EP4136111A1 - Combination therapy of atra or other retinoids with immunotherapeutic agents binding to bcma - Google Patents

Combination therapy of atra or other retinoids with immunotherapeutic agents binding to bcma

Info

Publication number
EP4136111A1
EP4136111A1 EP21717125.5A EP21717125A EP4136111A1 EP 4136111 A1 EP4136111 A1 EP 4136111A1 EP 21717125 A EP21717125 A EP 21717125A EP 4136111 A1 EP4136111 A1 EP 4136111A1
Authority
EP
European Patent Office
Prior art keywords
bcma
upregulator
binding
immunotherapeutic
combination
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
EP21717125.5A
Other languages
German (de)
French (fr)
Inventor
Michael Hudecek
Estefania GUERRERO GARCÍA
Sabrina PROMMERSBERGER
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Julius Maximilians Universitaet Wuerzburg
Original Assignee
Julius Maximilians Universitaet Wuerzburg
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Julius Maximilians Universitaet Wuerzburg filed Critical Julius Maximilians Universitaet Wuerzburg
Publication of EP4136111A1 publication Critical patent/EP4136111A1/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2878—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the NGF-receptor/TNF-receptor superfamily, e.g. CD27, CD30, CD40, CD95
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/045—Hydroxy compounds, e.g. alcohols; Salts thereof, e.g. alcoholates
    • A61K31/07—Retinol compounds, e.g. vitamin A
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/11—Aldehydes
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/185—Acids; Anhydrides, halides or salts thereof, e.g. sulfur acids, imidic, hydrazonic or hydroximic acids
    • A61K31/19—Carboxylic acids, e.g. valproic acid
    • A61K31/192—Carboxylic acids, e.g. valproic acid having aromatic groups, e.g. sulindac, 2-aryl-propionic acids, ethacrynic acid 
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/185—Acids; Anhydrides, halides or salts thereof, e.g. sulfur acids, imidic, hydrazonic or hydroximic acids
    • A61K31/19—Carboxylic acids, e.g. valproic acid
    • A61K31/20—Carboxylic acids, e.g. valproic acid having a carboxyl group bound to a chain of seven or more carbon atoms, e.g. stearic, palmitic, arachidic acids
    • A61K31/203—Retinoic acids ; Salts thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/21—Esters, e.g. nitroglycerine, selenocyanates
    • A61K31/215—Esters, e.g. nitroglycerine, selenocyanates of carboxylic acids
    • A61K31/22—Esters, e.g. nitroglycerine, selenocyanates of carboxylic acids of acyclic acids, e.g. pravastatin
    • A61K31/23—Esters, e.g. nitroglycerine, selenocyanates of carboxylic acids of acyclic acids, e.g. pravastatin of acids having a carboxyl group bound to a chain of seven or more carbon atoms
    • A61K31/232—Esters, e.g. nitroglycerine, selenocyanates of carboxylic acids of acyclic acids, e.g. pravastatin of acids having a carboxyl group bound to a chain of seven or more carbon atoms having three or more double bonds, e.g. etretinate
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/44—Non condensed pyridines; Hydrogenated derivatives thereof
    • A61K31/4427—Non condensed pyridines; Hydrogenated derivatives thereof containing further heterocyclic ring systems
    • A61K31/4436—Non condensed pyridines; Hydrogenated derivatives thereof containing further heterocyclic ring systems containing a heterocyclic ring having sulfur as a ring hetero atom
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/55—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having seven-membered rings, e.g. azelastine, pentylenetetrazole
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
    • A61K39/39533—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals
    • A61K39/3955—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals against proteinaceous materials, e.g. enzymes, hormones, lymphokines
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
    • A61K39/39533—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals
    • A61K39/39558—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals against tumor tissues, cells, antigens
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/46—Cellular immunotherapy
    • A61K39/461—Cellular immunotherapy characterised by the cell type used
    • A61K39/4611—T-cells, e.g. tumor infiltrating lymphocytes [TIL], lymphokine-activated killer cells [LAK] or regulatory T cells [Treg]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/46—Cellular immunotherapy
    • A61K39/463—Cellular immunotherapy characterised by recombinant expression
    • A61K39/4631—Chimeric Antigen Receptors [CAR]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/46—Cellular immunotherapy
    • A61K39/464—Cellular immunotherapy characterised by the antigen targeted or presented
    • A61K39/4643—Vertebrate antigens
    • A61K39/4644—Cancer antigens
    • A61K39/464402—Receptors, cell surface antigens or cell surface determinants
    • A61K39/464416—Receptors for cytokines
    • A61K39/464417—Receptors for tumor necrosis factors [TNF], e.g. lymphotoxin receptor [LTR], CD30
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/68—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
    • A61K47/6801—Drug-antibody or immunoglobulin conjugates defined by the pharmacologically or therapeutically active agent
    • A61K47/6803—Drugs conjugated to an antibody or immunoglobulin, e.g. cisplatin-antibody conjugates
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/02—Immunomodulators
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70503—Immunoglobulin superfamily
    • C07K14/7051—T-cell receptor (TcR)-CD3 complex
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2239/00—Indexing codes associated with cellular immunotherapy of group A61K39/46
    • A61K2239/46—Indexing codes associated with cellular immunotherapy of group A61K39/46 characterised by the cancer treated
    • A61K2239/48—Blood cells, e.g. leukemia or lymphoma
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/20—Immunoglobulins specific features characterized by taxonomic origin
    • C07K2317/21—Immunoglobulins specific features characterized by taxonomic origin from primates, e.g. man
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/60—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
    • C07K2317/62—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising only variable region components
    • C07K2317/622—Single chain antibody (scFv)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/73—Inducing cell death, e.g. apoptosis, necrosis or inhibition of cell proliferation
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/76—Antagonist effect on antigen, e.g. neutralization or inhibition of binding
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/03—Fusion polypeptide containing a localisation/targetting motif containing a transmembrane segment
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/33—Fusion polypeptide fusions for targeting to specific cell types, e.g. tissue specific targeting, targeting of a bacterial subspecies

