particular primer was used as a measure for primer performance. Additionally, uniformity of coverage and sequence accuracy were evaluated to create primer panels and improve assay performance.

Most low yield (fewer readings) had an extension primer / linear amplification with a T ^m <60 ° C and were derived from AT rich amplicons. A second group with low yield was composed of amplicons with higher GC percentages and primers with high melting temperatures. As a result of these experiments and analyzes, several criteria were created for the amplicons and primers. First, the melting temperature range of the primers to be used should be between 60 ° C - 68 ° C. Second, the primers can be between 21 and 32 nucleotides in length. Third, the primers must not contain 4 or more pyrimidines in the last 5 nucleotides at the 3 'end. Fourth, the amplicon must contain between 30% and 70% GC content. Finally, the length of the amplicon should be between 225 and 300 base pairs in length.

Example 5: improved reaction conditions

To improve reaction conditions for use in the directed sequencing procedures described, the stability and robustness of the amplified targets were evaluated. Additionally, coverage uniformity and sequence accuracy were evaluated to improve reaction conditions and improve assay performance.

To improve these parameters, several measures were evaluated, including the quality of the final amplified targets, the amplification cycle requirements, cleanliness of amplified products, and performance of amplified products. Iterative cycles of protocol modification, product build analysis, and sequence quality were used to improve assay performance.

Initial primer titration experiments were not sufficient to allow target production with existing amplification ramping and hybridization conditions. For highly complex primer sets it was hypothesized that more stringent ramp conditions would be required based on evaluation of the above parameters and measurements.

Using original ramping conditions for the CS-30 primer panel, 30 targets did not work with more complex primer panels. Stringency was increased by decreasing the ramp rates for the linear extension / amplification stage (PE2) and adding a hold at 68 ° C for the initial RT / PE stage. The minimum annealing temperature retention was lowered to 55 ° C to accommodate lower primer melt temperatures. Fixing the overall concentration of the primer sets showed better product formation with panel sizes ranging from 24 to 346 amplicons. A combination of the stringent RT / PE and linear extension / amplification ramp conditions with the fixed global primer sets showed improvements over the same procedures employing different conditions.

Additionally, other experiments were performed that employed various additives during the RT / PE and linear extension / amplification steps to improve product formation. Various additive conditions were tested and their impact on product formation was evaluated. The data showed improvements in reading coverage with optimized reaction conditions. Ammonium sulfate and additional MgCh had the most significant impact on depth of reading. These experiments were performed with the entire CS-350 panel prior to panel optimization. These experiments were performed to help define the mechanism of dimer formation and identify the primers involved.

Example 5: directed sequencing protocol

The procedures described herein have been used to specifically target, amplify, sequence, and / or quantify DNA or RNA sequences present in a sample. These procedures have allowed the addition of additional sequences that will format the target sequences for sequencing or other molecular analysis. The procedures have been used to add a unique identification sequence (UID) that allows to contain the reads derived from the same RNA or DNA molecule, which allows to determine if certain sequence polymorphisms were found in a population of RNA or DNA molecules. , or resulted from an amplification artifact. RNA or DNA has been used as the template / starting material. The sample can be from any organism or virus. The procedures have been used to format target molecules for a variety of sequencing and other molecular analysis devices.

A library preparation protocol was used for the purpose of targeted sequencing to be sequenced on the NGS platform. In this assay, many specific biological targets (one to many thousands), from a patient biological sample, were converted into an NGS-compatible library and sequenced. This allowed the identification of target frequencies (gene expression) and mutations or SNPs in the genome or transcriptome of the patient, from which clinical information has been obtained. This assay was also used to identify the presence or absence and frequency of various infections targeting RNA or DNA of viruses, bacteria, or fungi in patient samples.

Various applications have been made individually or simultaneously by sequencing the targets required for cancer mutation profiling, SNP and mutation analysis, vehicle testing, infectious diagnostics, and gene expression analysis, for example.

For RNA, reverse transcription (RT) was performed using reverse transcriptase enzyme, to generate a cDNA complement for the targets or interest. For DNA, primer extension (PE) was performed, using DNA polymerase to generate DNA as a complement to the targets or interest. In both cases, the oligo used to perform said RT or PE was composed of a gene specific primer directed against the target of interest, a unique identifier mark (UID) (a long or totally degenerate barcode composed of 15 or more degenerate bases); \ \ \ \ \ \ \ NN \ \ WN \ (SEQ ID NO: 1) or NWNNWNWNNW \ N \ N \ (SEQ ID NO: 2), and the universal mark of a known sequence (called forward primer P7: P7f) , with a phosphorylated 5 'end. The UID was used to barcode a single molecule of any RNA or DNA molecule and has been used in the sequence analysis phase to identify the absolute number of starting molecules in biological samples, deconvolve the consensus sequences of target and eliminate all PCR or sequencing errors, thereby increasing sequencing accuracy. To capture many different genes, a group consisting of many such oligo was used, where the specific parts of the corresponding gene of the oligo were a complement for each target to be captured.

Adapter Formatting / Ligation : At this stage, an additional sequence required for amplification / analysis was added to the newly synthesized nucleic acid. This additional sequence can be added by ligation (preferred approach), using a single stranded oligo or a bridging oligo. This sequence has been added by amplification in later stages. This sequence has been used as a generic primer sequence for the amplification of a large population of formatted sequences. This sequence has contained a barcode for the identification of the sample. This sequence has also contained a purification tag such as biotin. In the approach, an adapter used for ligation was composed of an upper chain that served as an oligo bridge complementary to the P7f 'region, and a lower chain oligo that was linked to the product generated during the RT or PE step. The resulting product added the remainder of the P7 region (for sequencing), as well as a sample barcode (SBC), required if many patient samples are processed in parallel, and optionally, the C7 region, to be grouped into one NGS platform.

Microsphere Capture (optional) : In this step, a partially formatted nucleic acid was captured via a previously added affinity tag or sequence. This capture was used to separate target sequences from template / sample sequences that are not of interest.

Primer extension / linear amplification : linear amplification or linear primer extension (LPE) was performed using a DNA polymerase and using a group of oligos composed of a specific region of the gene for each of the targets to be captured, a primer label of sequencing (P5), and a universal tag (C5) to pool on an NGS platform. A group of oligos was used to make LPE of many targets at once in a single reaction. This extension occurred in solution or with the template attached to a microsphere or matrix. LPE has been performed as a single cycle or many cycles (up to hundreds), avoiding the PCR amplification bias that would be generated in standard PCR.

