ES2628031T3 - Bioabsorbable acellular tissue regeneration matrices produced by incubation of acellular blood products - Google Patents

Abstract

An acellular bioabsorbable regeneration matrix obtained from blood and obtainable by a method according to any one of claims 14 to 19, the matrix comprising: a) aggregates of spherical structures that are at least 100 nm in diameter; and b) a proteinaceous nucleus having a protein content of at least 1%; in which the matrix lacks substantial metabolic activity compared to that initially present in said blood; and in which additionally the matrix has the ability to initiate tissue regeneration in a subject with tissue damage, increase tissue regeneration in a subject with tissue damage, or both.

Description

image 1

DESCRIPTION

Bioabsorbable acellular tissue regeneration matrices produced by incubation of acellular blood products

Cross reference with related requests

5 This application is pending along with, shares at least one common inventor with and claims priority for, U.S. Provisional Patent Application Number 60 / 730,614, filed on October 26, 2005, the contents of which are incorporated herein document by reference in its entirety.

Background

The present invention relates to the formulation of a bioabsorbable proteinaceous matrix obtained from animal tissue.

The invention also relates to the use of this matrix in vivo, which functions to induce and facilitate the growth and generation / regeneration of tissue.

With the exception of blood, all other body tissues are composed of cells arranged in an integrated structure that requires a support framework or extracellular matrix to maintain proper growth differentiation and function. The field of tissue engineering aims to provide procedures to achieve complex structure using polymers, either artificial or natural, with properties that allow the binding, growth and formation of cell patterns to provide replacement tissues for those lost during The injury or illness. The ideal scaffolding material would be non-immunogenic and mimics the support structure of the natural shell found in the body as narrowly as possible. One of these attributes is that the framework is biodegradable to allow the regenerated or restored tissue to reach its final level of homeostasis and function. It is known in the prior art to construct bioabsorbable frameworks that have the ability to provide a support structure for cell growth and junctions, as well as the delivery of biologically active chemicals, proteins and peptides. The most widely used are hydrogels that consist of various polymers that include polysaccharides. Biodegradable hydrogels produced from biodegradable polysaccharides, either alone or in combination with proteins of the naturally occurring extracellular matrix such as collagen, have been used as vehicles for drug delivery (Cascone, MG et al., Bioartificial polymeric materials based on polysaccharides, J Biomater. Sci. Polym. Ed. 12, 267-281, 2001; Jeong, B. et al., Drug release from biodegradable injectable thermosensitive hydrogel of PEG-PLGA-PEG triblock copolymers, J Control Release 63, 155-163, 2000; Kopecek, J., Smart and genetically engineered biomaterials and drug delivery systems, Eur. J. Pharm. Sci. 20, 1-16, 2003; Peppas, NA et al., Hydrogels in pharmaceutical 30 formulations, Eur. J. Pharm. Biopharm. 50, 27-46, 2000; Zhang, Y., and Chu, CC, In vitro release behavior of insulin from biodegradable hybrid hydrogel networks of polysaccharide and synthetic biodegradable polyester, J. Biomater. Appl. 16, 305-325, 2002) and to provide Ionar structural support for technologically designed fabrics (Arevalo-Silva, C.A. et al., Internal support of tissue-engineered cartilage, Arch. Otolaryngol. Head Neck Surg. 126, 1448-1452, 2000; Desgrandchamps, F., Biomaterials in functional reconstruction, Curr. Opin. Urol. 10, 201-206, 35 2000; Kim, T. K. et al., Experimental model for cartilage tissue engineering to regenerate the zonal organization of articular cartilage, Osteoarthritis Cartilage 11, 653-664, 2003; Kojima, K. et al., A composite tissue-engineered trachea using sheep nasal chondrocyte and epithelial cells, Faseb J. 17, 823-828, 2003; Marler, J. J. et al., Softtissue augmentation with injectable alginate and syngeneic fibroblasts, Plast. Reconstr. Surg. 105, 2049-2058, 2000; Saim, A. B. et al., Engineering autogenous cartilage in the shape of a helix using an injectable hydrogel scaffold, 40 Laryngoscope 110, 1694-1697, 2000; Thompson, C. A. et al., Percutaneous transvenous cellular cardiomyoplasty: A novel nonsurgical approach for myocardial cell transplantation, J. Am. Coll. Cardiol 41, 1964-1971, 2003; Wake, M.

C. et al., Dynamics of fibrovascular tissue ingrowth in hydrogel foams, Cell Transplant. 4, 275-279, 1995; Weng, Y. et al., Tissue-engineered composites of bone and cartilage for mandible condylar reconstruction, J. Oral Maxillofac. Surg. 59, 185-190, 2001; Zimmermann, U. et al., Hydrogel-based non-autologous cell and tissue therapy,

45 Biotechniques 29, 564-572, 574, 576, in various places, 2000). Recently, the use of a hydrogel shell has been reported as a connection structure that has the ability to provide guidance channels for the regeneration of neural tissue for the treatment of spinal cord injury ("LME") (Tsai,

E. C. et al., Synthetic hydrogel guidance channels facilita regeneration of adult rat brainstem motor axons after complete spinal cord transection, J. Neurotrauma. 21, 789-804, 2004). The production of an extracellular matrix or

50 scaffolding material from blood or other blood tissue has been described in Vacanti and Vacanti (Biological framework material, United States Patent Publication Number 20040137613, filed October 17, 2003). This material is described as substantially composed of cells, cell debris and cell debris. However, it is not reported that this material has a biological functionality that facilitates healing

or regeneration, and also needs viable cells or other structures with similar cell-like properties

55 (Vacanti, M. P. et al., Identification and initial characterization of spore-like cells in adult mammals, J. Cell Biochem. 80, 455-460, 2001). Despite these achievements, there is still a need for a non-immunogenic (or reduced immunogenicity) scaffolding material that additionally possesses binding and stimulating properties of cell growth, and sustains or stimulates the regenerative / restorative properties of the injured tissues that surround the site of the wound.

60

image2

Summary of the invention

The present invention provides regeneration matrices and processes for their production in accordance with the appended claims. In certain embodiments, a regeneration matrix is produced by processing either coagulated blood or blood collected with anticoagulant. In certain embodiments, a regeneration matrix is produced from a tissue sample from which the cells were first removed. A regeneration matrix can be obtained from a tissue of the subject itself, thus allowing an autologous application, or it can be a compatible type of tissue to allow allogeneic applications. In certain embodiments, a regeneration matrix is obtained from xenogenic tissue. Xenogenic applications are useful in research contexts, but they do not normally represent a therapeutic modality for

10 applications in humans or veterinarians. In certain embodiments, a regeneration matrix is produced from blood, for example, from the subject's own blood.

A regeneration matrix produced in accordance with certain methods of the present invention has therapeutic properties in the sense that it has the ability to initiate, increase, sustain and / or direct the regeneration of tissues at a site of damage, loss and / or degeneration of tissue, so that the surrounding tissue

15 regenerate normal functional tissue. The regeneration matrix can be administered to a subject, in which the regeneration matrix initiates and / or increases tissue regeneration. In certain embodiments, the damaged tissue to be regenerated according to the methods of the present invention includes, but is not limited to, nervous tissue, muscle tissue, liver tissue, cardiac tissue, lung tissue and / or skin tissue. For example, in certain embodiments, the invention provides methods for using the natural regenerative components of the

20 blood and / or blood clots, and design them technologically as a regeneration matrix that can be delivered to the site of a wound at an appropriate time to maximize the regeneration response while minimizing the production of non-functional scar formation.

In certain embodiments, a regeneration matrix has neuroregeneration properties that are useful.

25 to treat conditions that result in damage, loss and / or degeneration of nerve tissue. In certain embodiments, the nerve tissue to regenerate comprises nerve tissue from the central nervous system ("CNS"). In certain embodiments, CNS tissue is lost as a result of a disease and / or injury, such as, for example, spinal cord injury, spinal cord cancer, amyotrophic lateral sclerosis, Parkinson's disease, Alzheimer's disease, stroke and / or multiple sclerosis. The activity of

Regeneration of a regeneration matrix can be enhanced or supplemented by the addition of one or more therapeutic agents that include, but are not limited to, proteins, peptides, drugs, cytokines, extracellular matrix molecules and / or growth factors. In certain embodiments, one or more therapeutic effects of a therapeutic agent is increased when administered in a regeneration matrix.

The present invention provides a regeneration matrix comprising a bioabsorbable structure that

35 has tissue regenerative properties. Such a regeneration matrix may contain one or more of: transferrin, serum albumin, serum albumin precursor, complement component 3, hemoglobin of A-D chains, IgM, IgG1, inhibitor of medulasin 2, carbonic anhydrase and / or CA1 protein.

In certain embodiments, a regeneration matrix of the present invention is complemented with one or more therapeutic agents that include, but are not limited to, proteins, peptides, drugs, cytokines, molecules of the

40 extracellular matrix and growth factors. In certain embodiments, one or more therapeutic effects of a therapeutic agent are increased when administered in a regeneration matrix. In certain embodiments, a regeneration matrix can be seeded or mixed with cells including, but not limited to, stem cells, progenitor cells, nerve cells and / or glial cells.

The present invention provides a bioabsorbable tissue regeneration matrix to induce regeneration.

45 of functional tissue at the site of application in a subject. In certain embodiments, a regeneration matrix stimulates tissue self-regeneration at the site of application. In certain embodiments, a regeneration matrix increases the biological activity of the surrounding tissue. In certain embodiments, a regeneration matrix is in solid or semi-solid form. For example, a regeneration matrix may be in the form of a matrix

50 three-dimensional. In certain embodiments, a regeneration matrix is in the form of a suspension.

Brief description of the drawings

The foregoing features of the invention will be more readily understood in reference to the following detailed description, taken with reference to the accompanying drawings. In the drawings, "RMx" stands for a regeneration matrix.

55 Figures 1A, 1B and 1C show macrophage transdifferentiation in endothelial-type cells positive for von Willebrand factor. 2A: macrophages (light staining) and cells (+) for von Willebrand factor (dark staining) at the site of spinal cord injury and implant regeneration matrix at 2 weeks after implantation in a pig . Double staining is shown as black. Shown with a

image3

200x magnification 2B: black staining = macrophages (clear staining) expressing the von Willebrand factor, shown with an increase of 400x. 2C: macrophages expressing von Willebrand factor are forming a blood vessel, shown with a 400x magnification. Figures 2A, 2B, 2C and 2D show the effect of regeneration matrix treatment on tissue of

5 rat spinal cord. A sample of healthy rat spinal cord in the absence of a regeneration matrix with the indicated healthy blood vessels. B shows damaged rat spinal cord, where little CNS tissue is evident and healthy blood vessels are not present. C shows the view of the damaged rat's spinal cord treated with a regeneration matrix, where the regenerated healthy CNS tissue and cross sections of the blood vessels are evident. D is another view of damaged C spinal cord tissue, which shows regenerated CNS tissue and a longitudinal section of healthy blood vessels. Figure 3 is a photograph of a regeneration matrix produced using uncoagulated blood and the final filtration by 1.2 μm, contained with the Opticell® production cassette. Figure 4 shows a paraffin section of a 3-week regeneration matrix made from whole human blood. The regeneration matrix shows no evidence of intact cells or nuclei. The

15 staining with hematoxylin was completely negative in all the analyzed sections, but the material was stained more strongly with eosin. When using high aperture lenses (high resolution) a granulated structure can be clearly resolved. In addition to the granulated structure that most MRIs comprise, it is possible to observe small regions of flat sheets that appear to be composed of a more compact structure. Figures 5A, 5B, 5C and 5D show scanning electron micrographs of a regeneration matrix produced using coagulated blood and a final filtration by 5 μm. A -200x, B -1000x, C -7500x, D -7500x. Figures 6A, 6B, 6C and 6D show scanning electron micrographs of a regeneration matrix produced using coagulated blood and final filtration for 1.2 μm (21 days). A -200x, B -1000x, C -7500x, D 7500x.

25 Figures 67A, 7B, 7C and 7D show scanning electron micrographs of a regeneration matrix produced using uncoagulated blood (using EDTA) and a final filtration for 1.2 μm (21 days). A -200x, B -1500x, C -5000x, D -10000x. Figure 8 shows an optical micrograph of a regeneration matrix produced using uncoagulated blood and a final filtration by 1.2 μm (100x magnification). Figure 9 shows a transmission electron microscopy (MET) of a 21-day regeneration matrix prepared from a tissue sample passed through a 5 μm filter. It is evident in this MET that the rounded spheres observed in scanning electron micrographs (Figs. 5-7) are part of a much larger and relatively homogeneous structure or aggregate of these spheres. There is no evidence of nuclei.

35 Figure 10 shows a transmission electron microscopy of an 8 week regeneration matrix made from whole human blood. The regeneration matrix was stained homogeneously and the outer surface of each of the aggregates had fewer protruding small spheres than a 3 week regeneration matrix (see Figure 9), and had a somewhat honeycomb shape (the procedure more efficient arrangement for particles). Many new aggregates of the regeneration matrix were formed along long chains of regeneration matrix material. Figure 11 shows the transmission electron microscopy of an 8 week regeneration matrix made from whole human blood. The regeneration matrix was stained homogeneously and the external surface of each of the aggregates had fewer outstanding small spheres than a 3 week regeneration matrix (see Figure 9), and had a somewhat honeycomb shape (the procedure from

45 more efficient arrangement for particles). Figures 12A and 12B show the analysis by SDS-PAGE of a regeneration matrix from 5 different batches. Total proteins in the regeneration matrix on days 15 (A) and 21 (B) were stained with Coomassie blue. The main protein species are numbered 1-6 and are presented in the respective densitometry graphs. Molecular weight patterns (KDa) are indicated on the left side of the gels. Figure 13 shows the total RNA content (μg) in the regeneration matrix and the 21-day culture supernatant (filtered by 5 μm) that were formed in the presence of α-amanitin (RNA polymerase II inhibitor), afidicoline (DNA polymerase inhibitor) or cyclohexamide (protein synthesis inhibitor) versus control. Figure 14 shows the total protein content in the regeneration matrix and the culture supernatant of

55 21 days (filtered by 5 μm) formed in the presence of α-amanitin (RNA polymerase II inhibitor), afidicoline (DNA polymerase inhibitor) or cyclohexamide (protein synthesis inhibitor) versus control. Figure 15 shows the total protein content in the regeneration matrix and the 21-day culture supernatant (filtered by 1 μm) formed in the presence of α-amanitin (RNA polymerase II inhibitor) versus control. Figure 16 shows the total lipid content in the regeneration matrix and the 21-day culture supernatant (filtered by 1 μm) formed in the presence of α-amanitin (RNA polymerase II inhibitor) versus control. Figure 17 shows a comparison of a PAGE for the matrix and coomasie-stained protein band media from matrices filtered by 1 μm to filtered by 5 μm.

65 Figure 18 shows the effect of the regeneration matrices (and their associated supernatant, separately) produced in the process media with different supplements, on the positive regulation

image4

of neuronal genes. A: NT-3, B: NCAM-1, C: GAP-43. Figure 19 shows the positive regulation at times of genes caused by the regeneration matrix and the heat-inactivated regeneration matrix on SH-SY5Y cells. SH-SY5Y cells were incubated with regeneration matrix for 3 h and then the gene expression of GAPDH, NT-3, NT-6, NCAM-1, was analyzed.

5 FGF-9, GDNF, Netrina-1 and GAP-43 using RT-PCR. A regeneration matrix washed in PBS 3 times had an activity similar to the unwashed regeneration matrix. A regeneration matrix that had been incubated at 60 ° C for 30 min had no positive gene regulation activity. Figure 20 shows the extent of neurites from Neuroscreen® cells treated with a regeneration matrix. The left panel shows a representative field of Neuroscreen® cells that grow in basal medium. The right panel shows a representative field of cells treated with a regeneration matrix. The cell nuclei are stained blue and the tubulin is stained green. Figure 21 shows a comparison of Neuroscreen® cell neurite extensions cultured in the presence or absence of the regeneration matrix. The results are expressed as the percentage of the neurite extension index of the NGF treated cells. The results are the average of 4 experiments

15 independents made in quadruplicate. Error bars show the standard deviation of the mean. The values of the treated and untreated cells with regeneration matrices are different, with P values for the difference below 0.01 (t test). Figure 22 shows a comparison of Neuroscreen® cell neurite extensions cultured in the presence of a regeneration matrix produced with and without complementation with EGF and bFGF growth factor. The results are expressed as the percentage of the neurite extension index of NGF treated cells. The results are the average of at least six samples in duplicate. Error bars indicate the standard deviation of the mean. All values are different from each other, with a P value below 0.01 (t test). Figure 23 shows the dose response curves for NGF of different concentrations of NGF over the

25 Neuroscreen® cell neurite extension. Figure 24 shows the increase in times (fraction) over the positive control of NGF (fig. 23; NGF 100 ng / ml) in the mean of the total length of the neurite extension when regeneration matrices produced in the middle of TR-10 procedure. The regeneration matrices were produced from either whole blood or the plasma-platelet-leukocyte fraction. Figure 25 shows embryonic spinal cord cells from primary control rat, labeled for neuronal tubulin (Tuj 1) and glia (GFAP) six days after the start of individual suspension cell culture (two exposures to show all components dyed) On average, 4.2% of the cells were positive for Tuj-1 and 0.4% of the cells were positive for GFAP. 100x magnification Figure 26 shows the effect of the regeneration matrix on primary spinal cord cells

35 rat embryonic, labeled for neuronal tubulin (Tuj1) and glia (GFAP), six days after the start of individual suspension cell culture (two exposures to show all stained components). On average, 55% of the cells were positive for Tuj-1 and 92% of the cells were positive for GFAP. Double positive cells (positive for Tuj-1 and GFAP) are indicative of three-phase neuroprogenitor cells. 100x magnification Figures 27A, 27B, 27C and 27D show immunocytochemical staining for β-tubulin (A) and F-actin (B) of human fibroblasts cultured for 5 days on a regeneration matrix (C and D) against the control (A and B). The medium used in the control cultures was the process medium used to produce the regeneration matrix. Human fibroblasts cultured in contact with the regeneration matrix were significantly less confluent (and appeared to be experiencing apoptosis) compared to those

45 control cultures. Figure 28 shows the effect of the regeneration matrix on the fibroblast junction, the nuclear fibroblast area and the% of BrdU positive fibroblasts in 2-day cultures versus control. Figure 29 shows that the implantation of the regeneration matrix in a complete medullary section (5 mm) model of LME rat induces the restoration of motor function. The results of the restoration of the locomotive function, as measured by the BBB score, were recorded every 2 weeks after the injury and the implantation of the regeneration matrix. The BBB score for individual animals (regeneration matrix -M and controls -C). Figure 30 shows the decreased incidence of cyst formation in a spinal cord model of rat spinal cord injury for rats that received a regeneration matrix implant. Animals

55 implanted with regeneration matrix (n = 19) had an incidence rate of 15.8% of cyst formation at and around the site of the LME, while control animals (n = 5) had an incidence rate 60% of cyst formation around the site of the LME. Figure 31 shows that implanting the regeneration matrix in a hemisection model (5 mm) of rat LME induces the restoration of motor function. Results of locomotor function restoration, as measured by BBB scores, were recorded every 2 weeks after injury and implantation of the regeneration matrix. BBB score for individual animals that received a regeneration matrix implant. Non-implanted controls did not survive the first evaluation point. Figure 32A: functional restoration after implantation of the spinal cord regeneration matrix of

65 rats that had a full 5 mm section. Figure 32B: Functional restoration after implantation of a regeneration matrix in the spinal cord of rats, 2 weeks after the contusion injury (50 mm). The empty control rats did not undergo a second surgery at 2 weeks after the contusion. Figure 32C: combination model (complete section and contusion) indicating the efficacy of a regeneration matrix in the treatment of spinal cord injury. Control animals include controls

image5

5 voids and biologically inactivated regeneration matrix controls from both lesion models. For each of Figures 32A, 32B and 32C, the top line represents data from animals implanted with regeneration matrix, while the bottom line represents data from control animals. Figure 33 shows that the regeneration matrix implant induces the restoration of motor function in pig spinal cord injuries caused by impact and / or surgical hemisection (including the extraction of 5 mm of spinal cord). Pigs 00-6-5 and 113-1 received severe impact injuries resulting in tearing and loss of spinal cord tissue. Pig 80-1 received penetration injury through a 14 gauge needle. Pigs 55-1, 53-2, 54-5 and 54-2, as well as all control pigs, received surgical hemisection of the right side ( 5 mm long on the right side of the cord

15 spinal removed). The results of the restoration of motor function as measured were measured by the modified numerical ASIA scores recorded every week after the injury and the regeneration matrix implant. Figure 34 shows a comparison of average weights and average weight gains over 7 weeks in pigs implanted with the regeneration matrix or with homogenized blood clots. Figure 35 shows a comparison of the restorations of motor capacities on the left side for 7 weeks in pigs implanted with regeneration matrix or human blood clots after spinal cord injuries by hemisection (5 mm long on the right side of the spinal cord removed) from the right side. Figure 36 shows a comparison of locomotor restoration in pigs treated with a matrix of

25 human regeneration or blood clot at 7 weeks after SCI. The injured left side (served as an internal control) was the same in both groups, while the injured right side was significantly restored more (p = 0.03) with the regeneration matrix than with the blood clot. Figure 37 shows newly formed (brown) neurons at the site of spinal cord injury (and spinal cord removal) in a pig one month after the regeneration matrix implant. Light color = cell nuclei. Dark color = positive cells for Tuj-1. Black color = double staining. The increase is 200x. Figure 38 shows the microscopic evaluation of a longitudinal section from a rat spinal cord regeneration study. 38A: The primitive cells associated with the regeneration matrix are filling the spinal cord defect. Taken at a 10x increase. 38B: primitive cells at the site

35 new neural tissue formation 10 days after implanting the regeneration matrix in a 10 mm spinal cord defect. Taken at an increase of 40x.