Definitions

  • the invention relates to combination therapies of ATRA and other retinoids with immunotherapeutic agents binding to BCMA such as CAR-T cells capable of binding to BCMA, antibodies capable of binding to BCMA or antibody fragments capable of binding to BCMA.
  • these combination therapies can be advantageously applied to the treatment of cancers such as multiple myeloma and can also be applied to the treatment of antibody-mediated autoimmune diseases.
  • retinoids such as ATRA can upregulate BCMA mRNA levels as well as BCMA protein levels in cancer cells, such that the cancer cells can be targeted more effectively by immunotherapeutic anticancer agents capable of binding to BCMA such as CAR-T cells capable of binding to BCMA, antibodies capable of binding to BCMA or antibody fragments capable of binding to BCMA.
  • ATRA and other retinoids can be combined with gamma-secretase inhibitors and BCMA-targeting immunotherapeutic agents, leading to an even further increased BCMA expression on the target cells and therefore, even better immunotherapeutic response.
  • MM Multiple myeloma
  • BCMA B cell maturation antigen
  • BCMA-CAR T-cells achieved partial and complete responses in fractions of MM patients 16 ⁇ 19 .
  • Retinoic acids can influence gene expression and protein production of cells 20 .
  • ATRA all-trans retinoic acid
  • Treatment with ATRA also induces epigenetic changes in MM cells, leading to enhanced expression of CD38 and subsequently enhanced efficacy of the CD38-targeting antibody daratumumab 22 ’ 25 .
  • gamma-secretase inhibitors can also increase BCMA expression on MM cells, by blocking BCMA cleavage by the ubiquitous multi-subunit y-secretase complex, leading to improved MM cell recognition by BCMA-CAR-T cells 40 .
  • the inventors have investigated if epigenetic changes induced by ATRA influence the BCMA surface expression and the release of soluble BCMA (BCMAs) molecules by cancer cells and in particular by MM cells. Furthermore, it was analyzed if these ATRA-induced changes also affect the efficacy of BCMA-CAR T-cells.
  • BCMA B cell maturation antigen
  • MM multiple myeloma
  • CAR chimeric antigen receptor
  • Clinical trials with BCMA-CAR T-cells are currently running and achieved first encouraging results.
  • BCMA-CAR T-cells are currently running and achieved first encouraging results.
  • the inventors aimed to increase overall BCMA expression on cancer cells such as MM cells.
  • ATRA all-trans retinoic acid
  • BCMA-specific CAR T-cells showed enhanced recognition and lysis of target cell lines, when these were pretreated with ATRA. Cytokine release and proliferation of BCMA-CAR T-cells were enhanced after stimulation with ATRA-treated target cells in comparison to untreated target cells. Even in MM1.S/NSG mice, BCMA was up-regulated on the surface of tumor cells when the animals were injected with ATRA for several days. A combinatorial treatment with ATRA and BCMA-specific CAR T- cells led to a distinct and prolonged decline of tumor mass in comparison to single agent treatment.
  • BCMA up-regulation on target cell lines can be further enhanced by combining ATRA with gamma secretase inhibitors (GSI).
  • GSI gamma secretase inhibitors
  • retinoids such as ATRA can be used to enhance BCMA-targeting immunotherapies, e.g., by increasing the BCMA baseline expression on tumor cells and by keeping it at a high level during the therapy.
  • sBCMA shed soluble BCMA
  • the inventors confirmed that the anti-MM reactivity of their BCMA CAR is not inhibited in the presence of high concentrations of sBCMA that may occur at a later time point of ATRA treatment and which is constantly found in the serum of myeloma patients.
  • the advantageous upregulation of BCMA can not only be achieved with ATRA but can also be achieved with other retinoids.
  • These retinoids are considered to share the same more of action (e.g. as specific epigenetic modulators) and can therefore be used in accordance with the present invention.
  • the studies made by the inventors illustrate the advantageous effects of combining retinoids such as ATRA and immunotherapeutic agents capable of binding to BCMA such as BCMA-CAR T-cells for cancer treatment such as the treatment of myeloma.
  • such combination therapies can also be advantageously applied to the treatment of antibody-mediated autoimmune diseases.
  • Antibodies are secreted by B cells, mostly by plasma cells which are differentiated B cells. Autoantibodies are antibodies binding to the individual’s own proteins and can induce autoimmune diseases (such as lupus erythematosus). Therefore, B cells and especially plasma cells can act as therapeutic targets for treatment of such autoimmune diseases.
  • autoimmune diseases such as lupus erythematosus. Therefore, B cells and especially plasma cells can act as therapeutic targets for treatment of such autoimmune diseases.
  • Several monoclonal antibodies against CD19, CD20 and CD22 have already been used to target multiple B cell subtypes.
  • the CD20-targeting antibody Rituximab is already approved for use in rheumatoid arthritis, granulomatosis with polyangiitis and microscopic polyangiitis.
  • B cell maturation antigen (BCMA) is preferentially expressed by B lineage cells including plasma cells. Therefore, according to the invention, antibody-mediated autoimmune diseases can also be treated with the immunotherapeutic agents capable of binding to BCMA according to the invention.
  • administration of an upregulator of BCMA mRNA levels according to the invention e.g. a retinoid according to the invention, is expected to enhance the efficiency of the treatment.
  • immunotherapeutic agents comprising a gene therapy vector encoding a chimeric antigen receptor (CAR) capable of binding to BCMA, said gene therapy vector being a gene therapy vector for the in vivo expression of said CAR in immune cells, can also be used in accordance with the invention.
  • CAR chimeric antigen receptor
  • An immunotherapeutic anticancer agent capable of binding to BCMA for use in a method of cancer immunotherapy against BCMA as cancer antigen in a human patient, wherein the method is a method wherein an upregulator of BCMA mRNA levels is to be administered to the human patient.
  • a method of treating cancer by immunotherapy against BCMA as cancer antigen in a human patient comprising administering an immunotherapeutic anticancer agent capable of binding to BCMA and an upregulator of BCMA mRNA levels to the human patient.
  • ATRA all-trans retinoic acid
  • isotretionin 13-cis-retinoic acid
  • alitretinoin 9-cis- retinoic acid
  • retinal or retinol retinol.
  • CAR chimeric antigen receptor
  • An immunotherapeutic agent capable of binding to BCMA for use in a method of treating an antibody-mediated autoimmune disease in a human patient wherein the method is a method wherein an upregulator of BCMA mRNA levels is to be administered to the human patient.
  • An upregulator of BCMA mRNA levels for use in a method of treating an antibody-mediated autoimmune disease in a human patient wherein the method is a method wherein an immunotherapeutic agent capable of binding to BCMA is to be administered to the human patient.
  • a combination of an immunotherapeutic agent capable of binding to BCMA and an upregulator of BCMA mRNA levels for use in a method of treating an antibody-mediated autoimmune disease in a human patient are examples of an immunotherapeutic agent capable of binding to BCMA and an upregulator of BCMA mRNA levels for use in a method of treating an antibody-mediated autoimmune disease in a human patient.
  • a method of treating an antibody-mediated autoimmune disease in a human patient comprising administering an immunotherapeutic agent capable of binding to BCMA and an upregulator of BCMA mRNA levels to the human patient.
  • CAR chimeric antigen receptor
  • Graves’ disease myasthenia gravis, lupus erythematosus, rheumatoid arthritis, goodpasture syndrome, scleroderma, CREST syndrome, granulomatos
  • An immunotherapeutic anticancer agent comprising a gene therapy vector encoding a chimeric antigen receptor (CAR) capable of binding to BCMA, said gene therapy vector being a gene therapy vector for the in vivo expression of said CAR in immune cells, for use in a method of cancer immunotherapy against BCMA as cancer antigen in a human patient, wherein the method is a method wherein an upregulator of BCMA mRNA levels is to be administered to the human patient.
  • CAR chimeric antigen receptor
  • An upregulator of BCMA mRNA levels for use in a method of cancer immunotherapy against BCMA as cancer antigen in a human patient wherein the method is a method wherein an immunotherapeutic anticancer agent is to be administered to the human patient, said immunotherapeutic anticancer agent comprising a gene therapy vector encoding a chimeric antigen receptor (CAR) capable of binding to BCMA, said gene therapy vector being a gene therapy vector for the in vivo expression of said CAR in immune cells.
  • CAR chimeric antigen receptor
  • a combination of an immunotherapeutic anticancer agent and an upregulator of BCMA mRNA levels for use in a method of cancer immunotherapy against BCMA as cancer antigen in a human patient said immunotherapeutic anticancer agent comprising a gene therapy vector encoding a chimeric antigen receptor (CAR) capable of binding to BCMA, said gene therapy vector being a gene therapy vector for the in vivo expression of said CAR in immune cells.
  • said immunotherapeutic anticancer agent comprising a gene therapy vector encoding a chimeric antigen receptor (CAR) capable of binding to BCMA, said gene therapy vector being a gene therapy vector for the in vivo expression of said CAR in immune cells.
  • CAR chimeric antigen receptor
  • a method of treating cancer by immunotherapy against BCMA as cancer antigen in a human patient comprising administering an immunotherapeutic anticancer agent and an upregulator of BCMA mRNA levels to the human patient, said immunotherapeutic anticancer agent comprising a gene therapy vector encoding a chimeric antigen receptor (CAR) capable of binding to BCMA, said gene therapy vector being a gene therapy vector for the in vivo expression of said CAR in immune cells.
  • CAR chimeric antigen receptor
  • immunotherapeutic anticancer agent for use, the upregulator for use, the combination for use, or the method, of any one of items 37-41, wherein the cancer is as defined in any one of items 12-16 or 23.
  • immunotherapeutic anticancer agent for use, the upregulator for use, the combination for use, or the method, of any one of items 37-42, wherein in the method, a gamma secretase inhibitor is to be administered, and wherein the gamma secretase inhibitor is as defined in items 24 or 25.
  • FIG. 1 ATRA treatment leads to enhanced BCMA-expression on myeloma cell lines.
  • the overlay histogram shows BCMA expression on untreated myeloma cell lines, 72 hours after ATRA treatment (50 nM), 24 hours after subsequent removal of the drug, and 72 hours after re-exposition to ATRA.
  • ATRA treatment leads to enhanced BCMA-RNA levels in myeloma cell lines.
  • MFI mean fluorescence intensity
  • FIG. 1 ATRA treatment leads to enhanced BCMA-expression on primary myeloma cells.
  • the overlay histogram shows BCMA expression on untreated primary myeloma cells 72 hours after ATRA treatment (100 nM), 24 hours after subsequent removal of the drug, and 72 hours after reexposition to ATRA. 7-AAD was used to exclude dead cells from analysis. Figure 10. Combination of ATRA and GSI treatment leads to enhanced BCMA-expression on MM.1S and OPM-2 cells.
  • BCMA-CAR T-cells confer enhanced cytotoxicity against ATRA or ATRA+GSI-treated MM.1S in vitro.
  • BCMA-CAR T-cells confer enhanced cytotoxicity against ATRA or ATRA+GSI-treated OPM-2 in vitro.
  • BCMA-CAR T-cells confer enhanced cytokine release after stimulation with ATRA or ATRA+GSI-treated MM.1S in vitro.
  • ATRA enhances BCMA expression on MM.1S in vivo.
  • mice were inoculated with MM.1S cells. After twelve days, mice were i.p. injected with 30 mg/kg ATRA for 4 days. BCMA-expression on MM.1S cells obtained from bone marrow of untreated and ATRA-treated mice was analysed by flow cytometry.
  • mice The average radiance of MM.1S signal was analyzed to assess myeloma progression/regression in each treatment group.
  • Bioluminescence (BMI) values were obtained as photon/sec/cm2/sr in regions of interest encompassing the entire body of each mouse.
  • ATRA does not increase sBCMA in cell line supernatants.
  • Soluble BCMA concentration in the supernatant of MM.1S and OPM-2 cells after incubation with increasing doses of ATRA were cultured at 1x10 6 /well for 24 hours. After incubation, supernatant was collected and analyzed by ELISA. The stimulation was performed in triplicates. Depicted are mean values +SD
  • Soluble BCMA concentration in the serum of MM patients Peripheral blood from MM patients was collected. Centrifugation at 3,000 rpm for 10 min was performed to obtain the serum which was analyzed by ELISA (stimulation performed in triplicates). PD, progressive disease; SD, stable disease; PR, partial remission; CR, complete remission.
  • CD8+ BCMA-CAR T-cells were co-cultured with MM.1S or K562/BCMA target cells in absence or presence of 150 ng/ml of soluble BCMA. After 4 hours, luciferin was added to the culture and the cytotoxicity was evaluated with a bioluminescence-based assay. Data show mean values of technical triplicates ⁇ SD.
  • KQ or “KQ value” relate to the equilibrium dissociation constant as known in the art.
  • these terms can relate to the equilibrium dissociation constant of an immunotherapeutic agent or anticancer agent capable of binding to BCMA (e.g. a CAR T-cell or an antibody) with respect to the antigen of interest (i.e. BCMA).
  • BCMA e.g. a CAR T-cell or an antibody
  • the equilibrium dissociation constant is a measure of the propensity of a complex (e.g. an antigen-targeting agent complex) to reversibly dissociate into its components (e.g. the antigen and the targeting agent).
  • the chimeric antigen receptor is capable of binding to one or more antigens, preferably cancer antigens, more preferably cancer cell surface antigens.
  • the chimeric antigen receptor is capable of binding to the extracellular domain of a cancer antigen.
  • the chimeric antigen receptor is capable of binding to the extracellular domain of BCMA and is even more preferably a chimeric antigen receptor encoded by the nucleic acid sequence of SEQ ID NO: 1 and/or a chimeric antigen receptor having the amino acid sequence of SEQ ID NO: 13.
  • immune cells such as T cells, NK cells or PBMCs can be isolated from a patient, genetically modified (e.g. transduced) with a gene transfer vector encoding a chimeric antigen receptor according to the invention and administered to the patient in accordance with the methods and uses of the invention.
  • the T cells are CD8 + T cells or CD4 + T cells.
  • allogenic immune cells such as T cells, NK cells or PBMCs, from donors, preferably healthy donors, can be used. They can be genetically modified (e.g. transduced) with a gene transfer vector encoding a chimeric antigen receptor according to the invention and administered to the patient in accordance with the methods and uses of the invention.
  • the T cells are CD8 + T cells or CD4 + T cells.
  • T cells are usually manipulated and expanded ex vivo.
  • One way to program immune cells such as T cells within the body is the gene transfer with DNA-carrying nanoparticles. This has, for instance, been described by Smith et al. [T.T. Smith, et. al, In situ programming of leukaemia-specific T cells using synthetic DNA nanocarriers, Nat Nanotechnol. 2017 Aug; 12(8): 813-820. Published online 2017 Apr 17. doi: 10.1038/nnano.2017.57], A second strategy is the in vivo CAR immune cell (e.g. CAR T cell) generation with viral vectors.
  • CAR immune cell e.g. CAR T cell
  • Immuno cells as used in the invention are not particularly limited and include, for example, T cells, NK cells or PBMCs.
  • the T cells are CD8 + T cells or CD4 + T cells.
  • antibody refers to any functional antibody that is capable of specific binding to the antigen of interest.
  • the term antibody encompasses antibodies from any appropriate source species, including avian such as chicken and mammalian such as mouse, goat, nonhuman primate and human.
  • the antibody is a humanized or human antibody.
  • Humanized antibodies are antibodies which contain human sequences and a minor portion of non-human sequences which confer binding specificity to an antigen of interest (e.g. BCMA).
  • the antibody is preferably a monoclonal antibody which can be prepared by methods well-known in the art.
  • antibody encompasses an lgG-1, -2, -3, or -4, IgE, IgA, IgM, or IgD isotype antibody.
  • the term antibody encompasses monomeric antibodies (such as IgD, IgE, IgG) or oligomeric antibodies (such as IgA or IgM).
  • the term antibody also encompasses - without particular limitations - isolated antibodies and modified antibodies such as genetically engineered antibodies, e.g. chimeric antibodies or bispecific antibodies, or antibody conjugates with a drug such as an anticancer drug or a cytotoxic drug.
  • a preferred bispecific antibody capable of binding to BCMA in accordance with the invention can be a T- cell engager such as a BiTE (Bi-specific T-cell engager), e.g. a CD3xBCMA BiTE, or a DART (dualaffinity re-targeting proteins).
  • An “antibody” e.g. a monoclonal antibody or “a fragment thereof as described herein may have been derivatized or be linked to a different molecule.
  • molecules that may be linked to the antibody are other proteins (e.g. other antibodies), a molecular label (e.g. a fluorescent, luminescent, colored or radioactive molecule), a pharmaceutical and/or a toxic agent.
  • the antibody or antigen-binding portion may be linked directly (e.g. in form of a fusion between two proteins), or via a linker molecule (e.g. any suitable type of chemical linker known in the art).
  • an antibody fragment or fragment of an antibody capable of binding to BCMA refers to a portion of an antibody that retains the capability of the antibody to specifically bind to the BCMA antigen. This capability can, for instance, be determined by determining the capability of the antigen-binding portion to compete with the antibody for specific binding to the antigen by methods known in the art.
  • the antibody fragment can be produced by any suitable method known in the art, including recombinant DNA methods and preparation by chemical or enzymatic fragmentation of antibodies.
  • Antibody fragments may be Fab fragments, F(ab’) fragments, F(ab’)2 fragments, single chain antibodies (scFv), single-domain antibodies, diabodies or any other portion(s) of the antibody that retain the capability of the antibody to specifically bind to the antigen.
  • Terms such as “treatment of cancer” or “treating cancer” or “cancer therapy” or “cancer immunotherapy” according to the present invention refer to a therapeutic treatment.
  • An assessment of whether or not a therapeutic treatment works can, for instance, be made by assessing whether the treatment inhibits cancer growth in the treated patient or patients.
  • the inhibition is statistically significant as assessed by appropriate statistical tests which are known in the art.
  • Inhibition of cancer growth may be assessed by comparing cancer growth in a group of patients treated in accordance with the present invention to a control group of untreated patients, or by comparing a group of patients that receive a standard cancer treatment of the art plus a treatment according to the invention with a control group of patients that only receive a standard cancer treatment of the art.
  • treating cancer includes an inhibition of cancer growth where the cancer growth is inhibited partially (i.e. where the cancer growth in the patient is delayed compared to the control group of patients), an inhibition where the cancer growth is inhibited completely (i.e. where the cancer growth in the patient is stopped), and an inhibition where cancer growth is reversed (i.e. the cancer shrinks).
  • An assessment of whether or not a therapeutic treatment works can be made based on known clinical indicators of cancer progression. In the context of cancers which do not form solid tumors, cancer growth may be assessed by known methods such as methods based on a counting of the cancer cells.
  • a “treatment of cancer” or “treating cancer” or “cancer therapy” or “cancer immunotherapy” as used in accordance with the present invention is preferably a treatment of the cancer itself.
  • a “treatment of cancer” or “treating cancer” or “cancer therapy” or “cancer immunotherapy” in accordance with the invention can be a treatment of a precancerous condition which is preferably selected from multiple myeloma precursor states such as MGUS (Monoclonal Gammopathy of Undetermined Significance) and smoldering multiple myeloma.
  • MGUS Monitoring Gammopathy of Undetermined Significance
  • a treatment of cancer according to the present invention does not exclude that additional or secondary therapeutic benefits also occur in patients, such as a treatment of amyloidosis, e.g. an amyloidosis associated with multiple myeloma.
  • the treatment of cancer according to the invention can be a first-line therapy, a second-line therapy, a third-line therapy, or a fourth-line therapy.
  • the treatment can also be a therapy that is beyond fourth-line therapy.
  • the meaning of these terms is known in the art and in accordance with the terminology that is commonly used by the US National Cancer Institute.
  • the method in accordance with the invention such as the method of cancer immunotherapy or the method of treating cancer by immunotherapy may, in one embodiment, be a method wherein in the method, an epigenetic modulator is also to be administered.
  • Epigenetic modulators in accordance with the invention can be BET inhibitors, histone acetyltransferase inhibitors, histone deacetylase inhibitors, or DNA methyltransferase inhibitors and are preferably selected from the group consisting of valproic acid, butyric acid, panobinostat lactate, belinostat, vorinostat, dacinostat, entinostat, mocetinostat, romidepsin, and ricolinostat.
  • binding refers to the capability to form a complex with a molecule that is to be bound (e.g. BCMA). Binding typically occurs non-covalently by intermolecular forces, such as ionic bonds, hydrogen bonds and Van der Waals forces and is typically reversible. Various methods and assays to determine binding capability are known in the art.
  • Binding is usually a binding with high affinity, wherein the affinity as measured in KQ values is preferably is less than 1 mM, more preferably less than 100 nM, even more preferably less than 10 nM, even more preferably less than 1 nM, even more preferably less than 100 pM, even more preferably less than 10 pM, even more preferably less than 1 pM.
  • a “combination” according to the invention is not limited to a particular mode of administration.
  • the immunotherapeutic agent or anticancer agent capable of binding to BCMA and the upregulator of BCMA mRNA levels can, for example, be administered separately but at the same time, or in one composition and at the same time, or they can be administered separately and at separate time points.
  • Whether a substance is an upregulator of BCMA mRNA levels can be determined by methods known in the art, e.g. by measuring BCMA mRNA levels in the cells of interest, e.g. in the cancer cells, by methods such as quantitative RT-PCR, e.g. as described herein in the section “Quantitation of BCMA mRNA levels”.
  • compositions and formulations in accordance with the present invention which contain the immunotherapeutic anticancer agent capable of binding to BCMA and/or the upregulator of BCMA mRNA levels, are prepared in accordance with known standards for the preparation of pharmaceutical compositions and formulations.
  • the compositions and formulations are prepared in a way that they can be stored and administered appropriately, e.g. by using pharmaceutically acceptable components such as carriers, excipients or stabilizers.
  • pharmaceutically acceptable components are not toxic in the amounts used when administering the pharmaceutical composition or formulation to a patient.
  • the pharmaceutical acceptable components added to the pharmaceutical compositions or formulations can be selected based on the chemical nature of the active agents (e.g.
  • compositions or formulations are suitable for administration to humans.
  • a pharmaceutically acceptable carrier including any suitable diluent or, can be used herein as known in the art.
  • pharmaceutically acceptable means being approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopia, European Pharmacopia or other generally recognized pharmacopia for use in mammals, and more particularly in humans.
  • Pharmaceutically acceptable carriers include, but are not limited to, saline, buffered saline, dextrose, water, glycerol, sterile isotonic aqueous buffer, and combinations thereof. It will be understood that the formulation will be appropriately adapted to suit the mode of administration.
  • the present invention is exemplified by the following non-limiting examples.
  • Peripheral blood and bone marrow samples were obtained from healthy donors and myeloma patients after written informed consent to participate in research protocols approved by the Institutional Review Boards of the University of Wiirzburg.
  • K562, OPM-2, NCI-H929 and MM.1S cell lines were obtained from the German Collection of Microorganisms and Cell Cultures (DSMZ, Braunschweig, Germany).
  • K562, OPM-2 and MM.1S cell lines were modified with firefly-luciferase_GFP by lentiviral transduction.
  • K562 expressing full-length human BCMA was generated by transducing the K562-ffluc cell line with a BCMA-encoding lentiviral vector.
  • Bone marrow mononuclear cells were stained with anti-CD38 and anti-CD138 mAbs (Biolegend, Koblenz, Germany) to identify malignant plasma cells and anti-BCMA mAb (BioLegend; Clone: 19F2) or isotype control (Biolegend; mouse lgG2a,K) according to the manufacturer’s instructions.
  • Flow cytometry was done on a Canto II (BD, Heidelberg, Germany) and data analyzed using FlowJo software (TreeStar, Ashland, OR).
  • Myeloma cells were cultured in RPMI-1640 (Gibco, Darmstadt, Germany) supplemented with 10% fetal bovine serum at 1x10 6 cells/ml.
  • ATRA Sigma-Aldrich, Darmstadt, Germany
  • RNAs were extracted with RNeasy Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer's protocol.
  • Reverse transcription -quantitative polymerase chain reaction (RT-qPCR) analysis of BCMA was performed with 1 g of total RNA and SuperscriptTM II Reverse Transcriptase (Thermo Fisher Scientific, Inc Massachusetts). The quality and integrity of the RNA was verified by a Bioanalyzer 2100 (Agilent Technologies, Santa Clara, CA).
  • primer sequences used were as follows: BCMA forward primer, 5'-TGT TCT TCT AAT ACT CCT CCT CT-3' (SEQ ID NO: 25) and reverse primer, 5'-AAC TCG TCC TTT AAT GGT TC-3' (SEQ ID NO: 26). Primers specific for b-actin were used as a control (forward, 5'-TCC ATC ATG AAG TGT GAC GT-3' (SEQ ID NO: 27) and reverse, 5'-GAG CAA TGATCTTGATCT TCA T-3' (SEQ ID NO: 28)).
  • RT-qPCR was performed in a 7900HT Real-time PCR System (Thermo Fisher Scientific, Inc Massachusetts) using Quantitec SYBR green Kit (Qiagen, Hilden, Germany) in a 7900 FIT Fast Real Time PCR System (Applied Biosystems, Foster City, CA).
  • PCR conditions consisted of the following: 95 ° C for 3 min for denaturation; 95 ° C for 30 sec for annealing; and 62 ° C for 40 sec for extension, for 40 cycles.
  • the threshold cycle for each sample was selected from the linear range and converted to a starting quantity by interpolation from a standard curve generated on the same plate for each set of primers.
  • the BCMA messenger (m) RNA levels were normalized for each well to the b-actin mRNA levels using the 2-MCq method (21).
  • ATRA up-regulates BCMA expression on MM.1S in vivo
  • mice Six- to eight-week old female NSG (NOD-scid IL2rynull) mice were obtained from Charles River and inoculated by tail vein injection with 2x10 6 MM.1S/ffluc_GFP at day 0 and randomly allocated to ATRA-treatment and control group.
  • ATRA Sigma Aldrich, Darmstadt, Germany
  • i.p intraperitoneal
  • mice bone marrow samples of these mice were analyzed to study BCMA expression on MM.1S by a Canto II (BD, Heidelberg, Germany) and data analyzed using FlowJo software (TreeStar, Ashland, OR).
  • mice were inoculated by tail vein injection with 2x10 6 MM.1S/ffluc_GFP on day 0 and randomly allocated to treatment and control groups. On day 14, mice received a single dose of 1 c 10 6 T-cells (i.e., 0.5x10 6 CD4 + and 0.5x10 6 CD8 + ) by tail vein injection.
  • 1 c 10 6 T-cells i.e., 0.5x10 6 CD4 + and 0.5x10 6 CD8 +
  • ATRA (Sigma Aldrich, Darmstadt, Germany) was diluted in DMSO, formulated in PEG300, Tween80 and saline and administered by intraperitoneal injection (i.p) at a dose of 30 mg/kg from Monday to Friday for 16 days, starting twelve days after tumor inoculation.
  • GSI LY3039478 (Med Chem Express, NJ 08852, USA) was diluted in DMSO, formulated in PEG300, Tween80 and saline and administered by intraperitoneal injection (i.p) at a dose of 1 mg/kg Monday, Wednesday and Friday for 16 days, starting twelve days after tumor inoculation.
  • Bioluminescence imaging was performed on an IVIS Lumina (Perkin Elmer, Waltham, MA) following i.p injection of D-luciferin (0.3mg/g body weight) (Biosynth, Staad, Switzerland), and data was analyzed using Living Image software (Perkin Elmer).
  • Example 1 ATRA augments BCMA surface expression on myeloma cell lines
  • the inventors determined BCMA expression on three commonly utilized myeloma cell lines by flow cytometry and found graded BCMA expression with MM.1S being BCMA
  • BCMA expression had increased in all three myeloma cell lines, and that the hierarchy in BCMA expression had remained unchanged: MM.1S (deltaMFI: 2,709) ⁇ OPM-2 (deltaMFI: 7,358) ⁇ NCI-H929 (deltaMFI: 13,891) (Fig. 1).
  • the inventors normalized the deltaMFI obtained at baseline to 1 and thus, the relative increase in BCMA expression after ATRA treatment was 1.9-fold in MM.1S (Fig. 2) and OPM-2 myeloma cells (Fig. 2), and 1.7-fold in NCI-H929 myeloma cells (Fig. 2).
  • BCMA expression Upon discontinuation of ATRA treatment, BCMA expression returned to baseline levels within 72 hours in all three myeloma cell lines, but increased again with the same amplitude when ATRA treatment was recommenced (Fig. 4).
  • the increase of BCMA surface molecules on MM.1S cells after ATRA treatment was additionally confirmed by single-molecule sensitive superresolution microscopy using direct Stochastic Optical Reconstruction Microscopy dSTORM (Fig. 3). The inventors hypothesized that ATRA induces epigenetic changes in myeloma cells that lead to increased BCMA gene expression and confirmed by qPCR that this was indeed the case.
  • Example 2 ATRA up-regulates BCMA surface expression on primary myeloma cells
  • Patients in the R/R cohort had previously received treatment with immunomodulatory drugs and/or proteasome inhibitors, none of the patients had received anti-BCMA therapy.
  • Example 3 ATRA in combination with GSI further increases BCMA expression on myeloma cells lines
  • GSI can induce an increase in BCMA expression on myeloma cells, as they prevent shedding of BCMA molecules from the cell surface 40 .
  • the inventors determined whether the combination of ATRA and GSI can further increase BCMA expression on myeloma cells and if it can further improve the anti-myeloma reactivity of BCMA-CAR T-cells beyond the effect of ATRA alone.
  • the combination of both drugs resulted in higher BCMA expression than the single use of one of the two drugs alone (Fig. 10).
  • ATRA treatment had no negative effect on the viability of BCMA-CAR T-cells (Fig. 11), and did not diminish expression of the EGFRt_BCMA-CAR transgene (Fig. 12).
  • BCMA-CAR T-cells could be further enhanced when the MM.1 S target cells were previously treated with a combination of ATRA and GSI (Fig. 13). Similar results were obtained for OPM-2 cells (Fig. 14). Additionally, BCMA-CAR T-cells showed enhanced proliferative capacity (Fig. 15) and cytokine release (Fig. 16), when the target cells were pretreated with ATRA alone or a combination of ATRA and GSI.
  • BCMA-targeting immunotherapies can benefit not only from treatment with ATRA alone, but even more from a combination treatment with GSI and ATRA.
  • Example 5 sBCMA does not compromise BCMA-CAR T-cell function against ATRA-treated myeloma cells It is well established that the extracellular portion of membrane-bound BCMA can be shed from myeloma cells to release a shorter, soluble BCMA (sBCMA) protein isoform 26 ’ 27 .
  • the inventors measured sBCMA and in the supernatants of MM.1S and OPM-2 myeloma cells that had been treated with ATRA for 72 hours and obtained similar values as in the corresponding non-treated cell lines (Fig. 19).
  • the concentration of sBCMA in conditioned medium of ATRA-treated or untreated MM.1S and OPM-2 myeloma cells was higher than in serum from myeloma patients (Fig. 20).
  • the inventors analyzed the cytolytic activity of BCMA-CAR T-cells in fresh or sBCMA-containing medium and observed similarly potent cytolytic activity against MM.1S or K562/BCMA target cells at all effector to target cell ratios and time points (Fig. 21).
  • BCMA-CAR therapy is applicable for both disease conditions.
  • BCMA-CAR T-cells 40 Enhanced anti-myeloma efficacy of BCMA-CAR T-cells after BCMA upregulation by ATRA treatment was confirmed. This synergistic effect between CAR T-cell therapy and ATRA could be used as strategy to counteract the outgrowth of antigen-low tumor cell clones, sustaining the therapeutic efficacy of BCMA-CAR T-cells. Furthermore, patients with low BCMA baseline expression could be treated with ATRA and then successfully with BCMA-CAR T-cells. Additionally, BCMA expression on tumor cells could be further enhanced by combining ATRA with GSI administration.
  • the inventors analyzed serum samples from MM patients for sBCMA and found a correlation between the concentration of soluble BCMA and the disease status. In line with previous reports, the serum sBCMA levels were higher among patients with progressive disease than in patients with a therapeutic response to immunomodulatory or proteasome inhibitor therapy, or low tumor burden 27 .
  • the inventors wanted to know whether sBCMA could abrogate the anti-myeloma function of these BCMA-CAR T-cells in principle. Therefore, they tested CAR T-cell functionality in the presence of up to 150 ng/ml sBCMA, which is about ten times the average concentration the inventors observed in the serum of patients with progressive disease. Even with this high concentration the inventors could not find sBCMA having a negative impact on the cytolytic activity of these BCMA-CAR T-cells.
  • retinoids such as ATRA can be used synergistically with BCMA-CAR T-cells in a clinical setting to increase response rates and extend duration of responses in ND and R/R myeloma.
  • the use of a well-chosen CAR construct might reduce negative impacts by sBCMA molecules in the serum of patients.
  • the effect of BCMA up-regulation and BCMA-CAR T-cell targeting is even greater when not only using ATRA, but a combination of ATRA and GSI.
  • the immunotherapeutic agent and retinoids as used according to the invention can be industrially manufactured and sold as products for the claimed methods and uses (e.g. for treating a cancer as defined herein), in accordance with known standards for the manufacture of pharmaceutical and diagnostic products. Accordingly, the present invention is industrially applicable.
  • nucleotide sequences are indicated in a 5’-to-3’ order.
  • amino acid sequences are indicated in an N-to-C-terminal order using the three-letter amino acid code.
  • Nucleotide sequence of the (4GS)3 linker (SEQ ID NO: 4): GGAGGCGGAGGCT CCGGAGGGGGAGGAT CT GGGGGAGGCGGAAGC
  • Nucleotide sequence of the 4-1 BB cytoplasmic domain (SEC ID NO: 8):
  • Lys Arg Gly Arg Lys Lys Leu Leu Tyr lie Phe Lys Gin Pro Phe Met Arg Pro Val Gin Thr Thr Gin Glu Glu Asp Gly Cys Ser Cys Arg Phe Pro Glu Glu Glu Glu Gly Gly Cys Glu Leu
  • Lys Arg Gly Arg Lys Lys Leu Leu Tyr lie Phe Lys Gin Pro Phe Met Arg Pro Val Gin Thr Thr Gin Glu Glu Asp Gly Cys Ser Cys Arg Phe Pro Glu Glu Glu Glu Gly Gly Cys Glu Leu
  • the chimeric antigen receptor (CAR) capable of binding to BCMA is the chimeric antigen receptor (CAR) encoded by the nucleotide sequence of SEQ ID NO: 1 or by a nucleotide sequence at least 95% identical thereto.
  • the chimeric antigen receptor (CAR) capable of binding to BCMA has the amino acid sequence of SEQ ID NO: 13 or an amino acid sequence at least 95% identical thereto.
  • a novel BCMA/CD3 bispecific T- cell engager for the treatment of multiple myeloma induces selective lysis in vitro and in vivo.
  • T cells expressing an anti-B-cell maturation antigen chimeric antigen receptor cause remissions of multiple myeloma.
  • T Cells Genetically Modified to Express an Anti-B-Cell Maturation Antigen Chimeric Antigen Receptor Cause Remissions of Poor-Prognosis Relapsed Multiple Myeloma. Journal of clinical oncology: official journal of the American Society of Clinical Oncology 2018; 36(22): 2267-2280. doi:

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Immunology (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Microbiology (AREA)
  • Mycology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Cell Biology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Oncology (AREA)
  • Endocrinology (AREA)
  • Biomedical Technology (AREA)
  • Toxicology (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Emergency Medicine (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)

Abstract

The invention relates to combination therapies of ATRA and other retinoids with immunotherapeutic agents binding to BCMA such as CAR-T cells capable of binding to BCMA, antibodies capable of binding to BCMA or antibody fragments capable of binding to BCMA. According to the invention, these combination therapies can be advantageously applied to the treatment of cancers such as multiple myeloma and can also be applied to the treatment of antibody-mediated autoimmune diseases. The combination therapies in the treatment of cancers according to the present invention are advantageous, for instance, because retinoids such as ATRA can upregulate BCMA mRNA levels as well as BCMA protein levels in cancer cells, such that the cancer cells can be more effectively targeted by immunotherapeutic anticancer agents capable of binding to BCMA such as CAR-T cells capable of binding to BCMA, antibodies capable of binding to BCMA or antibody fragments capable of binding to BCMA.

