EP2393498A1 - Cancer diagnosis and treatment - Google Patents
Cancer diagnosis and treatmentInfo
- Publication number
- EP2393498A1 EP2393498A1 EP10706706A EP10706706A EP2393498A1 EP 2393498 A1 EP2393498 A1 EP 2393498A1 EP 10706706 A EP10706706 A EP 10706706A EP 10706706 A EP10706706 A EP 10706706A EP 2393498 A1 EP2393498 A1 EP 2393498A1
- Authority
- EP
- European Patent Office
- Prior art keywords
- nucleic acid
- sirna
- expression
- shrna
- domain
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K33/00—Medicinal preparations containing inorganic active ingredients
- A61K33/24—Heavy metals; Compounds thereof
- A61K33/243—Platinum; Compounds thereof
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/57407—Specifically defined cancers
- G01N33/57423—Specifically defined cancers of lung
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/335—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin
- A61K31/337—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having four-membered rings, e.g. taxol
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
- A61K31/47—Quinolines; Isoquinolines
- A61K31/4738—Quinolines; Isoquinolines ortho- or peri-condensed with heterocyclic ring systems
- A61K31/4745—Quinolines; Isoquinolines ortho- or peri-condensed with heterocyclic ring systems condensed with ring systems having nitrogen as a ring hetero atom, e.g. phenantrolines
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7042—Compounds having saccharide radicals and heterocyclic rings
- A61K31/7048—Compounds having saccharide radicals and heterocyclic rings having oxygen as a ring hetero atom, e.g. leucoglucosan, hesperidin, erythromycin, nystatin, digitoxin or digoxin
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/713—Double-stranded nucleic acids or oligonucleotides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/32—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against translation products of oncogenes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering N.A.
Definitions
- the invention relates to small inhibitory RNAs [siRNA] in the treatment of cancer, in particular lung cancers; including methods of diagnosis and treatment and animal models.
- siRNA small inhibitory RNAs
- Cancer is an abnormal disease state in which uncontrolled proliferation of one or more cell populations interferes with normal biological function. The proliferative changes are usually accompanied by other changes in cellular properties, including reversion to a less differentiated state. Cancer cells are typically referred to as "transformed”. Transformed cells generally display several of the following properties: spherical morphology, expression of fetal antigens, growth-factor independence, lack of contact inhibition, anchorage-independence, and growth to high density. Cancer cells form tumours and are referred to as "primary" or "secondary" tumours. A primary tumour results in cancer cell growth in an organ in which the original transformed cell develops. A secondary tumour results from the escape of a cancer cell from a primary tumour and the establishment of a secondary tumour in another organ.
- metastasis The process is referred to as metastasis and this process may be aggressive, for example as in the case of hepatoma or lung cancer; or non aggressive, for example early prostate cancer.
- the transformation of a normal cell to a cancer cell involves alterations in gene expression that results in the altered phenotype of the cancer cell.
- the genes expressed by cancer cells are unique to a particular cancer.
- tumour suppressor genes encode proteins that function to inhibit cell growth or division, while tumour promoters may play a role in the promotion or execution of cell growth or division. Both are important with respect to maintaining proliferation, growth and differentiation of normal cells, and mutations often result in abnormal cell-cycle progression.
- Tumour suppressor and tumour promoter genes function in all parts of the cell (e.g. cell surface, cytoplasm, nucleus) to influence the passage of damaged cells through the cell- cycle (i.e. G1, S 1
- Lung cancer is a generic term to describe cancers of lung tissue.
- the majority of lung cancers are carcinomas which are derived from epithelial cells. Of this type the cancer is either a small cell lung carcinoma or a non-small cell lung cancer.
- Other classes of lung cancer include carcinoid, sarcoma and metastatic cancers of different tissue origin. Lung cancers are amongst the most common cancers there being a strong correlation between the incidence of lung cancer and smoking tobacco. The prognosis of lung cancer patients is not good even with treatment.