Detailed description of certain embodiments

Definitions

"Acellular sample": the term "acellular sample" as used herein refers to a biological sample generated by removing cells from an isolated tissue sample. In certain embodiments an acellular sample is used to generate a regeneration matrix of acellular bioabsorbable tissue. An acellular sample is generated from blood. In certain embodiments, an acellular sample is generated by passing a tissue sample through a filter with a filtration diameter small enough to exclude cells from passing through such a filter. In

In certain embodiments, an acellular sample is generated by subjecting a tissue sample to centrifugation and using the supernatant. One skilled in the art will know other methods useful for removing cells from a tissue sample. It is understood that in the generation of an acellular sample from a tissue sample, some or all of the cells can be lysed. In certain embodiments, an acellular sample comprises one or more components from such lysed cells. An acellular sample has no substantial metabolic activity (see definition of "substantial metabolic activity", cited below).

"Bioabsorbable", "bio-absorbable": the terms "bioabsorbable" and "bio-absorbable" as used herein refer to the characteristic of existing for a limited time in the context of a biological environment. In certain embodiments, a regeneration matrix of the present invention and / or produced in accordance with one or more methods of the present invention is bioabsorbable. "Bioabsorbable" in the context of a bioabsorbable regeneration matrix 55 means that the regeneration matrix would not be recognizable as existing in its initial form if observed at a time after having been placed in the context of a biological environment. In certain embodiments, a bioabsorbable regeneration matrix may exist for days, weeks or months when placed in the context of a biological environment. For example, a bioabsorbable regeneration matrix may exist for 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 , 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150 , 160, 170, 180 days, or more, when placed in the context of a biological environment. A bioabsorbable regeneration matrix can be bioabsorbable by any of a variety of mechanisms. In certain embodiments, a bioabsorbable regeneration matrix can be bioabsorbable through the action of cellular activity. For example, an array of

5

10

fifteen

twenty

25

30

35

40

Four. Five

fifty

55

60

Bioabsorbable regeneration is bioabsorbable through the action of macrophages that break down the bioabsorbable regeneration matrix. In certain embodiments, a bioabsorbable regeneration matrix is bioabsorbable after having decomposed through mechanical, chemical, metabolic and / or enzymatic degradation. Those skilled in the art will understand that the precise mechanism of bioabsorbidity is not critical as long as the body can absorb and / or excrete the decomposition products of the regeneration matrix.

"Incubating": the term "incubating" as used herein, in the context of the production of a regeneration matrix, refers to the procedure of allowing the regeneration matrix to be formed over a period of time. . In certain embodiments, a regeneration matrix is produced by incubating an acellular sample in an incubation chamber (see definition of "incubation chamber", cited below). In certain embodiments, an acellular sample is suspended and / or solubilized in a process medium during incubation. In certain embodiments, a regeneration matrix is produced by incubating an acellular sample at any of a variety of temperatures, provided that the acellular sample remains in a liquid state. For example, such incubation can be performed at a temperature of -2, -1, 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 , 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42 degrees Celsius, or higher, as long as the acellular sample remains in a liquid state at these temperatures. In certain embodiments, the temperature may be increased and / or decreased during the incubation period, so that incubation occurs during a temperature range. In certain embodiments a regeneration matrix is produced by incubating an acellular sample at any of a variety of atmospheric pressures. For example, an acellular sample can be incubated at Normal Atmosphere (“ATM”), or any pressure above or below the ATM. In certain embodiments, the atmospheric pressure is changed during the incubation of an acellular sample. For example, atmospheric pressure can be raised and / or reduced during incubation. In certain embodiments, a regeneration matrix is produced by incubating an acellular sample at any of a variety of ambient oxygen concentrations. In certain embodiments the concentration of ambient oxygen is lower than the concentration of conventional atmospheric oxygen. For example, the concentration of ambient oxygen during incubation may be approximately 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 2, 1% or less. In certain embodiments the concentration of ambient oxygen during incubation is almost or exactly 0%. In certain embodiments, a regeneration matrix is produced by incubating an acellular sample at any of a variety of environmental humidities. In certain embodiments, the ambient humidity is kept low during incubation so that the evaporation of liquid in the acellular sample is increased. In certain embodiments, new liquid containing solutes is added continuously or periodically (which includes, but is not limited to, for example, a "process medium" or "physiological solution", see the definitions cited below) to an acellular sample that is Has experienced evaporation. In such embodiments, it will be understood that the osmolarity of the acellular sample increases over time as a result of evaporation and addition of new solute-containing liquid. In certain embodiments, a regeneration matrix is produced by incubating an acellular sample in any of a variety of effective gravitational field forces. In certain embodiments, a regeneration matrix is produced by incubating an acellular sample at an effective gravitational field strength approximately equal to that of the earth's gravity (for example, at sea level and / or at one or more specific heights above sea level ). In certain embodiments, a regeneration matrix is produced by incubating an acellular sample at an effective gravitational field strength greater than the gravity of the land at sea level. For example, an effective gravitational field force greater than that of the earth's gravity can be generated by incubation below sea level or in a centrifuge, provided that such a procedure does not produce any agitation. In certain embodiments a regeneration matrix is produced by incubating an acellular sample at an effective gravitational field strength lower than that of the gravity of the land at sea level. For example, an effective gravitational field force lower than that of the earth's gravity can be generated by incubation at high altitudes or in space.

"Incubation chamber": the term "incubation chamber" as used herein refers to any of a variety of containers that can be used to incubate (see definition of "incubate", cited above) an acellular sample during the formation of a regeneration matrix. In certain embodiments, an incubation chamber comprises a conventional laboratory vessel, such as a flask, culture plate, beaker, etc. A person skilled in the art will know other conventional, suitable and useful laboratory vessels. In certain embodiments, an incubation chamber comprises a sealed or semi-sealed container. In certain embodiments, an incubation chamber is a sealed container.

or semi-sealed that is permeable or semipermeable to one or more substances. For example, in certain embodiments, an incubation chamber comprises a container that is permeable to air and / or gaseous molecules. In certain embodiments, an incubation chamber comprises an Opticell® cassette (BioCrystal Ltd., Westerville, OH). In certain embodiments, a sealed or semi-sealed incubation chamber is designed so that the material can be added and / or removed from the container after the incubation procedure has begun. For example, an incubation chamber that is permeable or semipermeable to air and / or gaseous molecules can be designed so that liquid and / or solid material can be added and / or removed from the chamber one or more times during and / or after incubation . In certain embodiments, a sealed or semi-sealed incubation chamber is designed so that material can be added and / or removed through the use of a needle or other instrument that has the ability to penetrate the incubation chamber. In certain embodiments, it is desirable that the sealed or semi-sealed incubation chamber be penetrated with a needle or other instrument that is

5

10

fifteen

twenty

25

30

35

40

Four. Five

fifty

55

60

"Reseals" itself (and / or has the ability to be resealed), so that the incubation chamber retains its sealed or semi-sealed state.

"Matrix": the term "matrix", as used herein, refers to any physical structure that includes, but is not limited to, a solid or semi-solid structure and / or a suspension. In certain embodiments, the present invention provides matrices having regenerative characteristics (see definition of "regenerative" cited below). Such a regenerative matrix is referred to herein as a "regeneration matrix."

"Process medium": the term "process medium" as used herein refers to a liquid solution that can be added to a tissue sample, an acellular sample or both during the process of generating a regeneration matrix . In certain embodiments a process means comprises a physiological solution (see definition of "physiological solution", cited below). In certain embodiments, a process medium comprises a minimal saline solution. For example, a procedural means may be PBS. One skilled in the art will know other minimum salt solutions that can be used in accordance with the present invention. In addition, one skilled in the art will know compositions and methods useful for modifying minimal salt solutions to achieve one or more convenient properties of the solution that include, but without limitation, the pH, the osmolarity, the buffering capacity, the concentrations of one or more particular ions and / or any of a variety of other properties of the solution. In certain embodiments, a method means includes one or more therapeutic agents (see definition of "therapeutic agent", cited below). In certain embodiments, a process medium is added to a tissue sample before, during and / or after isolation. In certain embodiments, a process medium is added to the acellular sample before, during and / or after cell removal. In certain embodiments, a process medium is added to a cell sample during the incubation procedure. In certain embodiments, a process medium is added at multiple times during the incubation procedure. In certain embodiments, one or more components of a process medium added during the production process of the regeneration matrix become part of the regeneration matrix produced.

"Physiological solution": the term "physiological solution" as used herein refers to a solution that is similar or identical to one or more physiological conditions or that may change the physiological state of a given physiological environment. The term "physiological solution" as used herein also refers to a solution that has the ability to support the growth of cells (including, but not limited to, mammalian, vertebrate and / or other cells). In certain embodiments, a physiological solution comprises a defined medium, in which the concentration of each of the components of the medium is known and / or controlled. Defined media usually contain all the nutrients necessary to support cell growth, including, but not limited to, salts, amino acids, vitamins, lipids, trace elements and energy sources such as carbohydrates. Non-limiting examples of defined media include DMEM, Eagle Basal Medium (BME), Medium 199; Nutritious Blend F-12 (Ham); Nutritive Blend F-10 (Ham); Minimum Essential Medium (MEM), Williams E Medium and RPMI 1640. One skilled in the art will know other defined means that can be used in accordance with the present invention. In certain embodiments, a physiological solution comprises a mixture of one or more defined means. In certain embodiments, a physiological solution is a complex medium, in which at least one of the components of the medium is not known or controlled. Although physiological solutions are useful in the production of a regeneration matrix according to the methods of the present invention, as will be clear from the entirety of the present detailed description, an acellular sample that is incubated to produce a regeneration matrix It does not contain cells (see definition of "acellular sample" cited above). As such, although such a process means may have the ability to support cell growth, it is understood that cell growth is not a necessary component of the regeneration matrix production. However, in certain embodiments, cells can be added to the incubation chamber at a specific time or moments during the regeneration matrix formation procedure. In these cases it is understood that physiological solution by itself, or in combination with the regeneration matrix solution, can support the viability of the cells added to the incubation chamber.

"Regeneration", "regenerate", "regenerative": these terms, as used herein, refer to any procedure or quality that initiates, increases, modulates, stimulates, sustains and / or directs growth, new growth , repair, functionality, structuring, connectivity, strengthening, vitality and / or the natural healing process of weak, damaged, lost and / or degenerated tissue. These terms may also refer to any procedure or quality that initiates, increases, modulates, stimulates, sustains and / or directs the growth, strengthening, functionality, vitality, robustness, potency and / or health of weak, fatigued and / or normal tissue. In certain embodiments, the present invention provides compositions and methods useful in the regeneration of damaged, lost and / or degenerated tissue. For example, the methods and compositions of the present invention can be used to initiate, augment, sustain, stimulate and / or direct the regeneration of damaged, lost and / or degenerated tissue. In certain embodiments, the present invention provides a regeneration matrix (see definition of "matrix", cited above) that has one or more regenerative properties or activities. In certain embodiments, regeneration comprises initiating, increasing, modulating, stimulating, sustaining and / or directing one or more of the following processes: natural healing, tissue growth, tissue functionality, structuring, connectivity, angiogenesis, proliferation and / or cell activation progenitors, cell growth and / or proliferation, specialization and / or cell elongation, dedifferentiation and / or differentiation of cells, positive regulation of cellular genes related to regeneration and / or inhibition of scar formation. However, regeneration is not limited to these processes, qualities or activities, and an expert in the

image6

5 subject will know other processes, qualities or activities that are considered in the field "regeneration", "regenerate" or "regenerative".

"Substantial metabolic activity": the term "substantial metabolic activity" as used herein refers to the metabolic activity normally presented by intact cells in vitro or in vivo. The acellular samples and / or regeneration matrices of the present invention lack cells and, therefore, do not

10 have substantial metabolic activity. Those skilled in the art know a variety of techniques by which metabolic activity can be detected and / or measured. For example, intact cells produce significant amounts of ATP by aerobic and / or anaerobic decomposition of macromolecules (for example, sugars, amino acids, lipids, etc.). Therefore, the production of significant levels of ATP is usually indicative of the presence of intact cells in a sample. A subject matter expert will understand

15 that a phenomenon indicative of the presence of intact cells can be detected in an acellular sample. However, normally such an indicative cell phenomenon is observed at lower or reduced levels or magnitudes compared to the level or magnitude of such phenomenon that occurs as a result of the presence of cells. Therefore, for example, an acellular sample and / or a regeneration matrix may have low levels of ATP production, the levels of which are substantially lower than the levels that would occur if the

20 intact cells were present in the acellular sample and / or in the regeneration matrix.

"Therapeutic agent": the term "therapeutic agent" as used herein refers to any of a variety of agents that have one or more beneficial therapeutic effects when used in conjunction with the regeneration methods and / or matrices of the present invention Examples of therapeutic agents that can be used with the generation matrices and the methods of

The invention includes, but is not limited to, proteins, peptides, drugs, cytokines, extracellular matrix molecules and / or growth factors. One skilled in the art will know other suitable and / or advantageous therapeutic agents that can be used in accordance with the present invention. In certain embodiments, the magnitude or (magnitudes) of one or more beneficial therapeutic effects of a therapeutic agent are increased when administered in a regeneration matrix. In certain

In embodiments, the activity of one or more beneficial therapeutic effects of a therapeutic agent is prolonged when administered in a regeneration matrix. In certain embodiments, one or more beneficial therapeutic effects of a therapeutic agent occur over time when a regeneration matrix is administered. In certain embodiments, one or more beneficial effects of a therapeutic agent are protected from substantial decrease over time when administered in a regeneration matrix. In

In certain embodiments, two or more therapeutic agents are administered in a regeneration matrix.

"Tissue sample": The term "tissue sample" as used herein refers to a blood sample comprising cells and / or extracellular material. In certain embodiments, a tissue sample comprises two or more different types of tissues. A tissue sample can be isolated from any of a variety of organisms. As non-limiting examples, a tissue sample can be isolated from a being.

40 human, a pig, a rat, a salamander, a cow, a dog, a cat, a mouse and / or a rabbit. One skilled in the art will know other suitable organisms from which a tissue sample can be isolated. The tissue sample is used as a starting material to produce a regeneration matrix. In certain embodiments, the tissue sample used to produce a regeneration matrix is isolated from the type of organism in which the regeneration matrix is to be used. For example, a regeneration matrix to be used in beings

45 humans can be produced from a sample of isolated tissue from humans. In certain embodiments, a tissue sample used to produce a regeneration matrix of the individual organism in which the regeneration matrix is to be used is isolated. For example, a regeneration matrix to be used in a human individual can be produced from a sample of isolated tissue from that human individual. In certain embodiments, a regeneration matrix is produced from the blood of the human individual in the

50 that the regeneration matrix will be used.

Generalities

In certain embodiments, the present invention provides a regeneration matrix that has the ability to initiate, increase, sustain and / or direct tissue regeneration at a site of tissue damage. For example, a regeneration matrix according to the present invention can be used to regenerate nerve tissue,

55 muscle tissue, liver tissue, heart tissue, lung tissue and / or skin tissue.

The ability of a regeneration matrix to repair lesions and / or degenerated tissue, which includes, but is not limited to, central nervous system (CNS) tissue, is based on the science of scarring and tissue development. Although the healing process has not been fully elucidated, the present invention encompasses the finding that a regeneration matrix has the ability to initiate, increase, sustain and / or direct tissue regeneration.

60 damaged and / or degenerated.

image7

An advantage of the regeneration matrices of the present invention is that they have the ability to suppress certain healing processes that do not enhance tissue regeneration, while enhancing other processes that allow the patient to regenerate tissue. The body is notable in that it is able to repair itself quickly; however, certain aspects of the healing process do not allow functionality

5 original regenerative found in lower animal species such as salamanders. By reducing unwanted traits, and enhancing or reproducing suitable traits of healing and tissue development processes, a regeneration matrix has the ability to achieve superior results. Unlike the lower animal species such as salamanders, the natural healing process in humans is programmed to generate the fastest improvement of the lesion by isolating the site of the injury from the rest of the body with scar tissue that, in the case of The spinal cord or other CNS lesion results in a loss of restoration of function due to the limited effect or lack of other parallel healing processes. The same goes for injuries and degeneration of other parts of the central nervous system, as well as in other tissues of the body.

In certain embodiments, the regeneration methods and / or matrices of the present invention are useful.

15 for the treatment of damaged, lost and / or degenerated nervous tissue, for example, central nervous system tissue. Classically, there has been a lack of significant progress and available treatment for lesions of the central nervous system, including those of the spinal cord. The main reason for the lack of regenerative treatments for tissues, especially central nervous system tissue, is due to the vital and highly complex nature of these tissues.

The present invention encompasses the finding that the highly complex biological and structural nature of the spinal cord can be recovered in SCI patients with products containing the relevant biological activities that induce the recovery of this complex biological and structural nature, as well as inducing structuring. correct and reconnection of the spinal cord. The same goes for other areas of the central nervous system. The regeneration matrices of the present invention are designed to have these and other

25 advantageous features. In addition, additional functionalities can be added to the regeneration matrices of the present invention in a relatively simple and simple manner. To date, no other formulation has been developed for the treatment of CNS damage and SCI patients with such a comprehensive strategy to recover the complex functionality of the central nervous system, such as the spinal cord in SCI patients.

Cicatrization

During the healing process different types of cells are involved in different phases of the healing process, each with its exclusive contributions for the regeneration and recovery of the functionality of damaged tissue. The first cell line comes in general from the bloodstream and includes macrophages, whose job is to clean the damage site to create space for the growth of new cells and to release growth factors that activate the cells that are needed in the next phase of the healing process.

35 Although macrophages alone have a relatively small effect on spinal cord regeneration, this is better than nothing. However, combined with other mechanisms of action, activated macrophages can impart a more significant effect on the regeneration process. In certain embodiments, it has been observed that after days after implantation a regeneration matrix of the present invention increases the rate at which activated macrophages enter the spinal cord injury site in large quantities, thus making it unnecessary to inject any activated macrophage at the site of tissue damage. One skilled in the art will understand, however, that although the regeneration matrices of the invention induce macrophage invasion at a site of tissue damage, macrophages can, however, be administered at or near the site of injury along with, or in addition to, a regeneration matrix of the present invention.

The next stage in the natural healing process is the incorporation of new blood vessels and, in the

In the case of traumatic injuries, the incorporation of fibroblasts that create a scar that surround the site of traumatic injury, so that the surrounding undamaged tissue can continue to function and compensate for the loss of functionality of the damaged tissue while it is repaired slowly. Growth factors released by activated macrophages induce the incorporation of these new blood vessels and fibroblasts. Unfortunately, the central nervous system is surrounded by a blood-brain barrier that restricts macrophage invasion and stimulates the incorporation of new blood vessels. The inhibitory factors that surround the blood-brain barrier, especially in the lesion or degeneration of the CNS, restrict the entry of new blood vessels at the site of CNS damage, resulting in fibroblasts and glial cells that form scars without the simultaneous formation of New blood vessels The resulting scars become very thick and impenetrable, and the lack of new blood vessels implies that the site of the lesion does not

55 can be rebuilt. The end result is the formation of lesions (hollow structures surrounded by thick and impenetrable scars), and long-term (chronic) CNS damage and - in the case of chronic paralysis spinal cord injury. In certain embodiments the regeneration matrices of the present invention contain healing properties that decelerate and inhibit the formation of scars, while simultaneously inducing the formation of new blood vessels. Since the lack of blood vessels results in injuries (fluid-filled cavities that lack cells), it is advantageous for new blood vessels to form in and around these lesions and / or areas where the lesions are to be formed. Without wishing to be bound by any theory, it is hypothesized that the regeneration matrices of the present invention can create

5

fifteen

25

35

Four. Five

55

new blood vessels through an exclusive route: by transdifferentiation (transformation) of activated macrophages into endothelial-type cells positive for von Willebrand factor that naturally form new blood vessels (see Figures 1A, 1B and 1C). Therefore, according to this hypothesis, after the activated macrophages that were attracted to the site of the CNS lesion through such a regeneration matrix have done their job of cleaning the damage site, and having released growth factors, they transform into new specialized types of cells that form new blood vessels. The end result is an extensive new network of blood vessels that provide nutrients and oxygen for new cells and new CNS tissue. In animal models of CNS injury it has been found that an implanted regeneration matrix had already begun to create a network of new blood vessels (this network of blood vessels does not resemble the type of blood vessel growth seen in tumors, but, in instead, it resembles the types of large blood vessel networks present in embryonic development) after one week of the implant, with limited presence of any inhibitory scar (see, for example, Figures 2A, 2B, 2C and 2D).