Description

Combination Therapy of ATRA or other Retinoids with Immunotherapeutic Agents binding to BCMA
FIELD OF THE INVENTION
The invention relates to combination therapies of ATRA and other retinoids with immunotherapeutic agents binding to BCMA such as CAR-T cells capable of binding to BCMA, antibodies capable of binding to BCMA or antibody fragments capable of binding to BCMA. According to the invention, these combination therapies can be advantageously applied to the treatment of cancers such as multiple myeloma and can also be applied to the treatment of antibody-mediated autoimmune diseases. The combination therapies in the treatment of cancers according to the present invention are advantageous, for instance, because retinoids such as ATRA can upregulate BCMA mRNA levels as well as BCMA protein levels in cancer cells, such that the cancer cells can be targeted more effectively by immunotherapeutic anticancer agents capable of binding to BCMA such as CAR-T cells capable of binding to BCMA, antibodies capable of binding to BCMA or antibody fragments capable of binding to BCMA. Additionally, ATRA and other retinoids can be combined with gamma-secretase inhibitors and BCMA-targeting immunotherapeutic agents, leading to an even further increased BCMA expression on the target cells and therefore, even better immunotherapeutic response.
BACKGROUND OF THE INVENTION
Multiple myeloma (MM) is a largely incurable hematologic disease characterized by uncontrolled clonal proliferation of malignant plasma cells in the bone marrow1·2. Despite recent approval of several new therapeutics myeloma is still considered of not being curable. The majority of patients becomes refractory or has to discontinue treatment due to toxicity and ultimately succumbs to the disease3 5.
Since CAR T-cells have been shown to induce durable complete remissions in other advanced hematologic malignancies like acute lymphocytic leukemia (ALL) and diffuse large B-cell lymphoma (DLBCL), significant efforts are underway to develop CAR-based therapies for MM6 10. Recently, B cell maturation antigen (BCMA) has increasingly drawn attention as a possible target antigen for MM treatment2· 11· 12. BCMA is a tumor necrosis family receptor (TNFR) that is expressed by MM cells. It is also found on some healthy hematopoietic cells, such as plasma cells and plasmacytoid dendritic cells, but not on cells from healthy solid tissues. The favorable expression profile has fostered the development of a remarkable armamentarium of BCMA-specific immunotherapies including CAR T cell therapies13 19. In recent phase I/ll clinical trials BCMA-CAR T-cells achieved partial and complete responses in fractions of MM patients16· 19. Retinoic acids can influence gene expression and protein production of cells20. The use of all-trans retinoic acid (ATRA) has been widely investigated as treatment for some cancer types and it was shown, that it can induce major changes in post-translational modifications such as histone acetylation in tumor cells21 24. Treatment with ATRA also induces epigenetic changes in MM cells, leading to enhanced expression of CD38 and subsequently enhanced efficacy of the CD38-targeting antibody daratumumab22’ 25.
Administration of gamma-secretase inhibitors (GSI) can also increase BCMA expression on MM cells, by blocking BCMA cleavage by the ubiquitous multi-subunit y-secretase complex, leading to improved MM cell recognition by BCMA-CAR-T cells40.
Prior to the present invention, there remained a need in the art for more effective cancer therapies including therapies for multiple myeloma.
DESCRIPTION OF THE INVENTION
The inventors have investigated if epigenetic changes induced by ATRA influence the BCMA surface expression and the release of soluble BCMA (BCMAs) molecules by cancer cells and in particular by MM cells. Furthermore, it was analyzed if these ATRA-induced changes also affect the efficacy of BCMA-CAR T-cells.
B cell maturation antigen (BCMA) is preferentially expressed by B lineage cells, including multiple myeloma (MM) cells. Due to its favorable expression pattern it represents a promising target for chimeric antigen receptor (CAR) therapy. Clinical trials with BCMA-CAR T-cells are currently running and achieved first encouraging results. However, there are several therapeutic limitations, such as low or non-uniform BCMA expression, as well as tumor relapse after antigen-loss or down-regulation. To overcome these hurdles, the inventors aimed to increase overall BCMA expression on cancer cells such as MM cells.
The inventors investigated the potential of all-trans retinoic acid (ATRA) to up-regulate BCMA on MM cells, thereby enhancing the performance of BCMA-specific CAR T-cells. By using quantitative RT-PCR and flow cytometry, it was observed that co-incubation with the retinoid ATRA can induce a significant increase of BCMA RNA levels and BCMA surface expression on primary MM cells and myeloma cell lines.
Importantly, BCMA-specific CAR T-cells showed enhanced recognition and lysis of target cell lines, when these were pretreated with ATRA. Cytokine release and proliferation of BCMA-CAR T-cells were enhanced after stimulation with ATRA-treated target cells in comparison to untreated target cells. Even in MM1.S/NSG mice, BCMA was up-regulated on the surface of tumor cells when the animals were injected with ATRA for several days. A combinatorial treatment with ATRA and BCMA-specific CAR T- cells led to a distinct and prolonged decline of tumor mass in comparison to single agent treatment.
In addition it was shown, that the effect of BCMA up-regulation on target cell lines can be further enhanced by combining ATRA with gamma secretase inhibitors (GSI). By combining the administration of both drugs, the efficiency of BCMA-CAR T-cells was increased even further in vitro and in vivo. Thus, the combined application of the two agents GSI and ATRA leads to an even greater effect regarding BCMA up-regulation and recognition by BCMA-CAR-T cells.
According to the invention, retinoids such as ATRA can be used to enhance BCMA-targeting immunotherapies, e.g., by increasing the BCMA baseline expression on tumor cells and by keeping it at a high level during the therapy.
Although the retinoid ATRA led to enhanced expression of BCMA on the surface of myeloma cells, no increase in shed soluble BCMA (sBCMA) was found in supernatants of ATRA-treated cells. This was an unexpected favorable effect of the retinoid ATRA, because 1) sBCMA is constantly found in the serum of myeloma patients and was thus expected to be increased upon treatment with ATRA, and because 2) an increase in sBCMA should be avoided because it may interfere with and inhibit the efficacy of BCMA- directed anticancer therapies.
Nevertheless, the inventors confirmed that the anti-MM reactivity of their BCMA CAR is not inhibited in the presence of high concentrations of sBCMA that may occur at a later time point of ATRA treatment and which is constantly found in the serum of myeloma patients.
According to the invention, the advantageous upregulation of BCMA can not only be achieved with ATRA but can also be achieved with other retinoids. These retinoids are considered to share the same more of action (e.g. as specific epigenetic modulators) and can therefore be used in accordance with the present invention.
The studies made by the inventors illustrate the advantageous effects of combining retinoids such as ATRA and immunotherapeutic agents capable of binding to BCMA such as BCMA-CAR T-cells for cancer treatment such as the treatment of myeloma.
Further, according to the invention, such combination therapies can also be advantageously applied to the treatment of antibody-mediated autoimmune diseases. Antibodies are secreted by B cells, mostly by plasma cells which are differentiated B cells. Autoantibodies are antibodies binding to the individual’s own proteins and can induce autoimmune diseases (such as lupus erythematosus). Therefore, B cells and especially plasma cells can act as therapeutic targets for treatment of such autoimmune diseases. Several monoclonal antibodies against CD19, CD20 and CD22 have already been used to target multiple B cell subtypes. The CD20-targeting antibody Rituximab is already approved for use in rheumatoid arthritis, granulomatosis with polyangiitis and microscopic polyangiitis. [K Hofmann, et. al, Front. Immunol., 23 April 2018, Targeting B Cells and Plasma Cells in Autoimmune Diseases, https://doi.org/10.3389/fimmu.2018.00835; A. Rubbert-Roth, et. al Efficacy and safety of various repeat treatment dosing regimens of rituximab in patients with active rheumatoid arthritis: results of a Phase III randomized study (MIRROR), Rheumatology, Volume 49, Issue 9, September 2010, Pages 1683-1693, https://doi.Org/10.1093/rheumatology/keq116].
B cell maturation antigen (BCMA) is preferentially expressed by B lineage cells including plasma cells. Therefore, according to the invention, antibody-mediated autoimmune diseases can also be treated with the immunotherapeutic agents capable of binding to BCMA according to the invention. Here, administration of an upregulator of BCMA mRNA levels according to the invention, e.g. a retinoid according to the invention, is expected to enhance the efficiency of the treatment. Instead of immunotherapeutic agents capable of binding to BCMA according to the invention, immunotherapeutic agents comprising a gene therapy vector encoding a chimeric antigen receptor (CAR) capable of binding to BCMA, said gene therapy vector being a gene therapy vector for the in vivo expression of said CAR in immune cells, can also be used in accordance with the invention.
The present invention is exemplified by the following preferred embodiments:
1. An immunotherapeutic anticancer agent capable of binding to BCMA for use in a method of cancer immunotherapy against BCMA as cancer antigen in a human patient, wherein the method is a method wherein an upregulator of BCMA mRNA levels is to be administered to the human patient.
2. An upregulator of BCMA mRNA levels for use in a method of cancer immunotherapy against BCMA as cancer antigen in a human patient, wherein the method is a method wherein an immunotherapeutic anticancer agent capable of binding to BCMA is to be administered to the human patient.
3. A combination of an immunotherapeutic anticancer agent capable of binding to BCMA and an upregulator of BCMA mRNA levels for use in a method of cancer immunotherapy against BCMA as cancer antigen in a human patient.
4. A method of treating cancer by immunotherapy against BCMA as cancer antigen in a human patient, the method comprising administering an immunotherapeutic anticancer agent capable of binding to BCMA and an upregulator of BCMA mRNA levels to the human patient. The immunotherapeutic anticancer agent for use of item 1 , the upregulator for use of item 2, the combination for use of item 3, or the method of item 4, wherein the upregulator is a retinoid. The immunotherapeutic anticancer agent for use, the upregulator for use, the combination for use, or the method, of any one of items 1 to 5, wherein the retinoid is a non-aromatic retinoid. The immunotherapeutic anticancer agent for use, the upregulator for use, the combination for use, or the method, of item 6, wherein the non-aromatic retinoid is all-trans retinoic acid (ATRA), isotretionin (13-cis-retinoic acid), alitretinoin (9-cis- retinoic acid), retinal or retinol. The immunotherapeutic anticancer agent for use, the upregulator for use, the combination for use, or the method, of any one of items 1 to 7, wherein the upregulator is all-trans retinoic acid (ATRA). The immunotherapeutic anticancer agent for use, the upregulator for use, the combination for use, or the method, of item 5, wherein the retinoid is an aromatic retinoid. The immunotherapeutic anticancer agent for use, the upregulator for use, the combination for use, or the method, of item 9, wherein the aromatic retinoid is a monoaromatic retinoid, preferably acitretin, etretinate or motretinid. The immunotherapeutic anticancer agent for use, the upregulator for use, the combination for use, or the method, of item 9, wherein the aromatic retinoid is a polyaromatic retinoid, preferably adapalene, arotinoid, an acetylene retinoid such as tazarotene, or bexarotene. The immunotherapeutic anticancer agent for use, the upregulator for use, the combination for use, or the method, of any one of items 1 to 11, wherein the cancer is a cancer susceptible to upregulation of BCMA mRNA levels by said upregulator. The immunotherapeutic anticancer agent for use, the upregulator for use, the combination for use, or the method, of any one of items 1 to 12, wherein the cancer is a hematological cancer, preferably leukemia, lymphoma, or multiple myeloma. The immunotherapeutic anticancer agent for use, the upregulator for use, the combination for use, or the method, of any one of items 1 to 13, wherein the cancer is a cancer in which some or all of the cancer cells express BCMA. The immunotherapeutic anticancer agent for use, the upregulator for use, the combination for use, or the method, of any one of items 1 to 14, wherein the cancer is a multiple myeloma, a B- cell leukemia or a B-cell lymphoma. The immunotherapeutic anticancer agent for use, the upregulator for use, the combination for use, or the method, of any one of items 1 to 15, wherein the cancer is a multiple myeloma. The immunotherapeutic anticancer agent for use, the upregulator for use, the combination for use, or the method, of any one of items 1 to 16, wherein the immunotherapeutic anticancer agent capable of binding to BCMA comprises immune cells expressing a chimeric antigen receptor (CAR) capable of binding to BCMA. The immunotherapeutic anticancer agent for use, the upregulator for use, the combination for use, or the method, of item 17, wherein the immune cells expressing the CAR capable of binding to BCMA are T cells expressing the CAR capable of binding to BCMA (CAR-T cells capable of binding to BCMA). The immunotherapeutic anticancer agent for use, the upregulator for use, the combination for use, or the method, of any one of items 1 to 18, wherein the immunotherapeutic anticancer agent capable of binding to BCMA comprises an antibody capable of binding to BCMA or an antibody fragment capable of binding to BCMA, and wherein said antibody or antibody fragment is preferably a bispecific antibody which is more preferably selected from a BiTE or a DART. The immunotherapeutic anticancer agent for use, the upregulator for use, the combination for use, or the method, of item 19, wherein antibody capable of binding to BCMA or antibody fragment capable of binding to BCMA is a conjugate with a drug. The immunotherapeutic anticancer agent for use, the upregulator for use, the combination for use, or the method, of item 20, wherein the drug is an anticancer drug. The immunotherapeutic anticancer agent for use, the upregulator for use, the combination for use, or the method, of any one of items 17 or 18, wherein the use leads to prolonged persistence of the immune cells and/or prolonged decline of tumor mass, compared to the cancer immunotherapy with the immune cells alone. The immunotherapeutic anticancer agent for use, the upregulator for use, the combination for use, or the method, of any one of items 1 to 22, wherein the cancer is relapsed and refractory multiple myeloma or newly diagnosed multiple myeloma. The immunotherapeutic anticancer agent for use, the upregulator for use, the combination for use, or the method, of any one of items 1 to 23, wherein in the method, a gamma secretase inhibitor is to be administered. The immunotherapeutic anticancer agent for use, the upregulator for use, the combination for use, or the method, of item 24, wherein the gamma secretase inhibitor is semagacestat (LY 450139), crenigacestat (LY3039478), RO4929097, DAPT or MK-0752. An immunotherapeutic agent capable of binding to BCMA for use in a method of treating an antibody-mediated autoimmune disease in a human patient, wherein the method is a method wherein an upregulator of BCMA mRNA levels is to be administered to the human patient. An upregulator of BCMA mRNA levels for use in a method of treating an antibody-mediated autoimmune disease in a human patient, wherein the method is a method wherein an immunotherapeutic agent capable of binding to BCMA is to be administered to the human patient. A combination of an immunotherapeutic agent capable of binding to BCMA and an upregulator of BCMA mRNA levels for use in a method of treating an antibody-mediated autoimmune disease in a human patient. A method of treating an antibody-mediated autoimmune disease in a human patient, the method comprising administering an immunotherapeutic agent capable of binding to BCMA and an upregulator of BCMA mRNA levels to the human patient. The immunotherapeutic agent for use of item 26, the upregulator for use of item 27, the combination for use of item 28, or the method of item 29, wherein the upregulator is as defined in any one of items 5-11. The immunotherapeutic agent for use, the upregulator for use, the combination for use, or the method, of any one of items 26 to 30, wherein the immunotherapeutic agent capable of binding to BCMA comprises immune cells expressing a chimeric antigen receptor (CAR) capable of binding to BCMA. The immunotherapeutic agent for use, the upregulator for use, the combination for use, or the method, of item 31, wherein the immune cells expressing the CAR capable of binding to BCMA are T cells expressing the CAR capable of binding to BCMA (CAR-T cells capable of binding to BCMA). The immunotherapeutic agent for use, the upregulator for use, the combination for use, or the method, of any one of items 26 to 32, wherein the immunotherapeutic agent capable of binding to BCMA comprises an antibody capable of binding to BCMA or an antibody fragment capable of binding to BCMA. The immunotherapeutic agent for use, the upregulator for use, the combination for use, or the method, of item 33, wherein antibody capable of binding to BCMA or antibody fragment capable of binding to BCMA is a conjugate with a drug. The immunotherapeutic agent for use, the upregulator for use, the combination for use, or the method, of item 34, wherein the drug is a cytotoxic drug. The immunotherapeutic agent for use, the upregulator for use, the combination for use, or the method, of any one of items 26-35, wherein the antibody-mediated autoimmune disease is Graves’ disease, myasthenia gravis, lupus erythematosus, rheumatoid arthritis, goodpasture syndrome, scleroderma, CREST syndrome, granulomatosis with polyangiitis, microscopic polyangiitis, pemphigus vulgaris, Sjogren’s syndrome, diabetes mellitus type 1, primary biliary cholangitis, Hashimoto’s thyreoiditis, neuromyelitis optica spectrum disorders, anti-NMDA receptor encephalitis, vasculitis or multiple sclerosis. An immunotherapeutic anticancer agent comprising a gene therapy vector encoding a chimeric antigen receptor (CAR) capable of binding to BCMA, said gene therapy vector being a gene therapy vector for the in vivo expression of said CAR in immune cells, for use in a method of cancer immunotherapy against BCMA as cancer antigen in a human patient, wherein the method is a method wherein an upregulator of BCMA mRNA levels is to be administered to the human patient. An upregulator of BCMA mRNA levels for use in a method of cancer immunotherapy against BCMA as cancer antigen in a human patient, wherein the method is a method wherein an immunotherapeutic anticancer agent is to be administered to the human patient, said immunotherapeutic anticancer agent comprising a gene therapy vector encoding a chimeric antigen receptor (CAR) capable of binding to BCMA, said gene therapy vector being a gene therapy vector for the in vivo expression of said CAR in immune cells. A combination of an immunotherapeutic anticancer agent and an upregulator of BCMA mRNA levels for use in a method of cancer immunotherapy against BCMA as cancer antigen in a human patient, said immunotherapeutic anticancer agent comprising a gene therapy vector encoding a chimeric antigen receptor (CAR) capable of binding to BCMA, said gene therapy vector being a gene therapy vector for the in vivo expression of said CAR in immune cells.