- Treatment is either surgery if there is early detection or chemotherapy with agents such as cisplatin, paclitaxel, docetaxel, gemcitabine and vinorelbine. Therefore there is a continued need to develop diagnostic tests and treatments that improve the survival rates of patients suffering from cancers such as lung cancer.
- siRNA small inhibitory or interfering RNA
- the siRNA molecule comprises two complementary strands of RNA (a sense strand and an antisense strand) annealed to each other to form a double stranded RNA molecule.
- the siRNA molecule is typically derived from exons of the gene which is to be ablated. The mechanism of RNA interference is being elucidated. Many organisms respond to the presence of double stranded RNA by activating a cascade that leads to the formation of siRNA.
- RNA double stranded RNA activates a protein complex comprising RNase III which processes the double stranded RNA into smaller fragments (siRNAs, approximately 21-29 nucleotides in length) which become part of a ribonucleoprotein complex.
- the siRNA acts as a guide for the RNase complex to cleave mRNA complementary to the antisense strand of the siRNA thereby resulting in destruction of the mRNA.
- siRNA as a therapeutic strategy in the treatment of cancer, in particular lung cancer.
- WO2005/090991 describes siRNA directed to mRNA encoded by the ADAM8 gene which has a metalloprotease domain and is overexpressed in non-small cell lung cancer. Over expression of ADAM8 is also used as a diagnostic tool for lung cancer.
- WO2007/116923 the association of expression of SEZ6L2 as a prognostic marker is disclosed.
- vector encoded siRNA directed to SEZ6L2 mRNA suppresses expression with a concomitant inhibition of non-small lung cell growth.
- WO2007/136758 describes the use of siRNA in the inhibition of phosphatidylinositol 3 kinases in breast colorectal and lung cancer.
- Further examples of diagnostic/prognostic assays for small cell lung cancers include detection of IMP-1 oncogene in lung cancers; see WO2008/020652; detection of KIF4A, MAPJD, NPTX or FGFR1OP in lung cancer; see WO2008/023840; and WO2008/120812 which describes the detection of the CDCA8-AURKB complex in non-small cell lung cancer.
- Cip1 -interacting zinc finger protein 1 (Ciz1) is required for cell proliferation. Ciz1 localises to nuclear matrix bound foci that form sites of DNA replication during early S phase and promotes the initiation of DNA replication in association with cell cycle regulators including cyclin A/CDK2, cyclin E/CDK2 and p21cip1.
- CIZ1 is an oestrogen responsive gene that is itself a positive cofactor of the oestrogen receptor (ER), capable of enhancing the recruitment of ER to target chromatin.
- Ciz1 is alternatively spliced to produce conserved isoforms in mouse and man.
- Ciz1 DNA replication factor 1 .
- An alternatively spliced Ciz1 transcript has also been isolated from a medullablastoma cDNA library and linked to this disease (Warder, D. E. and M.J. Keherly, Ciz1, Cip1 interacting zinc finger protein 1 binds the consensus DNA sequence ARYSR(0-2)YYAC. J Biomed Sci, 2003. 10(4): p. 406-17.)
- Ciz1 plays a role in mammalian DNA replication that involves interaction with cyclin E and cyclin A, most likely tethering these activities to specific sites on the nuclear matrix where initiation of DNA replication takes place.
- molecular tools that efficiently and specifically detect expression of sequences that encode catalytic and anchorage domains of Ciz1 , and which discriminate between appropriately and inappropriately spliced transcripts.
- Their application to cell lines and to 27 tumour- derived RNAs and 27 matched control RNAs revealed that expression of domains involved in matrix attachment is disrupted in the majority of tumours tested.
- RNA small interfering RNA
- shRNA short hairpin RNA
- siRNA or shRNA is an inhibitor of CIZ1 expression.
- said RNA molecule is between 19 nucleotides [nt] and 29nt in length. More preferably still said RNA molecule is between 21 nt and 27nt in length. Preferably said RNA molecule is about 21 nt in length.