After the formation of a new network of blood vessels, the next stage in the healing process usually involves the migration of surrounding cells to the site of injury. These cells migrate to the site of the lesion to feed on the supply of fresh nutrients and oxygen provided by the newly formed blood vessels. Unfortunately, in the case of nerve tissue damage, nerve cells are the only long-term cells in the body that do not migrate and / or divide (multiply) after they have differentiated (transformed into adult cells) - if If they did, we would lose the memory inherent in these cells each time they migrated or divided, in effect 'forgetting' those memories (either somatic or autonomous) of which the particular nerve cell is a part. However, as one skilled in the art knows, nerve cells have the ability to form new memories and additional connections through the formation and / or extension of axons and dendrites. In certain embodiments, a regeneration matrix induces several times an increase in the expression of one or more genes that are responsible for the formation and correct structuring, and the connection of such new connections in nerve cells that surround the site of the lesion. (see for example, Figures 18-19). In certain embodiments a regeneration matrix causes nerve cells to spread at the site of the lesion and make new efficient and intelligent connections, such as those that control, for example, the GAP-43 genes and those of the Netrin family, which They are regulated positively by the regeneration matrix. Such new connections can be used to generate a new SNC functionality that can be exploited by training and / or teaching, leading to an advantageous functionality of the new CNS tissue. In certain embodiments, such new functionality is achieved in a short period of time, for example, within a window of about 2 months. As a non-limiting example, in the case of spinal cord injury, this would involve training / teaching the nerves how to move muscles in a coordinated way to allow movement. As another non-limiting example, in the case of Broca's area (the center of speech) in the brain, this would involve training / teaching the nerves how to create a coherent discourse.

In certain embodiments, the regeneration matrices of the present invention further enhance the formation of new CNS tissue by incorporating and increasing the proliferation of three-phase neuroprogenitor cells. Three-phase neuroprogenitor cells are a type of unique and highly mobile young cells that neuroscientists have implicated as responsible for the spontaneous growth of the new CNS tissue, especially in the brain, observed in several cases in humans where damaged CNS tissue of the person repaired himself at least partially. Three-phase neuroprogenitor cells have been difficult to study in vitro (on a plate) because of their nature they differentiate (transform) into nerve cells or glial cells (neuronal support cells: astrocytes and oligodendrocytes) at the time they realize that their environment lacks one of these cells (they seem to become the type of cell that their environment lacks). However, the present invention encompasses the finding that in the presence of a regeneration matrix, the three-phase neuroprogenitor cells continue to proliferate until the regeneration matrix is removed or biodegradable (for example, in the body), at which point they are transformed and created. An extensive neural network. Without wishing to be bound by any theory, one hypothesis is that as a last stage of the new CNS tissue generation process, three-phase neuroprogenitor cells partially fill in the lost parts of the new CNS tissue that are being created that other nerve and glial cells Surroundings did not fill during their regeneration matrix regeneration process phase. Regardless of the precise mechanism, the end result is that three-phase neuroprogenitor cells that are stimulated to proliferate through the regeneration matrices of the invention produce new nerve tissue.

In terms of the other strategies in the field of healing, the above products and strategies have resulted in significant slight or doubtful improvements in experimental animals with respect to untreated control animals. In addition, to date, clinical trials have not demonstrated any significant improvement over placebo due to these single-strategy products. Additionally, in human implants in several cases the technical problems related to adverse immune responses have been insurmountable. Other difficulties have included the inability to deliver a product to a human patient without the cerebrospinal fluid removing it (which in a human being normally moves at a speed of approximately 5 mm / min at a pressure of 120 mm H2O) and / or cause a significant additional injury during the implant. The regeneration matrices of the present invention overcome these and other difficulties. In certain embodiments, administration of the regeneration matrices of the present invention results in

5

10

fifteen

twenty

25

30

35

40

Four. Five

fifty

55

60

a significant improvement in experimental animals with respect to untreated control animals, with no toxicological effects observed. In addition, the regeneration matrices of the present invention are readily obtained in a form that can be delivered to a human patient without long-term immunological problems.

Regeneration Matrix Production

The present invention encompasses the finding that regeneration matrices can be produced by any of a variety of procedures. In certain embodiments, different production processes lead to regeneration matrices that have different physical characteristics, biological properties and / or therapeutic activities. In addition, in certain embodiments the physical characteristics, biological properties and / or therapeutic activities of the regeneration matrices produced in accordance with the methods of the present invention are modified by the provision of one or more exogenous factors during the production process.

A regeneration matrix can be formed from any animal within the animal kingdom. In certain embodiments, a regeneration matrix is produced from blood. Without wishing to be bound by any theory, the hypothesis is made that regeneration matrices are formed, at least partially, by components of cells that are experiencing, in particular, massive tissue damage or are in the vicinity of damaged tissue. For cells, such a mechanism seems to be a way of inducing surrounding cells to regenerate damaged tissue. In 1974 Becker et al. (Becker, R. O. et al., Regeneration of the ventricular myocardium in amphibians, Nature 248, 145-147, 1974) observed, although they did not fully understand, a similar but distinct phenomenon while studying the hearts of newts. Becker observed that when 30% -50% of the triton's heart was cut, the surrounding red blood cells were lysed and their released nuclei added to form new myocardial tissue, allowing the triton's heart to regenerate in about 4 hours and allowing so many of the newts survived. As will be clear from the rest of the present description, the regeneration matrices of the present invention are distinct from and operate through a mechanism different from the phenomenon observed by Becker et al., Since the regeneration matrices of the present invention they are produced from an acellular sample and on their own they do not become a living tissue based on cells. However, in certain embodiments, the regeneration matrices of the present invention are seeded or mixed with cells during or after their formation, to confer one or more beneficial features or functions on the regeneration matrix. As will be understood, however, such cells are not necessary for the formation of the regeneration matrices of the present invention.

A regeneration matrix can be produced from whole blood and / or from one or more fractions of the blood. In the case where a regeneration matrix is produced from whole blood, the main protein components of the regeneration matrix are normally albumin and hemoglobins. In the case where a regeneration matrix is produced from the plasma-platelet-leukocyte fraction of the blood, albumin is normally a major protein component of the regeneration matrix. However, regeneration matrices produced from whole blood and from the plasma-platelet-leukocyte fraction, each works to initiate, increase, sustain and / or direct tissue regeneration at a site of damage, loss and / or degeneration. tissue. In certain embodiments, a regeneration matrix is produced from an acellular sample generated from whole blood. In certain embodiments, a regeneration matrix is produced from an acellular sample generated from one or more blood fractions including, but not limited to, an erythrocyte fraction, a leukocyte fraction, a platelet fraction and / or a fraction plasma Such fractions can be generated, for example, allowing whole blood to settle and separate by gravity. In certain embodiments the blood fractions are generated by centrifugation. One skilled in the art will know other techniques for separating blood into fractions, whose fractions can be used to produce a regeneration matrix of the present invention. In certain embodiments a regeneration matrix is produced from blood or it has been frozen. In certain embodiments, such blood has been frozen for a period of days, weeks, months or years. In certain embodiments, better yields and development of regeneration matrices are obtained when the blood is subjected to multiple freeze-thaw cycles at a temperature range that is close to the freezing-melting point of the sample. In certain embodiments, a regeneration matrix is produced from blood that is isolated from corpses (eg, corpses that are several weeks old). In certain embodiments, a regeneration matrix is produced from placental or umbilical cord blood. One skilled in the art will know other blood sources that can be used to produce a regeneration matrix.

In addition, in the case of whole blood, as shown in Examples 1 and 2, the presence of an anticoagulant in the blood sample results in regeneration matrices with different adhesive properties. Any of a variety of anticoagulants that include, but are not limited to, heparin, EDTA and / or citrate can be used. One skilled in the art will know other anticoagulants, as well as coagulants, which can be used to produce regeneration matrices with different physical characteristics, biological properties and / or therapeutic activities.

In certain embodiments, an acellular sample is generated by removing cells from a tissue sample. Any of a variety of techniques can be used to eliminate such cells. For example, you can undergo a

5

fifteen

25

35

Four. Five

55

centrifugal tissue sample to separate the tissue sample into fractions that contain cells and that do not contain cells, in which the fraction that does not contain cells is then isolated. In certain embodiments, the cells are removed from a tissue sample by passing the tissue sample through a filter with a pore size small enough to exclude cells. For example, cells can be removed from a tissue sample by passing the tissue sample through a filter with a pore size of 5 μm, 1.2 μm and / or 0.8 μm. In certain embodiments, the filter pore size modifies the physical characteristics, the biological properties and / or the therapeutic activities of the regeneration matrix produced. The professional can determine the exact pore size depending on the experimental and / or laboratory limitations, the desired characteristics of the regeneration matrix and / or any of a variety of other factors considered important by the professional. In certain embodiments, a tissue sample is suspended, solubilized and / or diluted before removing the cells. For example, before removing the cells from the tissue sample, a tissue sample can be suspended, solubilized and / or diluted in a process medium and / or a physiological solution.

A regeneration matrix can be produced by incubating an acellular sample during any of a variety of incubation times. For example, an acellular sample can be incubated for 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23 , 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60 or more days. The functional regeneration matrix has been detected in in vitro assays in a regeneration matrix produced after 6 days, 12 days, 15 days, 21 days and 28 days, and has remained functional with a longer incubation period of 6 weeks or plus. By modifying the environmental parameters and / or a process means used in the production process, functional regeneration matrices can be produced in a shorter period of time. For example, by decreasing the oxygen concentration to about 0% and / or increasing the aggregation properties or the effects of the process medium by, for example, increasing its salt concentration, functional regeneration matrices can occur after minutes, hours or a few days. In certain embodiments the activity of a regeneration matrix produced by incubating an acellular sample increases as the incubation period increases. In certain embodiments, a regeneration matrix produced by incubating an acellular sample reaches a maximum or near maximum activity after an incubation period. In such embodiments, a regeneration matrix increases, in any case, the activity only gradually as a result of an additional incubation. In such embodiments, it is possible that the regeneration matrix may lose activity as a result of further incubation.

The first inventor has discovered that agitation, or otherwise disturbing the acellular sample during the initial formation of the regeneration matrix results in an incomplete and / or defective regeneration matrix, and / or the complete lack of a matrix of regeneration produced (as well as a corresponding decrease in the biological activity of such incomplete and / or defective regeneration matrices). In certain embodiments, an acellular sample is incubated so that the sample is not agitated or otherwise disturbed during the period of time in which the regeneration matrix is being formed. For example, an acellular sample may be incubated in the absence of agitation or other disturbance for 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17 , 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 days or more. In certain embodiments, an acellular sample is incubated so that the sample is not agitated or otherwise disturbed during the total time the regeneration matrix is formed.

Certain incubation conditions and / or the addition of one or more exogenous factors during the production process may modify the incubation time necessary for the regeneration matrix to achieve a desired level of activity. As a non-limiting example, the decrease in environmental oxygen concentration decreases the amount of time required to achieve a desired level of regeneration matrix activity. In certain embodiments, the concentration of ambient oxygen during incubation is approximately 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4 , 3, 2, 1% or less. In certain embodiments, the concentration of ambient oxygen during incubation is almost or exactly 0%. In certain embodiments, incubation in a low oxygen environment results in a regeneration matrix with a desired level of activity in as little as 3 days. In certain embodiments, incubation in a low oxygen environment results in a regeneration matrix with a desired level of activity in as little as 7 days. In certain embodiments, the concentration of ambient oxygen during incubation is modified (for example, it is raised and / or reduced) during the incubation procedure. One skilled in the art will have the ability to choose one or more appropriate ambient oxygen concentrations, depending on the time constraints in the formation of the regeneration matrix, the type of tissue damage for which the regeneration matrix will be used, experimental and / or laboratory limitations, and / or any of a variety of other factors considered important by the professional.

In certain embodiments during incubation the humidity is adjusted or controlled. For example, a regeneration matrix is produced by incubating an acellular sample at any of a variety of environmental humidities. In certain embodiments, ambient humidity is kept low during incubation so that the evaporation of liquid in the acellular sample is increased. In certain embodiments, new liquid containing solutes (for example, a "process medium" and / or "physiological solution") is added continuously or periodically to an acellular sample that has undergone evaporation. In such embodiments, it will be understood that the osmolarity of the acellular sample increases over time as a result of evaporation and the addition of liquid containing new solutes. In certain embodiments, such an increase in osmolarity gives as

image8

result in a change in physiological characteristics, biological properties and / or therapeutic activities of the regeneration matrix produced. As a non-limiting example, it has been shown that increasing the osmolarity of a solution and / or suspension containing the acellular sample during the incubation procedure, results in a regeneration matrix with a more solid physical consistency with respect to a regeneration matrix produced by a procedure in which the osmolarity is not increased, or increased by a smaller amount. Such a regeneration matrix can be used as an implantable composition when it is desired that the regeneration matrix retain a certain physical form for a prolonged period of time. A regeneration matrix that has a less solid physical consistency (for example, such as a regeneration matrix produced by a procedure where the osmolarity is kept constant or increased by a smaller amount) is for use when desired, for example , inject a regeneration matrix into a subject. In certain embodiments the ambient humidity is modified (for example, it is raised and / or reduced) during the incubation procedure, to control the rate of change in osmolarity. A person skilled in the art will have the ability to choose one or more appropriate environmental humidities depending on the time constraints in the formation of the regeneration matrix, the type of tissue damage for which the matrix of

Regeneration will be used, of experimental and / or laboratory limitations, and / or any of a variety of other factors considered important by the professional. In addition, the density, porosity and / or level of hydration of the regeneration matrix formed can be changed by centrifugation or lyophilization of the regeneration matrix formed. For example, the regeneration matrix formed could be centrifuged at 5000 x g to increase its density and hardness for the implant in a bone defect, to support bone regeneration.

In certain embodiments the regeneration matrices of the present invention are produced by incubating an acellular sample for a period of time in an incubation chamber. Any of a variety of incubation chambers can be used. In certain embodiments an incubation chamber comprises a sealed or semi-sealed container that is permeable or semipermeable to one or more substances, for example, air and / or gaseous molecules. For example, an Opticell® cassette (BioCrystal Ltd., 25 Westerville, OH) can be used as an incubation chamber to produce a regeneration matrix from an acellular sample. In certain embodiments, a sealed or semi-sealed incubation chamber is designed so that material can be added and / or removed from the container after the incubation procedure has begun. For example, an incubation chamber that is permeable or semipermeable to air and / or gaseous molecules can be designed so that liquid and / or solid material can be added and / or removed from the chamber, one or more times during and / or after incubation Such incubation chambers are advantageous when it is convenient to increase the osmolarity of the acellular sample during the incubation procedure. For example, during the incubation procedure the osmolarity of the acellular sample can be increased by allowing the solvent of a liquid solution or suspension containing the acellular sample (whose solution or solvent can be generated, for example, by adding a process medium or a solution physiological to the acellular chamber and / or a tissue sample a

From which the acellular sample is generated) evaporates over time, and new liquid containing solutes is added continuously or periodically to the acellular sample. Such a liquid containing solutes may comprise a process medium and / or a physiological solution. In the case where an acellular sample has been solubilized or suspended in a process medium and / or a physiological solution, during the incubation procedure the same procedure medium and / or physiological solution can be added to the acellular sample. Additionally or as an alternative, during the incubation procedure a different process medium and / or physiological solution can be added to the acellular sample. Additionally or as an alternative, a liquid containing solutes to be added to the acellular sample is neither a procedure nor a physiological solution.

In certain embodiments a regeneration matrix has physical characteristics, biological properties

45 and / or different therapeutic activities, depending on the method and / or the physiological solution used during the production procedure. For example, as shown in Example 11, a regeneration matrix produced using TR-10 media exhibits an increased biological activity compared to a regeneration matrix produced using DMEM / F-12 media. A person skilled in the art will have the ability to determine the procedural means and / or appropriate physiological means to achieve a regeneration matrix that has one or more physical characteristics, biological properties and / or desired therapeutic activities without undue experimentation.

A process medium and / or a physiological solution can be added to the tissue sample and / or acellular sample at any of a variety of time points during the regeneration matrix production process. In certain embodiments, during the isolation of the tissue sample a medium of

Procedure to the tissue sample and / or acellular sample, before the removal of cells from the tissue sample, before incubating the acellular sample and / or during the incubation procedure.

In certain embodiments, a regeneration matrix is produced by incubating an acellular sample in the presence of one or more exogenous factors. For example, an acellular sample can be incubated in the presence of one or more therapeutic agents, one or more cell types, or both. In certain embodiments such exogenous factors modify the physical characteristics and / or increase the biological and / or therapeutic activities of a regeneration matrix. For example, as shown in Example 9, a regeneration matrix supplemented by the addition of ITS, EGF and bFGF during the production of the regeneration matrix results in an increased effect of the regeneration matrix on the extension activity of neurites

image9

To increase and / or complement the activity of the regeneration matrices of the present invention, any of a variety of therapeutic agents can be used. Examples of therapeutic agents that can be used with the regeneration matrices and methods of the invention include, but are not limited to, proteins, peptides, drugs, cytokines, extracellular matrix molecules and / or growth factors. A person skilled in the art will know other suitable and / or advantageous therapeutic agents that can be used in accordance with the present invention. In certain embodiments, when administered in a regeneration matrix, the magnitude (or magnitudes) of one or more beneficial therapeutic effects of a therapeutic agent is increased. In certain embodiments, the activity of one or more beneficial therapeutic effects of a therapeutic agent is prolonged when administered in a regeneration matrix. In certain embodiments, when one therapeutic agent is administered in a regeneration matrix, one or more beneficial therapeutic effects occur over time. In certain embodiments when administered in a regeneration matrix, one or more beneficial effects of a therapeutic agent are protected from a substantial reduction over time. In certain embodiments, two or more therapeutic agents are administered in a regeneration matrix. In certain embodiments, a therapeutic agent is added during the procedure of

15 production of a regeneration matrix. For example, a therapeutic agent may be added at one or more stages of the production process including, but not limited to, during the isolation of the tissue sample, before the removal of cells from the tissue sample, before incubation of the tissue. acellular sample and / or during the incubation procedure.

In certain embodiments, a therapeutic agent is distributed throughout the regeneration matrix uniformly. In certain embodiments, a therapeutic agent is distributed throughout the regeneration matrix in a heterogeneous manner. For example, a therapeutic agent may be more concentrated in or near the core of a regeneration matrix. This could be achieved, for example, by introducing the therapeutic agent during the first days or the first half of the period of formation of the regeneration matrix, followed by the withdrawal of most or all of the solution surrounding the regeneration matrix in formation in the incubation chamber, adding to the incubation chamber more than the initial acellular sample or solution until a desired level is achieved, and then further incubating the acellular sample and the regeneration matrix to continue the process of formation of the regeneration matrix The acellular sample or additional solution could also be added together with another therapeutic agent, which would then be concentrated heterogeneously closer to the outer surface of the forming regeneration matrix and, thus, released into its surrounding environment earlier than the first therapeutic agent, when the regeneration matrix biodegrades or degrades; This procedure could be used in applications where it is desired that the therapeutic agents be delivered at different time points (for example, one after the other) at a specific site. In certain embodiments, such heterogeneous distribution affects the properties and / or function of the therapeutic agent in vivo. For example, such a heterogeneous distribution may result in a modification of the magnitude (or magnitudes) of one or more effects.

Therapeutic benefits of the therapeutic agent, prolongation of the activity of one or more beneficial therapeutic effects of the therapeutic agent, a modification of the prolonged release characteristics of one or more beneficial therapeutic effects of the therapeutic agent and / or the protection of one or more Beneficial effects of the therapeutic agent of the substantial decrease over time.