40. A method of treating cancer by immunotherapy against BCMA as cancer antigen in a human patient, the method comprising administering an immunotherapeutic anticancer agent and an upregulator of BCMA mRNA levels to the human patient, said immunotherapeutic anticancer agent comprising a gene therapy vector encoding a chimeric antigen receptor (CAR) capable of binding to BCMA, said gene therapy vector being a gene therapy vector for the in vivo expression of said CAR in immune cells.
41. The immunotherapeutic anticancer agent for use, the upregulator for use, the combination for use, or the method, of any one of items 37-40, wherein the upregulator is as defined in any one of items 5-11.
42. The immunotherapeutic anticancer agent for use, the upregulator for use, the combination for use, or the method, of any one of items 37-41, wherein the cancer is as defined in any one of items 12-16 or 23.
43. The immunotherapeutic anticancer agent for use, the upregulator for use, the combination for use, or the method, of any one of items 37-42, wherein in the method, a gamma secretase inhibitor is to be administered, and wherein the gamma secretase inhibitor is as defined in items 24 or 25.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1. ATRA treatment leads to enhanced BCMA-expression on myeloma cell lines.
Flow cytometric analysis of BCMA-expression on MM.1S, OPM-2 and NCI-H929 cell lines that had been cultured in the absence or presence of 50 nM ATRA for 72 hours. Shaded histogram shows staining with anti-BCMA mAb, white histogram shows staining with isotype control antibody. 7-AAD was used to exclude dead cells from analysis. Inset number states the absolute difference in MFI of treated and non- treated cells to isotype.
Figure 2. ATRA treatment leads to enhanced BCMA-expression on MM.1S, OPM-2 and NCI-H929 cells. Bar diagrams show relative increase of BCMA expression on ATRA-treated myeloma cell lines normalized to untreated cells. Bar diagrams show mean values +SD (n=3). P-values between indicated groups were calculated using unpaired t-test. *p<0.05
Figure 3. ATRA treatment leads to enhanced BCMA-expression on MM.1S cells.
Representative photographs of BCMA molecule distribution on untreated and ATRA-treated MM.1S cells visualized by direct stochastic optical reconstruction microscopy (dSTORM).
Figure 4. BCMA upregulation by ATRA is reversible on myeloma cell lines.
The overlay histogram shows BCMA expression on untreated myeloma cell lines, 72 hours after ATRA treatment (50 nM), 24 hours after subsequent removal of the drug, and 72 hours after re-exposition to ATRA.
Figure 5. ATRA treatment leads to enhanced BCMA-RNA levels in myeloma cell lines.
BCMA RNA levels in MM.1S (n=4) and OPM-2 (n=3) by quantitative reverse transcription PCR (qRT- PCR) assay was quantified after incubation with increasing doses of ATRA for 48 hours. Depicted are mean values +SD. P-values between indicated groups were calculated using unpaired t-test. *p<0.05.
Figure 6. BCMA expression highly varies between myeloma patients.
Differential mean fluorescence intensity (MFI) of BCMA and isotype control staining is shown on CD38+ CD138+ myeloma cells from newly diagnosed (ND) and relapse/refractory (R/R) myeloma who had received previous treatment with immunomodulatory drugs and proteasome inhibitors (n=18). delta MFI is the differential MFI of BCMA and isotype control staining.
Figure 7. ATRA treatment leads to enhanced BCMA-expression on primary myeloma cells.
Flow cytometric analysis of BCMA-expression on primary myeloma cells that had been cultured in the absence or presence of ATRA for 72 hours. 7-AAD was used to exclude dead cells from analysis.
Figure 8. ATRA treatment leads to enhanced BCMA-expression on primary myeloma cells.
Bar diagram shows normalized BCMA expression on primary myeloma cells (n=5) before and after ATRA treatment. Depicted are mean values +SD. P-values between indicated groups were calculated using unpaired t-test. *p<0.05.
Figure 9. BCMA up-regulation by ATRA is reversible on primary myeloma cells.
The overlay histogram shows BCMA expression on untreated primary myeloma cells 72 hours after ATRA treatment (100 nM), 24 hours after subsequent removal of the drug, and 72 hours after reexposition to ATRA. 7-AAD was used to exclude dead cells from analysis. Figure 10. Combination of ATRA and GSI treatment leads to enhanced BCMA-expression on MM.1S and OPM-2 cells.
Bar diagram shows BCMA expression on MM.1S cells (n=5) and OPM-2 cells (n=3) after treatment with 100 nM ATRA and/or 0.01 mM GSI LY3039478 for 72 hours. Depicted are mean values +SD. P-values between indicated groups were calculated using unpaired t-test. *p<0.05
Figure 11. ATRA treatment does not affect the viability of BCMA-CAR T-cells.
Viability of BCMA CD4+ and CD8+ CAR T-cells after incubation with increasing doses of ATRA for 72 hours determined by flow cytometry. The bar diagram shows the percentage of viable (7-AAD-) T cells after ATRA-treatment normalized to untreated cells. Data are presented as mean values +SD (n=3).
Figure 12. ATRA treatment does not affect the CAR expression on BCMA-CAR T-cells.
EGFR BCMA-CAR transgene expression of BCMA CD4+ and CD8+ CAR T-cells after incubation with increasing doses of ATRA for 72 hours determined by flow cytometry. The bar diagram shows the percentage of EGFRt+ T cells after ATRA-treatment normalized to untreated cells. Data are presented as mean values +SD (n=3).
Figure 13. BCMA-CAR T-cells confer enhanced cytotoxicity against ATRA or ATRA+GSI-treated MM.1S in vitro.
Myeloma cell lines were incubated with 100 nM ATRA and/or 0.01 uM GSI for 72 hours or were left untreated. Cytolytic activity of CD8+ BCMA-CAR T-cells was determined in a bioluminescence-based assay after 4h of co-incubation with target cells. Assay was performed in triplicate wells with 5,000 target cells per well. Data are presented as mean values +SD of n=4 independent experiments. P- values between indicated groups were calculated using unpaired t-test. *p<0.05
Figure 14. BCMA-CAR T-cells confer enhanced cytotoxicity against ATRA or ATRA+GSI-treated OPM-2 in vitro.
Myeloma cell lines were incubated with 100 nM ATRA and/or 0.01 uM GSI for 72 hours or were left untreated. Cytolytic activity of CD8+ BCMA-CAR T-cells was determined in a bioluminescence-based assay after 4h of co-incubation with target cells. Assay was performed in triplicate wells with 5,000 target cells per well. Data are presented as mean values +SD of n=4 independent experiments. P- values between indicated groups were calculated using unpaired t-test. *p<0.05
Figure 15. BCMA-CAR T-cells confer enhanced proliferative reactivity after stimulation with ATRA or ATRA+GSI-treated MM.1S in vitro. MM.1S were incubated with 100 nM ATRA and/or 0.01 uM GSI for 72 hours or were left untreated. Afterwards, CFSE-labeled BCMA-CAR T-cells were co-incubated with these target cells. Proliferative capacity of BCMA-CAR T-cells was determined after three days by measuring the reduction of CFSE- labeling in effector cells. Data are presented as mean values +SD of n=3 independent experiments. P- values between indicated groups were calculated using unpaired t-test. *p<0.05
Figure 16. BCMA-CAR T-cells confer enhanced cytokine release after stimulation with ATRA or ATRA+GSI-treated MM.1S in vitro.
MM.1S were incubated with 100 nM ATRA and/or 0.01 uM GSI for 72 hours or were left untreated. Afterwards, BCMA-CAR T-cells were co-incubated with these target cells for 20 hours. Cytokine release of BCMA-CAR T-cells was determined in the supernatant by ELISA. Assay was performed in triplicate wells. Data are presented as mean values +SD of n=3 independent experiments. P-values between indicated groups were calculated using unpaired t-test. *p<0.05
Figure 17. ATRA enhances BCMA expression on MM.1S in vivo.
NSG mice were inoculated with MM.1S cells. After twelve days, mice were i.p. injected with 30 mg/kg ATRA for 4 days. BCMA-expression on MM.1S cells obtained from bone marrow of untreated and ATRA-treated mice was analysed by flow cytometry.
Figure 18. Combinatorial treatments of ATRA and BCMA-CAR T-cells or ATRA, GSI and BCMA- CAR T-cells lead to enhanced eradication of MM.1S in vivo.
NSG mice were inoculated with 2 c 106 MM.1S cells (ffluc- 3FP+). 14 days later, they were treated with 1 x 106 BCMA-CAR T-cells (CD4+:CD8+ ratio = 1 :1). BCMA-CAR T-cells were given alone or in combination with ATRA (30 mg/kg body weight as i.p. injection), GSI LY3039478 (1 mg/kg body weight as i.p. injection) or both drugs. 12 doses of ATRA were injected between day 12 and day 27 (Monday- Friday). GSI was given within the same time span and mice received a total of 7 doses (each Monday, Wednesday and Friday). The average radiance of MM.1S signal was analyzed to assess myeloma progression/regression in each treatment group. Bioluminescence (BMI) values were obtained as photon/sec/cm2/sr in regions of interest encompassing the entire body of each mouse. A) Time course of the experiment. The grey box marks the time period in which GSI and ATRA were administered. B) Graphs show the percentage change of bioluminescence signal from baseline values derived on day 14. Each bar represents mean value per mouse group. n=3-6 mice per group
Figure 19. ATRA does not increase sBCMA in cell line supernatants.
Soluble BCMA concentration in the supernatant of MM.1S and OPM-2 cells after incubation with increasing doses of ATRA. Cell lines were cultured at 1x106/well for 24 hours. After incubation, supernatant was collected and analyzed by ELISA. The stimulation was performed in triplicates. Depicted are mean values +SD
Figure 20. sBCMA levels in the serum of myeloma patients increase with tumor burden.
Soluble BCMA concentration in the serum of MM patients. Peripheral blood from MM patients was collected. Centrifugation at 3,000 rpm for 10 min was performed to obtain the serum which was analyzed by ELISA (stimulation performed in triplicates). PD, progressive disease; SD, stable disease; PR, partial remission; CR, complete remission.
Figure 21. Soluble BCMA is not abrogating the effect of BCMA-CAR T-cells against ATRA-treated myeloma cells.
CD8+ BCMA-CAR T-cells were co-cultured with MM.1S or K562/BCMA target cells in absence or presence of 150 ng/ml of soluble BCMA. After 4 hours, luciferin was added to the culture and the cytotoxicity was evaluated with a bioluminescence-based assay. Data show mean values of technical triplicates ± SD.
Definitions and Embodiments
Unless otherwise defined below, the terms used in the present invention shall be understood in accordance with the common meaning known to the person skilled in the art.
Each publication, patent application, patent, and other reference cited herein is incorporated by reference in its entirety for all purposes to the extent that it is not inconsistent with the present invention. References are indicated by their reference numbers and their corresponding reference details which are provided in the “references” section.
The terms “KQ” or “KQ value” relate to the equilibrium dissociation constant as known in the art. In the context of the present invention, these terms can relate to the equilibrium dissociation constant of an immunotherapeutic agent or anticancer agent capable of binding to BCMA (e.g. a CAR T-cell or an antibody) with respect to the antigen of interest (i.e. BCMA). The equilibrium dissociation constant is a measure of the propensity of a complex (e.g. an antigen-targeting agent complex) to reversibly dissociate into its components (e.g. the antigen and the targeting agent). Methods to determine KQ values are known in art.
The chimeric antigen receptor is capable of binding to one or more antigens, preferably cancer antigens, more preferably cancer cell surface antigens. In a preferred embodiment, the chimeric antigen receptor is capable of binding to the extracellular domain of a cancer antigen. In a particularly preferred embodiment, the chimeric antigen receptor is capable of binding to the extracellular domain of BCMA and is even more preferably a chimeric antigen receptor encoded by the nucleic acid sequence of SEQ ID NO: 1 and/or a chimeric antigen receptor having the amino acid sequence of SEQ ID NO: 13.
In accordance with the invention, immune cells such as T cells, NK cells or PBMCs can be isolated from a patient, genetically modified (e.g. transduced) with a gene transfer vector encoding a chimeric antigen receptor according to the invention and administered to the patient in accordance with the methods and uses of the invention. In a preferred embodiment, the T cells are CD8+ T cells or CD4+ T cells. Alternatively, allogenic immune cells such as T cells, NK cells or PBMCs, from donors, preferably healthy donors, can be used. They can be genetically modified (e.g. transduced) with a gene transfer vector encoding a chimeric antigen receptor according to the invention and administered to the patient in accordance with the methods and uses of the invention. In a preferred embodiment, the T cells are CD8+T cells or CD4+T cells.
CAR NK cell therapy has been described, for instance, in [Liu E, et.al. Use of CAR-Transduced Natural Killer Cells in CD19-Positive Lymphoid Tumors. N Engl J Med. 2020 Feb 6;382(6):545-553. doi: 10.1056/NE JMoal 910607] .
For CAR T cell therapy, T cells are usually manipulated and expanded ex vivo. However, in accordance with the invention, there is also the option to conduct gene transfer in vivo. One way to program immune cells such as T cells within the body is the gene transfer with DNA-carrying nanoparticles. This has, for instance, been described by Smith et al. [T.T. Smith, et. al, In situ programming of leukaemia-specific T cells using synthetic DNA nanocarriers, Nat Nanotechnol. 2017 Aug; 12(8): 813-820. Published online 2017 Apr 17. doi: 10.1038/nnano.2017.57], A second strategy is the in vivo CAR immune cell (e.g. CAR T cell) generation with viral vectors. This has, for instance, been described by Agarwal et al. [Agarwal S, et. al, Oncoimmunology. 2019 Oct 10;8(12):e1671761. In vivo generated human CAR T cells eradicate tumor cells, doi: 10.1080/2162402X.2019.1671761],
“Immune cells” as used in the invention are not particularly limited and include, for example, T cells, NK cells or PBMCs. In a preferred embodiment, the T cells are CD8+T cells or CD4+T cells.
The term “antibody” as used herein refers to any functional antibody that is capable of specific binding to the antigen of interest. Without particular limitation, the term antibody encompasses antibodies from any appropriate source species, including avian such as chicken and mammalian such as mouse, goat, nonhuman primate and human. Preferably, the antibody is a humanized or human antibody. Humanized antibodies are antibodies which contain human sequences and a minor portion of non-human sequences which confer binding specificity to an antigen of interest (e.g. BCMA). The antibody is preferably a monoclonal antibody which can be prepared by methods well-known in the art. The term antibody encompasses an lgG-1, -2, -3, or -4, IgE, IgA, IgM, or IgD isotype antibody. The term antibody encompasses monomeric antibodies (such as IgD, IgE, IgG) or oligomeric antibodies (such as IgA or IgM). The term antibody also encompasses - without particular limitations - isolated antibodies and modified antibodies such as genetically engineered antibodies, e.g. chimeric antibodies or bispecific antibodies, or antibody conjugates with a drug such as an anticancer drug or a cytotoxic drug. A preferred bispecific antibody capable of binding to BCMA in accordance with the invention can be a T- cell engager such as a BiTE (Bi-specific T-cell engager), e.g. a CD3xBCMA BiTE, or a DART (dualaffinity re-targeting proteins). An “antibody” (e.g. a monoclonal antibody) or “a fragment thereof as described herein may have been derivatized or be linked to a different molecule. For example, molecules that may be linked to the antibody are other proteins (e.g. other antibodies), a molecular label (e.g. a fluorescent, luminescent, colored or radioactive molecule), a pharmaceutical and/or a toxic agent. The antibody or antigen-binding portion may be linked directly (e.g. in form of a fusion between two proteins), or via a linker molecule (e.g. any suitable type of chemical linker known in the art).
An antibody fragment or fragment of an antibody capable of binding to BCMA as used herein refers to a portion of an antibody that retains the capability of the antibody to specifically bind to the BCMA antigen. This capability can, for instance, be determined by determining the capability of the antigen-binding portion to compete with the antibody for specific binding to the antigen by methods known in the art. Without particular limitation, the antibody fragment can be produced by any suitable method known in the art, including recombinant DNA methods and preparation by chemical or enzymatic fragmentation of antibodies. Antibody fragments may be Fab fragments, F(ab’) fragments, F(ab’)2 fragments, single chain antibodies (scFv), single-domain antibodies, diabodies or any other portion(s) of the antibody that retain the capability of the antibody to specifically bind to the antigen.