PCR enrichment : the targets of interest were simultaneously amplified by PCR using the following oligos: a forward primer composed of any part of the LPE oligo, preferably composed of C5 (or optionally P5C5, or just P5), and a reverse primer complementary to any part of the universal adapter, but preferably complementary to C7 (or optionally P7-BC-C7 or just P7).

Final Library : The final library consisted of a group of all the targets captured with the tags.

The following claims are intended to define the scope of the methods, compositions, and kits described herein. Claims can be drafted to exclude any optional elements. As such, this statement is intended to serve as an antecedent basis for the use of exclusive terminology such as "only", "only" and the like in connection with the repeated mention of elements of the claim or the use of a "negative" limitation. .

SEQUENCE LIST

<110> F. HOFFMANN-LA ROCHE AG

<120> DIRECTED SEQUENCING AND UID FILTERING

<130> 32510-WO

<140>

<141>

<150> 62 / 031.405

<151> 07/31/2014

<150> 61 / 938.227

<151> 02/11/2014

<160> 100

<170> PatentIn version 3.5

<210> 1

<211> 15

<212> DNA

<213> Artificial Sequence

<220>

<221> source

<223> / note = "Description of artificial sequence: synthetic oligonucleotide"

<220>

<221> modified_base

<222> (1). . (fifteen)

<223> a, c, t, g, unknown or other

^{<400> 1}

nnnnnnnnnn nnnnn 15 <210> 2

<211> 17

<212> DNA

<213> Artificial Sequence

<220>

<221> source

<223> / note = "Description of artificial sequence: synthetic oligonucleotide"

<220>

<221> modified_base

<222> (1). . (5)

<223> a, c, t, g, unknown or other

<220>

<221> modified_base

<222> (7). . (eleven)

<223> a, c, t, g, unknown or other

<220>

<221> modified_base

<222> (13). . (17)

<223> a, c, t, g, unknown or other

^{<400> 2}

nnnnnwnnnn nwnnnnn 17

^< 210> 3

<211> 35

<212> DNA

<213> Artificial Sequence

<220>

<221> source

<223> / note = "Description of artificial sequence: synthetic primer"

<220>

<221> source

<223> / note = "5 '-Fos modified"

<220>

<221> modified_base

<222> (7). . (10)

<223> a, c, t, g, unknown or other

<220>

<221> modified_base

<222> (12). . (fifteen)

<223> a, c, t, g, unknown or other

<400> 3

cgatctnnnn wnnnnaaccg actgctgtca ccttc 35

<210> 4

<211> 35

<212> DNA

<213> Artificial Sequence

<220>

<221> source

<223> / note = "Description of artificial sequence: synthetic primer"

<220>

<221> source

<223> / note = "5 '-Fos modified"

<220>

<221> modified_base

<222> (7). . (10)

<223> a, c, t, g, unknown or other

<220>

<221> modified_base

<222> (12). . (fifteen)

<223> a, c, t, g, unknown or other

<400> 4

cgatctnnnn wnnnnccagg gagaccaaaa gcctt 35

<210> 5

<211> 37

<212> DNA

<213> Artificial Sequence

<220>

<221> source

<223> / note = "Description of artificial sequence: synthetic primer"

<220>

<221> source

<223> / note = "5 '-Fos modified"

<220>

<221> modified base

<222> (7). . (10)

<223> a, c, t, g, unknown or other

<220>

<221> modified_base

<222> (12). . (fifteen)

<223> a, c, t, g, unknown or other

<400> 5

cgatctnnnn wnnnnaccag attaaccaca accatgc 37

<210> 6

<211> 37

<212> DNA

<213> Artificial Sequence

<220>

<221> source

<223> / note = "Description of artificial sequence: synthetic primer"

<220>

<221> source

<223> / note = "5 '-Fos modified"

<220>

<221> modified_base

<222> (7). . (10)

<223> a, c, t, g, unknown or other

<220>

<221> modified_base

<222> (12). . (fifteen)

<223> a, c, t, g, unknown or other

<400> 6

cgatctnnnn wnnnnatggt tcacacccat gacgaac 37

<210> 7

<211> 37

<212> DNA

<213> Artificial Sequence

<220>

<221> source

<223> / note = "Description of artificial sequence: synthetic primer"

<220>

<221> source

<223> / note = "5 '-Fos modified"

<220>

<221> modified_base

<222> (7). . (10)

<223> a, c, t, g, unknown or other

<220>

<221> modified_base

<222> (12). . (fifteen)

<223> a, c, t, g, unknown or other

<400> 7

cgatctnnnn wnnnngtttt tctagacggc aggtcag 37

<210> 8

<211> 64

<212> DNA

<213> Artificial Sequence

<220>

<221> source

<223> / note = "Description of artificial sequence: synthetic oligonucleotide"

^{<400> 8}

agatcggaag agcacacgtc tgaactccag tcacatcacg atctcgtatg ccgtcttctg 60

cttg 64

<210> 9

<211> 64

<212> DNA

<213> Artificial Sequence

<220>

<221> source

<223> / note = "Description of artificial sequence: synthetic oligonucleotide"

^{<400> 9}

agatcggaag agcacacgtc tgaactccag tcaccgatgt atctcgtatg ccgtcttctg 60

cttg 64

<210> 10

<211> 64

<212> DNA

<213> Artificial Sequence

<220>

<221> source

<223> / note = "Description of artificial sequence: synthetic oligonucleotide"

<400> 10

agatcggaag agcacacgtc tgaactccag tcacttaggc atctcgtatg ccgtcttctg 60

cttg 64

<210> 11

<211> 64

<212> DNA

<213> Artificial Sequence

<220>

<221> source

<223> / note = "Description of artificial sequence: synthetic oligonucleotide"

<400> 11

agatcggaag agcacacgtc tgaactccag tcactgacca atctcgtatg ccgtcttctg 60

cttg 64

<210> 12

<211> 64

<212> DNA

<213> Artificial Sequence

<220>

<221> source

<223> / note = "Description of artificial sequence: synthetic oligonucleotide"

<400> 12

agatcggaag agcacacgtc tgaactccag tcacacagtg atctcgtatg ccgtcttctg 60

cttg 64

<210> 13

<211> 64

<212> DNA

<213> Artificial Sequence

<220>

<221> source

<223> / note = "Description of artificial sequence: synthetic oligonucleotide"

<400> 13

agatcggaag agcacacgtc tgaactccag tcacgccaat atctcgtatg ccgtcttctg 60

cttg 64

<210> 14

<211> 58

<212> DNA

<213> Artificial Sequence

<220>

<221> source

<223> / note = "Description of artificial sequence: synthetic oligonucleotide"

<220>

<221> source

<223> / note = "5'-BiotinTEG modified"