To increase and / or complement the activity of the regeneration matrices of the present invention, any of a variety of cell types can be used. However, although cells can be used to increase and / or complement the activity of the regeneration matrices of the present invention, it will be understood that such cells are not needed to form a regeneration matrix. In certain embodiments, cells are added to an acellular sample form whose cells have been removed. In certain embodiments, cells of a different type from the cells present in the tissue sample from which the acellular sample was generated are used. Examples of cell types that can be used in accordance with the present invention include, but are not limited to, stem cells, progenitor cells and / or somatic cells. One skilled in the art will know other suitable and / or advantageous cell types that can be used in accordance with the present invention. In certain embodiments during the production process of a regeneration matrix cells are added. For example, cells may be added at one or more stages of the production process including, but not limited to, during the isolation of the tissue sample, before the removal of cells from the tissue sample, before incubation of the acellular sample. and / or during the incubation procedure. In certain embodiments, the cells are distributed throughout the regeneration matrix evenly. In certain embodiments, the cells are distributed heterogeneously throughout the regeneration matrix. For example, cells may be more concentrated in or near the nucleus of a regeneration matrix. In certain

In embodiments, such heterogeneous distribution affects the properties and / or function of cells in vivo.

One of the most effective ways to produce a promising regeneration matrix for implantation in a patient, without triggering a significant immune response, is to obtain the regeneration matrix from the patient's own blood and / or tissue. However, the regeneration matrices of the present invention are not limited to such autologous regeneration matrices. In certain embodiments, prefabricated regeneration matrices are manufactured for immediate implantation using blood or other allogeneic tissue. In such embodiments, it may be convenient to administer such an allogeneic regeneration matrix together with one or more immunosuppressive agents. Examples of such immunosuppressive agents are known to those skilled in the art. In certain embodiments, a regeneration matrix is obtained for use in a kind of cell of

5

10

fifteen

twenty

25

30

35

40

Four. Five

fifty

55

60

A different species. For example, a regeneration matrix produced using tissue obtained from an animal (eg, pigs) is administered to a human being. In certain embodiments the regeneration matrices of the present invention are useful in veterinary applications, for example to repair damaged and / or degenerated tissue of production cattle and / or pets.

In certain embodiments the physical characteristics, biological properties and / or therapeutic activities of a regeneration matrix are modified after the production process is substantially or completely completed. For example, in many cases it will be convenient to store a regeneration matrix for an extended period of time after it is manufactured. As is known in the art, hydrolysis is a cause of shortening the shelf life for a variety of biological and non-biological substances. Therefore, in certain embodiments, the shelf life of the regeneration matrices of the present invention can be increased by removing some, or all, of the liquid present in such a regeneration matrix. Any of a variety of techniques can be used to remove such liquid. For example, to condense the proteinaceous components and / or other biological macromolecular components, a regeneration matrix can be centrifuged, after which a desired amount of liquid is removed from the centrifuged sample. Additionally or alternatively, liquid can be removed from a regeneration matrix by subjecting the regeneration matrix to a filtration stage (for example, by gravity or low speed centrifugation), using a filter with a pore size sufficiently large as to pass liquid but small enough so that the material of the regeneration matrix does not transfer it. Additionally or as an alternative, liquid can be removed from a regeneration matrix by dehydrating the regeneration matrix for a period of time, either in the presence or absence of dehydrators. A person skilled in the art will know other appropriate and / or useful procedures for removing liquid from a regeneration matrix to improve its shelf life. It will be understood that the removal of liquid from a regeneration matrix can also modify one or more of its biological properties and / or therapeutic activities. In certain embodiments, the biological properties and / or therapeutic activities are increased by the liquid withdrawal procedure.

In addition, such removal of liquid can result in an additional advantage by modifying the physical characteristics of a regeneration matrix, so that the regeneration matrix coincides more closely with the physical environment in which it is to be administered. For example, lowering the level of hydration of the regeneration matrix may result in a regeneration matrix with a higher density. Such a dense regeneration matrix can be used advantageously, for example, in the regeneration of bone and / or cartilage. One skilled in the art will know, on the basis of this description, other advantageous applications of such dense regeneration matrices and will have the ability to use such regeneration matrices in such applications without undue experimentation.

Composition and characteristics of the regeneration matrix

The regeneration matrices of the present invention comprise a heterogeneous mixture of proteins, lipids, carbohydrates, salts and nucleic acids. In addition, regeneration matrices have been stored at refrigerated temperatures for up to 3 months without loss of function. Presumably, a regeneration matrix could be stored indefinitely using appropriate conditions. For example, the water content of a regeneration matrix can be decreased (for example, through centrifugation, dehydration, lyophilization, etc.) to increase the time that can be stored. In certain embodiments, the main structure consists mostly of aggregates of spherical structures of approximately 1 to 4 μm in diameter. In certain embodiments, the main structure consists mostly of aggregates of spherical structures of approximately 100 nm in diameter. In certain embodiments, the main structure consists mostly of aggregates of spherical structures of at least about 100 nm in diameter. In certain embodiments, the regeneration matrices comprise such spherical structures with fibers interspersed throughout. As described above, the processing conditions used to form the starting material can affect the final size of the spherical structures. For example, if the starting material is filtered through a 5 μm filter, the predominant spherical structures are normally approximately 2 to 4 μm in diameter. If the starting material is filtered through a 1.2 μm filter, the predominant structures are usually approximately 1 to 2 μm in diameter.

In certain embodiments, anti-CD56 antibodies recognize the surface of the spheres, indicating the presence of the neural cell adhesion molecule (NCAM). Without pretending to be bound by any theory, the hypothesis is formulated that NCAM-mediated stimulation is a mechanism by which the regeneration matrix recognizes neuronal cells and stimulates regeneration after damage. In certain embodiments, during tissue repair, tissue regeneration and / or tissue formation, the regeneration matrix acts as an extracellular growth matrix (MCEC). When a regeneration matrix is formed from blood, the physical and functional properties are affected by the blood collection procedure (for example, the presence or absence of anticoagulants and / or the type of anticoagulant) as well as by the size of pore used to filter the lysate before the incubation period. When blood is collected with the heparin anticoagulant, structures similar to those formed with blood collected without anticoagulant are formed. The regeneration matrix formed from this whole blood generally joins both the lower and the upper part of the production device (for example, Opticell®), with a slightly different arrangement of structures on the respective surfaces. However, when blood is collected with EDTA or citrate anticoagulants, the regeneration matrix formed from whole blood is weakly bound to the production device and has a gel-like appearance and consistency.

image10

In certain embodiments, the regeneration matrices of the present invention comprise water as their

5 main ingredient. In certain embodiments, the non-aqueous composition of a regeneration matrix primarily comprises protein. In certain embodiments, the protein content of a regeneration matrix ranges from about 5 to 15% by mass. However, this percentage can be manipulated using different proportions of tissue sample and / or acellular sample with respect to the process medium in the production process. In certain embodiments, using such proportions

10 different, the protein content of the regeneration matrix produced is approximately 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30% or more. This percentage can also be changed by modifying the level of hydration of the regeneration matrix produced. In certain embodiments, using such modifications in the level of hydration of the regeneration matrix, the protein content of the regeneration matrix may be less than about 0.1% or more than

15 approximately 90%. In the case where a regeneration matrix is produced from whole blood, the main protein components of the regeneration matrix are normally albumin and hemoglobins. In the case where a regeneration matrix is produced from the plasma-platelet-leukocyte fraction of the blood, a major protein component of the regeneration matrix is normally albumin. However, one skilled in the art will understand that in these regeneration matrices other ones are also present.

20 protein or peptide constituents of blood. In addition, one skilled in the art will understand that other protein or peptide constituents may be present when the regeneration matrix is produced from an acellular sample generated from tissue other than blood.

A regeneration matrix has important regenerative and tissue formation properties and potential. It can serve as an aid and / or a framework for the cells involved in tissue regeneration and tissue formation. In certain embodiments, the regeneration matrices of the present invention allow cells to bind, proliferate and / or differentiate into or around the regeneration matrices. In certain embodiments, the regeneration matrices of the present invention stimulate neurons to extend neuronal extensions to bind to the regeneration matrix. In vitro cell culture assays using neural cells have shown that a regeneration matrix selectively stimulates genes that are associated with neural cell adhesion, neuron survival, axonal growth and regeneration, structuring and connectivity. . In vitro cell culture assays using human fibroblasts have shown that a regeneration matrix produced by filtration with a 5 μm filter has an inhibitory effect on the proliferation of these cells. The magnitude of such fibroblast inhibition activity can be affected by the processing conditions used for the formation of the regeneration matrix. A regeneration matrix 35 produced from coagulated blood inhibits fibroblast proliferation rather than a regeneration matrix produced from blood collected in the presence of anticoagulants. In certain embodiments this difference is advantageous since the fibroblasts secrete collagen in the injured tissue, which is necessary to some extent to provide a support structure, but in most cases of severe tissue damage the defect is mainly filled with a connective tissue scar. The healing of extensive connective tissue is

40 inhibitor of the regeneration process and contributes to the permanent loss of function in damaged tissues and organs. Therefore, in certain embodiments the magnitude of the regeneration matrix activity is modulated or controlled to provide optimal healing characteristics based on the severity of tissue damage at the injured site.

Using in vivo models of spinal cord injury the regeneration matrices of the present invention have

45 demonstrated to have multiple beneficial effects that include, but are not limited to, angiogenic properties, axonal growth, size and number of reduced lesions, as well as an inhibitory function of the formation of glial astrocyte scars. In vivo, a regeneration matrix normally degrades over time (for example, usually about 4-8 weeks), mainly by ingestion of macrophages, although the regeneration matrices of the present invention are not limited to such times or mechanisms. of degradation

As is clear from the present description, such degradation can occur through any of a variety of mechanisms including, but not limited to, cell activity (for example, through macrophage action), and mechanical degradation, chemical, metabolic and / or enzymatic. In certain embodiments, such degradation of the regeneration matrix stimulates macrophages to present additional regenerative properties themselves (for example, through their transdifferentiation into endothelial-type cells positive for

55 von Willebrand factor). When implanted in parts of damaged or lost tissue or organs, the regeneration matrices of the present invention support the regeneration and formation of new tissue and help restore the functionality of the damaged part or loss of tissue or organ. Non-limiting examples of tissues in which a regeneration matrix can be implanted to initiate, increase, sustain and / or direct tissue regeneration and tissue formation include damaged, lost or cut parts of the liver, kidneys, pancreas,

60 heart, ovaries, thyroid gland, brain, spinal cord and any other neural tissue.

In the context of spinal cord regeneration, a regeneration matrix can be implanted with or without cells such as, for example, neural stem cells, neural progenitor cells and / or differentiated neural cells, in the damaged, degenerated, lost or cut from the spinal cord. The functionality of a

5

fifteen

25

35

Four. Five

55

Regeneration matrix can be further expanded and manipulated by the addition of one or more therapeutic agents that include, but are not limited to, growth factors, cytokines, drugs and / or other components. In certain embodiments, when a regeneration matrix is produced without the addition of exogenous therapeutic agents, partial functionality is observed in terms of extension of neuronal extensions and positive regulation of neuronal genes. In such embodiments, the magnitude of these functions is enhanced by the incorporation of exogenous therapeutic agents during the formation of a regeneration matrix. Non-limiting examples of suitable additional therapeutic agents include growth factors such as bFGF, EGF, BDNF and / or NGF. In certain embodiments, the implantation of the regeneration matrix in injured spinal cord leads to the functional restoration of loss of motor function in just 4 weeks after implantation.

The formation of an implantable degradable biological framework with inherent and multi-faceted regenerative properties, the framework of which is encompassed in certain embodiments of the present invention, is by no means precedent. Although some cell types have produced simple extracellular matrices, such matrices appear to be only of a structural nature. No one has reported so far the production of a self-assembly matrix or framework material that facilitates, sustains and assists in a structural and biological way in the regeneration and growth of new tissue, whose matrix or support material is covered by certain embodiments of the present invention

Examples

Example 1. Obtaining the regeneration matrix from whole coagulated blood.

Venous blood was obtained from healthy donors (Research Blood Components, Brighton, MA) in 12 ml vaccutainers®, allowed to clot at RT for at least 30 min and frozen at -20 ° C until use. Processing began by subjecting the blood to 5 cycles of freezing (-20 ° C) -freezing (TA). The contents of vaccutainer containing 10 ml of blood were emptied into a sterile mortar. The clot was broken by manual crushing using a sterile crusher with the addition of procedural medium consisting of a 1: 1 mixture of DMEM (Mediatech, Herndon, VA) and Ham F12 (Mediatech), supplemented with ITS 2X complement (Gibco / Invitrogen, Gaithersburg, MD), recombinant human EGF (R&D Systems, Minneapolis, MN) 20 ng / ml and recombinant human bFGF (R&D Systems) 40 ng / ml. During the crushing procedure, the liquid containing the liquefied whole blood and procedure medium was aspirated from the mortar using a sterile 25 ml serological pipette, and transferred to a 40 μm mesh filter where the contents were allowed to filter through gravity in a sterile 50 ml conical centrifuge tube. Freshly prepared process medium was added to the remaining solid clot, and the procedure was repeated until the entire clot was liquefied and a final volume of 200 ml was reached. The tubes were centrifuged at 500 xg for 30 min and the supernatant was filtered through a 5 µm syringe filter (Pall / Gelman) directly onto the Opticell® cassettes. Opticell® cassettes were incubated at 37 ° C and 7.5% CO2. After 6 to 8 days of incubation, 3 ml of fresh process medium was added to each Opticell® cassette. After that 1.5 ml of freshly prepared process medium was added on alternate days until the regeneration matrix was collected for further analysis. The regeneration matrix formed using this procedure has adhesive properties in the sense that it must be collected by removing the upper membrane from the Opticell® cassette and scraping off the lower part of the membrane.

Example 2. Obtaining the regeneration matrix from whole blood collected using anticoagulant.

Venous blood was obtained from healthy donors (Research Blood Components, Brighton, MA) in 12 ml vaccutainers® containing Na4-EDTA and frozen at -20 ° C until use. The processing was started by subjecting the blood to 5 successive cycles of freezing (-20 ° C) - defrosting (TA). The contents of the vaccutainer containing 10 ml of blood were emptied into a sterile container and procedural medium (see Example 1) was added to a final volume of 200 ml and the solution was mixed gently. This starting material was filtered by gravity through a 40 μm mesh screen. The filtrate was collected and centrifuged at 500 xg for 30 min and the supernatant was passed through a 5 µm syringe filter directly into the Opticell® cassettes, up to 10 ml each. Opticell® cassettes were incubated at 37 ° C and 7.5% CO2 in air. After 6 to 8 days of incubation, 3 ml of fresh process medium was added to each Opticell® cassette. After this, 1.5 ml of fresh process medium was added on alternate days until the regeneration matrix was collected for further analysis.

In another experiment, venous blood was obtained from healthy donors (Research Blood Components, Brighton, MA) in 12 ml vaccutainers® containing Na4-EDTA and kept on ice. The contents of the vaccutainer containing 10 ml of blood were emptied into a sterile container and procedural medium (see Example 1) was added to a final volume of 200 ml and the solution was mixed gently. This starting material was filtered through 5 µm syringe filters. The filtrate was collected and centrifuged at 500 xg for 30 min, and the supernatant was passed through a 5 µm syringe filter directly into the Opticell® cassettes up to 10 ml each. Opticell® cassettes were incubated at 37 ° C and 7.5% CO2. After 6 to 8 days of incubation, 3 ml of fresh process medium was added to each Opticell® cassette. After this 1.5 ml of freshly prepared process medium was added on alternate days until the regeneration matrix was collected for further analysis.

image11

The regeneration matrix formed using these procedures has weak adhesive properties and can be collected by aspiration through an 18 gauge needle, using one of the access holes of the Opticell® cassette.

5 Example 3. Obtaining the regeneration matrix from whole blood fractions produced using serial filtration.

The activity of the regeneration matrix was further enhanced by passing the supernatant from the centrifugation step (as listed in Examples 1 and 2) through sets of 5 μm and 1.2 μm filters coupled together. This step removes larger particles from the starting material, which results in modified functional properties. An example of the structure of the regeneration matrix within the Opticell® cassette is shown (Figure 3). Figure 4 shows that a regeneration matrix produced from whole blood does not show any evidence of intact cells or nuclei. Hematoxylin staining was completely negative in all the analyzed sections, but the material was stained strongly with eosin. When using high aperture (high resolution) lenses, a pearl-shaped structure can be clearly resolved. Besides the

In the form of pearls comprising the majority of the regeneration matrix, it is possible to observe small regions of flat sheets that appear to be composed of more compact structures.

Example 4.1 Scanning electron microscopy (MEB) of the regeneration matrix.

For electron microscopy, a regeneration matrix produced by the procedures described in Examples 1, 2 and 3 was fixed with 2.5% glutaraldehyde in 0.1 M sodium cacodylate buffer (Electron Microscopy 20 Sciences) at 4 ° C for 16 h. Fixings were made directly on the Opticell® by replacing the culture medium with 10 ml of fixative solution. The next day the fixative was removed and PBS (10 ml) was added to the Opticell®. The Opticell® was opened with a scalpel and the Opticell® membrane with the regeneration matrix attached to it was cut into small 0.5x1 cm pieces. These pieces were placed in a 1.5 ml microcentrifuge tube and subsequently fixed with 1% osmium tetroxide in water for 2 h. The mixture was then immediately placed in 50% 50% ethanol solution for 2 min and serially dehydrated in 70, 80, 90, 95 and 100% ethanol solutions. After the last stage of ethanol, the samples were kept at -20 ° C until they were sent to the facilities of the Center for Central Microscopy at the University of Massachusetts Amherst. The samples were dried by critical point and coated with metallized by atomic bombardment. Images of the samples were taken with a JEOL JSM-5400 scanning electron microscope at magnifications of 100x to 7500x. The images are

30 were taken through a digital interface on a computer and exported in TIFF format, with a resolution of 640x480 pixels.

Each of the preparation procedures produced a regeneration matrix with a different microstructure (Figures 5, 6 and 7). The filtration of lower porosity produced a similar overall morphology, however the size of the spheres was smaller for the treatment by 1.2 μm (diameter of 1-2 μm, Figure 6) than that of the treatment by

35 5.0 μm (diameter of 2-3 μm, Figure 5). A regeneration matrix produced using coagulated blood passed a maturation phase of approximately 2 to 3 weeks of incubation, in which the upper surface of the matrix had a wavy structure appearance. A regeneration matrix produced with uncoagulated blood does not develop this aspect, however the spherical structures are added together to form a continuous structure that has approximately 100 nm fibers interspersed everywhere (Figure 7).

For histology the regeneration matrix was fixed with 2.5% glutaraldehyde in 0.1 M sodium cacodylate buffer (Electron Microscopy Sciences) at 4 ° C for 16 hours. Fixings were made directly on the Opticell® by replacing the culture medium with 10 ml of fixative solution. The next day the fixative solution was removed and PBS (10 ml) was added to the Opticell®. The Opticell® was opened with a scalpel and the Opticell® membrane with the regeneration matrix attached to it was cut into small pieces of 2x2 cm, and mounted between sponges in a cassette

45 tissue histology. Samples were placed in 70% ethanol and sent for conventional histological processing by Mass Histology (Worcester, MA). The samples were dehydrated in ethanol series, included in paraffin, oriented and cut. The sections were stained with hematoxylin eosin using conventional fixing conditions. Images were taken with dark field optics using a modified Leica microscope optimized with Richardson technologies for contrast enhancement and

50 interference reduction. The images were collected with a video camera with a resolution of 640x480 pixels, with 20, 40 and 100x. A sample image collected with a magnification of 100x is shown (Figure 8). The regeneration matrix is stained with eosin and not with hematoxylin.

Example 4.2. Transmission electron microscopy (MET) of the regeneration matrix.

A 21-day regeneration matrix prepared from a sample of was cut and scanned by MET

55 tissue that was passed through a 5 μm filter (Figures 9-11). MET analysis reveals that sphere-like particles are part of a continuous material since in the MET they show no boundaries between them. The spheres are solid and not hollow, and do not have a membrane or any other type of structure that surrounds them. The interior of this material is homogeneous. The very dark spots in Figure 9 are staining background.

image12

Example 5. Biochemical characterization of the regeneration matrix.

Regeneration matrices manufactured from whole blood were analyzed for protein, lipid, nucleic acid and carbohydrate content, and for metabolic activities as a sensitive indicator of the presence of viable cells. The biological data were normalized with respect to the mass in grams of the matrix

5 of wet regeneration analyzed. Conventional procedures for the quantification of proteins, DNA, RNA and lipids were used, and the composition of several different batches of the regeneration matrix was determined at multiple time points in the regeneration matrix manufacturing process (detailed procedures are provided in the individual sections).

5.1. Total protein content of the regeneration matrix

10 The most abundant biological constituent of the regeneration matrix are proteins, being represented at 8.8 ± 1.2% by mass, with the remaining mass being liquid associated with the regeneration matrix. The normalized protein content in the regeneration matrix was determined by solubilizing a previously heavy aliquot of a regeneration matrix in SDS lysis buffer (150 mM NaCl, 50 mM Tris-HCl (pH 7.5), 10 mM EDTA, SDS 1% and Complete © mini protease inhibitor cocktail (Cat. No. 11-836-153, Roche) Protein concentration

15 in the lysate was determined using a Lowry based protein assay kit (Cat. No. 500-0112, Bio-Rad) according to the manufacturer's instructions. A standard curve was constructed using a BSA pattern (Cat. No. 500-0007, Bio-Rad). The optical density (750 nm) was measured using a Spectramax Plus spectrophotometer (Model 384, Molecular Devices) and the protein concentration of the sample was determined by interpolation of the linear range of the standard curve using the Softmax Pro software (Molecular Devices) .