Terms such as “treatment of cancer” or “treating cancer” or “cancer therapy” or “cancer immunotherapy” according to the present invention refer to a therapeutic treatment. An assessment of whether or not a therapeutic treatment works can, for instance, be made by assessing whether the treatment inhibits cancer growth in the treated patient or patients. Preferably, the inhibition is statistically significant as assessed by appropriate statistical tests which are known in the art. Inhibition of cancer growth may be assessed by comparing cancer growth in a group of patients treated in accordance with the present invention to a control group of untreated patients, or by comparing a group of patients that receive a standard cancer treatment of the art plus a treatment according to the invention with a control group of patients that only receive a standard cancer treatment of the art. Such studies for assessing the inhibition of cancer growth are designed in accordance with accepted standards for clinical studies, e.g. double-blinded, randomized studies with sufficient statistical power. The term “treating cancer” includes an inhibition of cancer growth where the cancer growth is inhibited partially (i.e. where the cancer growth in the patient is delayed compared to the control group of patients), an inhibition where the cancer growth is inhibited completely (i.e. where the cancer growth in the patient is stopped), and an inhibition where cancer growth is reversed (i.e. the cancer shrinks). An assessment of whether or not a therapeutic treatment works can be made based on known clinical indicators of cancer progression. In the context of cancers which do not form solid tumors, cancer growth may be assessed by known methods such as methods based on a counting of the cancer cells.
A “treatment of cancer” or “treating cancer” or “cancer therapy” or “cancer immunotherapy” as used in accordance with the present invention is preferably a treatment of the cancer itself. Alternatively, a “treatment of cancer” or “treating cancer” or “cancer therapy” or “cancer immunotherapy” in accordance with the invention can be a treatment of a precancerous condition which is preferably selected from multiple myeloma precursor states such as MGUS (Monoclonal Gammopathy of Undetermined Significance) and smoldering multiple myeloma.
A treatment of cancer according to the present invention does not exclude that additional or secondary therapeutic benefits also occur in patients, such as a treatment of amyloidosis, e.g. an amyloidosis associated with multiple myeloma.
The treatment of cancer according to the invention can be a first-line therapy, a second-line therapy, a third-line therapy, or a fourth-line therapy. The treatment can also be a therapy that is beyond fourth-line therapy. The meaning of these terms is known in the art and in accordance with the terminology that is commonly used by the US National Cancer Institute.
The method in accordance with the invention such as the method of cancer immunotherapy or the method of treating cancer by immunotherapy may, in one embodiment, be a method wherein in the method, an epigenetic modulator is also to be administered. Epigenetic modulators in accordance with the invention can be BET inhibitors, histone acetyltransferase inhibitors, histone deacetylase inhibitors, or DNA methyltransferase inhibitors and are preferably selected from the group consisting of valproic acid, butyric acid, panobinostat lactate, belinostat, vorinostat, dacinostat, entinostat, mocetinostat, romidepsin, and ricolinostat.
The term “capable of binding” as used herein refers to the capability to form a complex with a molecule that is to be bound (e.g. BCMA). Binding typically occurs non-covalently by intermolecular forces, such as ionic bonds, hydrogen bonds and Van der Waals forces and is typically reversible. Various methods and assays to determine binding capability are known in the art. Binding is usually a binding with high affinity, wherein the affinity as measured in KQ values is preferably is less than 1 mM, more preferably less than 100 nM, even more preferably less than 10 nM, even more preferably less than 1 nM, even more preferably less than 100 pM, even more preferably less than 10 pM, even more preferably less than 1 pM.
As used herein, each occurrence of terms such as “comprising” or “comprises” may optionally be substituted with “consisting of or “consists of”.
A “combination” according to the invention is not limited to a particular mode of administration. The immunotherapeutic agent or anticancer agent capable of binding to BCMA and the upregulator of BCMA mRNA levels can, for example, be administered separately but at the same time, or in one composition and at the same time, or they can be administered separately and at separate time points.
Whether a substance is an upregulator of BCMA mRNA levels can be determined by methods known in the art, e.g. by measuring BCMA mRNA levels in the cells of interest, e.g. in the cancer cells, by methods such as quantitative RT-PCR, e.g. as described herein in the section “Quantitation of BCMA mRNA levels”.
Compositions and formulations in accordance with the present invention, which contain the immunotherapeutic anticancer agent capable of binding to BCMA and/or the upregulator of BCMA mRNA levels, are prepared in accordance with known standards for the preparation of pharmaceutical compositions and formulations. For instance, the compositions and formulations are prepared in a way that they can be stored and administered appropriately, e.g. by using pharmaceutically acceptable components such as carriers, excipients or stabilizers. Such pharmaceutically acceptable components are not toxic in the amounts used when administering the pharmaceutical composition or formulation to a patient. The pharmaceutical acceptable components added to the pharmaceutical compositions or formulations can be selected based on the chemical nature of the active agents (e.g. the immunotherapeutic anticancer agent capable of binding to BCMA and/or the upregulator of BCMA mRNA levels), the particular intended use of the pharmaceutical compositions and the route of administration. It is understood that in accordance with the invention, the compositions or formulations are suitable for administration to humans.
A pharmaceutically acceptable carrier, including any suitable diluent or, can be used herein as known in the art. As used herein, the term “pharmaceutically acceptable” means being approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopia, European Pharmacopia or other generally recognized pharmacopia for use in mammals, and more particularly in humans. Pharmaceutically acceptable carriers include, but are not limited to, saline, buffered saline, dextrose, water, glycerol, sterile isotonic aqueous buffer, and combinations thereof. It will be understood that the formulation will be appropriately adapted to suit the mode of administration.
EXAMPLES
The present invention is exemplified by the following non-limiting examples.
The materials and methods used in the present examples were as follows:
Human subjects
Peripheral blood and bone marrow samples were obtained from healthy donors and myeloma patients after written informed consent to participate in research protocols approved by the Institutional Review Boards of the University of Wiirzburg.
Cell lines
The K562, OPM-2, NCI-H929 and MM.1S cell lines were obtained from the German Collection of Microorganisms and Cell Cultures (DSMZ, Braunschweig, Germany). K562, OPM-2 and MM.1S cell lines were modified with firefly-luciferase_GFP by lentiviral transduction. K562 expressing full-length human BCMA was generated by transducing the K562-ffluc cell line with a BCMA-encoding lentiviral vector.
Flow cytometry
Bone marrow mononuclear cells (BMMC) were stained with anti-CD38 and anti-CD138 mAbs (Biolegend, Koblenz, Germany) to identify malignant plasma cells and anti-BCMA mAb (BioLegend; Clone: 19F2) or isotype control (Biolegend; mouse lgG2a,K) according to the manufacturer’s instructions. Flow cytometry was done on a Canto II (BD, Heidelberg, Germany) and data analyzed using FlowJo software (TreeStar, Ashland, OR).
ATRA-treatment of myeloma cells
Myeloma cells were cultured in RPMI-1640 (Gibco, Darmstadt, Germany) supplemented with 10% fetal bovine serum at 1x106 cells/ml. ATRA (Sigma-Aldrich, Darmstadt, Germany) was reconstituted in dimethyl sulfoxide and added to the medium to a final concentration of 25, 50 or 100 nM.
In vitro T-cell functional assays
Cytolytic activity was analyzed in a bioluminescence-based assay using firefly-luciferase (ffluc)- transduced target cells. Proliferation was measured by dilution of CFSE proliferation dye by flow cytometry. Therefore, CFSE-labeled CAR T-cells were incubated with target cells for 72 h at a 4:1 effector to target cell ratio. IFNy and IL-2 were measured by ELISA (Biolegend, Koblenz, Germany) in supernatants obtained after a 20 hour co-culture of T-cells with target cells (effectontarget ratio=4:1).
Quantitation of BCMA mRNA levels Total RNAs were extracted with RNeasy Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer's protocol. Reverse transcription -quantitative polymerase chain reaction (RT-qPCR) analysis of BCMA was performed with 1 g of total RNA and Superscript™ II Reverse Transcriptase (Thermo Fisher Scientific, Inc Massachusetts). The quality and integrity of the RNA was verified by a Bioanalyzer 2100 (Agilent Technologies, Santa Clara, CA). The primer sequences used were as follows: BCMA forward primer, 5'-TGT TCT TCT AAT ACT CCT CCT CT-3' (SEQ ID NO: 25) and reverse primer, 5'-AAC TCG TCC TTT AAT GGT TC-3' (SEQ ID NO: 26). Primers specific for b-actin were used as a control (forward, 5'-TCC ATC ATG AAG TGT GAC GT-3' (SEQ ID NO: 27) and reverse, 5'-GAG CAA TGATCTTGATCT TCA T-3' (SEQ ID NO: 28)). RT-qPCR was performed in a 7900HT Real-time PCR System (Thermo Fisher Scientific, Inc Massachusetts) using Quantitec SYBR green Kit (Qiagen, Hilden, Germany) in a 7900 FIT Fast Real Time PCR System (Applied Biosystems, Foster City, CA). PCR conditions consisted of the following: 95°C for 3 min for denaturation; 95°C for 30 sec for annealing; and 62°C for 40 sec for extension, for 40 cycles. The threshold cycle for each sample was selected from the linear range and converted to a starting quantity by interpolation from a standard curve generated on the same plate for each set of primers. The BCMA messenger (m) RNA levels were normalized for each well to the b-actin mRNA levels using the 2-MCq method (21).
ATRA up-regulates BCMA expression on MM.1S in vivo
The University of Wiirzburg Institutional Animal Care and Use Committee approved all mouse experiments. Six- to eight-week old female NSG (NOD-scid IL2rynull) mice were obtained from Charles River and inoculated by tail vein injection with 2x106 MM.1S/ffluc_GFP at day 0 and randomly allocated to ATRA-treatment and control group. ATRA (Sigma Aldrich, Darmstadt, Germany) was formulated in corn oil and administered by intraperitoneal (i.p) injection (30 mg/kg) for four days, starting twelve days after tumor inoculation. At the experiment end point on day 16, bone marrow samples of these mice were analyzed to study BCMA expression on MM.1S by a Canto II (BD, Heidelberg, Germany) and data analyzed using FlowJo software (TreeStar, Ashland, OR).
In vivo experiment with combined ATRA and GSI
To examine the combinatorial treatment with BCMA-CAR T-cells, ATRA and GSI female NSG (NOD- scid IL2rynull) mice were inoculated by tail vein injection with 2x106 MM.1S/ffluc_GFP on day 0 and randomly allocated to treatment and control groups. On day 14, mice received a single dose of 1 c 106 T-cells (i.e., 0.5x106 CD4+ and 0.5x106 CD8+) by tail vein injection. ATRA (Sigma Aldrich, Darmstadt, Germany) was diluted in DMSO, formulated in PEG300, Tween80 and saline and administered by intraperitoneal injection (i.p) at a dose of 30 mg/kg from Monday to Friday for 16 days, starting twelve days after tumor inoculation. GSI LY3039478 (Med Chem Express, NJ 08852, USA) was diluted in DMSO, formulated in PEG300, Tween80 and saline and administered by intraperitoneal injection (i.p) at a dose of 1 mg/kg Monday, Wednesday and Friday for 16 days, starting twelve days after tumor inoculation. Bioluminescence imaging was performed on an IVIS Lumina (Perkin Elmer, Waltham, MA) following i.p injection of D-luciferin (0.3mg/g body weight) (Biosynth, Staad, Switzerland), and data was analyzed using Living Image software (Perkin Elmer).
Statistical analyses
Statistical analyses were performed using Prism software v6.07 (GraphPad, San Diego, California). Unpaired t-tests were used to analyze data obtained from in vitro and in vivo experiments. P- values < 0.05 were considered statistically significant.
Example 1 : ATRA augments BCMA surface expression on myeloma cell lines
The inventors determined BCMA expression on three commonly utilized myeloma cell lines by flow cytometry and found graded BCMA expression with MM.1S being BCMA|0W (deltaMFI: 1,098), OPM-2 being BCMA“diate (deltaMFI: 3,558) and NCI-H929 being BCMAh'9h (deltaMFI: 9,883) (Fig. 1). Then, the inventors treated each myeloma cell line with ATRA for 72 hours and re-examined BCMA expression by flow cytometry. The inventors found that BCMA expression had increased in all three myeloma cell lines, and that the hierarchy in BCMA expression had remained unchanged: MM.1S (deltaMFI: 2,709) < OPM-2 (deltaMFI: 7,358) < NCI-H929 (deltaMFI: 13,891) (Fig. 1). The inventors normalized the deltaMFI obtained at baseline to 1 and thus, the relative increase in BCMA expression after ATRA treatment was 1.9-fold in MM.1S (Fig. 2) and OPM-2 myeloma cells (Fig. 2), and 1.7-fold in NCI-H929 myeloma cells (Fig. 2). Upon discontinuation of ATRA treatment, BCMA expression returned to baseline levels within 72 hours in all three myeloma cell lines, but increased again with the same amplitude when ATRA treatment was recommenced (Fig. 4). The increase of BCMA surface molecules on MM.1S cells after ATRA treatment was additionally confirmed by single-molecule sensitive superresolution microscopy using direct Stochastic Optical Reconstruction Microscopy dSTORM (Fig. 3). The inventors hypothesized that ATRA induces epigenetic changes in myeloma cells that lead to increased BCMA gene expression and confirmed by qPCR that this was indeed the case. On example of MM.1S and OPM-2, the relative increase in BCMA transcripts after 50 nM ATRA treatment was 1.8-fold and 2.1 -fold, respectively (Fig. 5). Taken together, these data show that treatment with ATRA leads to increased expression of BCMA RNA and BCMA protein on the surface of MM.1S, OPM-2 and NCI- H929 myeloma cells.
Example 2: ATRA up-regulates BCMA surface expression on primary myeloma cells To corroborate their findings in primary myeloma cells, the inventors obtained bone marrow from patients with newly diagnosed (ND, n=7) and relapsed/refractory (R/R, n=11) myeloma. Patients in the R/R cohort had previously received treatment with immunomodulatory drugs and/or proteasome inhibitors, none of the patients had received anti-BCMA therapy. The inventors analyzed purified CD38+CD138+ malignant plasma cells by flow cytometry and found variable BCMA expression as assessed by deltaMFI between patients (deltaMFIl0W = 94; deltaMFIh'9h = 2,650). There was no significant difference in BCMA expression on myeloma cells from ND and R/R patients (Fig. 6). From n=5 patients there was a sufficient number of primary myeloma cells to perform ATRA treatment and sequential analysis of BCMA expression (Fig. 7). Amongst these 5 patients, there were 3 ND and 2 R/R patients, and they evenly covered the spectrum of low to high BCMA expression determined above. In each of these 5 patient samples, the inventors detected a substantial increase in BCMA expression by flow cytometry after treatment with ATRA for 72 hours. A significant increase could be observed with ATRA used at all dose levels (100 nM P = 0.04, 50 nM P = 0.006 and 25 nM P = 0.04) (Fig. 8). The increase in deltaMFI for BCMA expression that the inventors observed with primary myeloma cells after 100 nM ATRA treatment was on average 1.6X on average (1.23 fold - 2.23 fold). Also with primary myeloma cells, BCMA expression declined to baseline levels once exposure to ATRA was discontinued, and increased again upon re-exposure to the drug (Fig. 9). Taken together, these data show that ATRA treatment augments BCMA surface expression on primary myeloma cells in patients with ND and R/R disease.
Example 3: ATRA in combination with GSI further increases BCMA expression on myeloma cells lines
GSI can induce an increase in BCMA expression on myeloma cells, as they prevent shedding of BCMA molecules from the cell surface40. The inventors determined whether the combination of ATRA and GSI can further increase BCMA expression on myeloma cells and if it can further improve the anti-myeloma reactivity of BCMA-CAR T-cells beyond the effect of ATRA alone. Treatment of MM.1S and OPM-2 cells with 100 nM ATRA and 0.01 mM GSI LY3039478 for 72h led to a significant increase in BCMA expression. The combination of both drugs resulted in higher BCMA expression than the single use of one of the two drugs alone (Fig. 10).
Example 4: BCMA-CAR T-cells confer enhanced reactivity against ATRA-treated myeloma cells
The inventors sought to determine whether the increase in BCMA expression that is induced by ATRA treatment, affected the anti-myeloma reactivity of BCMA-CAR T-cells. First, the inventors confirmed that ATRA treatment had no negative effect on the viability of BCMA-CAR T-cells (Fig. 11), and did not diminish expression of the EGFRt_BCMA-CAR transgene (Fig. 12). Then, the inventors tested the cytolytic activity of BCMA-CAR T-cells and found superior cytolysis of ATRA-treated MM.1S myeloma cells compared to non-treated MM.1S myeloma cells (Fig. 13). Furthermore, the cyotolytic effect of BCMA-CAR T-cells could be further enhanced when the MM.1 S target cells were previously treated with a combination of ATRA and GSI (Fig. 13). Similar results were obtained for OPM-2 cells (Fig. 14). Additionally, BCMA-CAR T-cells showed enhanced proliferative capacity (Fig. 15) and cytokine release (Fig. 16), when the target cells were pretreated with ATRA alone or a combination of ATRA and GSI.