^{<400> 14}

caagcagaag acggcatacg agatcgtgat gtgactggag ttcagacgtg tgctcttc 58

<210> 15

<211> 58

<212> DNA

<213> Artificial Sequence

<220>

<221> source

<223> / note = "Description of artificial sequence: synthetic oligonucleotide"

<220>

<221> source

<223> / note = "5'-BiotinTEG modified"

^{<400> 15}

caagcagaag acggcatacg agatacatcg gtgactggag ttcagacgtg tgctcttc 58

<210> 16

<211> 58

<212> DNA

<213> Artificial Sequence

<220>

<221> source

<223> / note = "Description of artificial sequence: synthetic oligonucleotide"

<220>

<221> source

<223> / note = "5'-BiotinTEG modified"

<400> 16

caagcagaag acggcatacg agatgcctaa gtgactggag ttcagacgtg tgctcttc 58

<210> 17

<211> 58

<212> DNA

<213> Artificial Sequence

<220>

<221> source

<223> / note = "Description of artificial sequence: synthetic oligonucleotide"

<220>

<221> source

<223> / note = "5'-BiotinTEG modified"

<400> 17

caagcagaag acggcatacg agattggtca gtgactggag ttcagacgtg tgctcttc 58

<210> 18

<211> 58

<212> DNA

<213> Artificial Sequence

<220>

<221> source

<223> / note = "Description of artificial sequence: synthetic oligonucleotide"

<220>

<221> source

<223> / note = "5'-BiotinTEG modified"

<400> 18

caagcagaag acggcatacg agatcactgt gtgactggag ttcagacgtg tgctcttc 58

<210> 19

<211> 58

<212> DNA

<213> Artificial Sequence

<220>

<221> source

<223> / note = "Description of artificial sequence: synthetic oligonucleotide"

<220>

<221> source

<223> / note = "5'-BiotinTEG modified"

^{<400> 19}

caagcagaag acggcatacg agatattggc gtgactggag ttcagacgtg tgctcttc 58

<210> 20

<211> 76

<212> DNA

<213> Artificial Sequence

<220>

<221> source

<223> / note = "Description of artificial sequence: synthetic primer"

<400> 20

aatgatacgg cgaccaccga gatctacact ctttccctac acgacgctct tccgatctct 60

tccgagcggt cgcaac 76 <210> 21

<211> 77

<212> DNA

<213> Artificial Sequence

<220>

<221> source

<223> / note = "Description of artificial sequence: synthetic primer"

^{<400> 21}

aatgatacgg cgaccaccga gatctacact ctttccctac acgacgctct tccgatctcc 60

tgcgctccat gaacatg 77

<210> 22

<211> 81

<212> DNA

<213> Artificial Sequence

<220>

<221> source

<223> / note = "Description of artificial sequence: synthetic primer"

<400> 22

aatgatacgg cgaccaccga gatctacact ctttccctac acgacgctct tccgatctta 60

gaaaagtgac acacacggat c 81

<210> 23

<211> 79

<212> DNA

<213> Artificial Sequence

<220>

<221> source

<223> / note = "Description of artificial sequence: synthetic primer"

<400> 23

aatgatacgg cgaccaccga gatctacact ctttccctac acgacgctct tccgatcttc 60

cagcagatgt ggatcagca 79

<210> 24

<211> 78

<212> DNA

<213> Artificial Sequence

<220>

<221> source

<223> / note = "Description of artificial sequence: synthetic primer"

<400> 24

aatgatacgg cgaccaccga gatctacact ctttccctac acgacgctct tccgatctac 60

aggaagtccc ttgccatc 78

<210> 25

<211> 81

<212> DNA

<213> Artificial Sequence

<220>

<221> source

<223> / note = "Description of artificial sequence: synthetic primer"

<400> 25

aatgatacgg cgaccaccga gatctacact ctttccctac acgacgctct tccgatcttc 60

caacatcaac atcttggtca g 81

<210> 26

<211> 80

<212> DNA

<213> Artificial Sequence

<220>

<221> source

<223> / note = "Description of artificial sequence: synthetic primer"

<400> 26

aatgatacgg cgaccaccga gatctacact ctttccctac acgacgctct tccgatctca 60

aattccatgg caccgtcaag 80

<210> 27

<211> 79

<212> DNA

<213> Artificial Sequence

<220>

<221> source

<223> / note = "Description of artificial sequence: synthetic primer"

<400> 27

aatgatacgg cgaccaccga gatctacact ctttccctac acgacgctct tccgatctgg 60

tatcgtggaa ggactcatg 79

<210> 28

<211> 25

<212> DNA

<213> Artificial Sequence

<220>

<221> source

<223> / note = "Description of artificial sequence: synthetic primer"

<400> 28

aatgatacgg cgaccaccga gatct 25

<210> 29

<211> 24

<212> DNA

<213> Artificial Sequence

<220>

<221> source

<223> / note = "Description of artificial sequence: synthetic primer"

<400> 29

caagcagaag acggcatacg agat 24

<210> 30

<211> 46

<212> DNA

<213> Artificial Sequence

^< 220 ^>

<221> source

<223> / note = "Description of artificial sequence: synthetic primer"

<220>

<221> source

<223> / note = "5'-Fos modified"

<220>

<221> modified_base

<222> (7). . (eleven)

<223> a, c, t, g, unknown or other

<220>

<221> modified_base

<222> (13). . (17)

<223> a, c, t, g, unknown or other

<220>

<221> modified_base

<222> (19). . (2. 3)

<223> a, c, t, g, unknown or other

<400> 30

cgatctnnnn nwnnnnnwnn nnnacctgtc ttgtaacctt gatacc 46

<210> 31

<211> 50

<212> DNA

<213> Artificial Sequence

<220>

<221> source

<223> / note = "Description of artificial sequence: synthetic primer"

<220>

<221> source

<223> / note = "5'-Fos modified"

<220>

<221> modified_base

<222> (7). . (eleven)

<223> a, c, t, g, unknown or other

<220>

<221> modified_base

<222> (13). . (17)

<223> a, c, t, g, unknown or other

<220>

<221> modified_base

<222> (19). . (2. 3)

<223> a, c, t, g, unknown or other

^{<400> 31}

cgatctnnnn nwnnnnnwnn nnngggtata agtctctctc gtatgtgatg 50

<210> 32

<211> 44

<212> DNA

<213> Artificial Sequence

<220>

<221> source

<223> / note = "Description of artificial sequence: synthetic primer"

<220>

<221> source

<223> / note = "5'-Fos modified"

<220>

<221> modified_base

<222> (7). . (eleven)

<223> a, c, t, g, unknown or other

<220>

<221> modified_base

<222> (13). . (17)