The total protein content (per regeneration matrix) was determined for the starting material (0) of the regeneration matrix, for the samples collected on days 0, 15 and 21 of the initial sowing of the OptiCell® cassettes.

Table 1. Total protein content of the regeneration matrix in the Opticell® cassette.

The production liquid of the regeneration matrix was removed and the regeneration matrix was solubilized in SDS buffer, and the total protein content was determined. Samples of 4 cassettes were taken for each time point

25 Opticell® and analyzed. The results from 4 independent batches of regeneration matrix production are presented as the mean ± the standard deviation.

Time point (days)

Protein content (mg)

0

80 ± 25

fifteen

49 ± 7

twenty-one

51 ± 12

5.2. Analysis by SDS Page of the regeneration matrix.

The main species of the proteins present in the regeneration matrix were determined by mass spectroscopy in all visible Coomassie bands extracted from a reducing SDS-PAGE gel.

30 For SDS-PAGE, the samples were prepared and quantified as indicated above and loaded onto precast polyacrylamide gradient gels (4-20% gradient PAGE, Cat. No. 345-0033, Bio-Rad ) at 10 μg per well. The main protein bands were visualized by staining with Simply Blue® gel dye (Cat. No. LC6060, Invitrogen).

The extracted protein bands were sent to Midwest Bio Services (Overland Park, KS (www.midwestbioservic

35 es.com) for identification. In summary; the reduction, alkylation and trypsinization in the gel was continued by the extraction of peptides and separation in a microcapillary column of reverse phase. The peptides were eluted and electropulverized directly on a Deca XP Plus LCQ ion entrapment mass spectrometer. The complete MS spectra were acquired, as well as the MS / MS spectra, and the data was analyzed by the TurboSEQUEST software. Since this type of analysis uses the mass of the peptides

In order to give a reference with respect to the known molecular weight of peptide fragments of known proteins, the presence of partially degraded proteins would also be detected in the gel bands. The main protein species identified in the regeneration matrix are listed below: transferrin, seroalbumin, seroalbumin precursor, complement component 3, hemoglobin A-D chains, IgM, IgG1, medulasin 2 inhibitor, carbonic anhydrase and CA1 protein.

45 A protein banding pattern was observed consisting of samples from all batches (51-56) on both day 15 and day 21. Most of the protein was resolved at low molecular weights (approximately 67% <10 KDa), approximately 15% in 33 KDa and approximately 19% in molecular weights between 34 and 103 KDa. A picture of the SDS gel is shown in Figure 12.

image13

5.3. Nucleic acid content of the regeneration matrix.

The DNA was purified and quantified from the regeneration matrix (M) and compared with the starting material (O) for time points 0, 15, 21, as well as for the proteins. A measured amount of sample was lysed using SDS / proteinase lysis buffer K 2X (40 mM Tris-HCl [pH 8.0], 50 mM EDTA, 200 mM NaCl, 2% SDS and 6 µl of 5 stock solution of Proteinase K (20 mg / ml, Cat. No. 25530-049, Invitrogen) and incubated overnight at 50 ° C. The lysate was extracted with an equivalent volume of phenol-chloroform-isoamyl alcohol saturated with Tris-HCl (PCI, 25: 24: 1, pH 8.0), one drop of Phase Lock Gel ((PLG, Cat. No. 955 15 403-7, Eppendorf). Samples were centrifuged at 14,000 g for 10 min. at 4 ° C to separate the phases The aqueous phase was transferred to a new 2.0 ml microcentrifuge tube with PLG and the extraction and centrifugation were repeated.The aqueous phase was transferred to a new 2 microcentrifuge tube 2, 0 ml with PLG and extracted with an equivalent volume of chloroform and centrifuged at 12,000 xg for 10 minutes at 4 ° C. The aqueous phase was transferred to a clean 1.5 ml microcentrifuge tube and the AD N was precipitated by adding 0.7 volumes of isopropanol (Cat. No. 3032-06, Mallinckrodt) and 10 μg of glycogen (Cat. No. 10901393001, Roche) and allowed to stand at RT for 15 min. The samples were centrifuged for 20 minutes at 14,000 x g at 4 ° C. The sediments were washed 2X with 0.5 ml of 70% ethanol (Cat.

EX0289-1, EM Science), air dried and resuspended in 30 µl of TE buffer, pH 8.0. The DNA concentration was determined by spectrophotometric measurement (Spectra Max Plus, Model 384, Molecular Devices) of the optical density (OD) at 260 nm. The OD 260/280 ratio was also determined to indicate the level of protein contamination in DNA isolation. The total DNA content (μg) of the regeneration matrix on days 15 and 21 was compared with that of the starting material at time 0.

20 Table 2. Total DNA content of the regeneration matrix in the Opticell® cassette.

The production liquid was removed from the regeneration matrix and the regeneration matrix R was solubilized in SDS buffer and the total DNA content was determined. For each time point, samples of 4 Opticell® cassettes were taken and analyzed. The results from 4 independent batches of the regeneration matrix production are presented as the mean ± the standard deviation.

Time point (days)

DNA content (μg)

0

8 ± 18

fifteen

7.8 ± 2.0

twenty-one

6.6 ± 3.3

25

RNA was isolated from the regeneration matrix (M) and compared with that of the starting material (O) for time points 0, 15 and 21 using Trizol reagent (Cat. No. 15596-018, Invitrogen) . 1.0 ml of Trizol was added to a mass of predetermined quantity and allowed to stand at RT until it was solubilized (10-20 min). The samples were centrifuged at 12,000 x g for 10 minutes at 4 ° C and the aqueous layer was transferred to a new 1.5 ml microcentrifuge tube. The solution was extracted with 200 μl of chloroform (Cat. No. 4440-04, Mallinckrodt) and centrifuged at 12,000 x g for 20 minutes at 4 ° C. The aqueous phase was transferred to a new 1.5 ml microcentrifuge tube and the RNA was precipitated by adding 500 μl of isopropyl alcohol (Cat. No. 3032-06, Mallinckrodt) and centrifuging at 12,000 xg for 30 minutes at 4 ºC. The RNA pellet was washed in 75% ethanol, centrifuged at 7,500 x g for 5 minutes at 4 ° C, air dried and resuspended in 25 µl of water without RNAase by heating the

35 sample at 65 ° C for 15 min. RNA was quantified by OD at 260 nm using a spectrophotometer (Spectramax, Model 384, Molecular Devices). The total RNA content (μg) of the regeneration matrix on days 15 and 21 was compared with that of the starting material of the regeneration matrix at time 0.

Table 3. Total RNA content of the regeneration matrix in the Opticell® cassette.

The production liquid was removed from the regeneration matrix and the regeneration matrix was solubilized in buffer

40 SDS and the total RNA content was determined. For each time point, samples of 4 Opticell® cassettes were taken and analyzed. The results of 4 independent batches of the regeneration matrix production are presented as the mean ± the standard deviation.

Time point (days)

RNA content (μg)

0

1551 ± 1145

fifteen

184 ± 29

twenty-one

96 ± 43

image14

5.4. Lipid content of the regeneration matrix.

The total lipid content in the regeneration matrix (M) was compared with that of the starting material (O) for time points 0, 15 and 21 using the Bligh and Dyer procedure (Bligh, EG, and Dyer, WJ , A rapid method of total lipid extraction and purification, Can. J. Biochem. Physiol. 37, 911-917, 1959). Prior to analysis, samples 5 were stored frozen at -85 ° C and thawed at RT at the time of analysis. For the regeneration matrix, 375 µl of methanol: chloroform (2: 1 v / v) was added to the pre-weighed mixture and it was incubated at RT for 15 min in a vortex shaker (mini digital vortex shaker, Cat No. 14005-824, VWR) at medium speed). Then, 475 μl of methanol: chloroform: water mixture (Cat. No. IB05174, IBI Shelton) was added and incubated for 15 minutes at RT on a vortex shaker as indicated above. The samples were centrifuged at 10 250 x g for 10 minutes at RT. The liquid phase (both the chloroform phase and the water phase) was transferred to a clean 1.5 ml microcentrifuge tube leaving only the sediment of the regeneration matrix in the tube. The sediment of the regeneration matrix was resuspended in 475 μl of methanol: chloroform: water 2: 1: 0.8 mixture and extracted again by vortexing for 15 minutes at medium speed. 125 µl of chloroform was added and the samples were subjected to vortexing for 2 minutes, 125 µl of water was added and the mixtures were subjected to vortexing for another 2 minutes, and then centrifuged at 250 xg for 10 minutes at RT . The liquid phase was grouped with the sample from the original extraction and centrifuged at 1,000 x g for 10 minutes at RT. The chloroform phase was transferred to a clean 1.5 ml microcentrifuge tube and dried in a vacuum desiccator for 45 minutes or until the chloroform was completely evaporated. 50 µl of chloroform was added to the dry lipid sediment and the samples were vortexed for 15 min to completely solubilize the lipids. Samples were stored at -85 ° C until final analysis. A series of standard lipid dilutions (L4646, Sigma) were constructed and the samples were hydrolyzed by adding 10 µl of the lipid sample extracted to 500 µl of concentrated sulfuric acid (Cat. No. SX1244-6, EMD Chemicals) and bringing the tubes to a boil for 10 min. The samples were cooled in a water bath at RT for 2 min and 40 μl of sample was added to 600 μl of phosphorus-vanyl reagent (0.6 g of vanillin (Cat. No. VX0045-1, EM 25 Science ), 10 ml of 100% ethanol (Cat. No. EX0289-1, EM Science), 90 ml of H2Od and 400 ml of phosphoric acid (Cat. No. PX0995-6, EMD Chemicals), is mixed and incubated at RT with lightning protection for 45 min.The lipid concentration was determined by measuring the OD at 525 nm (Spectra Max 384, Molecular Devices) and interpolation with the standard curve using the SoftMax software provided with the spectrophotometer The total lipid content (μg) of the regeneration matrix on days 15 and 21 was compared with that of the material

30 heading at time 0.

Table 4. Total lipid content of the regeneration matrix in the Opticell® cassette.

The production liquid was removed from the regeneration matrix and the total lipid content of the regeneration matrix was determined as indicated above. For each time point, samples of 4 Opticell® cassettes were taken and analyzed. The results of 4 independent batches of matrix production of

35 regeneration are presented as the mean ± the standard deviation.

Time point (days)

Lipid content (μg)

0

1.9 ± 0.4

fifteen

0.02 ± 0.01

twenty-one

0.03 ± 0.01

The results of the analyzes for nucleic acids and lipids suggest that these materials are present in the starting material and that they degrade over time. The initial degradation rate seems to be variable with the high degree of variation in the amount of DNA and RNA detected in the starting material at zero time. This variability between different samples decreases over time on days 15 and 21. In no case was there a

Increase in any of these components, which provides additional evidence that no cellular activity is present.

Example 5.5. Radiolabelled substrate for the synthesis of protein and nucleic acids during the formation of the regeneration matrix.

To establish whether the formation of the regeneration matrix involves active basic cellular processes (synthesis of

45 DNA, RNA and proteins), the starting material of the regeneration matrix was incubated with tritiated substrates for the synthesis of DNA, RNA and proteins. Five Opticells® containing starting material with radioisotope-labeled substrates, an Opticell® for each substrate, were incubated. The substrates used were a mixture of 3H-Lamino acids (1 mCi / ml, Cat. 20063, MP Biomedicals), 3H-dTTP (10-20 Ci / mmol, Cat. No. 24044, MP Biomedical), 3H-Thymidine ( 60-90 Ci / mmol, Cat. No. 24060 MP Biomedicals), 3H-UTP (35-50 Ci / mmol, Cat. No. 24061, MP

50 Biomedicals) and 3H-Uridine (35-50 Ci / mmol, Cat. No. 24046, MP Biomedicals). For introduction into Opticell® cassettes, 25 μl of isotope was diluted in 0.5 ml of DMEM medium: F-12, then injected into each Opticell® and rotated to facilitate mixing. Immediately after injection and mixing, a 1.0 ml aliquot of Opticell® (total volume of 10 ml) was taken and processed for a zero time control (see below). The

image15

Opticell® were incubated at 37 ° C in an atmosphere of 5.0% CO2 in air. At times of 1, 3 and 7 days, 1.0 ml aliquots were taken for analysis. The samples were kept on ice in 1.5 ml microcentrifuge tubes and 100 μl (0.1 vol) of 100% trichloroacetic acid was added and the tubes were inverted to mix the contents. Samples were incubated on ice for 20 min to precipitate nucleic acids and proteins. 5 The precipitate was added to a GF / C filter (Whatman) in 0.1% TCA (ice-cold) using a Pasteur pipette. The contents of the microcentrifuge tube was added to the filter and clarified 5X using 0.1% ice-cold TCA. The filters were placed on aluminum foil and air dried for one hour. The filter was placed in 4 ml of Twinkling Cocktail (ScintiSafe, Fisher Scientific) and added to a 5 ml plastic scintillation vial. The vials were counted using a Beckman liquid scintillation counter in the tritium's energy channel during a

10 minute The results (counts per minute) of the TCA precipitable material are presented in the table shown below. As a positive control for the assay, cultured human fibroblasts were used.

Table 5. Total counts per minute for each of the radiolabeled substrates at time zero, 1 day, 3 days and one week after the initial sowing of the regeneration matrix formation material.

Protein

Weather

3H-TTP DNA 3H-Thymidine DNA 3H-UTP RNA 3H-Uridine RNA 3H mix-

AA

250,781

248,971 252,367 253,674 249,875

Total

Material of

planting of the

0 h 103 113 127 115 95

matrix of

1 day 236 277 356 387 499

regeneration

3 days 301 286 346 354 524

1 week

289 275 321 289 426

Fibroblasts

0 h 526 487 512 426 458

humans

1 day 14,643 12,473 27,943 25,784 69,285

These results indicate that there is no detectable cellular activity during the regeneration matrix formation process.

Example 5.6. Studies of metabolic inhibition.

In the first set of experiments (see Figures 13 and 14), to inhibit the activity of DNA polymerase, RNA polymerase II and protein synthesis, afidicoline (dissolved in DMSO, final concentration 10 μg / ml) ), α-amanitin (dissolved in water, final concentration 10 μg / ml) and cyclohexamide (dissolved in ethanol,

20 final concentration of 10 μg / ml), respectively, in the regeneration matrix produced from whole blood. The inhibitors were added on day 0 to the Opticell®, on the day of the first feeding (day 5 or 6). From there, the crops were fed with regular means. Samples from the respective treatments and controls were collected on day 21 and analyzed.

The results of these inhibition studies are presented in Figures 13-16. The fibroblast cultures of

25 controls containing 0, 10, 30 and 100 nM α-amanitin were grown for one week. Fibroblasts without added αamanitin were confluent on day 7. Cultures containing 10, 30 and 100 nM α-amanitin had a mortality of approximately 60-70%, 80-90% and 100% respectively on day 7.

In another set of experiments, the addition of apyrase (dissolved in water, final concentration 10 μg / ml), an ATPase / ADPase, indicated that it had the ability to partially prevent matrix formation in samples

30 filter of 5 μm. Apyrase has two functions: on the one hand it has ATPase / ADPase activity and, on the other, it has anticoagulant activity. It is possible that the components present in samples filtered by 5 μm are susceptible to the anticoagulant activity of apyrase resulting in the “sedimentation” observed in these cultures. The absence of "sedimentation" in the samples filtered by 1 μm is possibly due to the removal of these components retained by the small pore size of the filter.

35 Example 5.7. Fatty acid analysis.

Mass spectrometry analyzes were performed to determine the content of fatty acids in 3-week regeneration matrix cultures prepared from whole blood that had been filtered through a 5 μm or 1 μm filter. As can be seen in Table 6, several of the fatty acid species detected were absent in the supernatant and present exclusively in the matrix. The proportion of fatty acid per

40 mg of lipid was higher in the sample filtered by 1 μm compared to that filtered by 5 μm for the matrix. This ratio was reversed for the supernatant. Because the data presented is based on only one sample and one analysis, a conclusion could not be drawn at this stage.

image16

Table 6. Results of the analysis of fatty acids in the 3-week regeneration matrix (prepared from whole blood) and the supernatant by Folch partition, represented as μg / mg of lipid.

Structure

Name Matrix Supernatant

Filtered by 5 μ

Filtered by 1 μ 002S 003S

14: 0

Myristic acid 16.32 24.80 1.69 -

15: 0

Pentodecyclic acid 1.27 3.19 0.81 0.03

16: 0

Palmitic acid 29.33 82.65 7.82 0.44

16: 1

Palmitoleic acid 1.62 18.92 - -

17: 0

Margaric acid 1.64 2.38 0.56 0.29

18: 0

Stearic acid 15.24 44.00 1.76 -

18: 1

Oleic acid 15.21 38.38 4.75 0.69

18: 2

Α-linoleic acid 3.41 10.40 1.62 0.38

18: 3

Α-linolenic acid 1.44 - - 0.08

20: 0

Arachidic acid 0.5 1.34 - -

20: 1

Gadoleic acid 0.48 0.75 - -

20: 4

Arachidonic acid - 3.02 - -

21: 0

Heneicosanoid acid - 0.17 - -

22: 0

Behenic Acid 0.81 2.10 - -

22: 6

Nisinic Acid 1.79 2.49 - -

23: 0

Tricosanoic acid 0.31 0.84 0.58 -

24: 0

Tetracosanoic acid 1.76 5.14 - -

24: 1

Nerve acid 1.20 3.76 - -

Total fatty acids in the sample

92.13 μg / mg 244.33 μg / mg 19.59 μg / mg 1.92 μg / mg

Example 5.8. Osmolarity

5 The osmolarity of frozen samples from supernatants from two different cultures was analyzed for different periods of time. It is obvious from Table 7 shown below that there is a dramatic increase in osmolarity as the crops age.

Table 7. Osmolarity measurements of the regeneration matrix cultures.

Weather ID 14 days 21 days 28 days 42 days 56 days

Sample 0

1 314-420 437 532 528

2 311 406 440 -----

10 Example 5.9. Analysis of the regeneration matrix for metabolic activity directed by ATP.

The levels of adenosine triphosphate (ATP) of the regeneration matrix and the associated production liquid were tested at 2, 3, 4, 6 and 8 weeks and these levels were compared with the levels of ATP in the starting material. The ENLITEN ATP test system was used for the rapid and quantitative detection of ATP by luminescence. The material was extracted with SDS and precipitated with TCA, as suggested by the manufacturer. In addition, the presence of several metabolic enzymes in the same samples was examined using Western blotting. For the ATP level, the detection reactions were performed in triplicate and tested on three different days. The starting material of three batches of regeneration matrix contained picomolar amounts (1x10-12 mol) of ATP, while ATP became undetectable on day six of culture and remained undetectable during all

image17

subsequent crop time points.

The presence of the metabolic enzymes glucose-6-phosphate dehydrogenase, aldolase, pyruvate dehydrogenase and cytochrome reductase was evaluated using Western blotting. Aldolase, an enzyme that catalyzes the degradation of glucose through glycolysis, was present in the starting material and was detected at decreasing levels between days 21 and 28 days of incubation and was not detectable at 60 days. Glucose-6 phosphate dehydrogenase (route of pentose phosphate) was detected in the starting material and was detected over time predominantly in the production liquid associated with the regeneration matrix. The levels in the regeneration matrix fell towards day 28 and remained low during the rest of the crop. However, the band in the gel for this enzyme was of a lower molecular weight, which suggested that only a degraded form was detected. Pyruvate dehydrogenase (Krebs cycle) was detectable in the starting material at levels that did not seem to change until day 28. Again, the band had a lower molecular weight than predicted, which suggested that a product was being detected. degradation. This enzyme could not be detected at any later time points. Cytochrome reductase (oxidative phosphorylation) was detected in the starting material and a faster migration protein (absent in the starting material) was recognized at all time points

15 later, which suggested that a degradation product was being detected in the regeneration matrix.

The absence of detectable levels of ATP in the regeneration matrix already at 6 days after initial sowing supports the conclusion that these enzymes are not functional. Both pyruvate dehydrogenase and cytochrome reductase catalyze reactions that produce massive amounts of ATP (36 ATP per reaction).

Example 5.10. Other analyzes

20 The compositional analysis of the matrix indicates that there is no evidence of cellular metabolic activity in the regeneration matrix. The pH of the culture medium remains constant throughout the entire culture, thus indicating a very low or zero metabolic activity. In addition, the osmolarity of the culture medium increases dramatically during the period of culture making the conditions not permissive for cell growth.