This encouraged experiments in a murine xenograft model of myeloma (NSG/MM1.S). In a first set of experiments, n=6 mice were inoculated with MM1.S cells (2x106 cells given i.v. by tail vein injection) for 12 days to establish systemic myeloma, and then administered a 4-day treatment course with either ATRA (n=3 mice; 30 mg/kg given i.p. every day) or solvent control (n=3 mice). The following day, mice were sacrificed, MM.1S myeloma cells were isolated from bone marrow and BCMA expression analyzed by flow cytometry. Significantly higher BCMA expression was found on MM.1S myeloma cells from mice that had received ATRA compared to control mice (P = 0.002, Fig. 17). The in vivo upregulation of BCMA after GSI treatment was shown by Pont et.al. in 201940.
In a second MM.1S/NSG mouse experiment, the anti-myeloma efficacy of a suboptimal dose of BCMA- CAR T-cells (1x106 total CAR-T cells, CD8:CD4 at 1 :1 ratio, given i.v. by tail vein injection on day 14) was investigated in combination with ATRA alone, GSI alone or a combination of both drugs. 30 mg/kg of ATRA was administrated i.p. twelve times within 16 days, starting twelve days after tumor inoculation. 1 mg/kg GSI was administrated i.p. seven times within the same time span (day 12 to day 28 after tumor inoculation).
During the first days after CAR T-cell injection, bioluminescence imaging decreased in all mice groups. Flowever, the mice which just received CAR-T cells relapsed within two weeks after the treatment. Mice treated with a combination of ATRA and BCMA-CAR T-cells relapsed much slower in comparison (Fig. 18). Furthermore, bioluminescence imaging revealed a more distinct and more stable tumor reduction, when mice were treated with a combination of CAR T-cells, ATRA and GSI. These mice achieved and remained in complete remission during the follow-up period (Fig. 18)
In aggregate, these data show that ATRA elevates BCMA expression on myeloma cells in vivo, and augments the anti-myeloma reactivity of BCMA-CAR T-cells. Additionally, BCMA-targeting immunotherapies can benefit not only from treatment with ATRA alone, but even more from a combination treatment with GSI and ATRA.
Example 5: sBCMA does not compromise BCMA-CAR T-cell function against ATRA-treated myeloma cells It is well established that the extracellular portion of membrane-bound BCMA can be shed from myeloma cells to release a shorter, soluble BCMA (sBCMA) protein isoform26’ 27. The inventors measured sBCMA and in the supernatants of MM.1S and OPM-2 myeloma cells that had been treated with ATRA for 72 hours and obtained similar values as in the corresponding non-treated cell lines (Fig. 19). Notably, the concentration of sBCMA in conditioned medium of ATRA-treated or untreated MM.1S and OPM-2 myeloma cells was higher than in serum from myeloma patients (Fig. 20). The inventors analyzed the cytolytic activity of BCMA-CAR T-cells in fresh or sBCMA-containing medium and observed similarly potent cytolytic activity against MM.1S or K562/BCMA target cells at all effector to target cell ratios and time points (Fig. 21). These data show that ATRA treatment does not accelerate the release of sBCMA from myeloma cells and that the increased reactivity of the presently used BCMA- CAR T-cells against ATRA-treated myeloma cells is not diminished through interference from sBCMA.
Collectively, these data demonstrate that ATRA induces increased BCMA expression in primary myeloma cells and myeloma cell lines, and enables enhanced reactivity of BCMA-CAR T-cells in vitro and in vivo. These data encourage the investigation of BCMA-CAR T-cells and other BCMA-directed immunotherapies in combination with ATRA. This effect can be potentiated by combining ATRA with a GSI.
Ongoing clinical trials with BCMA-CAR T-cells have shown first promising results in MM patients, raising high expectations in this treatment strategy16· 19. Flowever, despite high initial response rates tumor eradication remained incomplete in some of the patients, the overall duration of response was short and there were case reports of relapses after BCMA downregulation or loss16· 17. This phenomenon has also been described in other CAR T-cell trials targeting CD19 and CD22. There is strong evidence that diminished antigen densities might be the mechanism of tumor escape from CAR-targeted therapies32- 35.
Furthermore, the baseline expression of BCMA can be low and non-uniform on MM cells, leading to the exclusion of patients from the treatment, or suboptimal response to the treatment16· 17. In accordance with previous reports, highly variable BCMA expression levels were found in MM samples36· 37. It was further observed that BCMA molecules are equally expressed on the surface of primary myeloma cells from ND and R/R MM patients, indicating that BCMA-CAR therapy is applicable for both disease conditions.
For these reasons, there is the need to enhance BCMA-CAR T-cell efficacy by increasing BCMA density on the surface of the target cells. It has been demonstrated that the retinoic acid receptor on MM cells plays an important role in the induction of CD38 expression by ATRA22· 38· 39. Therefore, it was hypothesized that ATRA could also upregulate other MM antigens than CD38, in particular BCMA. Indeed, these data show that BCMA gene and surface expression was increased on all tumor cell lines and primary malignant plasma cells after ATRA-treatment. Importantly, this was also true for primary myeloma cells with low BCMA baseline expression. To verify this effect in vivo, MM.1S tumor-bearing NSG mice were injected with ATRA. Analysis of these MM.1S revealed a significant increase of BCMA expression after the ATRA treatment.
It was shown before, that an increase of BCMA surface expression on target cells leads to enhanced recognition by BCMA-CAR T-cells40. Enhanced anti-myeloma efficacy of BCMA-CAR T-cells after BCMA upregulation by ATRA treatment was confirmed. This synergistic effect between CAR T-cell therapy and ATRA could be used as strategy to counteract the outgrowth of antigen-low tumor cell clones, sustaining the therapeutic efficacy of BCMA-CAR T-cells. Furthermore, patients with low BCMA baseline expression could be treated with ATRA and then successfully with BCMA-CAR T-cells. Additionally, BCMA expression on tumor cells could be further enhanced by combining ATRA with GSI administration.
The inventors analyzed serum samples from MM patients for sBCMA and found a correlation between the concentration of soluble BCMA and the disease status. In line with previous reports, the serum sBCMA levels were higher among patients with progressive disease than in patients with a therapeutic response to immunomodulatory or proteasome inhibitor therapy, or low tumor burden27.
The inventors examined if treatment with ATRA also leads to increased sBCMA levels in the supernatant of myeloma cell lines. Despite significantly enhanced levels of membrane bound BCMA, they observed no rise of sBCMA in the supernatant of drug exposed cells. This leads to the conclusion that there is no immediate increase in ectodomain shedding after expressing more membrane-bound molecules.
Nevertheless, the inventors wanted to know whether sBCMA could abrogate the anti-myeloma function of these BCMA-CAR T-cells in principle. Therefore, they tested CAR T-cell functionality in the presence of up to 150 ng/ml sBCMA, which is about ten times the average concentration the inventors observed in the serum of patients with progressive disease. Even with this high concentration the inventors could not find sBCMA having a negative impact on the cytolytic activity of these BCMA-CAR T-cells.
There are divergent prior reports on the impact of sBCMA on BCMA-CAR T-cells. M.J. Pont et al. reported that CAR T-cell cytokine release and proliferation are impaired by even low levels of 10 ng/ml sBCMA and cytotoxicity at high sBCMA levels of at least 100 ng/ml40. On the other hand, the groups of R.O. Carpenter et al and K.M. Friedman et al. found that BCMA-CAR T-cells were highly efficient in MM xenograft mice, despite increased sBCMA serum levels of about 7 ng/ml37· 41. Furthermore, R.O. Carpenter et al. found that sBCMA with concentrations up to 150 ng/ml had no impact on CAR T-cell cytokine release in vitro41. These different observations might be due to the use of different BCMA CARs, binding to distinct epitopes. Not all of these epitopes might be accessible in the soluble BCMA conformation.
In conclusion, this study demonstrates that the efficacy of BCMA-CAR T-cell therapy can be improved by up-regulation of antigen expression with ATRA. Therefore, according to the invention, retinoids such as ATRA can be used synergistically with BCMA-CAR T-cells in a clinical setting to increase response rates and extend duration of responses in ND and R/R myeloma. The use of a well-chosen CAR construct might reduce negative impacts by sBCMA molecules in the serum of patients. The effect of BCMA up-regulation and BCMA-CAR T-cell targeting is even greater when not only using ATRA, but a combination of ATRA and GSI.
Industrial Applicability
The immunotherapeutic agent and retinoids as used according to the invention, can be industrially manufactured and sold as products for the claimed methods and uses (e.g. for treating a cancer as defined herein), in accordance with known standards for the manufacture of pharmaceutical and diagnostic products. Accordingly, the present invention is industrially applicable.
Sequences
All nucleotide sequences are indicated in a 5’-to-3’ order. All amino acid sequences are indicated in an N-to-C-terminal order using the three-letter amino acid code.
Whole nucleotide sequence of the chimeric antigen receptor (CAR) capable of binding to BCMA used in the Examples (SEQ ID NO: 1):
ATGCTGCTGCTCGTGACATCTCTGCTGCTGTGCGAGCTGCCCCACCCCGCCTTTCTGCT
GATTCCT
CAGGTGCAGCTGGTGCAGTCTGGCGCCGAAGTGAAGAAACCAGGCGCCAGCGTGAAG
GTGTCCTGCAAGGCCAGCGGCTACAGCTTCCCCGACTACTACATCAACTGGGTGCGCC
AGGCCCCTGGACAGGGCCTGGAATGGATGGGCTGGATCTACTTCGCCAGCGGCAACT
CCGAGTACAACCAGAAATTCACCGGCAGAGTGACCATGACCCGGGACACCAGCATCAA
CACCGCCTACATGGAACTGAGCAGCCTGACCAGCGAGGATACCGCCGTGTACTTCTGC
GCCAGCCTGTACGACTACGACTGGTACTTCGACGTGTGGGGCCAGGGCACAATGGTCA
CCGTGTCTAGC
GGAGGCGGAGGCTCCGGAGGGGGAGGATCTGGGGGAGGCGGAAGC GATATCGTGATGACCCAGACCCCCCTGAGCCTGAGCGTGACACCTGGACAGCCTGCCA
GCATCAGCTGCAAGAGCAGCCAGAGCCTGGTGCACAGCAACGGCAACACCTACCTGCA
CTGGTATCTGCAGAAGCCCGGCCAGAGCCCCCAGCTGCTGATCTACAAGGTGTCCAAC
CGGTTCAGCGGCGTGCCCGACAGATTTTCTGGCAGCGGCTCCGGCACCGACTTCACCC
TGAAGATCTCCCGGGTGGAAGCCGAGGACGTGGGCATCTACTACTGCAGCCAGTCCAG
CATCTACCCCTGGACCTTCGGCCAGGGGACCAAGCTGGAAATCAAA
AAAGAGTCTAAGTACGGACCGCCTTGTCCTCCTTGTCCAGCTCCTCCTGTGGCCGGAC
CTAGCGTGTTCCTGTTCCCCCCAAAGCCCAAGGACACCCTGATGATCAGCCGGACCCC
CGAAGTGACCTGCGTGGTGGTGGATGTGTCCCAGGAAGATCCCGAGGTGCAGTTCAAT
TGGTACGTGGACGGCGTGGAAGTGCACAACGCCAAGACCAAGCCCAGAGAGGAACAG
TTCCAGAGCACCTACCGGGTGGTGTCCGTGCTGACAGTGCTGCACCAGGACTGGCTGA
ACGGCAAAGAGTACAAGTGCAAGGTGTCCAACAAGGGCCTGCCCAGCAGCATCGAGAA
AACCATCAGCAAGGCCAAGGGCCAGCCTCGCGAGCCCCAGGTGTACACACTGCCTCCA
AGCCAGGAAGAGATGACCAAGAACCAGGTGTCCCTGACCTGTCTCGTGAAGGGCTTCT
ACCCCAGCGACATTGCCGTGGAATGGGAGAGCAACGGCCAGCCCGAGAACAACTACAA
GACCACCCCCCCT GTGCTGGACAGCGACGGCTCATTCTTCCT GT ACAGCAGACT GACC
GTGGACAAGAGCCGGTGGCAGGAAGGCAACGTGTTCAGCTGCAGCGTGATGCACGAG
GCCCTGCACAACCACTACACCCAGAAGTCCCTGTCTCTGAGCCTGGGCAAG
ATGTTCTGGGTGCTGGTGGTCGTGGGCGGAGTGCTGGCCTGTTACAGCCTGCTCGTGA
CCGTGGCCTTCATCATCTTTTGGGTC
AAGCGGGGCAGAAAGAAGCTGCTGTATATCTTCAAGCAGCCCTTCATGCGGCCCGTGC
AGACCACACAGGAAGAGGACGGCTGCTCCTGCCGGTTCCCCGAGGAAGAAGAAGGCG
GCTGCGAGCTG
AGAGTGAAGTTCAGCAGAAGCGCCGACGCCCCTGCCTATCAGCAGGGCCAGAACCAG CT GT ACAACGAGCT GAACCT GGGCAGACGGGAAGAGT ACGACGTGCTGGAT AAGCGGA GAGGCCGGGACCCTGAGATGGGCGGCAAGCCTAGAAGAAAGAACCCCCAGGAAGGCC TGTATAACGAACTGCAGAAAGACAAGATGGCCGAGGCCTACAGCGAGATCGGAATGAA GGGCGAGCGGAGAAGAGGCAAGGGCCACGATGGCCTGTACCAGGGACTGAGCACCG CCACCAAGGAT ACCT AT GACGCACT GCACAT GCAGGCCCTGCCCCCCAGA
CTCGAGGGCGGAGGCGAAGGCAGAGGATCTCTGCTGACATGCGGCGACGTGGAAGAG
AACCCTGGCCCCAGA
ATGCTGCTGCTCGTGACAAGCCTGCTGCTGTGCGAGCTGCCCCACCCTGCCTTTCTGC
TGATCCCC
CGGAAAGTGTGCAACGGCATCGGCATCGGAGAGTTCAAGGACAGCCTGTCCATCAACG
CCACCAACATCAAGCACTTCAAGAATTGCACCAGCATCAGCGGCGACCTGCACATCCTG
CCAGTGGCCTTTAGAGGCGACAGCTTCACCCACACCCCCCCACTGGATCCACAGGAAC
TGGATATTCTGAAAACCGTAAAGGAAATCACAGGGTTTTTGCTGATTCAGGCTTGGCCT
GAAAACAGGACGGACCTCCATGCCTTTGAGAACCTAGAAATCATACGCGGCAGGACCA
AGCAACATGGTCAGTTTTCTCTTGCAGTCGTCAGCCTGAACATAACATCCTTGGGATTAC
GCTCCCTCAAGGAGATAAGTGATGGAGATGTGATAATTTCAGGAAACAAAAATTTGTGCT
ATGCAAATACAATAAACTGGAAAAAACTGTTTGGGACCTCCGGTCAGAAAACCAAAATTA TAAGCAACAGAGGTGAAAACAGCTGCAAGGCCACAGGCCAGGTCTGCCATGCCTTGTG
CTCCCCCGAGGGCTGCTGGGGCCCGGAGCCCAGGGACTGCGTCTCTTGCCGGAATGT
CAGCCGAGGCAGGGAATGCGTGGACAAGTGCAACCTTCTGGAGGGTGAGCCAAGGGA
GTTT GT GGAGAACTCTGAGTGCAT ACAGTGCCACCCAGAGT GCCT GCCTCAGGCCAT G
AACAT CACCTGCACAGGACGGGGACCAGA CAACT GT ATCCAGT GTGCCCACTACATT GA
CGGCCCCCACTGCGTCAAGACCTGCCCGGCAGGAGTCATGGGAGAAAACAACACCCT
GGTCTGGAAGTACGCAGACGCCGGCCATGTGTGCCACCTGTGCCATCCAAACTGCACC
TACGGATGCACTGGGCCAGGTCTTGAAGGCTGTCCAACGAATGGGCCTAAGATCCCGT
CCATCGCCACTGGGATGGTGGGGGCCCTCCTCTTGCTGCTGGTGGTGGCCCTGGGGA
TCGGCCTCTTCATGTGA
Nucleotide sequence of the GMCSF signal peptide (SEQ ID NO: 2):
AT GCTGCTGCTCGT GACAT CT CT GCTGCT GT GCGAGCT GCCCCACCCCGCCTTT CT GOT GATT CCT
Nucleotide sequence of the BCMA single chain variable fragment VH (SEQ ID NO: 3):
CAGGT GCAGCT GGT GCAGT CT GGCGCCGAAGT GAAGAAACCAGGCGCCAGCGT GAAGGT GT CCT GCAAGGCCAGCGGCT ACAGCTT CCCCGACT ACT ACAT CAACT GGGT GCGCCAGGCCCCT GGACA GGGCCT GGAAT GGAT GGGCT GGAT CT ACTT CGCCAGCGGCAACT CCGAGT ACAACCAGAAATT CA CCGGCAGAGT GACCAT GACCCGGGACACCAGCAT CAACACCGCCT ACAT GGAACT GAGCAGCCT GACCAGCGAGGAT ACCGCCGT GT ACTT CT GCGCCAGCCT GT ACGACT ACGACT GGT ACTT CGACG T GT GGGGCCAGGGCACAAT GGT CACCGT GT CT AGC
Nucleotide sequence of the (4GS)3 linker (SEQ ID NO: 4): GGAGGCGGAGGCT CCGGAGGGGGAGGAT CT GGGGGAGGCGGAAGC
Nucleotide sequence of the BCMA single chain variable fragment VL (SEQ ID NO: 5):
GAT AT CGT GAT GACCCAGACCCCCCT GAGCCT GAGCGT GACACCT GGACAGCCT GCCAGCAT CAG CT GCAAGAGCAGCCAGAGCCT GGT GCACAGCAACGGCAACACCT ACCT GCACT GGT AT CT GCAGA AGCCCGGCCAGAGCCCCCAGCT GCT GAT CT ACAAGGT GT CCAACCGGTT CAGCGGCGT GCCCGA CAGATTTT CT GGCAGCGGCT CCGGCACCGACTT CACCCT GAAGAT CTCCCGGGT GGAAGCCGAGG ACGT GGGCAT CT ACT ACT GCAGCCAGT CCAGCAT CT ACCCCT GGACCTT CGGCCAGGGGACCAAG CTGGAAATCAAA
Nucleotide sequence of the lgG4-Fc Hinge-CH2-CH34/2NQ (SEQ ID NO: 6):
AAAGAGT CT AAGT ACGGACCGCCTT GT CCT CCTT GT CCAGCT CCT CCT GT GGCCGGACCT AGCGT GTT CCT GTT CCCCCCAAAGCCCAAGGACACCCT GAT GAT CAGCCGGACCCCCGAAGT GACCT GCG TGGTGGT GGAT GT GT CCCAGGAAGAT CCCGAGGT GCAGTT CAATT GGT ACGT GGACGGCGT GGAA GT GCACAACGCCAAGACCAAGCCCAGAGAGGAACAGTT CCAGAGCACCT ACCGGGT GGTGTCCG TGCT GACAGT GOT GCACCAGGACT GGCT GAACGGCAAAGAGT ACAAGT GCAAGGT GT CCAACAAG GGCCT GCCCAGCAGCAT CGAGAAAACCAT CAGCAAGGCCAAGGGCCAGCCT CGCGAGCCCCAGG T GT ACACACT GCCT CCAAGCCAGGAAGAGAT GACCAAGAACCAGGT GT CCCT GACCT GT CTCGTG AAGGGCTT CT ACCCCAGCGACATT GCCGT GGAAT GGGAGAGCAACGGCCAGCCCGAGAACAACT A CAAGACCACCCCCCCT GT GCT GGACAGCGACGGCT CATT CTT CCT GT ACAGCAGACT GACCGT GG ACAAGAGCCGGT GGCAGGAAGGCAACGT GTT CAGCT GCAGCGT GAT GCACGAGGCCCT GCACAA CCACT ACACCCAGAAGT CCCT GT CT CT GAGCCT GGGCAAG
Nucleotide sequence of the CD28 transmembrane domain (SEC ID NO: 7):
AT GTT CTGGGTGCTGGTGGTCGT GGGCGGAGT GCTGGCCT GTT ACAGCCT GCTCGT GACCGT GG CCTT CAT CAT CTTTT GGGTC
Nucleotide sequence of the 4-1 BB cytoplasmic domain (SEC ID NO: 8):
AAGCGGGGCAGAAAGAAGCT GCT GT AT AT CTT CAAGCAGCCCTT CAT GCGGCCCGT GCAGACCAC ACAGGAAGAGGACGGCT GCT CCT GCCGGTT CCCCGAGGAAGAAGAAGGCGGCT GCGAGCT G
Nucleotide sequence of the CD3 zeta domain (SEC ID NO: 9):
AGAGTGAAGTTCAGCAGAAGCGCCGACGCCCCTGCCTATCAGCAGGGCCAGAACCAGCTGTACAA CGAGCT GAACCT GGGCAGACGGGAAGAGT ACGACGT GCT GGAT AAGCGGAGAGGCCGGGACCCT GAGATGGGCGGCAAGCCTAGAAGAAAGAACCCCCAGGAAGGCCTGTATAACGAACTGCAGAAAGA CAAGAT GGCCGAGGCCT ACAGCGAGAT CGGAAT GAAGGGCGAGCGGAGAAGAGGCAAGGGCCA CGAT GGCCT GT ACCAGGGACT GAGCACCGCCACCAAGGAT ACCT AT GACGCACT GCACAT GCAGG CCCT GCCCCCCAGA Nucleotide sequence of the T2A ribosomal skip element (SEQ ID NO: 10):
CT CGAGGGCGGAGGCGAAGGCAGAGGAT CT CT GOT GACAT GCGGCGACGT GGAAGAGAACCCT G GCCCCAGA
Nucleotide sequence of the GMCSF signal peptide (SEQ ID NO: 11):
AT GCTGCTGCTCGT GACAAGCCT GCTGCT GT GCGAGCT GCCCCACCCT GCCTTT CT GOT GAT CCC C
Nucleotide sequence of the tEGFR sequence (SEQ ID NO: 12):
CGGAAAGT GT GCAACGGCAT CGGCAT CGGAGAGTT CAAGGACAGCCT GT CCAT CAACGCCACCAA CAT CAAGCACTT CAAGAATT GCACCAGCAT CAGCGGCGACCT GCACAT CCT GCCAGT GGCCTTT AG AGGCGACAGCTT CACCCACACCCCCCCACT GGAT CCACAGGAACT GGAT ATT CT GAAAACCGT AAA GGAAAT CACAGGGTTTTT GCT GATT CAGGCTT GGCCT GAAAACAGGACGGACCT CCAT GCCTTT GA GAACCT AGAAAT CAT ACGCGGCAGGACCAAGCAACAT GGT CAGTTTT CT CTT GCAGT CGT CAGCCT GAACAT AACAT CCTT GGGATT ACGCT CCCT CAAGGAGAT AAGT GAT GGAGAT GT GAT AATTT CAGG AAACAAAAATTT GT GCT AT GCAAAT ACAAT AAACT GGAAAAAACT GTTT GGGACCT CCGGT CAGAAA ACCAAAATT AT AAGCAACAGAGGT GAAAACAGCT GCAAGGCCACAGGCCAGGT CT GCCAT GCCTT GT GCT CCCCCGAGGGCT GCT GGGGCCCGGAGCCCAGGGACT GCGT CT CTT GCCGGAAT GT CAGC CGAGGCAGGGAAT GCGT GGACAAGT GCAACCTT CT GGAGGGT GAGCCAAGGGAGTTT GT GGAGA ACT CT GAGT GCAT ACAGT GCCACCCAGAGT GCCT GCCT CAGGCCAT GAACAT CACCT GCACAGGA CGGGGACCAGACAACT GT AT CCAGT GT GCCCACT ACATT GACGGCCCCCACT GCGT CAAGACCT G CCCGGCAGGAGT CAT GGGAGAAAACAACACCCT GGT CT GGAAGT ACGCAGACGCCGGCCAT GT G T GCCACCT GT GCCAT CCAAACT GCACCT ACGGAT GCACT GGGCCAGGT CTT GAAGGCT GT CCAAC GAAT GGGCCT AAGAT CCCGT CCAT CGCCACT GGGAT GGTGGGGGCCCT CCT CTT GCTGCT GGTG GT GGCCCT GGGGAT CGGCCT CTT CAT GT GA
Whole amino acid sequence of the chimeric antigen receptor (CAR) capable of binding to BCMA used in the Examples (SEQ ID NO: 13):
Met Leu Leu Leu Val Thr Ser Leu Leu Leu Cys Glu Leu Pro His Pro Ala Phe Leu Leu lie Pro Gin Val Gin Leu Val Gin Ser Gly Ala Glu Val Lys Lys Pro Gly Ala Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Ser Phe Pro Asp Tyr Tyr lie Asn Trp Val Arg Gin Ala Pro Gly Gin Gly Leu Glu Trp Met Gly Trp lie Tyr Phe Ala Ser Gly Asn Ser Glu Tyr Asn Gin Lys Phe Thr Gly Arg Val Thr Met Thr Arg Asp Thr Ser lie Asn Thr Ala Tyr Met Glu Leu Ser Ser Leu Thr Ser Glu Asp Thr Ala Val Tyr Phe Cys Ala Ser Leu Tyr Asp Tyr Asp Trp Tyr Phe Asp Val Trp Gly Gin Gly Thr Met Val Thr Val Ser Ser
Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser
Asp lie Val Met Thr Gin Thr Pro Leu Ser Leu Ser Val Thr Pro Gly Gin Pro Ala Ser lie Ser Cys Lys Ser Ser Gin Ser Leu Val His Ser Asn Gly Asn Thr Tyr Leu His Trp Tyr Leu Gin Lys Pro Gly Gin Ser Pro Gin Leu Leu lie Tyr Lys Val Ser Asn Arg Phe Ser Gly Val Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys lie Ser Arg Val Glu Ala Glu Asp Val Gly lie Tyr Tyr Cys Ser Gin Ser Ser lie Tyr Pro Trp Thr Phe Gly Gin Gly Thr Lys Leu Glu lie Lys
Lys Glu Ser Lys Tyr Gly Pro Pro Cys Pro Pro Cys Pro Ala Pro Pro Val Ala Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met lie Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser Gin Glu Asp Pro Glu Val Gin Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Phe Gin Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Gly Leu Pro Ser Ser lie Glu Lys Thr lie Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin Val Tyr Thr Leu Pro Pro Ser Gin Glu Glu Met Thr Lys Asn Gin Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp lie Ala Val Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Arg Leu Thr Val Asp Lys Ser Arg Trp Gin Glu Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu Ser Leu Gly Lys