<223> a, c, t, g, unknown or other

<220>

<221> modified_base

<222> (19). . (2. 3)

<223> a, c, t, g, unknown or other

^{<400> 32}

cgatctnnnn nwnnnnnwnn nnntcccaaa cagcttgaat cact 44

<210> 33

<211> 43

<212> DNA

<213> Artificial Sequence

<220>

<221> source

<223> / note = "Description of artificial sequence: synthetic primer"

<220>

<221> source

<223> / note = "5'-Fos modified"

<220>

<221> modified_base

<222> (7). . (eleven)

<223> a, c, t, g, unknown or other

<220>

<221> modified_base

<222> (13). . (17)

<223> a, c, t, g, unknown or other

<220>

<221> modified_base

<222> (19). . (2. 3)

<223> a, c, t, g, unknown or other

<400> 33

cgatctnnnn nwnnnnnwnn nnntcccaaa gtgctgggat tac 43

<210> 34

<211> 45

<212> DNA

<213> Artificial Sequence

<220>

<221> source

<223> / note = "Description of artificial sequence: synthetic primer"

<220>

<221> source

<223> / note = "5'-Fos modified"

<220>

<221> modified_base

<222> (7). . (eleven)

<223> a, c, t, g, unknown or other

<220>

<221> modified_base

<222> (13). . (17)

<223> a, c, t, g, unknown or other

<220>

<221> modified_base

<222> (19). . (2. 3)

<223> a, c, t, g, unknown or other

^{<400> 34}

cgatctnnnn nwnnnnnwnn nnncatttgc cattcaaaca gaagc 45

<210> 35

<211> 43

<212> DNA

<213> Artificial Sequence

<220>

<221> source

<223> / note = "Description of artificial sequence: synthetic primer"

<220>

<221> source

<223> / note = "5'-Fos modified"

<220>

<221> modified_base

<222> (7). . (eleven)

<223> a, c, t, g, unknown or other

<220>

<221> modified_base

<222> (13). . (17)

<223> a, c, t, g, unknown or other

<220>

<221> modified_base

<222> (19). . (2. 3)

<223> a, c, t, g, unknown or other

<400> 35

cgatctnnnn nwnnnnnwnn nnnagcaggc tggtaagaaa tgg 43

<210> 36

<211> 41

<212> DNA

<213> Artificial Sequence

<220>

<221> source

<223> / note = "Description of artificial sequence: synthetic primer"

<220>

<221> source

<223> / note = "5'-Fos modified"

<220>

<221> modified_base

<222> (7). . (eleven)

<223> a, c, t, g, unknown or other

<220>

<221> modified_base

<222> (13). . (17)

<223> a, c, t, g, unknown or other

<220>

<221> modified_base

<222> (19). . (2. 3)

<223> a, c, t, g, unknown or other

<400> 36

cgatctnnnn nwnnnnnwnn nnngatcgcg ccactgtact c 41

<210> 37

<211> 44

<212> DNA

<213> Artificial Sequence

<220>

<221> source

<223> / note = "Description of artificial sequence: synthetic primer"

<220>

<221> source

<223> / note = "5'-Fos modified"

<220>

<221> modified_base

<222> (7). . (eleven)

<223> a, c, t, g, unknown or other

<220>

<221> modified_base

<222> (13). . (17)

<223> a, c, t, g, unknown or other

<220>

<221> modified_base

<222> (19). . (2. 3)

<223> a, c, t, g, unknown or other

^{<400> 37}

cgatctnnnn nwnnnnnwnn nnnggagaac acaggaatgg gatg 44

<210> 38

<211> 45

<212> DNA

<213> Artificial Sequence

<220>

<221> source

<223> / note = "Description of artificial sequence: synthetic primer"

<220>

<221> source

<223> / note = "5'-Fos modified"

<220>

<221> modified_base

<222> (7). . (eleven)

<223> a, c, t, g, unknown or other

<220>

<221> modified_base

<222> (13). . (17)

<223> a, c, t, g, unknown or other

<220>

<221> modified_base

<222> (19). . (2. 3)

<223> a, c, t, g, unknown or other

<400> 38

cgatctnnnn nwnnnnnwnn nnncagggtt tgattgtccc taatg 45

<210> 39

<211> 41

<212> DNA

<213> Artificial Sequence

<220>

<221> source

<223> / note = "Description of artificial sequence: synthetic primer"

<220>

<221> source

<223> / note = "5'-Fos modified"

<220>

<221> modified_base

<222> (7). . (eleven)

<223> a, c, t, g, unknown or other

<220>

<221> modified_base

<222> (13). . (17)

<223> a, c, t, g, unknown or other

<220>

<221> modified_base

<222> (19). . (2. 3)

<223> a, c, t, g, unknown or other

<400> 39

cgatctnnnn nwnnnnnwnn nnntgattcc tgggcaatgg g 41

<210> 40

<211> 46

<212> DNA

<213> Artificial Sequence

<220>

<221> source

<223> / note = "Description of artificial sequence: synthetic primer"

<220>

<221> source

<223> / note = "5'-Fos modified"

<220>

<221> modified_base

<222> (7). . (eleven)

<223> a, c, t, g, unknown or other

<220>

<221> modified_base

<222> (13). . (17)

<223> a, c, t, g, unknown or other

<220>

<221> modified_base

<222> (19). . (2. 3)

<223> a, c, t, g, unknown or other

<400> 40

cgatctnnnn nwnnnnnwnn nnnatactta gggacaatgc aagagt 46

<210> 41

<211> 47

<212> DNA

<213> Artificial Sequence

<220>

<221> source

<223> / note = "Description of artificial sequence: synthetic primer"

<220>

<221> source

<223> / note = "5'-Fos modified"

<220>

<221> modified_base

<222> (7). . (eleven)

<223> a, c, t, g, unknown or other

<220>

<221> modified_base

<222> (13). . (17)

<223> a, c, t, g, unknown or other

<220>

<221> modified_base

<222> (19). . (2. 3)

<223> a, c, t, g, unknown or other

<400> 41

cgatctnnnn nwnnnnnwnn nnnttatact tagggacaat gcaagag 47

<210> 42

<211> 47

<212> DNA

<213> Artificial Sequence

<220>

<221> source

<223> / note = "Description of artificial sequence: synthetic primer"

<220>

<221> source

<223> / note = "5'-Fos modified"

<220>

<221> modified_base

<222> (7). . (eleven)

<223> a, c, t, g, unknown or other

<220>

<221> modified_base

<222> (13). . (17)

<223> a, c, t, g, unknown or other

<220>

<221> modified base

<222> (19). . (2. 3)