A comparison of Coomasie-stained SDS-PAGE gels revealed small differences in the patterns of

25 bands between the samples filtered by 5 μm and 1 μm. The images of the gels are presented in Figure 17. The blue band designations represent bands that were previously identified by mass spectrometry. The new bands indicated by the red circle (M7 and M8) are bands that have only been observed in the matrix filtered by 1 μm. The appearance of these bands may be due to the enrichment of certain bands resulting from the elimination of other proteins.

30 The sensitivity of the regeneration matrix to different proteases and nucleases was analyzed. Nucleases such as DNase and RNase had no effect on the regeneration matrix. Proteolytic enzymes such as pepsin, trypsin, papain and proteinase K had the ability to digest the matrix.

Example 6. Activation of neurotrophic genes in vitro using the regeneration matrix

Human neuroblastoma cells were used (Cell Line SH-SY5Y, Cat. No. CRL-2266, Collection

35 American Type Culture, Manassas, VA) to characterize the neurotrophic activity of the regeneration matrix. Cells were cultured using the following basal medium (MB): DMEM: F12 (Cat. No. 30-2006, ATCC) supplemented with 10% SFT (Cat. No. 26140-079, Invitrogen) and antibiotic Gentamicin 5 μg / ml (Cat. No. 15710064, Invitrogen) and were routinely amplified and maintained by passing in the confluence using T125 tissue culture flasks.

For the analysis of gene induction, the cells were trypsinized and seeded in T75 flasks at 105 cells / ml, 3 days before the addition of the starting material. The materials analyzed were basal medium (MB), matrix medium (R), OptiCell® starting material (O) and regeneration matrix (M). To inactivate the liquid test material, the OptiCell® (O) starting material was placed in 15 ml conical polystyrene culture tubes and heated at 60 ° C for 30 min. To inactivate the regeneration matrix, the liquid associated with the matrix of

The regeneration was removed from the OptiCell® and the regeneration matrix was washed three times (with 10 ml each time) with PBS (Cat. No. 21-030-CM, Mediatech). 10 ml of formalin (3.7% formaldehyde, Cat. No. 2106-01, JT Baker in PBS) was added to the OptiCell® containing the regeneration matrix and incubated for 30 minutes. The regeneration matrix was washed 3X with PBS and stored in PBS until it was collected for experiments.

For the regeneration matrix treatments (active or fixed), the complete contents of the OptiCell® are

50 added to a T75 culture flask containing 70% confluent SH-SY5Y neuroblastoma cells. After 3 hours, the cells were washed with PBS and collected by scraping the cells and pipetting into a 2.0 ml centrifuge tube. The cells were centrifuged at 12,000 RPM and the supernatant discarded. Total cellular RNA was isolated using a Total Atlas RNA Isolation kit (Cat. No. K1036-1, BD Biosciences, formerly Clontech) according to the manufacturer's instructions. RNA sediments are

55 dissolved in H2O without RNase and was quantified by OD260. RT-PCR was performed using an Ambion Retroscript Kit (Cat. No. 1710, Ambion, Austin, TX) according to the manufacturer's instructions using 2 μg of RNA template. Primers specific for human glyceraldehyde-3-phosphate dehydrogenase (GAPDH), growth-associated protein 43 (GAP-43), netrin-1, neural cell adhesion molecule (NCAM-1), were used for RT-PCR neurotrophin-3 (NT-3), neurotrophin-6 (NT-6), glia neurotrophic factor (GDNF) and fibroblast growth factor-9 (FGF-9). GAPDH was used as a control because its transcription should not be affected by the type of stimulation used in this trial. The primers used were the following:

image18

GAPDH 5 ’CCTGCACCACCAACTGCTTAG 5’ AGACCACCTGGTGCTCAGTGT

GAP-43 5 ’AAAGTGCCCGGCAGGACGAGGGTAAAGA 5’ GAAAGTGGACTCCACAGGGCCACACG

NT-3 5 ’AAGGAGTTTGCCAGAAGACTCGCTCAATTCC 5’ CACGTAATCCTCCATGAGATACAAGGGCGG

NT-6 5 ’CCCGGACCGCTGTGGACTTGGTTG 5’ GTATAAGTCTCAGGCCCGGCCAGTC

Netrina-1 5 ’GCAGTCTGCCACTTGGAAGGA 5’ GCCATATTGCGTAGGCGAGGT

NCAM 5 ’CACAGCCATCCCAGCAACCTTGGG 5’ GGGCAAACTCCTTATGAAGTGGCACAAA

GDNF 5 ’AAATGTCACTGACTTGGGTCTGGG 5’ GACAGGTCATCATCAAAGGCGATGGG

FGF-9 5 ’CGCCTAATATCTCCTGGGTTGACACC 5’ AATGCCAAATCGGCTGTGGTCTTTCC

5 For PCR, 5 μl of the RT reaction product was added to 45 μl of the PCR reaction cocktail (5 μl of 10X PCR buffer, 100 mM Tris-HCl, pH 8.3, 500 mM KCl, MgCl2 15 mM, 2.5 μl of mixture of DNTP 2.5 mM, 32.1 μl of H2Od (without nucleases), 2.5 μl of each of the stock solutions of the 10 μM sense and antisense primers and 0.4 μl of Taq Polymerase 5 U / μl (Cat. No. 2052, Ambion) The PCR parameters were: 94 ° C for 2 min (initial denaturation), followed by 30 cycles of 94 ° C for 30 sec, 55 ° C for 30 sec and 72 ° C

10 for 40 sec, with a final cleaning stage of 72 ºC for 5 min. The PCR products were resolved using 10 µl of PCR product per well, in 2.5% agarose gels processed for 2 hours at 58 V and stained with 0.5 µg / ml ethidium bromide. Positive regulation was analyzed at times in the digital images of the gels using the Scion image analysis software (Scion, Frederick, MD). The lane band intensity containing RT-PCT product of the RNA produced from the addition medium was only used

15 to normalize the signals of the other treatments (data not shown).

RT-PCR analyzes showed that the genes of FGF-9, Netrina-1, NT-3, NCAM-1 and GAP-43 are activated in response to incubation with the regeneration matrix. Gene activation by the regeneration matrix appears to be selective since the transcription of the GAPDH, NT-6 and GDNF genes was not stimulated in these experiments. These data indicate that the SH-SY5Y human neuroblastoma cell line responds in a way

20 selective to the regeneration matrix with the activation of genes related to function and differentiation. The production medium supplemented with growth factors only provided a marginal increase in the activity of positive gene regulation compared to the medium only for FGF-9 and Netrina-1 only. These results suggest that the gene positive regulation activity of the regeneration matrix is due to its inherent properties and not just the presence of growth factors.

The activation of the gene expression of NT-3, NCAM-1, Netrina-1, GAP-43 and FGF-9 by the regeneration matrix in SH-SY5Y cells can be inactivated by treating the matrix at 60 ° C for 30 minutes (Figure 19). Finally, the treatment of the regeneration matrix with formalin or with high-energy gamma irradiation (30 kGy, 30 min) also inactivates the regeneration matrix (data not shown).

For the routine analysis, the effect of the regeneration matrix on the positive regulation of the

30 GAPDH (control), GAP-43, NCAM-1 and NT-3 for four consecutive production batches. Samples of a regeneration matrix were taken from each batch on day 15 and 21 and compared with the gene induction activity of the starting material (Table 8). By means of RT-PCR, the positive regulation was determined at times of 4 production runs (2 Opticell® cassettes per time point). The results are presented as the mean ± the standard deviation.

image19

Table 8. Positive regulation on average times of GAPDH, NT-3, NCAM-1 and GAP-43 in SH-SY5Y neuroblastoma cells after incubation with the regeneration matrix on days 0 (starting material), 15 and 21 production

Time (days)

GAPDH NT-3 NCAM-1 GAP-43

0

1.1 ± 0.1 2.5 ± 0.2 2.9 ± 0.3 3.0 ± 0.3

fifteen

0.9 ± 0.1 3.9 ± 1.1 4.4 ± 1.7 4.7 ± 1.8

twenty-one

1.0 ± 0.2 4.5 ± 1.9 4.7 ± 2.2 5.6 ± 3.0

5 Example 6.1. Effect of the regeneration matrix produced without complements of growth factors on gene induction in human neuroblastoma cells.

A regeneration matrix was produced using DMEM: F12 medium alone without any growth factor complementation. The positive regulation response of genes in SH-SY5Y neuroblastoma cells for GAPDH, NT3, NCAM-1 and GAP-43 was compared with a regeneration matrix produced with ITS complementation (2X),

10 EGF (20 ng / ml) and bFGF (40 ng / ml). The regeneration matrix produced without growth factors contains a positive gene regulation activity that is not appreciably modified when it is produced in production medium with growth factor complements (data not shown).

Example 6.2. Activity of the positive regulation of neuronal genes of the regeneration matrix.

The regeneration matrix formed during 12 days has activity of positive regulation of neuronal genes,

15 while its surrounding solution (SC), as well as the initial solution (day 0) that would form the regeneration matrix (Rep), have a limited activity of positive regulation of neuronal genes. Figures 18A-18C show RT-PCR results on SHSY human neuroblastoma cells treated with regeneration matrix for 3 hours. Values presented as positive regulation at times above conventional control. The regeneration matrices were produced in parallel from whole uncoagulated blood (treated with EDTA) from

20 from the same human donor. A = DMEM / F12 base medium with complements (a conventional regeneration matrix production medium). STI = insulin complement + transferrin + selenium added to DMEM / F12 base media. EGF = complement of epidermal growth factor added to DMEM / F12 base media. FGF = complement of fibroblast growth factor 2 added to DMEM / F12 base media. All = ITS + EGF + FGF complements added to DMEM / F12 base media. None = no add-ons added

25 to DMEM / F12 base media. No food = no additional means were added after the start of the regeneration matrix formation period (day 0).

The A-S columns in Figures 18A-18C refer to the following regeneration matrices:

A = Medium regeneration matrix production medium; B = Day-12, All, RM-1;

30 C = Day-12, All, SC-1; D = Day-12, STI, RM-1; E = Day-12, STI, SC-1; F = Day-12, EGF-STI, RM-1; G = Day-12, EGF-ITS, SC-1;

35 H = Day-12, FGF-ITS, RM-1; I = Day-12, FGF-ITS, SC-1; J = Day-12, None, RM-1; K = Day-12, None, SC-1; L = Day-12, Without Food, RM-1;

40 M = Day-12, Without Food, SC-1; N = Day-0, EGF-ITS, Rep-1; O = Day-0, EGF-ITS, Rep-2; P = Day-0, FGF-ITS, Rep-1; Q = Day-0, FGF-ITS, Rep-2;

45 R = Day-0, None, Rep-1; S = Day-0, None, Rep-2.

As can be seen in Figures 18A-18C, in all cases, the regeneration matrix on day 21 presented an increased activity of positive regulation of neuronal genes compared to its initial solution (day 0). The surrounding solution on day 21 continues to exhibit the same limited activity that was observed in the initial solution (day 0). Therefore, only the regeneration matrix formed showed increased activity, and its formation did not result in a diminished activity of its surrounding solution. Therefore, the activity of positive regulation of total neuronal genes of the cultures increased dramatically over time as

image20

formed the regeneration matrices.

Example 7. Effect of the regeneration matrix on rat Neuroscreen-1® cells (induction of neurite extensions).

Neuroscreen® cells, an enhanced subclone from rat PC-12 pheochromocytoma cells (Tsuji, 5 M. et al., Induction of neurite outgrowth in PC12 cells by alpha-phenyl-N-tert-butylnitron through activation of protein kinase C and the Ras-extracellular signal-regulated kinase pathway, J. Biol. Chem. 276, 32779-32785, 2001; Wu, Y.

Y. and Bradshaw, RA, Synergistic induction of neurite outgrowth by nerve growth factor or epidermal growth factor and interleukin-6 in PC12 cells, J Biol Chem 271,13033-13039, 1996), were obtained from Cellomics (Cat. R040001-C1) and incubated with a regeneration matrix. Neuroscreen® cells responded by

10 extension of neurites. In addition, the morphology of the Neuroscreen® cells changed and flattened and became more elongated in the presence of the regeneration matrix (Figure 20).

For Neuroscreen®-regeneration matrix cell interaction studies, the cells and the regeneration matrix sample material were prepared using the following procedure. Neuroscreen® cells were maintained before the interaction assay by routine culture in collagen coated plastic and subcultured at the confluence using basal medium consisting of RPMI (Cat. No. 10-040-CV, Mediatech), 4.0 mM Glutamine (Cat. No. 25-005-CI, Mediatech) supplemented with 20% horse serum (Cat. No. 35030-CV, Mediatech) and 10% bovine fetal serum (n .º of Cat. 35-010, Mediatech). The regeneration matrix interactions were established the day before, the cells were trypsinized, 2,000 cells were counted and cultured per well in 96-well cell culture plates (BD Biosciences, Cat. No. 47743-953, Axygen ). The cassettes of

20 Opticell® containing the regeneration matrix were opened and the regeneration matrix was transferred to a 100 μm nylon cell strainer (Cat. No. 352360, BD Falcon), screened and dispersed in 1 ml of PBS (Cat. No. MT21-030-CM, Mediatech). 10 µl of dispersed regeneration matrix suspension was added to each well containing Neuroscreen® cells seeded the previous day.

For each production batch, samples were taken for analyzes prior to 0, 15 and 21 days after

25 start. The extension formation of neurite processes in Neuroscreen® cells was tested using immunostaining for β-tubulin as indicated below. The cells were fixed after 4 days in culture by adding 10% v / v of 37% formaldehyde (Cat. No. 2106-01, J. T. Baker) directly to the culture medium in the well. The plates were incubated at 37 ° C for 30 min, washed 2X with PBS, permeabilized and blocked with blocking buffer (10% normal goat serum Cat. No. S26-100M, Chemicon, 5% BSA

30 Cat. No. 2910, Omnipure, 0.1% Saponin Cat. No. 102855, MP-Biochemicals) for 2.5 hours and were stained for 16 hours at 4 ° C using anti-β-tubulin antibody ( Mouse monoclonal, cell culture supernatant, Cat. No. E7, Developmental Studies Hybridoma Bank) diluted 1: 100 in blocking buffer. The cells were washed 2X in PBS and labeled with Cabra alexa 488 secondary mouse anti-mouse antibody (Cat. No. A11029, Invitrogen) diluted 1: 200 in blocking buffer. The cells were counterstained with Hoechst 33342 (Cat. No. H1399, Invitrogen)

35 to 2 μg / ml in PBS for 30 minutes and then washed 1X with PBS. The plates were scanned with a KineticScan microscope (Cellomics, V2.2.0.0 Build 19) using the Bio-application V2.0 for neurite extension.

Selected performance parameters include, total cells, neurite extension index (ESI), which is the percentage of cells in a well with a total neurite length above 10 μm, and the neurite length

40 average per cell (LNP) in μm.

The positive control for this assay was the addition of nerve growth factor (FCN, Cat. No. 13257-019, Invitrogen) at 100 ng / ml. In summary, the treatments used were as follows, each with and without FCN: regeneration matrix, Basal Neuroscreen Medium, Basal Neuroscreen Medium + FCN 100 ng / ml, regeneration matrix prepared without growth factors.

45 Only the wells with cell counts above 100 cells per field were analyzed. The average IEN per well was divided by the average IEN value of the positive control wells containing Neuroscreen® basal medium plus FCN 100 ng / ml. This value is presented as the percentage of response of FCN. Data from 4 independent experiments that test the stimulation of Neuroscreen® cell neurite extension are shown in Figure 21. The stimulation of neurite extension by the matrix of

50 regeneration without growth factor complements compared to that observed with them is shown in Figure 22.

These results indicate that the regeneration matrix has significant neurite induction activity when tested on Neuroscreen® cells. However, unlike the results from studies of positive gene regulation with neuroblastoma cells, the neurite extension activity of the

The regeneration matrix can be significantly increased by the addition of the ITS, EGF and bFGF complements during the production of the regeneration matrix.

image21

Example 8. Protection and enhancement of the activity of growth factors through the regeneration matrix.

Human peripheral blood collected in ten 8 ml Vacutainer ™ tubes containing K2EDTA was sent overnight on ice and then placed vertically in a freezer at +4 ° C for 6 hours to allow the blood to separate by gravity . Vacutainer ™ tubes containing gravity-separated blood were carefully placed vertically in a freezer at -20 ° C for storage. Two days later, four of the tubes were removed from the freezer, placed vertically on a rack and allowed to defrost at 20 ° C. Once thawed, the plasma-platelet-leukocyte fraction of two of the tubes was removed and placed in a 50 ml conical tube, and the total contents of the remaining two tubes were placed in another 10 50 ml conical tube. After thoroughly mixing the contents of each conical tube, 5 ml of each conical tube were placed in different 50 ml conical tubes together with 10 ml of TR-10 medium containing 100 ng / ml nerve growth factor (FCN) . The composition of the TR-10 medium is shown in Table 9. After thoroughly mixing the contents of each conical tube, the solutions were filtered through a 5 μm syringe filter, followed by a 1 syringe filter. , 2 μm, and then put in new 50 ml conical tubes. Enough amount of TR-10 medium containing 100 ng / ml FCN was added to make the content of each conical tube equal to 50 ml. After thoroughly mixing the contents of each conical tube, 10 ml amounts of the solutions were injected into separate sets of 5 Opticells ™, and then placed horizontally in a 37 ° C incubator, 20% CO2, O2 at 2%, not humidified. Therefore, each Opticell ™ received 1 μg of FCN. The samples were left untouched for 6 days, after which 3 ml of 20 TR-10 medium was added to each Opticell ™. An additional 1 ml of TR-10 medium was added to each Opticell ™ on days 8, 10 and 12. On day 13, the content of each Opticell ™ was placed in different 15 ml conical tubes and centrifuged at 500 x g. The supernatant was removed and stored for further analysis. The content of each 15 ml conical tube was then washed with PBS, centrifuged at 500 x g and the supernatant removed and discarded. This was repeated two more times to remove all of the original solution that was surrounded by each of the Regeneration Matrices (when

25 were in the Opticells ™). Each Regeneration Matrix (~ 1 g by mass and ~ 1 ml by volume) was then stored for further analysis. Each Regeneration Matrix contained approximately 5 mg of protein. The hydration level of the regeneration matrices could be almost half when centrifuged at 5,000 x g for 30 min (and the resulting liquid supernatant was removed).

Table 9. Composition of TR-10.

INORGANIC SALTS

mg / l AMINO ACIDS mg / l

Anhydrous calcium chloride

255.49 L-Alanina 4,455

9H2O ferric nitrate

0.404 Glycine 15,014

6H2O magnesium chloride

142.31 L-Arginine HCl 147,251

Anhydrous magnesium sulfate

97.67 L-Asparagine H2O 1,501

Potassium chloride

400 GlutaMAX ™ I 217.23

Potassium chloride

1491 L-Histidine HCl H2O 31,445

Baking soda

1280.1 L-Isoleucine 54,567

Sodium chloride

6800 L-Leucine 59,158

7H2O dibasic sodium phosphate

134,035 L-Lysine HCl 91,142

Monobasic Sodium Phosphate

140 L-Methionine 17,308

H2O Monobasic Sodium Phosphate

62,509 L-Phenylalanine 35,516

Zinc Sulfate 7H2O

0.14378 L-Proline 5,757

L-Serine

26,273

OTHER COMPONENTS

mg / l L-Threonine 53,485

D-Galactose

360.32 L-Tryptophan 9,027

D-Glucose (Dextrose)

4154,602 L-Valine 52,952

Tocopherol acetate DL

4.7273 L-Tyrosine disodium salt 55,895

Thioctic DL-Lipoic Acid

2,0632 L-Cysteine HCl H2O 0.87815

image22

(continuation)

OTHER COMPONENTS

mg / l AMINO ACIDS mg / l

Ethanolamine HCl

4 L-Cystine 2HCl 1,567

Glutathione (reduced)

153,665

Holo human transferrin

eleven VITAMINS mg / l

Complete recombinant insulin (Recombulin)

twenty Biotin 0,24431

Linoleic acid

5,6088 Pyridoxine HCl 0,030846

Linolenic acid

2.7842 Folic acid 2207

MOPS

2092.7 Riboflavin 18,819

Putrescina 2HCl

32,216 B12 vitamin 67,769

Sodium hypoxanthine

2.37165 L-Carnitine 3.96

Sodium pyruvate

55.02 Choline chloride 139.62

Sodium selenite

0.0134 i-Inositol 12,611

Thymidine

0,365767 Niacinamide 6,107

Calcium D-Pantothenate

23,827

Pyridoxal HCl

10,181

Thiamine HCl

16,864

Ascorbic acid 2 Fos. mg

28,954

Two weeks later, the Neuroscreen® assays were prepared as described in Example 9. The nerve growth factor response curves (FCN) were created (see Figure 23). Since each well in the 96-well plate of the Neuroscreen® assay receives 200 μl of solution, the wells with a concentration of

5 FCN of 100 ng / ml received a total of 20 ng of FCN.

Since previous studies had shown that the addition of 10 mg of regeneration matrix doubled the average length of neurites (of neurites above 10 μm in length) of Neuroscreen® cells exposed to FCN 100 ng / ml (see Table 10), an experiment was conducted to determine the effect of the addition of FCN to the initial matrix solution in this assay.