Met Phe Trp Val Leu Val Val Val Gly Gly Val Leu Ala Cys Tyr Ser Leu Leu Val Thr Val Ala Phe lie lie Phe Trp Val
Lys Arg Gly Arg Lys Lys Leu Leu Tyr lie Phe Lys Gin Pro Phe Met Arg Pro Val Gin Thr Thr Gin Glu Glu Asp Gly Cys Ser Cys Arg Phe Pro Glu Glu Glu Glu Gly Gly Cys Glu Leu
Arg Val Lys Phe Ser Arg Ser Ala Asp Ala Pro Ala Tyr Gin Gin Gly Gin Asn Gin Leu Tyr Asn Glu Leu Asn Leu Gly Arg Arg Glu Glu Tyr Asp Val Leu Asp Lys Arg Arg Gly Arg Asp Pro Glu Met Gly Gly Lys Pro Arg Arg Lys Asn Pro Gin Glu Gly Leu Tyr Asn Glu Leu Gin Lys Asp Lys Met Ala Glu Ala Tyr Ser Glu lie Gly Met Lys Gly Glu Arg Arg Arg Gly Lys Gly His Asp Gly Leu Tyr Gin Gly Leu Ser Thr Ala Thr Lys Asp Thr Tyr Asp Ala Leu His Met Gin Ala Leu Pro Pro Arg
Leu Glu Gly Gly Gly Glu Gly Arg Gly Ser Leu Leu Thr Cys Gly Asp Val Glu Glu Asn Pro Gly Pro Arg Met Leu Leu Leu Val Thr Ser Leu Leu Leu Cys Glu Leu Pro His Pro Ala Phe Leu Leu lie Pro Arg Lys Val Cys Asn Gly lie Gly lie Gly Glu Phe Lys Asp Ser Leu Ser lie Asn Ala Thr Asn lie Lys His Phe Lys Asn Cys Thr Ser lie Ser Gly Asp Leu His lie Leu Pro Val Ala Phe Arg Gly Asp Ser Phe Thr His Thr Pro Pro Leu Asp Pro Gin Glu Leu Asp lie Leu Lys Thr Val Lys Glu lie Thr Gly Phe Leu Leu lie Gin Ala Trp Pro Glu Asn Arg Thr Asp Leu His Ala Phe Glu Asn Leu Glu lie lie Arg Gly Arg Thr Lys Gin His Gly Gin Phe Ser Leu Ala Val Val Ser Leu Asn lie Thr Ser Leu Gly Leu Arg Ser Leu Lys Glu lie Ser Asp Gly Asp Val lie lie Ser Gly Asn Lys Asn Leu Cys Tyr Ala Asn Thr lie Asn Trp Lys Lys Leu Phe Gly Thr Ser Gly Gin Lys Thr Lys lie lie Ser Asn Arg Gly Glu Asn Ser Cys Lys Ala Thr Gly Gin Val Cys His Ala Leu Cys Ser Pro Glu Gly Cys Trp Gly Pro Glu Pro Arg Asp Cys Val Ser Cys Arg Asn Val Ser Arg Gly Arg Glu Cys Val Asp Lys Cys Asn Leu Leu Glu Gly Glu Pro Arg Glu Phe Val Glu Asn Ser Glu Cys lie Gin Cys His Pro Glu Cys Leu Pro Gin Ala Met Asn lie Thr Cys Thr Gly Arg Gly Pro Asp Asn Cys lie Gin Cys Ala His Tyr lie Asp Gly Pro His Cys Val Lys Thr Cys Pro Ala Gly Val Met Gly Glu Asn Asn Thr Leu Val Trp Lys Tyr Ala Asp Ala Gly His Val Cys His Leu Cys His Pro Asn Cys Thr Tyr Gly Cys Thr Gly Pro Gly Leu Glu Gly Cys Pro Thr Asn Gly Pro Lys lie Pro Ser lie Ala Thr Gly Met Val Gly Ala Leu Leu Leu Leu Leu Val Val Ala Leu Gly lie Gly Leu Phe Met
Amino acid sequence of the GMCSF signal peptide (SEQ ID NO: 14):
Met Leu Leu Leu Val Thr Ser Leu Leu Leu Cys Glu Leu Pro His Pro Ala Phe Leu Leu lie Pro
Amino acid sequence of the BCMA single chain variable fragment VH (SEQ ID NO: 15):
Gin Val Gin Leu Val Gin Ser Gly Ala Glu Val Lys Lys Pro Gly Ala Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Ser Phe Pro Asp Tyr Tyr lie Asn Trp Val Arg Gin Ala Pro Gly Gin Gly Leu Glu Trp Met Gly Trp lie Tyr Phe Ala Ser Gly Asn Ser Glu Tyr Asn Gin Lys Phe Thr Gly Arg Val Thr Met Thr Arg Asp Thr Ser lie Asn Thr Ala Tyr Met Glu Leu Ser Ser Leu Thr Ser Glu Asp Thr Ala Val Tyr Phe Cys Ala Ser Leu Tyr Asp Tyr Asp Trp Tyr Phe Asp Val Trp Gly Gin Gly Thr Met Val Thr Val Ser Ser
Amino acid sequence of the (4GS)3 linker (SEQ ID NO: 16): Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser
Amino acid sequence of the BCMA single chain variable fragment VL (SEQ ID NO: 17):
Asp lie Val Met Thr Gin Thr Pro Leu Ser Leu Ser Val Thr Pro Gly Gin Pro Ala Ser lie Ser Cys Lys Ser Ser Gin Ser Leu Val His Ser Asn Gly Asn Thr Tyr Leu His Trp Tyr Leu Gin Lys Pro Gly Gin Ser Pro Gin Leu Leu lie Tyr Lys Val Ser Asn Arg Phe Ser Gly Val Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys lie Ser Arg Val Glu Ala Glu Asp Val Gly lie Tyr Tyr Cys Ser Gin Ser Ser lie Tyr Pro Trp Thr Phe Gly Gin Gly Thr Lys Leu Glu lie Lys
Amino acid sequence of the lgG4-Fc Hinge-CH2-CH3 4/2NQ (SEQ ID NO: 18):
Lys Glu Ser Lys Tyr Gly Pro Pro Cys Pro Pro Cys Pro Ala Pro Pro Val Ala Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met lie Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser Gin Glu Asp Pro Glu Val Gin Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Phe Gin Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Gly Leu Pro Ser Ser lie Glu Lys Thr lie Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin Val Tyr Thr Leu Pro Pro Ser Gin Glu Glu Met Thr Lys Asn Gin Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp lie Ala Val Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Arg Leu Thr Val Asp Lys Ser Arg Trp Gin Glu Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu Ser Leu Gly Lys
Amino acid sequence of the CD28 transmembrane domain (SEC ID NO: 19):
Met Phe Trp Val Leu Val Val Val Gly Gly Val Leu Ala Cys Tyr Ser Leu Leu Val Thr Val Ala Phe lie lie Phe Trp Val
Amino acid sequence of the 4-1 BB cytoplasmic domain (SEC ID NO: 20):
Lys Arg Gly Arg Lys Lys Leu Leu Tyr lie Phe Lys Gin Pro Phe Met Arg Pro Val Gin Thr Thr Gin Glu Glu Asp Gly Cys Ser Cys Arg Phe Pro Glu Glu Glu Glu Gly Gly Cys Glu Leu
Amino acid sequence of the CD3 zeta domain (SEC ID NO: 21):
Arg Val Lys Phe Ser Arg Ser Ala Asp Ala Pro Ala Tyr Gin Gin Gly Gin Asn Gin Leu Tyr Asn Glu Leu Asn Leu Gly Arg Arg Glu Glu Tyr Asp Val Leu Asp Lys Arg Arg Gly Arg Asp Pro Glu Met Gly Gly Lys Pro Arg Arg Lys Asn Pro Gin Glu Gly Leu Tyr Asn Glu Leu Gin Lys Asp Lys Met Ala Glu Ala Tyr Ser Glu lie Gly Met Lys Gly Glu Arg Arg Arg Gly Lys Gly His Asp Gly Leu Tyr Gin Gly Leu Ser Thr Ala Thr Lys Asp Thr Tyr Asp Ala Leu His Met Gin Ala Leu Pro Pro Arg Amino acid sequence of the T2A ribosomal skip element (SEQ ID NO: 22):
Leu Glu Gly Gly Gly Glu Gly Arg Gly Ser Leu Leu Thr Cys Gly Asp Val Glu Glu Asn Pro Gly Pro Arg
Amino acid sequence of the GMCSF signal peptide (SEQ ID NO: 23):
Met Leu Leu Leu Val Thr Ser Leu Leu Leu Cys Glu Leu Pro His Pro Ala Phe Leu Leu lie Pro
Amino acid sequence of the tEGFR sequence (SEQ ID NO: 24):
Arg Lys Val Cys Asn Gly lie Gly lie Gly Glu Phe Lys Asp Ser Leu Ser lie Asn Ala Thr Asn lie Lys His Phe Lys Asn Cys Thr Ser lie Ser Gly Asp Leu His lie Leu Pro Val Ala Phe Arg Gly Asp Ser Phe Thr His Thr Pro Pro Leu Asp Pro Gin Glu Leu Asp lie Leu Lys Thr Val Lys Glu lie Thr Gly Phe Leu Leu lie Gin Ala Trp Pro Glu Asn Arg Thr Asp Leu His Ala Phe Glu Asn Leu Glu lie lie Arg Gly Arg Thr Lys Gin His Gly Gin Phe Ser Leu Ala Val Val Ser Leu Asn lie Thr Ser Leu Gly Leu Arg Ser Leu Lys Glu lie Ser Asp Gly Asp Val lie lie Ser Gly Asn Lys Asn Leu Cys Tyr Ala Asn Thr lie Asn Trp Lys Lys Leu Phe Gly Thr Ser Gly Gin Lys Thr Lys lie lie Ser Asn Arg Gly Glu Asn Ser Cys Lys Ala Thr Gly Gin Val Cys His Ala Leu Cys Ser Pro Glu Gly Cys Trp Gly Pro Glu Pro Arg Asp Cys Val Ser Cys Arg Asn Val Ser Arg Gly Arg Glu Cys Val Asp Lys Cys Asn Leu Leu Glu Gly Glu Pro Arg Glu Phe Val Glu Asn Ser Glu Cys lie Gin Cys His Pro Glu Cys Leu Pro Gin Ala Met Asn lie Thr Cys Thr Gly Arg Gly Pro Asp Asn Cys lie Gin Cys Ala His Tyr lie Asp Gly Pro His Cys Val Lys Thr Cys Pro Ala Gly Val Met Gly Glu Asn Asn Thr Leu Val Trp Lys Tyr Ala Asp Ala Gly His Val Cys His Leu Cys His Pro Asn Cys Thr Tyr Gly Cys Thr Gly Pro Gly Leu Glu Gly Cys Pro Thr Asn Gly Pro Lys lie Pro Ser lie Ala Thr Gly Met Val Gly Ala Leu Leu Leu Leu Leu Val Val Ala Leu Gly lie Gly Leu Phe Met
In a preferred embodiment in accordance with the invention, the chimeric antigen receptor (CAR) capable of binding to BCMA is the chimeric antigen receptor (CAR) encoded by the nucleotide sequence of SEQ ID NO: 1 or by a nucleotide sequence at least 95% identical thereto. In another preferred embodiment in accordance with the invention, the chimeric antigen receptor (CAR) capable of binding to BCMA has the amino acid sequence of SEQ ID NO: 13 or an amino acid sequence at least 95% identical thereto. References
1. Kohler M, Greil C, Hudecek M, Lonial S, Raje N, Wasch R et al. Current developments in immunotherapy in the treatment of multiple myeloma. Cancer 2018; 124(10): 2075-2085. doi: 10.1002/cncr.31243
2. Hudecek M, Einsele H. Myeloma CARs are rolling into the clinical arena. Blood 2016; 128(13): 1667-1668. doi: 10.1182/blood-2016-08-729467
3. Chim CS, Kumar SK, Orlowski RZ, Cook G, Richardson PG, Gertz MA et al. Management of relapsed and refractory multiple myeloma: novel agents, antibodies, immunotherapies and beyond. Leukemia. 2018 Feb;32(2):252-262. doi: 10.1038/leu.2017.329
4. Lonial S, Boise LH, Kaufman J. How I treat high-risk myeloma. Blood. 2015; 126(13): 1536-1543.
5. Kumar SK, Lee JH, Lahuerta JJ , Morgan G, Richardson PG, Crowley J, et al. Risk of progression and survival in multiple myeloma relapsing after therapy with IMiDs and bortezomib: a multicenter international myeloma working group study. Leukemia. 2012;26(1 ): 149-157.
6. Davila ML, Riviere I, Wang X, Bartido S, Park J, Curran K et al. Efficacy and toxicity management of 19-28z CAR T cell therapy in B cell acute lymphoblastic leukemia. Science translational medicine 2014; 6(224): 224ra225. doi: 10.1126/scitranslmed.3008226
7. Kochenderfer JN, Dudley ME, Kassim SH, Somerville RP, Carpenter RO, Stetler-Stevenson M et al. Chemotherapy-refractory diffuse large B-cell lymphoma and indolent B-cell malignancies can be effectively treated with autologous T cells expressing an anti-CD19 chimeric antigen receptor. Journal of clinical oncology : official journal of the American Society of Clinical Oncology 2015; 33(6): 540-549. doi: 10.1200/JC0.2014.56.2025
8. Maude SL, Frey N, Shaw PA, Aplenc R, Barrett DM, Bunin NJ et al. Chimeric antigen receptor T cells for sustained remissions in leukemia. The New England journal of medicine 2014; 371(16): 1507-1517. doi: 10.1056/NE JMoal 407222
9. Brentjens RJ, Davila ML, Riviere I, Park J, Wang X, Cowell LG, et al. CD19-targeted T cells rapidly induce molecular remissions in adults with chemotherapy-refractory acute lymphoblastic leukemia. Sci Trans! Med. 2013 Mar 20;5(177): 177ra38. doi: 10.1126/scitranslmed.3005930.
10. Timmers M, Roex G, Wang Y, Campillo-Davo D, Van Tendeloo VFI, Chu Y, et al. Chimeric Antigen Receptor-Modified T Cell Therapy in Multiple Myeloma: Beyond B Cell Maturation Antigen. Front Immunol. 2019 Jul 16; 10: 1613. doi: 10.3389/fimmu.2019.01613. Garfall AL, Fraietta JA, Maus MV. Immunotherapy with chimeric antigen receptors for multiple myeloma. Discovery medicine 2014; 17(91): 37-46. Maus MV, June CH. CARTs on the road for myeloma. Clinical cancer research : an official journal of the American Association for Cancer Research 2014; 20(15): 3899-3901. doi: 10.1158/1078-0432.CCR-14-0721 Seckinger A, Delgado JA, Moser S, Moreno L, Neuber B, Grab A et al. Target Expression, Generation, Preclinical Activity, and Pharmacokinetics of the BCMA-T Cell Bispecific Antibody EM801 for Multiple Myeloma Treatment. Cancer cell 2017; 31(3): 396-410. doi: 10.1016/j.ccell.2017.02.002 Hipp S, Tai YT, Blanset D, Deegen P, Wahl J, Thomas O ef al. A novel BCMA/CD3 bispecific T- cell engager for the treatment of multiple myeloma induces selective lysis in vitro and in vivo. Leukemia 2017; 31(8): 1743-1751. doi: 10.1038/leu.2016.388 Ramadoss NS, Schulman AD, Choi SH, Rodgers DT, Kazane SA, Kim CH et al. An anti-B cell maturation antigen bispecific antibody for multiple myeloma. Journal of the American Chemical Society 2015; 137(16): 5288-5291. doi: 10.1021/jacs.5b01876 Ali SA, Shi V, Marie I, Wang M, Stroncek DF, Rose JJ et al. T cells expressing an anti-B-cell maturation antigen chimeric antigen receptor cause remissions of multiple myeloma. Blood 2016; 128(13): 1688-1700. doi: 10.1182/blood-2016-04-711903 Brudno JN, Marie I, Hartman SD, Rose JJ, Wang M, Lam N et al. T Cells Genetically Modified to Express an Anti-B-Cell Maturation Antigen Chimeric Antigen Receptor Cause Remissions of Poor-Prognosis Relapsed Multiple Myeloma. Journal of clinical oncology: official journal of the American Society of Clinical Oncology 2018; 36(22): 2267-2280. doi:
10.1200/JC0.2018.77.8084 Cohen AD, Garfall AL, Stadtmauer EA, Melenhorst JJ, Lacey SF, Lancaster E, et al. B cell maturation antigen-specific CAR T cells are clinically active in multiple myeloma. J Clin Invest. 2019 Mar 21 ; 129(6):2210-2221. doi: 10.1172/JC1126397. Raje N, Berdeja J, Lin Y, Siegel D, Jagannath S, Madduri D, et al. Anti-BCMA CAR T-Cell Therapy bb2121 in Relapsed or Refractory Multiple Myeloma. N Engl J Med. 2019 May 2;380(18): 1726-1737. doi: 10.1056/NE JMoal 817226 Balmer JE, Blomhoff R. Gene expression regulation by retinoic acid. Journal of lipid research 2002; 43(11): 1773-1808. Coltella N, Valsecchi R, Ponente M, Ponzoni M, Bernardi R. Synergistic Leukemia Eradication by Combined Treatment with Retinoic Acid and HIF Inhibition by EZN-2208 (PEG-SN38) in Preclinical Models of PML-RARalpha and PLZF-RARalpha-Driven Leukemia. Clinical cancer research : an official journal of the American Association for Cancer Research 2015; 21(16): 3685-3694. doi: 10.1158/1078-0432.CCR-14-3022 Chaudhari N, Talwar P, Lefebvre D'hellencourt C, Ravanan P. CDDO and ATRA Instigate Differentiation of IMR32 Human Neuroblastoma Cells. Frontiers in molecular neuroscience 2017; 10: 310. doi: 10.3389/fnmol.2017.00310 Martens JH, Brinkman AB, Simmer F, Francoijs KJ, Nebbioso A, Ferrara F, et al. PML- RARalpha/RXR Alters the Epigenetic Landscape in Acute Promyelocytic Leukemia. Cancer Cell. 2010 Feb 17;17(2): 173-85. doi: 10.1016/j.ccr.2009.12.042. Mikesch JH, Gronemeyer H, So CW. Discovery of novel transcriptional and epigenetic targets in APL by global ChIP analyses: Emerging opportunity and challenge. Cancer Cel I. 2010 Feb 17;17(2):112-4. doi: 10.1016/j.ccr.2010.01.012. Nijhof IS, Casneuf T, van Velzen J, van Kessel B, Axel AE, Syed K et al. CD38 expression and complement inhibitors affect response and resistance to daratumumab therapy in myeloma. Blood 2016; 128(7): 959-970. doi: 10.1182/blood-2016-03-703439 Laurent SA, Hoffmann FS, Kuhn PH, Cheng Q, Chu Y, Schmidt-Supprian M et al. gamma- Secretase directly sheds the survival receptor BCMA from plasma cells. Nature communications 2015; 6: 7333. doi: 10.1038/ncomms8333 Sanchez E, Li M, Kitto A, Li J, Wang CS, Kirk DT et al. Serum B-cell maturation antigen is elevated in multiple myeloma and correlates with disease status and survival. British journal of haematology 2012; 158(6): 727-738. doi: 10.1111/j.1365-2141.2012.09241.x Stone JD, Aggen DH, Schietinger A, Schreiber H, Kranz DM. A sensitivity scale for targeting T cells with chimeric antigen receptors (CARs) and bispecific T-cell Engagers (BiTEs). Oncoimmunology. 2012 Sep 1;1(6):863-873. Nerreter T, Letschert S, Gotz R, Doose S, Danhof S, Einsele H, et al. Super-resolution microscopy reveals ultra-low CD19 expression on myeloma cells that triggers elimination by CD19 CAR-T. Nat Commun. 2019 Jul 17;10(1):3137. Walker AJ, Majzner RG, Zhang L, Wanhainen K, Long AH, Nguyen SM, et al. Tumor Antigen and Receptor Densities Regulate Efficacy of a Chimeric Antigen Receptor Targeting Anaplastic Lymphoma Kinase. Mol Ther. 2017 Sep 6;25(9):2189-2201. doi: 10.1016/j.ymthe.2017.06.008. Ramakrishna S, Highfill SL, Walsh Z, Nguyen SM, Lei H, Shern JF, et al. Modulation of Target Antigen Density Improves CAR T-cell Functionality and Persistence. Clin Cancer Res. 2019 Sep 1;25(17):5329-5341. Fry TJ, Shah NN, Orentas RJ, Stetler-Stevenson M, Yuan CM, Ramakrishna S, et al. CD22- targeted CAR T cells induce remission in B-ALL that is naive or resistant to CD19-targeted CAR immunotherapy. Nat Med 2018;24:20-8 Sotillo E , Barrett DM, Black KL, Bagashev A, Oldridge D, Wu G, et al. Convergence of acquired mutations and alternative splicing of CD19 enables resistance to CART-19 immunotherapy. Cancer Discov. 5, 1282-1295 (2015). doi: 10.1158/2159-8290 Grupp SA, Teachey DT, Porter DL, Grupp SA. Durable remissions in children with relapsed/refractory ALL Treated with T cells engineered with a CD19-targeted chimeric antigen receptor (CTL019). Blood m abstr. 681 (2015). doi: 10.1182/blood-2014-12-580068 Gardner R, Wu D, Cherian S, Fang M, Hanafi LA, Finney O, et al. Acquisition of a CD19- negative myeloid phenotype allows immune escape of MLL-rearranged B-ALL from CD19 CAR- T-cell therapy. Blood , 2406-2410 (2016). doi: 10.1182/blood-2015-08-665547 Salem DA, Marie I, Yuan CM, Liewehr DJ, Venzon DJ, Kochenderfer J et al. Quantification of B- cell maturation antigen, a target for novel chimeric antigen receptor T-cell therapy in Myeloma. Leukemia research 2018; 71 : 106-111. doi: 10.1016/j.leukres.2018.07.015 Friedman KM, Garrett TE, Evans JW, Horton HM, Latimer HJ, Seidel SL et al. Effective Targeting of Multiple B-Cell Maturation Antigen-Expressing Hematological Malignances by Anti- B-Cell Maturation Antigen Chimeric Antigen Receptor T Cells. Human gene therapy 2018; 29(5): 585-601. doi: 10.1089/hum.2018.001 Ruella M, Barrett DM, Kenderian SS, Shestova O, Hofmann TJ, Perazzelli J et al. Dual CD19 and CD123 targeting prevents antigen-loss relapses after CD19-directed immunotherapies. The Journal of clinical investigation 2016; 126(10): 3814-3826. doi: 10.1172/JCI87366 Malavasi F. Editorial: CD38 and retinoids: a step toward a cure. Journal of leukocyte biology 2011; 90(2): 217-219. doi: 10.1189/jlb.0211069 Pont MJ, Hill T, Cole GO, Abbott JJ, Kelliher J, Salter Al, et al. g-secretase inhibition increases efficacy of BCMA-specific chimeric antigen receptor T cells in multiple myeloma. Blood. 2019 Sep 26. pii: blood.2019000050 doi: 10.1182/blood.2019000050. Carpenter RO, Evbuomwan MO, Pittaluga S, Rose JJ, Raffeld M, Yang S et al. B-cell maturation antigen is a promising target for adoptive T-cell therapy of multiple myeloma. Clinical cancer research : an official journal of the American Association for Cancer Research 2013; 19(8): 2048-2060. doi: 10.1158/1078-0432.CCR-12-2422 K Hofmann, et. al, Front. Immunol., 23 April 2018, Targeting B Cells and Plasma Cells in Autoimmune Diseases, https://doi.orq/10.3389/fimmu.2018.00835 A. Rubbert-Roth, et. al Efficacy and safety of various repeat treatment dosing regimens of rituximab in patients with active rheumatoid arthritis: results of a Phase III randomized study (MIRROR), Rheumatology, Volume 49, Issue 9, September 2010, Pages 1683-1693, https://doi.orq/10.1093/rheumatoloqy/keq116. T.T. Smith, et. al, In situ programming of leukaemia-specific T cells using synthetic DNA nanocarriers, Nat Nanotechnol. 2017 Aug; 12(8): 813-820. Published online 2017 Apr 17. doi: 10.1038/nnano.2017.57. Agarwal S, et. al, Oncoimmunology. 2019 Oct 10;8(12):e1671761. In vivo generated human CAR T cells eradicate tumor cells doi: 10.1080/2162402X.2019.1671761. Liu E, et.al. Use of CAR-Transduced Natural Killer Cells in CD19-Positive Lymphoid Tumors. N Engl J Med. 2020 Feb 6;382(6):545-553. doi: 10.1056/NEJMoa1910607.