<223> a, c, t, g, unknown or other

<400> 42

cgatctnnnn nwnnnnnwnn nnnttgctcc tctctatttc catatcc 47

<210> 43

<211> 43

<212> DNA

<213> Artificial Sequence

<220>

<221> source

<223> / note = "Description of artificial sequence: synthetic primer"

<220>

<221> source

<223> / note = "5'-Fos modified"

<220>

<221> modified_base

<222> (7). . (eleven)

<223> a, c, t, g, unknown or other

<220>

<221> modified_base

<222> (13). . (17)

<223> a, c, t, g, unknown or other

<220>

<221> modified_base

<222> (19). . (2. 3)

<223> a, c, t, g, unknown or other

^{<400> 43}

cgatctnnnn nwnnnnnwnn nnnaccttaa atgaagccac age 43

<210> 44

<211> 43

<212> DNA

<213> Artificial Sequence

<220>

<221> source

<223> / note = "Description of artificial sequence: synthetic primer"

<220>

<221> source

<223> / note = "5'-Fos modified"

<220>

<221> modified_base

<222> (7). . (eleven)

<223> a, c, t, g, unknown or other

<220>

<221> modified_base

<222> (13). . (17)

<223> a, c, t, g, unknown or other

<220>

<221> modified_base

<222> (19). . (2. 3)

<223> a, c, t, g, unknown or other

<400> 44

cgatctnnnn nwnnnnnwnn nnntccttgg cttgagagaa acc 43

<210> 45

<211> 44

<212> DNA

<213> Artificial Sequence

<220>

<221> source

<223> / note = "Description of artificial sequence: synthetic primer"

<220>

<221> source

<223> / note = "5'-Fos modified"

<220>

<221> modified_base

<222> (7). . (eleven)

<223> a, c, t, g, unknown or other

<220>

<221> modified_base

<222> (13). . (17)

<223> a, c, t, g, unknown or other

<220>

<221> modified_base

<222> (19). . (2. 3)

<223> a, c, t, g, unknown or other

^{<400> 45}

cgatctnnnn nwnnnnnwnn nnntgttccc actgtgctat taag 44

<210> 46

<211> 40

<212> DNA

<213> Artificial Sequence

<220>

<221> source

<223> / note = "Description of artificial sequence: synthetic primer"

<220>

<221> source

<223> / note = "5'-Fos modified"

<220>

<221> modified_base

<222> (7). . (eleven)

<223> a, c, t, g, unknown or other

<220>

<221> modified_base

<222> (13). . (17)

<223> a, c, t, g, unknown or other

<220>

<221> modified_base

<222> (19). . (2. 3)

<223> a, c, t, g, unknown or other

^{<400> 46}

cgatctnnnn nwnnnnnwnn nnncctgcac ctgctcagac 40 <210> 47

<211> 42

<212> DNA

<213> Artificial Sequence

<220>

<221> source

<223> / note = "Description of artificial sequence: synthetic primer"

<220>

<221> source

<223> / note = "5'-Fos modified"

<220>

<221> modified_base

<222> (7). . (eleven)

<223> a, c, t, g, unknown or other

<220>

<221> modified_base

<222> (13). . (17)

<223> a, c, t, g, unknown or other

<220>

<221> modified_base

<222> (19). . (2. 3)

<223> a, c, t, g, unknown or other

^{<400> 47}

cgatctnnnn nwnnnnnwnn nnntgccatg ggacatcaac ac 42

<210> 48

<211> 42

<212> DNA

<213> Artificial Sequence

<220>

<221> source

<223> / note = "Description of artificial sequence: synthetic primer"

<220>

<221> source

<223> / note = "5'-Fos modified"

<220>

<221> modified_base

<222> (7). . (eleven)

<223> a, c, t, g, unknown or other

<220>

<221> modified_base

<222> (13). . (17)

<223> a, c, t, g, unknown or other

<220>

<221> modified_base

<222> (19). . (2. 3)

<223> a, c, t, g, unknown or other

<400> 48

cgatctnnnn nwnnnnnwnn nnnaccaccc accttgaaga ag 42

<210> 49

<211> 41

<212> DNA

<213> Artificial Sequence

<220>

<221> source

<223> / note = "Description of artificial sequence: synthetic primer"

<220>

<221> source

<223> / note = "5'-Fos modified"

<220>

<221> modified_base

<222> (7). . (eleven)

<223> a, c, t, g, unknown or other

<220>

<221> modified_base

<222> (13). . (17)

<223> a, c, t, g, unknown or other

<220>

<221> modified_base

<222> (19). . (2. 3)

<223> a, c, t, g, unknown or other

<400> 49

cgatctnnnn nwnnnnnwnn nnngcttctg caggtcatcg g 41

<210> 50

<211> 44

<212> DNA

<213> Artificial Sequence

<220>

<221> source

<223> / note = "Description of artificial sequence: synthetic primer"

<220>

<221> source

<223> / note = "5'-Fos modified"

<220>

<221> modified_base

<222> (7). . (eleven)

<223> a, c, t, g, unknown or other

<220>

<221> modified_base

<222> (13). . (17)

<223> a, c, t, g, unknown or other

<220>

<221> modified_base

<222> (19). . (2. 3)

<223> a, c, t, g, unknown or other

<400> 50

cgatctnnnn nwnnnnnwnn nnngggatat gccacttcca tgag 44

<210> 51

<211> 44

<212> DNA

<213> Artificial Sequence

<220>

<221> source

<223> / note = "Description of artificial sequence: synthetic primer"

<220>

<221> source

<223> / note = "5'-Fos modified"

<220>

<221> modified_base

<222> (7). . (eleven)

<223> a, c, t, g, unknown or other

<220>

<221> modified_base

<222> (13). . (17)

<223> a, c, t, g, unknown or other

<220>

<221> modified_base

<222> (19). . (2. 3)

<223> a, c, t, g, unknown or other

<400> 51

cgatctnnnn nwnnnnnwnn nnncccaaag tgttgggatt acag 44

<210> 52

<211> 42

<212> DNA

<213> Artificial Sequence

<220>

<221> source

<223> / note = "Description of artificial sequence: synthetic primer"

<220>

<221> source

<223> / note = "5'-Fos modified"

<220>

<221> modified_base

<222> (7). . (eleven)

<223> a, c, t, g, unknown or other

<220>

<221> modified_base

<222> (13). . (17)

<223> a, c, t, g, unknown or other

<220>

<221> modified_base

<222> (19). . (2. 3)