10 Table 10. Average neurite length of NeuroscreenTM cells exposed to RMx and FCN 100 ng / ml. Values are expressed as the percentage of the positive control (FCN 100 ng / ml).

Lot Days RMx Des. Tip

51 6 170% 46% 12 159% 21% 15ND NA 18ND NA 21 176% NA

52

6 147% 23%

12 184% 26%

15 299% NA

18ND NA

21 244% 64%

53

6 266% 5%

15 242% 31%

18 169% 28%

21 186% 20%

image23

(continuation)

Lot Days RMx Des. Tip

54

6 148% NA

12 211% 36%

15 212% 44%

18 223% 26%

21 263% 25%

55 12 245% 87% 15 222% 30%

56

6 163% 25%

12 267% 72%

15ND NA

21 225% 49%

57 12 192% 33% 21 221% 36%

58 12 192% 65% 15 214% 28% 21 184% 39%

Average 209% 40%

ND Undetermined. NA. Not applicable (either by ND or a single data point)

Three of the five regeneration matrices and their corresponding solutions (stored supernatants) from each group were used to determine the response curves (see below) in the 5 Neuroscreen® test. Very similar results were obtained from the doubling of the average length of neurites (from neurites longer than 10 μm in length) from Neuroscreen® cells when the Neuroscreen® cells were exposed to the regeneration matrix containing FCN (see below) ). However, this doubling effect was obtained only with 0.2 mg of the regeneration matrix obtained from whole blood, and 0.03 mg of the regeneration matrix obtained from the plasma-platelet-leukocyte fraction (without the erythrocyte fraction, see 10 Figure 24). If the FCN added to the initial matrix solution was dispersed equally between the forming regeneration matrix and the surrounding solution, the total amount of regeneration matrix added to the Neuroscreen® test wells contained only 0.02 ng and 0.003 ng of FCN for regeneration matrices obtained from whole blood and plasma-platelet-leukocyte fraction, respectively. If all the FCN ended up in the regeneration matrices, then the total amount of FCN per well would be 0.2 ng and 15 0.03 ng, respectively. However, conventional FCN response curves (which were performed in parallel to these experiments with the same FCN and the same time point (freshness of the FCN) show that there is a limited effect, or not at all, of the FCN freshly prepared on Neuroscreen® cells in quantities less than 10 ng per well, and maximum responses occur at 100 ng of FCN per well, since the regeneration matrix obtained from the plasma-platelet-leukocyte fraction provides 20 doubling this maximum response to an amount of three-thousandth to thirty-thousandth (or less) of the amount (or concentration) of FCN, the regeneration matrix must have a sensitization effect of growth factor (or similar) on Neuroscreen cells ® together with the stimulation of other neurite growth pathways since the average neurite length doubled above the maximum threshold value that can be achieved. Assist with FCN alone It has been determined that the regeneration matrix alone (without any FCN) results in

25 an average neurite length of Neuroscreen® cells of approximately 60% of the positive control (100 ng / ml of FCN).

It is interesting to note that the supernatant (or solution that surrounds the regeneration matrix in each Opticell® at the end of the 13-day regeneration matrix formation period) also caused a doubling of the maximum response of Neuroscreen® cells to the FCN. If the FCN added to the initial matrix solution was dispersed in an equivalent manner between the forming regeneration matrix and the surrounding solution (supernatant), the doubling effect (or maximum response) occurs only with 5 ng of FCN per well. , or a twenty-part of the amount of FCN (or concentration) necessary for the maximum conventional response (which is only half of the response obtained with the supernatant). Therefore, effects similar to those of the regeneration matrix are observed in the supernatant, although with a lower potency. This seems to be due to the properties that exist and are

During the process, they also form the formation of the regeneration matrix, as well as tiny particles of the regeneration matrix that had not yet been added in the regeneration matrix complexes.

image24

In addition, since the activity of the FCN decreases over time at 37 ° C, the regeneration matrix also appears to have protective effects of growth factor activity. The FCN activity test on the 13-day regeneration matrix that had been stored at 4 ° C for an additional two weeks, shows a much higher FCN activity than the freshly prepared FCN from the same batch. These were observed

5 same effects with EGF, bFGF and BDNF in previous experiments.

Example 9. Dose response in the regeneration matrix prepared with DMEM / F12 base media and TR-10 base media.

Table 11 shows a comparison of the dose response for neurite extensibility (assays prepared as in Example 7) of regeneration matrices prepared with DMEM / f12 base media or with

10 TR-10 base media. Values are expressed as the percentage of the positive control (FCN).

Table 11

RMX (mg) DMEM / F12 Desv. Tip TR-10 Def. Tip

0 23% 5% 24% 2%

1 60% 6% 67% 11% 5 77% 5% 103% 5% 10 88% 5% 101% 5%

Example 10. Effect of the regeneration matrix on cultures of primary cells from rat fetal spinal cord.

15 Spinal cords were obtained from adults and fetuses from healthy rats (E18). The neuronal cell culture protocol used was adapted from Brewer et al. (Serum-free B27 / neurobasal medium supports differentiated growth of neurons from the striatum substantia nigra, septum, cerebral cortex, cerebellum, and dentate gyrus, J. Neurosci. Res. 42, 674-683, 1995). The spinal cords were quickly dissected from the animals in 2 ml of Hibernate-A (Brainbits, Springfield, IL), supplemented with B27 (Cat. No. 17504-044, Invitrogen) and L-glutamine

20 0.5 mm (Cat. No. 25-005-CI, Mediatech) at 4 ° C in 35 mm petri dishes. The meninges and excess white matter in the same medium were removed to a second plate at 4 ° C. The spinal cords were transferred to a sterile paper pre-moistened with the same medium and cuts of approximately 0.5 mm thick perpendicular to the longitudinal axis of the spinal cord were prepared and transferred to a tube at 4 ° C in the same medium. After stirring for 8 minutes at 30 ° C, the cuts were transferred, with a large gauge pipette, to another

25 tube at 30 ° C containing papain. Papain (15-23 units / mg of protein, and not activated by cysteine) was prepared by dissolving 12 mg in 6 ml of Hibernate A, heated for 5 min at 37 ° C. The solution was sterilized by filter and stored at 4 ° C. The cuts were incubated for 30 min in a 30 ° C water bath, with a rotating platform at a speed sufficient to suspend the cuts (170 rpm). The cuts were transferred to a 15 ml conical tube containing 2 ml of Hibernate-A / B27 at 30 ° C and allowed to settle for 5 min at RT. The

30 cuts were crushed 10 times (in approximately 30 seconds) with a siliconized pasteur pipette (fire polished tip). These pieces were allowed to deposit for 2 min and the supernatant was transferred to another tube. The sediment from the first tube was resuspended in 2 ml of Hibernate A / B27 and the crushing and deposition procedure was repeated two more times. Supernatants from each crushing were combined, providing a suspension of 6 ml.

35 The cells were plated at 90-320 / mm2 in 60-150 μl of Neurobasal-A / B27, in autoclaved glass previously coated with 50 μg / ml lysine-arginine copolymer (LAS, BrainBits) and distributed in a 100 mm plate. One hour after plating and incubation (5.0% O2, 5.0% CO2, rest of N2) the coverslip was quickly lifted, allowed to drain and transferred to 0.4 ml of Neurobasal -A / B27 in a 24-well plate at 37 ° C. The medium was aspirated, the coverslip was rinsed once with warm Hibernate-A and the cells

40 were fed back with Neurobasal-A / B27, 0.5 mM glutamine, 10 μg / ml gentamicin and 5 ng / ml bFGF. The cells were fed on day 4 by removing half of the medium and replacing it with an equivalent volume of fresh medium containing 5 ng / ml of bFGF. Neural cells were allowed to bind and proliferate for 6 days after they were used for interaction experiments. They seemed healthy, proliferated continuously and were between 40-60% confluence at the time of the onset of interactions.

45 Three different batches of matrix were evaluated on days 16, 9 and 7, respectively. All three batches were obtained from uncoagulated blood collected using EDTA as an anticoagulant. Two of the lots contained glucose, glutamine and pyruvate, while the other lot did not. Suspensions of single cells from spinal cord of complete embryonic rat (E18) were prepared according to the above protocol. Monolayers of cells were grown on glass coverslips and incubated with matrix or with control medium. On day 7

50 after the start of the interaction culture, the coverslips for ICQ were processed. Primary control spinal cord cells without matrix were used as a positive control for the functionality of the culture system.

image25

Figures 25 and 26 show the micrographs that present the results of the immunocytochemical analysis. The controls gave a positive staining for mature neurons and all of them gave a negative staining for glial cells (Figure 25). In control cultures, the number of positive cells for Tuj1 is 4.2%, GFAP positive cells are 0.4%. No cells were detected that stained with Tuj 1 and were positive

5 for GFAP.

Neural cells incubated with matrix had a lower percentage of prominent and long axons; however, the percentage of positive cells for Tuj1 within the culture increased to 55% with the regeneration matrix (with the majority of staining confined to cell bodies and short processes) compared to 4.2% without regeneration matrix. The percentage of GFAP positive cells within the culture increased to 92% with the

10 regeneration matrix compared to only 0.4% for controls. In the culture treated with the regeneration matrix, approximately 50% of the cells were positive for both Tuj 1 and GFAP, indicating that they were three-phase neuroprogenitor cells, while no control cells were observed in the control.

This observation indicates that the regeneration matrix stimulates the proliferation of new young neurons. The increase in the presence of astrocytes during the same period of time may represent a phenomenon of

Tissue neurogenesis and / or an initial "injury" response, a stage necessary for and preceding a healing cascade.

As seen in Figure 26, the cells treated with the regeneration matrix contained cells that were positive for both Tuj1 and GFAP, indicating that they were three-phase neuroprogenitor cells, while the control culture showed no such cells.

20 Example 11. Effect of the regeneration matrix on human fibroblasts in vitro.

Human neonatal foreskin fibroblasts were maintained (Cell line No. CCD 1079 Sk, Cat. No. CRL 2097, ATCC), prior to the interaction assay by routine culture and pass at confluence using basal fibroblast medium (DMEM with 10% SFB and pen-estrep). The cells were trypsinized and plated on an empty Opticell® membrane (Opticell®) or membrane

25 Opticell® with attached regeneration matrix formed using coagulated blood (Regeneration Matrix). The membranes were cut to 1 cm2. The membranes had previously been attached to the bottom of a 6-well plate using a small piece of sterile petrolatum. The petroleum jelly point was placed at the bottom of the well before adding medium and the medium was added later and the membranes were placed at the end by pressing in the center from the top. Each well contained 2 Opticell® and 2 regeneration matrix treatments. The

30 trypsinized cells from a confluent plate were counted and plated at a density of 20,000 cells per well in 3 ml of medium. The plates were placed in an incubator and, after 2 hours, some representative samples were fixed and their nuclei stained and the amounts of cells were estimated. The rest of the membranes were not altered for an additional 2 days. BrdU (Cat # 203806, EMD Biosciences) was added up to 20 μM in culture medium diluting a 10 mM stock solution. After the incubation period, the

35 membranes were immersed in 1 ml of 70% ice-cold ethanol (Cat. UN1170, EM Science) in 15 mM glycine (Cat. No. G-8790, Sigma) in a 24-well plate. The fixed cells were stored at -20 ° C for at least 24 h. For BrdU detection, the cells were washed once in PBS (Cat. No. MT21-030-CM, Mediatech), treated with a 1:10 dilution of the anti-BrdU-nuclease reagent monoclonal antibody for KitII ( No. Cat. 1299964, Roche) and incubated for 1 h at 37 ° C. The cells were washed 2X in PBS and incubated with a

40: 1: 200 dilution of goat anti-mouse antibody conjugated to Alexa-488 (Cat. No. A11029, Invitrogen) in blocking buffer (10% normal goat serum Cat. No. S26-100M, Chemicon, BSA 5% Cat. No. 2910, Omnipure, 0.1% Saponin Cat. No. 102855, MP-Biochemical, final solution sterilized by filtration through a 0.2 μm filter and stored at 4 ° C) at room temperature for 1 h. The samples were counterstained with Hoechst 33342 2 μg / ml (cat. No. H1399, Invitrogen, 10 mg / ml stock solution maintained at -20 ° C) in PBS for 30 min and

45 were washed once in PBS. Then, the membranes were inverted and mounted in 50 μl of glycerol again on a 24-well plate. The plate was stored at 4 ° C until scanning, after one week.

Image analysis was performed with a KineticScan (Cellomics, V2.2.0.0 Build 19) using a Target Activation V2.0 Bioapplication software. The images were stored on the hard disk in the patented Cellomics format and analyzed while the plate was scanned. The settings for setting the threshold

50 of the positive cells were obtained representing a histogram of the negative and positive cells for each staining session. Plates where cells had detached from all wells during fixation or where no signal was observed were not included in the final analysis.

The cells that grew on the Opticell® membrane had a total of 21.8 ± 2.6% positive for BrdU, while only 13.4 ± 2.0% were positive when they grew on the regeneration matrix. The differences in the union

Initially, they were discarded by counting the cells just before binding (i.e., the total number of bound cells was identical between the two samples).

Fibroblasts bind to the regeneration matrix in 2 hours in the same amounts as the control Opticell®, but the nuclear size is reduced (which is possibly indicative of the first stages of apoptosis) and the amount of cells positive for BrdU decreases in fibroblasts that grow in the regeneration matrix over a period of 24 hours (see Figures 28A-C). Cultures of fibroblasts cultured for longer periods on these regeneration matrices resulted in a markedly lower density of fibroblasts (experiencing some of these apoptosis fibroblasts) compared to control cultures. Figure 27 shows this difference in the growth density of cultured fibroblasts for 5 days over

image26

5 regeneration matrices prepared from whole blood filtered by 5 μm.

Example 12. Effect of the regeneration matrix on human astrocytes in vitro.

The same treatments and culture conditions as for fibroblasts were used for astrocytes, except that the morphological change test was performed using staining for fibrillar glial acid protein (GFAP). Primary human astrocytes (No. Cat. 1800, Sciencell, San Diego, CA) were grown in basal medium (Astrocyte

10 Medium, Cat. No. 1801, ScienCell) on poly-D-lysine coated plates and passed in confluence. One day before the interaction experiments, the cells were trypsinized, counted and plated at 2000 cells per well for BrdU in 96-well plates coated with poly-D-lysine (Cat. No. 354461, BD Falcon ).

Samples were taken for each batch for the previous analyzes, at 0, 6, 12, 15, 18 and 21 days after the start. Each treatment was replicated 4 times for each measurement (for example 4 wells per sample). For proliferation, 15 after 2 days in the presence of the regeneration matrix, BrdU (Cat. No. 203806, EMD Biosciences) was added up to 20 μM in culture medium diluting 1:20 a stock solution of 400 μM in 200 μl of means, medium. The cells were incubated at 37 ° C, 5.0% O2, 5.0% CO2, rest of N2 for an additional 1.5 h. The medium was removed by decantation and the cells were fixed with 70% ethanol cooled in ice (Cat. No. UN1170, EM Science) in 15 mM glycine (Cat. No. G-8790, Sigma). The fixed cells were stored at -20 ° C for at least 24 h. For BrdU detection, the cells were washed once in 200 µl of PBS (Cat. No. MT21-030-CM, Mediatech), treated with a 1:80 dilution of anti-BrdU-nuclease reagent monoclonal antibody for KitII (Cat. No. 1299964, Roche) and incubated for 1 h at 37 ° C. The cells were washed 2X in PBS and incubated with a 1: 200 dilution of goat anti-mouse antibody conjugated to Alexa-488 (Cat. No. A11029, Invitrogen) in blocking buffer (10% normal goat serum n Cat. S26-100M, Chemicon, 5% BSA No. Cat. 2910, Omnipure, 0.1% Saponin No. 25 Cat. 102855, MP-Biochemical, final solution sterilized by filtration through 0 , 2 μm and stored at 4 ° C) at room temperature for 1 h. The samples were counterstained with Hoechst 33342 2 μg / ml of (cat. # H1399, Invitrogen, stock solution 10 mg / ml maintained at -20 ° C) in PBS for 30 min and washed once in PBS, and stored at 4 ° C until they were explored, usually after one week. After ethanol fixation and storage, the cells were treated with 2 N HCl (Cat. No. 2612-14, Mallinckrodt chemicals) for 30 min and neutralized with 100 mM Tris, pH 8.5 HCl (n. º Cat. 9230, OmniPure) and washed 2X with PBS. The cells were incubated in 50 µl of a 1: 200 dilution of monoclonal antibody against BrdU conjugated to Alexa-488 (Cat. No. MD5420, Caltag laboratories) in blocking buffer for 16 h at 4 ° C. The cells were washed twice in PBS and incubated with a 1: 200 dilution of goat anti-mouse antibody conjugated to Alexa 546 (Cat. No. A11030, Invitrogen) in blocking buffer for 3 h. The cells were counterstained in 200 μl of Hoechst 2 μg / ml in PBS 35 for 30 min and stored in PBS. Image analysis was performed with a KineticScan (Cellomics, V2.2.0.0 Build 19) using a Bio-application Target Activation V2.0 software. The images were stored on the hard drive in the patented Cellomics format and analyzed while the plate was scanned. The parameters for determining the threshold of positive cells were obtained by representing a histogram of the negative and positive cells for each staining session. The plates where the cells had

40 detached from all wells during fixation or where no signal was observed were not included in the final analysis. Overall, astrocytes cultured in the presence of the regeneration matrix had fewer positive nuclei for BrdU (13.9 ± 2.3%) than those grown without regeneration matrix (18.5 ± 2.4%), which provides a possible explanation for the observation of reduced glial healing in spinal cord injuries treated with the regeneration matrix compared to controls.

45 Example 13. Effect of the regeneration matrix on spinal cord of injured rat in vivo.

To evaluate the in vivo activity of the regeneration matrix, three rat models of spinal cord injury models were used:

-Full section (5mm defect). -Hemisection (5 mm defect, right side).

50 -Contusion (50 mm weight loss).

All animal studies were conducted using protocols approved by the IACUC (Institutional Animal Care and Use Committees) with standardized surgical and post-surgical animal care procedures. Naked rats (Biomedical Research Models, Inc., Worcester, MA) were used in these studies to minimize immunological reactions against the human regeneration matrix. To access the spinal cord, an incision was made in the midline, above the spine from T8 to T11, and the skin and dorso-lumbar fascia were retracted. Both sides of the spine were exposed by blunt dissection. A dorsal laminectomy was performed at the T8-T9 level. The dura was cut and retracted, exposing the spinal cord. In the section studies, a full-thickness segment of the spinal cord between T8 and T9, 5 mm in length, was cut and carefully removed. In the EML model by hemisection, the spinal cord was exposed as described above and a 5 mm defect was created surgically on the right side of the spinal cord. The regeneration matrix implant was used to fill in the defects. The dura, the ligaments that are above, the muscles and the skin were closed by suturing. In the contusion model, the dura of the exposed spinal cord was struck by a 50 mm weight drop using the NYU IMPACTOR and the animals were allowed to reset for 2 weeks after the injury. After the 2-week recovery period, the regeneration matrix was implanted surgically into the spinal cord, adjacent to the area of the lesion. All animals were allowed to re-establish themselves in their own cages and subcutaneous injections of antibiotics were administered for three days to prevent infections. Sensory and motor functions of all animals were periodically evaluated according to the modified version of the neurological scale 10 of BBB (Basso, D. M. et al., A sensitive and reliable locomotor rating scale for open field testing in rats,

image27

J. Neurotrauma 12, 1-21, 1995). BBB scores were recorded approximately every 2 weeks using the criteria listed in Tables 12 and 13.

Table 12. Basso, Beattie and Bresnahan locomotive classification scale

Classification

Description of the locomotion

0

No movement of the hind limbs (PE) observable

one

Slight movement of one or two joints (usually hip and / or knee).

2

Extensive movement of a joint or extensive movement of a joint and slight movement of another joint.

3

Extensive movement of two joints.

4

Light movement of the three joints of the EP.

5

Light movement of two joints and extensive movement of the third.

6

Extensive movement of two joints and light movement of the third.

7

Extensive movement of the three joints of the EP.

8

Sweep without weight support or plantar leg location without weight support.

9

Plantar position of the leg with weight support only in position (that is when it is stationary) or occasional, frequent or consistent dorsal displacement supported by weight and without plantar displacement.

10

Plantar steps with occasional weight support, without ED-EP coordination.

eleven

Plantar steps with frequent weight support to consistent and without ED-EP coordination.