Claims

1. An immunotherapeutic anticancer agent capable of binding to BCMA for use in a method of cancer immunotherapy against BCMA as cancer antigen in a human patient, wherein the method is a method wherein an upregulator of BCMA mRNA levels is to be administered to the human patient.
2. An upregulator of BCMA mRNA levels for use in a method of cancer immunotherapy against BCMA as cancer antigen in a human patient, wherein the method is a method wherein an immunotherapeutic anticancer agent capable of binding to BCMA is to be administered to the human patient.
3. A combination of an immunotherapeutic anticancer agent capable of binding to BCMA and an upregulator of BCMA mRNA levels for use in a method of cancer immunotherapy against BCMA as cancer antigen in a human patient.
4. A method of treating cancer by immunotherapy against BCMA as cancer antigen in a human patient, the method comprising administering an immunotherapeutic anticancer agent capable of binding to BCMA and an upregulator of BCMA mRNA levels to the human patient.
5. The immunotherapeutic anticancer agent for use of claim 1, the upregulator for use of claim 2, the combination for use of claim 3, or the method of claim 4, wherein the upregulator is a retinoid.
6. The immunotherapeutic anticancer agent for use, the upregulator for use, the combination for use, or the method, of any one of claims 1 to 5, wherein the retinoid is a non-aromatic retinoid.
7. The immunotherapeutic anticancer agent for use, the upregulator for use, the combination for use, or the method, of claim 6, wherein the non-aromatic retinoid is all-trans retinoic acid (ATRA), isotretionin (13-cis-retinoic acid), alitretinoin (9-cis- retinoic acid), retinal or retinol.
8. The immunotherapeutic anticancer agent for use, the upregulator for use, the combination for use, or the method, of any one of claims 1 to 7, wherein the upregulator is all-trans retinoic acid (ATRA).
9. The immunotherapeutic anticancer agent for use, the upregulator for use, the combination for use, or the method, of claim 5, wherein the retinoid is an aromatic retinoid.
10. The immunotherapeutic anticancer agent for use, the upregulator for use, the combination for use, or the method, of claim 9, wherein the aromatic retinoid is a monoaromatic retinoid, preferably acitretin, etretinate or motretinid.
11. The immunotherapeutic anticancer agent for use, the upregulator for use, the combination for use, or the method, of claim 9, wherein the aromatic retinoid is a polyaromatic retinoid, preferably adapalene, arotinoid, an acetylene retinoid such as tazarotene, or bexarotene.
12. The immunotherapeutic anticancer agent for use, the upregulator for use, the combination for use, or the method, of any one of claims 1 to 11, wherein the cancer is a cancer susceptible to upregulation of BCMA mRNA levels by said upregulator.
13. The immunotherapeutic anticancer agent for use, the upregulator for use, the combination for use, or the method, of any one of claims 1 to 12, wherein the cancer is a hematological cancer, preferably leukemia, lymphoma, or myeloma.
14. The immunotherapeutic anticancer agent for use, the upregulator for use, the combination for use, or the method, of any one of claims 1 to 13, wherein the cancer is a cancer in which some or all of the cancer cells express BCMA.
15. The immunotherapeutic anticancer agent for use, the upregulator for use, the combination for use, or the method, of any one of claims 1 to 14, wherein the cancer is a multiple myeloma, a B- cell leukemia or a B-cell lymphoma.
16. The immunotherapeutic anticancer agent for use, the upregulator for use, the combination for use, or the method, of any one of claims 1 to 15, wherein the cancer is a multiple myeloma.
17. The immunotherapeutic anticancer agent for use, the upregulator for use, the combination for use, or the method, of any one of claims 1 to 16, wherein the immunotherapeutic anticancer agent capable of binding to BCMA comprises immune cells expressing a chimeric antigen receptor (CAR) capable of binding to BCMA.
18. The immunotherapeutic anticancer agent for use, the upregulator for use, the combination for use, or the method, of claim 17, wherein the immune cells expressing the CAR capable of binding to BCMA are T cells expressing the CAR capable of binding to BCMA (CAR-T cells capable of binding to BCMA).
19. The immunotherapeutic anticancer agent for use, the upregulator for use, the combination for use, or the method, of any one of claims 1 to 18, wherein the immunotherapeutic anticancer agent capable of binding to BCMA comprises an antibody capable of binding to BCMA or an antibody fragment capable of binding to BCMA, and wherein said antibody or antibody fragment is preferably a bispecific antibody which is more preferably selected from a BiTE or a DART.
20. The immunotherapeutic anticancer agent for use, the upregulator for use, the combination for use, or the method, of claim 19, wherein antibody capable of binding to BCMA or antibody fragment capable of binding to BCMA is a conjugate with a drug.
21. The immunotherapeutic anticancer agent for use, the upregulator for use, the combination for use, or the method, of claim 20, wherein the drug is an anticancer drug.
22. The immunotherapeutic anticancer agent for use, the upregulator for use, the combination for use, or the method, of any one of claims 17 or 18, wherein the use leads to prolonged persistence of the immune cells and/or prolonged decline of tumor mass, compared to the cancer immunotherapy with the immune cells alone.
23. The immunotherapeutic anticancer agent for use, the upregulator for use, the combination for use, or the method, of any one of claims 1 to 22, wherein the cancer is relapsed and refractory multiple myeloma or newly diagnosed multiple myeloma.
24. The immunotherapeutic anticancer agent for use, the upregulator for use, the combination for use, or the method, of any one of claims 1 to 23, wherein in the method, a gamma secretase inhibitor is to be administered.
25. The immunotherapeutic anticancer agent for use, the upregulator for use, the combination for use, or the method, of claim 24, wherein the gamma secretase inhibitor is semagacestat (LY 450139), crenigacestat (LY3039478), RO4929097, DAPT or MK-0752.
26. An immunotherapeutic agent capable of binding to BCMA for use in a method of treating an antibody-mediated autoimmune disease in a human patient, wherein the method is a method wherein an upregulator of BCMA mRNA levels is to be administered to the human patient.
27. An upregulator of BCMA mRNA levels for use in a method of treating an antibody-mediated autoimmune disease in a human patient, wherein the method is a method wherein an immunotherapeutic agent capable of binding to BCMA is to be administered to the human patient.
28. A combination of an immunotherapeutic agent capable of binding to BCMA and an upregulator of BCMA mRNA levels for use in a method of treating an antibody-mediated autoimmune disease in a human patient.
29. A method of treating an antibody-mediated autoimmune disease in a human patient, the method comprising administering an immunotherapeutic agent capable of binding to BCMA and an upregulator of BCMA mRNA levels to the human patient.
30. The immunotherapeutic agent for use of claim 26, the upregulator for use of claim 27, the combination for use of claim 28, or the method of claim 29, wherein the upregulator is as defined in any one of claims 5-11.
31. The immunotherapeutic agent for use, the upregulator for use, the combination for use, or the method, of any one of claims 26 to 30, wherein the immunotherapeutic agent capable of binding to BCMA comprises immune cells expressing a chimeric antigen receptor (CAR) capable of binding to BCMA.
32. The immunotherapeutic agent for use, the upregulator for use, the combination for use, or the method, of claim 31, wherein the immune cells expressing the CAR capable of binding to BCMA are T cells expressing the CAR capable of binding to BCMA (CAR-T cells capable of binding to BCMA).
33. The immunotherapeutic agent for use, the upregulator for use, the combination for use, or the method, of any one of claims 26 to 32, wherein the immunotherapeutic agent capable of binding to BCMA comprises an antibody capable of binding to BCMA or an antibody fragment capable of binding to BCMA.
34. The immunotherapeutic agent for use, the upregulator for use, the combination for use, or the method, of claim 33, wherein antibody capable of binding to BCMA or antibody fragment capable of binding to BCMA is a conjugate with a drug.
35. The immunotherapeutic agent for use, the upregulator for use, the combination for use, or the method, of claim 34, wherein the drug is a cytotoxic drug.
36. The immunotherapeutic agent for use, the upregulator for use, the combination for use, or the method, of any one of claims 26-35, wherein the antibody-mediated autoimmune disease is Graves’ disease, myasthenia gravis, lupus erythematosus, rheumatoid arthritis, goodpasture syndrome, scleroderma, CREST syndrome, granulomatosis with polyangiitis, microscopic polyangiitis, pemphigus vulgaris, Sjogren’s syndrome, diabetes mellitus type 1, primary biliary cholangitis, Hashimoto’s thyreoiditis, neuromyelitis optica spectrum disorders, anti-NMDA receptor encephalitis, vasculitis or multiple sclerosis.
37. An immunotherapeutic anticancer agent comprising a gene therapy vector encoding a chimeric antigen receptor (CAR) capable of binding to BCMA, said gene therapy vector being a gene therapy vector for the in vivo expression of said CAR in immune cells, for use in a method of cancer immunotherapy against BCMA as cancer antigen in a human patient, wherein the method is a method wherein an upregulator of BCMA mRNA levels is to be administered to the human patient.
38. An upregulator of BCMA mRNA levels for use in a method of cancer immunotherapy against BCMA as cancer antigen in a human patient, wherein the method is a method wherein an immunotherapeutic anticancer agent is to be administered to the human patient, said immunotherapeutic anticancer agent comprising a gene therapy vector encoding a chimeric antigen receptor (CAR) capable of binding to BCMA, said gene therapy vector being a gene therapy vector for the in vivo expression of said CAR in immune cells.
39. A combination of an immunotherapeutic anticancer agent and an upregulator of BCMA mRNA levels for use in a method of cancer immunotherapy against BCMA as cancer antigen in a human patient, said immunotherapeutic anticancer agent comprising a gene therapy vector encoding a chimeric antigen receptor (CAR) capable of binding to BCMA, said gene therapy vector being a gene therapy vector for the in vivo expression of said CAR in immune cells.
40. A method of treating cancer by immunotherapy against BCMA as cancer antigen in a human patient, the method comprising administering an immunotherapeutic anticancer agent and an upregulator of BCMA mRNA levels to the human patient, said immunotherapeutic anticancer agent comprising a gene therapy vector encoding a chimeric antigen receptor (CAR) capable of binding to BCMA, said gene therapy vector being a gene therapy vector for the in vivo expression of said CAR in immune cells.
41. The immunotherapeutic anticancer agent for use, the upregulator for use, the combination for use, or the method, of any one of claims 37-40, wherein the upregulator is as defined in any one of claims 5-11.
42. The immunotherapeutic anticancer agent for use, the upregulator for use, the combination for use, or the method, of any one of claims 37-41, wherein the cancer is as defined in any one of claims 12-16 or 23.
43. The immunotherapeutic anticancer agent for use, the upregulator for use, the combination for use, or the method, of any one of claims 37-42, wherein in the method, a gamma secretase inhibitor is to be administered, and wherein the gamma secretase inhibitor is as defined in claims 24 or 25.
EP21717125.5A 2020-04-14 2021-04-14 Combination therapy of atra or other retinoids with immunotherapeutic agents binding to bcma Pending EP4136111A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP20169313 2020-04-14
PCT/EP2021/059657 WO2021209498A1 (en) 2020-04-14 2021-04-14 Combination therapy of atra or other retinoids with immunotherapeutic agents binding to bcma

Publications (1)

Publication Number Publication Date
EP4136111A1 true EP4136111A1 (en) 2023-02-22

Family

ID=70289340

Family Applications (1)

Application Number Title Priority Date Filing Date
EP21717125.5A Pending EP4136111A1 (en) 2020-04-14 2021-04-14 Combination therapy of atra or other retinoids with immunotherapeutic agents binding to bcma

Country Status (6)

Country Link
US (1) US20230346734A1 (en)
EP (1) EP4136111A1 (en)
JP (1) JP2023523572A (en)
CN (1) CN115667303A (en)
CA (1) CA3175159A1 (en)
WO (1) WO2021209498A1 (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2019090003A1 (en) * 2017-11-01 2019-05-09 Juno Therapeutics, Inc. Chimeric antigen receptors specific for b-cell maturation antigen (bcma)

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3131927B8 (en) * 2014-04-14 2020-12-23 Cellectis Bcma (cd269) specific chimeric antigen receptors for cancer immunotherapy
EP4269594A3 (en) * 2017-02-17 2023-12-20 Fred Hutchinson Cancer Center Combination therapies for treatment of bcma-related cancers and autoimmune disorders
WO2018201051A1 (en) * 2017-04-28 2018-11-01 Novartis Ag Bcma-targeting agent, and combination therapy with a gamma secretase inhibitor
EP3801551A4 (en) * 2018-05-24 2022-04-06 Ayala Pharmaceuticals Inc. Compositions comprising bisfluoroalkyl-1,4-benzodiazepinone compounds and immunotherapeutics and methods of use thereof
BR112021000919A2 (en) * 2018-07-19 2021-04-27 Regeneron Pharmaceuticals, Inc. chimeric antigen receptors with bcma specificity and uses thereof

Also Published As

Publication number Publication date
WO2021209498A1 (en) 2021-10-21
CA3175159A1 (en) 2021-10-21
US20230346734A1 (en) 2023-11-02
CN115667303A (en) 2023-01-31
JP2023523572A (en) 2023-06-06

Similar Documents

Publication Publication Date Title
US11865167B2 (en) Treatment of cancer using humanized anti-EGFRvIII chimeric antigen receptor
Zhang et al. Mesenchymal stromal cells as vehicles of tetravalent bispecific Tandab (CD3/CD19) for the treatment of B cell lymphoma combined with IDO pathway inhibitor D-1-methyl-tryptophan
KR20190057366A (en) Chimeric antigen receptor for the treatment of cancer
US20210169880A1 (en) Control and modulation of the function of gene-modified chimeric antigen receptor t cells with dasatinib and other tyrosine kinase inhibitors
Zheng et al. Efficacy of B7-H3-redirected BiTE and CAR-T immunotherapies against extranodal nasal natural killer/T cell lymphoma
US20230277591A1 (en) Use of flt3 car-t cells and flt3 inhibitors to treat acute myeloid leukemia
US20210268027A1 (en) Chimeric antigen receptors targeting cd37 and cd19
US20230346734A1 (en) Combination therapy of atra or other retinoids with immunotherapeutic agents binding to bcma
KR20200121783A (en) CAR-T cells targeting IL-1RAP and use thereof
US20240156863A1 (en) Sequential anti-cd19 therapy
KR20230143135A (en) CAR T-cells for treating CD19+, CD20+ or CD22+ tumors or B-cell derived auto-immune diseases
CN114981413A (en) Adoptive immunotherapy

Legal Events

Date Code Title Description
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: UNKNOWN

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE

PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE

17P Request for examination filed

Effective date: 20221110

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR

DAV Request for validation of the european patent (deleted)
DAX Request for extension of the european patent (deleted)