<223> a, c, t, g, unknown or other

<400> 52

cgatctnnnn nwnnnnnwnn nnnggtcctg acgagtctgg tg 42

<210> 53

<211> 48

<212> DNA

<213> Artificial Sequence

<220>

<221> source

<223> / note = "Description of artificial sequence: synthetic primer"

<220>

<221> source

<223> / n o ta = "5 '-F o s mod ified"

<220>

<221> modified_base

<222> (7). . (eleven)

<223> a, c, t, g, unknown or other

<220>

<221> modified_base

<222> (13). . (17)

<223> a, c, t, g, unknown or other

<220>

<221> modified_base

<222> (19). . (2. 3)

<223> a, c, t, g, unknown or other

<400> 53

cgatctnnnn nwnnnnnwnn nnntagtttc ttacctcttc tagttggc 48

<210> 54

<211> 46

<212> DNA

<213> Artificial Sequence

<220>

<221> source

<223> / note = "Description of artificial sequence: synthetic primer"

<220>

<221> source

<223> / note = "5'-Fos modified"

<220>

<221> modified_base

<222> (7). . (eleven)

<223> a, c, t, g, unknown or other

<220>

<221> modified_base

<222> (13). . (17)

<223> a, c, t, g, unknown or other

<220>

<221> modified_base

<222> (19). . (2. 3)

<223> a, c, t, g, unknown or other

^{<400> 54}

cgatctnnnn nwnnnnnwnn nnnagaaatt tgcttagatg cctacc 46

<210> 55

<211> 48

<212> DNA

<213> Artificial Sequence

<220>

<221> source

<223> / note = "Description of artificial sequence: synthetic primer"

<220>

<221> source

<223> / note = "5'-Fos modified"

<220>

<221> modified_base

<222> (7). . (eleven)

<223> a, c, t, g, unknown or other

<220>

<221> modified_base

<222> (13). . (17)

<223> a, c, t, g, unknown or other

<220>

<221> modified_base

<222> (19). . (2. 3)

<223> a, c, t, g, unknown or other

<400> 55

cgatctnnnn nwnnnnnwnn nnntgtaaga caccgtgtaa gatgtaag 48

<210> 56

<211> 42

<212> DNA

<213> Artificial Sequence

<220>

<221> source

<223> / note = "Description of artificial sequence: synthetic primer"

<220>

<221> source

<223> / note = "5'-Fos modified"

<220>

<221> modified_base

<222> (7). . (eleven)

<223> a, c, t, g, unknown or other

<220>

<221> modified_base

<222> (13). . (17)

<223> a, c, t, g, unknown or other

<220>

<221> modified_base

<222> (19). . (2. 3)

<223> a, c, t, g, unknown or other

^{<400> 56}

cgatctnnnn nwnnnnnwnn nnngtacagt ctccgcccag tg 42

<210> 57

<211> 45

<212> DNA

<213> Artificial Sequence

<220>

<221> source

<223> / note = "Description of artificial sequence: synthetic primer"

<220>

<221> source

<223> / note = "5'-Fos modified"

<220>

<221> modified_base

<222> (7). . (eleven)

<223> a, c, t, g, unknown or other

<220>

<221> modified_base

<222> (13). . (17)

<223> a, c, t, g, unknown or other

<220>

<221> modified_base

<222> (19). . (2. 3)

<223> a, c, t, g, unknown or other

^{<400> 57}

cgatctnnnn nwnnnnnwnn nnncatgatc acgtcgcgaa gtttg 45

<210> 58

<211> 40

<212> DNA

<213> Artificial Sequence

<220>

<221> source

<223> / note = "Description of artificial sequence: synthetic primer"

<220>

<221> source

<223> / note = "5'-Fos modified"

<220>

<221> modified_base

<222> (7). . (eleven)

<223> a, c, t, g, unknown or other

<220>

<221> modified_base

<222> (13). . (17)

<223> a, c, t, g, unknown or other

<220>

<221> modified_base

<222> (19). . (2. 3)

<223> a, c, t, g, unknown or other

^{<400> 58}

cgatctnnnn nwnnnnnwnn nnnaggccag tcctgatccc 40

<210> 59

<211> 42

<212> DNA

<213> Artificial Sequence

<220>

<221> source

<223> / note = "Description of artificial sequence: synthetic primer"

<220>

<221> source

<223> / note = "5'-Fos modified"

<220>

<221> modified_base

<222> (7). . (eleven)

<223> a, c, t, g, unknown or other

<220>

<221> modified base

<222> (13). . (17)

<223> a, c, t, g, unknown or other

<220>

<221> modified_base

<222> (19). . (2. 3)

<223> a, c, t, g, unknown or other

^{<400> 59}

cgatctnnnn nwnnnnnwnn nnnacagggc aaggatgttg ag 42

<210> 60

<211> 78

<212> DNA

<213> Artificial Sequence

<220>

<221> source

<223> / note = "Description of artificial sequence: synthetic primer"

^{<400> 60}

aatgatacgg cgaccaccga gatctacact ctttccctac acgacgctct tccgatctaa 60

cctgaagggt gtcttgtg 78

<210> 61

<211> 80

<212> DNA

<213> Artificial Sequence

<220>

<221> source

<223> / note = "Description of artificial sequence: synthetic primer"

^{<400> 61}

aatgatacgg cgaccaccga gatctacact ctttccctac acgacgctct tccgatctat 60

caacaagact gagattgagg 80

<210> 62

<211> 80

<212> DNA

<213> Artificial Sequence

<220>

<221> source

<223> / note = "Description of artificial sequence: synthetic primer"

<400> 62

aatgatacgg cgaccaccga gatctacact ctttccctac acgacgctct tccgatctct 60

gggatcatga ctacctggag 80

<210> 63

<211> 81

<212> DNA

<213> Artificial Sequence

<220>

<221> source

<223> / note = "Description of artificial sequence: synthetic primer"

<400> 63

aatgatacgg cgaccaccga gatctacact ctttccctac acgacgctct tccgatctct 60

gagcgtgatt tgataatgac c 81

<210> 64

<211> 77

<212> DNA

<213> Artificial Sequence

<220>

<221> source

<223> / note = "Description of artificial sequence: synthetic primer"

<400> 64

aatgatacgg cgaccaccga gatctacact ctttccctac acgacgctct tccgatctcc 60

cgtgtttgtg aatgagg 77

<210> 65

<211> 81

<212> DNA

<213> Artificial Sequence

<220>

<221> source

<223> / note = "Description of artificial sequence: synthetic primer"

<400> 65

aatgatacgg cgaccaccga gatctacact ctttccctac acgacgctct tccgatcttt 60

gtttcctgag aggatcaaga c 81

<210> 66

<211> 79

<212> DNA

<213> Artificial Sequence

<220>

<221> source

<223> / note = "Description of artificial sequence: synthetic primer"