12

Plantar steps with frequent to consistent weight support and occasional ED-EP coordination.

13

Plantar steps with frequent to consistent weight support and frequent ED-EP coordination.

14

Plantar steps with consistent weight support, consistent ED-EP coordination and the predominant position of the leg during locomotion is rotated (internally or externally) when it makes initial contact with the surface as well as just before it is lifted at the end of posture or frequent plantar displacement, consistent ED-EP coordination and occasional dorsal displacement.

fifteen

Consistent plantar displacement and consistent ED-EP coordination; and with no space between the fingers or occasional space between fingers during the advancement of the front limb, the position of the predominant leg is parallel to the body at the initial contact.

16

Consistent plantar displacement and consistent ED-EP coordination during gait, and space between the fingers occurs frequently during the advancement of the front limb. The predominant position of the leg is parallel in the initial contact and turned when lifting.

17

Consistent plantar displacement and consistent ED-EP coordination during walking; and space between the fingers occurs frequently during the advancement of the front limb, the predominant position of the leg is parallel to the beginning of the contact and when lifting.

18

Consistent plantar displacement and consistent ED-EP coordination during walking; and space between the fingers is produced consistently during the advancement of the front limb, predominant position of the leg is parallel in the initial contact and rotated when lifting.

19

Consistent plantar displacement and consistent ED-EP coordination during walking; and space between the fingers occurs frequently during the advancement of the front limb. The predominant position of the leg is parallel in the initial contact and when lifting and the tail is down part or all the time.

twenty

Consistent plantar displacement and consistent coordinated gait; consistent space between the fingers, predominant position of the leg is parallel in the initial contact and when lifting; and trunk instability, tail consistently raised.

image28

(continuation)

Classification

Description of the locomotion

twenty-one

Consistent plantar displacement and coordinated gait, consistent space between the fingers, predominant leg position is parallel throughout the posture, consistent trunk stability and consistently raised tail.

Table 13. BBB definitions

Locomotion

Definition

Light

Partial movement of the joint through less than half the range of movement of the joint.

Extensive

Movement through more than half of the range of motion

Swept

Rhythmic movement of PD in which the three joints extend, then fully flex and extend again: the animal is usually on its side and the plantar surface of the leg may or may not contact the ground. Weight support throughout PD is not evident

No weight support

Without contraction of the extensor muscles of the PD during the plantar placement of the leg and without elevation of the hindquarters

Weight support

Contraction of the extensor muscles of the PD during the plantar placement of the leg, or elevation of the hindquarters - that is, it seeks a change in the hindquarters and the position of the abdomen during displacement.

Plantar shift

The leg is in plantar contact with weight support, then the PD is advanced forward and the plantar contact is restored with weight support

Dorsal displacement

The weight is supported along the dorsal surface of the leg at some point in the step cycle

ED-ET Coordination

For each ED step one EP step is taken, and the EP alternate. (Only evaluate the periods in which> 3 steps are taken on one line)

Occasional

<50%

Frequent

51-94%

Consistent

95-100% only if there are no prolonged episodes without displacement.

Trunk instability

Lateral changes of weights that cause side-to-side wiggle or partial trunk collapse.

5 15th. Model of full section spinal cord injury in the rat.

Figure 29 shows the results from the full section studies in rats, where the lesions per section are filled with the regeneration matrix or left with the empty space that is filled by blood as in the controls. In general, there was a high level of mortality associated with this type of study due to the severity of the spinal cord injury and the results represent neurofunctional status 10 in animals that survived at least 6 weeks. BBB scores were monitored at 2-week intervals for up to 12 to 14 weeks post-implant. The seven animals with regeneration matrix implants that survived at least 6 weeks post-injury / implant showed improved BBB scores (Figure 29). The maximum increases were observed at 6-8 weeks post-implant. The three control animals that survived at least 6 weeks showed no substantial improvement during the evaluation period of 12

15 weeks

In addition, the rats that received the regeneration matrix implants had a significantly decreased number of lesions (cysts) as well as the average volume of each lesion above or below the site of spinal cord injury (surgery), in comparison with control animals (see Figure 30). This means that the regeneration matrix presented neuroprotective effects in these animal models, giving as

20 result more conservation of neuronal tissue above and below the site of injury.

15b Model of spinal cord injury due to hemisection in the rat.

Figure 31 summarizes the results where the regeneration matrix was implanted in the damaged spinal cord by hemisection. In the EMF hemisection model, the spinal cord was exposed as described above and a 5 mm defect was created surgically on the right side of the spinal cord. This

25 model is not as severe as the section model and allows some normal animal function. For example, the surgically induced defect allows bladder control but not the motor function of the right hind leg. The regeneration matrix implant (n = 4) led to increased survival as well as a functional restoration (n = 3) compared to the non-implanted controls (n = 2). Unimplanted control animals died a week before the first BBB evaluation period.

image29

15c Contusion model of spinal cord injury in the rat.

In the contusion model, the dura was exposed with the underlying spinal cord and the LME was induced by a 50 mm weight loss using the MASCIS IMPACTOR (formerly the NYU IMPACTOR, WM Keck Center for Collaborative Neuroscience, Rutgers University, Piscataway, NJ). The rats were allowed to restore for two weeks and then a second surgery was performed, where the spinal cord was exposed and the regeneration matrix adjacent to the area of the lesion was placed. Figure 32 shows that the regeneration matrix implant also improves BBB scores in rats with bruised spinal cord. In this study, 25 rats had bruising damage inflicted on their spinal cord and 19 animals survived 2 weeks after the bruise. Of the surviving animals, 11 animals received 10 regeneration matrix implants and 8 served as control animals that received either a biologically inactivated implant or did not undergo a second surgery (and therefore, without an implant). At 6 weeks after the injury, 9 implants with regeneration matrix, 4 implants with inactivated matrix and 3 controls not implanted were alive. BBB scores for these surviving animals were evaluated at 2-week intervals (Figure 32). Animals implanted with regeneration matrix were restored as in the 15 full-section and hemisection models. Animals implanted with biologically inactivated matrix were partially restored, indicating that the structural properties of the regeneration matrix alone have significant regenerative potential with respect to controls that did not receive matrix. An apparent substantial spontaneous restoration was observed for one of the control animals that appeared to be due to an incomplete injury. However, the minor but measurable debilitating effects of the second surgery were overcome.

20 through the implanted matrices, which resulted in a significant improvement of the animals.

Example 16. The human regeneration matrix is safe, well tolerated and supports functional restoration in pigs with experimental spinal cord injuries.

In experimental pilot studies, male pigs weighing between 20 and 45 kg received different types of spinal cord injuries (impact, penetration, tear / tear, surgical hemisection) and 25 were placed at the sites of the human regeneration matrix lesion or porcine fibrin plugs. The different models were tested to develop an idea of the results of each type of lesion on the sensitive locomotive functionality in pigs, as well as to obtain an idea of in which lesion model a regeneration matrix seemed to work best. There was a clear trend in the human regeneration matrix, which induced a functional restoration in pigs with SCI, with the most significant effect observed in severe impact lesions that resulted in tearing and loss of spinal cord tissue. These experiments also provided an opportunity to assess the tolerability and possible safety of the regeneration matrix implant. The swine spinal cord is more than 98% identical to the human spinal cord in terms of its microenvironment from T2 to L2 and, therefore, is a good model for determining any possible safety issue that the regeneration matrix could have in a human spinal cord. No safety issues were detected in any of the pigs that received the human regeneration matrix implant, including 3 pigs that had a regeneration matrix injected twice into their spinal cords in the course of two distinct surgeries separated by 1 -3 months. No significant differences were found between control animals and animals that received the regeneration matrix implant in terms of their weights and behaviors, including the general observations made during animal husbandry on their

40 feeding, drinking, social interactions, urination and defecation behavior, indicating that the regeneration matrix is well tolerated and relatively non-toxic when implanted in pigs.

Tissue samples taken one month after implantation in some of the pigs and stained for Tuj-1 indicated that the implanted regeneration matrix had induced the formation of new neurons at the site of spinal cord injury. Figure 37 shows that implanted regeneration matrices induce

45 formation of new positive neurons for Tuj-1 (shown with an increase of 200x) after one month of the implant.

These preliminary pilot studies suggested that the human regeneration matrix induces locomotor restoration in pigs with SCI. Figure 33 shows the results of these preliminary studies in which an ASIA scoring system (acronym for English American spinal injury association: Association) was used.

50 North American spinal cord injury) modified to assess neurofunctional restoration in these animals. Some of the animals started with very low ASIA scores due to the severity of the surgical damage while other pigs (including all control animals) received less severe surgical injuries and, therefore, started with higher ASIA scores.

After the completion of these pilot studies, a 7-week safety study complete with concealment

55 double demonstrated that a matrix of human regeneration is safe and well tolerated in pigs that had received experimental spinal cord injuries. In these studies with double concealment, the pigs received surgically induced SCI located on the right side of their spinal cord, in the T8-T9 -a double hemisection, separated by 5 mm, followed by the extraction of the piece of spinal cord from 5 mm in length and either human regeneration matrix or an equivalent amount of human blood clot was implanted

60 homogenized. The left side of the spinal cord served as a control for nonspecific toxicities related to experimental surgery and implants. In all animals, they were routinely observed for changes in overall health status, weight and locomotor responses for 7 weeks after SCI and implant.

image30

Initially, sixteen pigs that matched in age and weight were randomly distributed into 8 groups of 2 animals each, which were implanted with either a human regeneration matrix or blood clots. Little bit

5 after receiving the severe spinal cord injury, four animals died - two in the regeneration matrix treatment groups and two in the blood clot group - indicating that the human regeneration matrix was not associated with mortality. increased compared to the group implanted with a clot.

The regeneration matrix implant seemed to be well tolerated and, in general, to be safe in pigs in

10 comparison with implanted animals with clot and control. Figure 34 summarizes and compares the weekly weight gains of pigs in the two groups. There were no detectable differences in the average total weight gains of pigs during the first 5 weeks, with an increase in weight gain of pigs implanted with regeneration matrix with respect to control pigs during the last two weeks of the period study. These data suggest that the regeneration matrix is well tolerated in pigs and that it is not

15 toxic systemically. In addition, the data suggest that during the last two weeks of the study period pigs implanted with regeneration matrix began to gain more muscle mass with respect to control pigs.

Locomotive functions in all animals were measured initially at 72 h and then at intervals of one week after the LME, using an ASIA sensory and motor capacity scoring system

20 modified for the hind legs of the animals. Figure 35 shows the locomotive scores of animals implanted with the regeneration matrix or with the homogenized blood clot.

In these studies, the scores of the sensory and motor starting capacities were measured 72 hours after the surgical and implant SCI, used as the initial values, and then, the values were determined at weekly intervals for 7 weeks. The pigs in both study groups began to restore the locomotor and sensory functions (of the impact on the spinal cord) after one week of the surgical SCI and 2-4 weeks after implantation these values reached constant levels. During this period of 2-4 weeks, no significant differences were observed in the locomotor and sensory functions of the groups implanted with the regeneration matrix and with a clot, which indicates that the regeneration matrix does not prevent functional restoration in animals with LME nor causes any further deterioration of

30 the function of the spinal cord.

Approximately 4-6 weeks after SCI, an additional increase in sensory and locomotor restoration was observed in most animals. The levels of restoration observed in animals implanted with regeneration matrix at the latter time points were higher than those observed in animals implanted with a clot. A detailed analysis of the differences in these two groups at the time point of 7

35 weeks indicates that there was a significant improvement (p = 0.03) in the functions of the right side (the side that received the injury) of the animals that received the regeneration matrix (Figure 36). The much higher variability within the group implanted with a regeneration matrix with respect to the control group at this time point of 7 weeks is indicative that the biological activity of the regeneration matrix has not yet reached its endpoint value (score final motor). It was estimated that the end point had been approximately at 16 weeks.

40 Taken together, these studies indicate that the regeneration matrix is safe and well tolerated in pigs, and induces sensory and locomotor restoration after surgically induced SCI.

Example 17. Toxicology studies in rats with GLP.

To evaluate the possible systemic toxicity associated with the implantation of a regeneration matrix, a preclinical study was designed in accordance with ISO 10993-11 and BPL, and was carried out in the NAMSA (Northwood, OH). In this

In this study, a regeneration matrix was implanted in the subcutaneous tissue of 14 rats (7 males and 7 females). The control article (sterile 0.9% saline) was similarly implanted in a group of 14 different rats (7 males and 7 females). Mortality and apparent signs of toxicity in animals were observed daily. Detailed examinations of the clinical signs of disease and anomaly were performed weekly. Before implantation the body weights of the animals were obtained and at weekly intervals throughout the entire study.

50 At 4 weeks, the animals underwent euthanasia and blood test samples were collected for hematology and clinical chemistry analysis (all analyzes were performed by NAMSA). A necropsy was performed and selected organs were absorbed, weighed and processed histologically. The subcutaneous tissue around each implant site was also removed from each rat and examined microscopically. A qualified pathologist performed the microscopic evaluation of the implant sites as well as the organs

55 selected. Body weights, organ weights, organ / body weights proportions, hematology values and clinical chemistry values were statistically analyzed.

After subcutaneous implantation in the rat the data revealed no evidence of systemic toxicity of the test article (regeneration matrix). Daily clinical observations, body weights, findings of the

image31

Necropsy, the weights of the animal's organs and the proportions of organs / body were within acceptable limits and were similar between and within the test and control treatment groups. There were no changes in hematology values or clinical chemistry values in male or female rats, which were considered as being biologically significant or related to the treatment with the test article. The microscopic evaluation of the selected tissues revealed no evidence of systemic toxicity in the group treated with the regeneration matrix. Based on the histological criteria, the regeneration matrix in male and female rats was considered to be a moderate irritant when compared to the reference control material of saline solution. This last finding is within the range of experience of the test facility for the evaluation of bioabsorbable materials and in the lower range for a xenogeneic implant (in this case the

10 human whole blood obtained from the regeneration matrix was implanted in rat). In conclusion, the local injection of a regeneration matrix between species does not lead to any significant toxicity and suggests that a regeneration matrix will not cause local pathology when implanted in human SCI patients.

Example 18. Microscopic evaluation of cuts from a spinal cord regeneration study.

15 A regeneration matrix was implanted in an experimental rat in which 10 mm of spinal cord was surgically removed. After 10 days, the spinal cord was examined histologically. The defect of the central spinal cord consisted microscopically of severe central Wallerian axonal degeneration and neurophilic necrosis extending approximately 4.5 mm radially from the center (a total width of 1 cm) due to the surgical removal of 1 cm of spinal cord. Surrounding the regeneration matrix implant there were

20 sheets of reactive glial cells and microglia, some with hemosiderin, as well as sheets of manifest primitive mesenchymal / reticular type cells (see Figures 38A and 38B) that appeared to expand (fill in) the spinal cord defect. These cells appear to be involved in the development of new neural tissue and in the regeneration of the spinal cord. On the periphery of the defect there was a thickening of the leptomeninges with increased reactive fibroplasia. Fibroplasia seemed to expand along the leptomeninges as a framework

25 of support for these manifest primitive mesenchymal / reticular-type cells and seemed to support regeneration of the injured spinal cord.

Claims (18)

image 1 1. An acellular bioabsorbable regeneration matrix obtained from blood and obtainable by a method according to any one of claims 14 to 19, the matrix comprising: a) aggregates of spherical structures that are at least 100 nm in diameter; and 5 b) a proteinaceous nucleus having a protein content of at least 1%; in which the matrix lacks substantial metabolic activity compared to that initially present in said blood; and in which additionally the matrix has the ability to initiate tissue regeneration in a subject with damage 10, increase tissue regeneration in a subject with tissue damage, or both.

2.

The acellular bioabsorbable regeneration matrix of claim 1, comprising fibers intercalated between the aggregates.

3.

The acellular bioabsorbable regeneration matrix of claim 1 or 2, wherein said matrix is self-assembled.

4. The acellular bioabsorbable regeneration matrix of any one of claims 1-3, further comprising one or more proteins selected from the group consisting of: transferrin, serum albumin, serum albumin precursor, complement component 3, AD chain hemoglobin , IgM, IgG1, inhibitor of medulasin 2, carbonic anhydrase, CA1 protein and combinations thereof. 5. The acellular bioabsorbable regeneration matrix of any one of claims 1-4, wherein the CD56 antibodies recognize spherical structures.

6.

The acellular bioabsorbable regeneration matrix of any one of claims 1-5, further comprising one or more therapeutic agents.

7.

The acellular bioabsorbable regeneration matrix of claim 6, wherein said one or more agents

Therapeutics are selected from the group consisting of: proteins, peptides, drugs, cytokines, extracellular matrix molecules, growth factors and combinations thereof.

8.

The acellular bioabsorbable regeneration matrix of claim 6 or 7, wherein said one or more therapeutic agents are distributed heterogeneously within the acellular bioabsorbable regeneration matrix.

9.

The acellular bioabsorbable regeneration matrix of claim 6 or 7, wherein said one or more therapeutic agents are homogeneously distributed within the acellular bioabsorbable regeneration matrix.

10. The acellular bioabsorbable regeneration matrix of any one of claims 7-9, wherein said acellular bioabsorbable regeneration matrix protects and / or enhances one or more beneficial effects of said one or more therapeutic agents. 11. A combination of (i) the acellular bioabsorbable regeneration matrix of any one of the Claims 1-10 and (ii) cells that have been seeded or mixed in the matrix after it has been produced or while it is being produced.

12.

The combination of claim 11, wherein the cells are selected from the group consisting of: stem cells, progenitor cells, somatic cells and combinations thereof.

13.

The acellular bioabsorbable regeneration matrix of any one of claims 1-10, or the

combination of any of claims 11 and 12, wherein said regeneration matrix is in solid or semi-solid form, in the form of a three-dimensional matrix or in the form of a suspension. 14. A method of producing an acellular bioabsorbable regeneration matrix comprising the steps of a) provide an isolated blood sample; b) remove intact cells from the sample; C) adding a process means at one or more moments selected from the group consisting of: during the isolation of the sample, before the elimination stage, before the incubation stage and during the incubation stage, to provide a liquid acellular fraction; d) incubating said liquid acellular fraction in an incubation chamber without stirring or otherwise disturbing the acellular sample for 2 or more days, to form an acellular bioabsorbable regeneration matrix that 50 lacks substantial metabolic activity; and e) isolate the acellular bioabsorbable regeneration matrix. 40 image2

fifteen.

 The method of claim 14, wherein said sample comprises blood or a blood fraction, wherein the blood fraction may contain a leukocyte layer, which may additionally be a leukocyte / platelet / plasma layer.

16.

 The method of claim 15, wherein the sample contains an anticoagulant.

The method of claim 15, wherein the sample is blood containing clots and the method comprises solubilizing the clots. 18. The method of any of claims 14-17, wherein said removal of intact cells in b) is carried out by freezing, filtration (for example through a size selection filter) and / or centrifugation. The method of claim 18, wherein the size selection filter excludes particles larger than about 5 µm, larger than about 1.2 µm and / or larger than about 0.8 µm. 20. Use of the acellular bioabsorbable regeneration matrix of any one of claims 1-13 or produced by the method of any one of claims 14-19, for the manufacture of a medicament used to initiate, increase, sustain, stimulate and / or direct the regeneration of damaged tissue, 15 lost and / or degenerated. 21. Use of the acellular bioabsorbable regeneration matrix of any one of claims 1-13 or produced by the method of any one of claims 14-19, for the manufacture of a medicament for a therapy procedure comprising initiating, increasing , modulate, stimulate, sustain and / or direct one or more of the following processes: natural wound healing, tissue growth, Tissue functionality, structuring, connectivity, angiogenesis, proliferation and / or activation of progenitor cells, cell growth and / or proliferation, cell specialization and / or elongation, cell differentiation and / or differentiation , positive regulation of cellular genes related to regeneration, and / or inhibition of scar formation. 22. Use of the acellular bioabsorbable regeneration matrix of any one of claims 1-13 or 25 produced by the method of any one of claims 14-19, for the manufacture of a medicament for stimulating neurotrophic activity at or near a damaged or degenerated central nervous system tissue site, wherein said neurotrophic activity is characterized by an increase in the expression of at least one neurotrophic gene selected from the group consisting of: FGF-9, Netrina-1, NT-3, NCAM-15 GAP-43 and Neuregulin. 30 23. A pharmaceutical composition to stimulate, direct and / or sustain wound healing and / or tissue regeneration, tissue growth, cell growth, positive gene regulation, cell inhibition, cell proliferation, cell dedifferentiation , cell differentiation, cell transdifferentiation, neurite extension, positive gene regulation, one or more natural wound healing processes, or combinations thereof, and / or to stimulate neurotrophic activity at or near a site system tissue Damaged or degenerated central nervous core, comprising the acellular bioabsorbable regeneration matrix of any one of claims 1-13 or produced by the method of any one of claims 14-19. 41