<400> 66

aatgatacgg cgaccaccga gatctacact ctttccctac acgacgctct tccgatctat 60

gtcagcgcag tcagatcac 79

<210> 67

<211> 75

<212> DNA

<213> Artificial Sequence

<220>

<221> source

<223> / note = "Description of artificial sequence: synthetic primer"

<400> 67

aatgatacgg cgaccaccga gatctacact ctttccctac acgacgctct tccgatctag 60

ggtagcctgc gcttc 75

<210> 68

<211> 79

<212> DNA

<213> Artificial Sequence

<220>

<221> source

<223> / n o ta = "D e s c rip tio n of se cu e n c ia a rtific ia l: c e b a d o r s in tetico"

^{<400> 68}

aatgatacgg cgaccaccga gatctacact ctttccctac acgacgctct tccgatctac 60

tctgggtgct tctctcttc 79

<210> 69

<211> 78

<212> DNA

<213> Artificial Sequence

<220>

<221> source

<223> / note = "Description of artificial sequence: synthetic primer"

^{<400> 69}

aatgatacgg cgaccaccga gatctacact ctttccctac acgacgctct tccgatctcc 60

catccaggct aatcacac 78

<210> 70

<211> 77

<212> DNA

<213> Artificial Sequence

<220>

<221> source

<223> / note = "Description of artificial sequence: synthetic primer"

<400> 70

aatgatacgg cgaccaccga gatctacact ctttccctac acgacgctct tccgatctgg 60

gttggccaat ctactcc 77

<210> 71

<211> 84

<212> DNA

<213> Artificial Sequence

<220>

<221> source

<223> / note = "Description of artificial sequence: synthetic primer"

<400> 71

aatgatacgg cgaccaccga gatctacact ctttccctac acgacgctct tccgatctaa 60

tgacagggag cttataattt agcc 84

<210> 72

<211> 80

<212> DNA

<213> Artificial Sequence

<220>

<221> source

<223> / note = "Description of artificial sequence: synthetic primer"

<400> 72

aatgatacgg cgaccaccga gatctacact ctttccctac acgacgctct tccgatctac 60

atattcagct ggcacagtta 80

<210> 73

<211> 82

<212> DNA

<213> Artificial Sequence

<220>

<221> source

<223> / note = "Description of artificial sequence: synthetic primer"

<400> 73

aatgatacgg cgaccaccga gatctacact ctttccctac acgacgctct tccgatcttg 60

aaacacacct gaatacctac ag 82

<210> 74

<211> 77

<212> DNA

<213> Artificial Sequence

<220>

<221> source

<223> / note = "Description of artificial sequence: synthetic primer"

^{<400> 74}

aatgatacgg cgaccaccga gatctacact ctttccctac acgacgctct tccgatctac 60

agggcaggca tgttatc 77

<210> 75

<211> 78

<212> DNA

<213> Artificial Sequence

<220>

<221> source

<223> / note = "Description of artificial sequence: synthetic primer"

<400> 75

aatgatacgg cgaccaccga gatctacact ctttccctac acgacgctct tccgatctgt 60

ggtttggatc gacgtctc 78

<210> 76

<211> 77

<212> DNA

<213> Artificial Sequence

<220>

<221> source

<223> / note = "Description of artificial sequence: synthetic primer"

<400> 76

aatgatacgg cgaccaccga gatctacact ctttccctac acgacgctct tccgatctgg 60

ccttcaaaga gcacctg 77

<210> 77

<211> 76

<212> DNA

<213> Artificial Sequence

<220>

<221> source

<223> / n o ta = "D e s c rip tio n of se cu e n c ia a rtific ia l: c e b a d o r s in tetico"

<400> 77

aatgatacgg cgaccaccga gatctacact ctttccctac acgacgctct tccgatctct 60

acccagctgc tcatgc 76

<210> 78

<211> 78

<212> DNA

<213> Artificial Sequence

<220>

<221> source

<223> / note = "Description of artificial sequence: synthetic primer"

<400> 78

aatgatacgg cgaccaccga gatctacact ctttccctac acgacgctct tccgatctca 60

gggaacaaat gccaagtg 78

<210> 79

<211> 77

<212> DNA

<213> Artificial Sequence

<220>

<221> source

<223> / note = "Description of artificial sequence: synthetic primer"

^{<400> 79}

aatgatacgg cgaccaccga gatctacact ctttccctac acgacgctct tccgatctga 60

agggaaggaa ggaaggg 77

<210> 80

<211> 81

<212> DNA

<213> Artificial Sequence

<220>

<221> source

<223> / note = "Description of artificial sequence: synthetic primer"

<400> 80

aatgatacgg cgaccaccga gatctacact ctttccctac acgacgctct tccgatctga 60

ttctcttgat gatgctgatg c 81

<210> 81

<211> 79

<212> DNA

<213> Artificial Sequence

<220>

<221> source

<223> / note = "Description of artificial sequence: synthetic primer"

<400> 81

aatgatacgg cgaccaccga gatctacact ctttccctac acgacgctct tccgatcttt 60

ctcttgatga tgctgatgc 79

<210> 82

<211> 82

<212> DNA

<213> Artificial Sequence

<220>

<221> source

<223> / note = "Description of artificial sequence: synthetic primer"

<400> 82

aatgatacgg cgaccaccga gatctacact ctttccctac acgacgctct tccgatctcc 60

ttccaaatct ctaccctcta te 82

<210> 83

<211> 82

<212> DNA

<213> Artificial Sequence

<220>

<221> source

<223> / note = "Description of artificial sequence: synthetic primer"

^{<400> 83}

aatgatacgg cgaccaccga gatctacact ctttccctac acgacgctct tccgatctag 60

taaagtcaca taacctctaa cc 82

<210> 84

<211> 80

<212> DNA

<213> Artificial Sequence

<220>

<221> source

<223> / note = "Description of artificial sequence: synthetic primer"

<400> 84

aatgatacgg cgaccaccga gatctacact ctttccctac acgacgctct tccgatctag 60

agttggtaag gaggagaatg 80

<210> 85

<211> 82

<212> DNA

<213> Artificial Sequence

<220>

<221> source

<223> / note = "Description of artificial sequence: synthetic primer"

^{<400> 85}

aatgatacgg cgaccaccga gatctacact ctttccctac acgacgctct tccgatctct 60

gtggtatctg aactatcttc te 82

<210> 86

<211> 78

<212> DNA

<213> Artificial Sequence

<220>

<221> source

<223> / n o ta = "D e s c rip tio n of se cu e n c ia a rtific ia l: c e b a d o r s in tetico"

<400> 86

aatgatacgg cgaccaccga gatctacact ctttccctac acgacgctct tccgatctca 60

tttgtggagc accttctg 78

<210> 87

<211> 82

<212> DNA

<213> Artificial Sequence

<220>

<221> source

<223> / note = "Description of artificial sequence: synthetic primer"

^{<400> 87}

aatgatacgg cgaccaccga gatctacact ctttccctac acgacgctct tccgatctaa 60

ggatagtttg gaactgagag ac 82

<210> 88

<211> 77

<212> DNA

<213> Artificial Sequence

<220>

<221> source

<223> / note = "Description of artificial sequence: synthetic primer"

^{<400> 88}

aatgatacgg cgaccaccga gatctacact ctttccctac acgacgctct tccgatcttg 60

acctggccaa gaagaag 77

<210> 89

<211> 79

<212> DNA

<213> Artificial Sequence

<220>

<221> source

<223> / note = "Description of artificial sequence: synthetic primer"

<400> 89

aatgatacgg cgaccaccga gatctacact ctttccctac acgacgctct tccgatctaa 60

tcggaactgg aggaacaac 79

<210> 90

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<221> source

<223> / note = "Description of artificial sequence: synthetic primer"

<400> 90

catgccgcca cccccaccct to 21 <210> 91

<211> 41

<212> DNA

<213> Artificial Sequence

<220>

<221> source

<223> / note = "Description of artificial sequence: synthetic primer"

<220>

<221> modified_base

<222> (1). . (5)

<223> a, c, t, g, unknown or other

<220>

<221> modified_base

<222> (7). . (eleven)

<223> a, c, t, g, unknown or other

<220>

<221> modified_base

<222> (13). . (17)

<223> a, c, t, g, unknown or other

^{<400> 91}

nnnnnwnnnn nwnnnnntgg gggtggctcc aggaaaattg g 41

<210> 92

<211> 33

<212> DNA

<213> Artificial Sequence

<220>

<221> source

<223> / note = "Description of artificial sequence: synthetic primer"

<220>

<221> modified_base

<222> (20). . (twenty-one)

<223> a, c, t, g, unknown or other

<220>

<221> modified_base

<222> (23). . (27)

<223> a, c, t, g, unknown or other

<220>

<221> modified_base

<222> (29). . (33)

<223> a, c, t, g, unknown or other

<400> 92

catgccgcca cccccacccn nwnnnnnwnn nnn 33

<210> 93

<211> 73

<212> DNA

<213> Artificial Sequence

<220>

<221> source

<223> / note = "Description of artificial sequence: synthetic primer"

<400> 93

catgccgcca cccccacccg atcagtcaac cggagatcgg aagagcacac gtctgaactc 60

cagtcacccg tcc 73

<210> 94

<211> 19

<212> DNA

<213> Artificial Sequence

<220>

<221> source

<223> / note = "Description of artificial sequence: synthetic oligonucleotide"

^{<400> 94}

cccgcccgcc gcccgccgc 19

<210> 95

<211> 26

<212> DNA

<213> Artificial Sequence

<220>

<221> source

<223> / note = "Description of artificial sequence: synthetic oligonucleotide"

^{<400> 95}

cccgcccgcc gcccgccgcc cgccgc 26

<210> 96

<211> 24

<212> DNA

<213> Artificial Sequence

<220>

<221> source

<223> / note = "Description of artificial sequence: synthetic oligonucleotide"

^{<400> 96}

atgtgtgtgt gtgtgtgtgt gtgt 24

<210> 97

<211> 11

<212> DNA

<213> Artificial Sequence

<220>

<221> source

<223> / note = "Description of artificial sequence: synthetic oligonucleotide"

^{<400> 97}

gccagcacca g 11

<210> 98

<211> 211

<212> DNA

<213> Homo sapiens

^{<400> 98}

actacctttg tctctagata cccctgattc accgagccct gcagttggcc cagcgtcccg 60

tttcactcct tgccagcccc tggacatcac ccacttggct caagaccaat ggagcggtga 120

atgggaaggg gtcactcaag ggacagcccg gagacatcta ccaccagacc tgggccagat 180

actttgtgaa gtaagggatc agcaaggatg t 211 <210> 99

<211> 211

<212> DNA

<213> Homo sapiens

<400> 99

actacctttg tctctagata cccctgattc accgagccct gcagttggcc cagcgtcccg € 0 tttcactcct tgccagcccc tggacatcac ccacttggct caagaccaat ggagcggtga 120 atgggaagccagtcactcaag ggacagcccccag gagattag ggacagccgcccg 180ccgattg tggatt10 180ccgtg tggatt2 180

<211> 211

<212> DNA

<213> Homo sapiens

^{<400> 100}

actacctttg tctctagata cccctgattc accgagccct gcagttggcc cagcgtcccg 60 tttcactcct tgccagcccc tggacatcac ccactcggct caagaccaag ggagcgggga 120 atgggaaggg gccactcaag ggacagccca gagacatttg ccaccagat ggacagccca gagacatttg ccaccagat ggacagccca gagacatttg ccaccagat ggacagccca gagacatttg ccaccagat 21

Claims (7)

1. A method of generating a polynucleotide library comprising: (a) generating a first complement sequence (CS) of a target polynucleotide from a sample using a first primer, the first primer comprising a target specific sequence; (b) linking by ligation to the first CS an adapter comprising a first primer binding sequence (PBS) or a part thereof, thereby forming a modified complement sequence (MCS); (c) extending a second primer hybridized to the MCS, thereby forming a second CS, wherein the second primer comprises: (i) a specific target region, and (ii) a second PBS; Y (d) amplifying the second CS using primers that hybridize to the first PBS and the second PBS respectively, wherein the first or second primer comprises a unique identification sequence (UID). The method of any one of claims 1, wherein the first primer comprises a universal ligation sequence (ULS). 3. The method of any one of claims 1-2, wherein the second primer further comprises a universal priming sequence (UPS). The method of any one of claims 1-3, wherein the adapter further comprises a sample barcode (SBC) sequence. 5. The method of any one of claims 1-4, wherein the MCS further comprises an affinity molecule or capture sequence. 6. The method of any one of claims 1-5, wherein the UID comprises the sequence \ N \ N \ \ \ NN \ \ N \ N \ (SEQ ID NO: 1), wherein N is any nucleic acid residue. The method of any one of claims 1-5, wherein the UID comprises the sequence N N N N N W N N N N N W N N N N N (SEQ ID NO: 2), wherein N is any nucleic acid residue and W is adenine or thymine.