- siRNA consists of 21 bp.
- siRNA or shRNA includes modified nucleotides.
- modified describes a nucleic acid molecule in which; i) at least two of its nucleotides are covalently linked via a synthetic internucleoside linkage (i.e., a linkage other than a phosphodiester linkage between the 5' end of one nucleotide and the 3' end of another nucleotide).
- a synthetic internucleoside linkage i.e., a linkage other than a phosphodiester linkage between the 5' end of one nucleotide and the 3' end of another nucleotide.
- said linkage may be the 5' end of one nucleotide linked to the 5' end of another nucleotide or the 3' end of one nucleotide with the 3' end of another nucleotide; and/or
- a chemical group, such as cholesterol, not normally associated with nucleic acids has been covalently attached to the double stranded nucleic acid.
- Preferred synthetic intemucleoside linkages are phosphorothioates, alkylphosphonates, phosphorodithioates, phosphate esters, alkylphosphonothioates, phosphoramidates, carbamates, phosphate triesters, acetamidates, peptides, and carboxymethyl esters.
- modified nucleotides also encompasses nucleotides with a covalently modified base and/or sugar.
- modified nucleotides include nucleotides having sugars which are covalently attached to low molecular weight organic groups other than a hydroxyl group at the 3' position and other than a phosphate group at the 5' position.
- modified nucleotides may also include 2' substituted sugars such as 2'-O-methyl-;
- 2-O-alkyl 2-O-allyl; 2'-S-alkyl; 2'-S-allyl; 2'- fluoro-; 2'-halo or 2;azido-ribose, carbocyclic sugar analogues a-anomeric sugars; epimeric sugars such as arabinose, xyloses or lyxoses, pyranose sugars, furanose sugars, and sedoheptulose.
- Modified nucleotides include, by example and not by way of limitation, alkylated purines and/or pyrimidines; acylated purines and/or pyrimidines; or other heterocycles. These classes of pyrimidines and purines are known in the art and include, pseudoisocytosine; N4, N4-ethanocytosine; 8-hydroxy-N6-methyladenine; 4- acetylcytosine, 5-(carboxyhydroxylmethyl) uracil; 5-fluorouracil; 5-bromouracil;5- carboxymethylaminomethyl-2-thiouracil; 5 carboxymethylaminomethyl uracil; dihydrouracil; inosine; N6-isopentyl-adenine; l-methyladenine; 1-methylpseudouracil; 1- methylguanine; 2,2-dimethylguanine; 2-methyladenine; 2-methylguanine; 3- methylcytosine;
- siRNA or shRNA is part of an expression vector adapted for eukaryotic expression; preferably said siRNA or shRNA is operably linked to at least one promoter sequence.
- said vector is adapted by inclusion of a transcription cassette comprising a nucleic acid molecule wherein said cassette comprises the nucleic acid sequence GAAGAAGAGATCGAGGTGAGGTCCAGAGA which is adapted such that both sense and antisense nucleic acid molecules are transcribed from said cassette wherein said sense and antisense nucleic acid molecules are adapted to anneal over at least part of their length to form an siRNA or shRNA.
- said cassette is provided with at least two promoters adapted to transcribe both sense and antisense strands of said nucleic acid molecule.
- said cassette comprises a nucleic acid molecule wherein said molecule comprises a first part linked to a second part wherein said first and second parts are complementary over at least part of their sequence and further wherein transcription of said nucleic acid molecule produces an RNA molecule which forms a double stranded region by complementary base pairing of said first and second parts thereby forming an shRNA.
- Enhancer is an art recognised term and, for the sake of clarity, includes the following features which are provided by example only.
- Enhancer elements are cis acting nucleic acid sequences often found 5' to the transcription initiation site of a gene (enhancers can also be found 3' to a gene sequence or even located in intronic sequences). Enhancers function to increase the rate of transcription of the gene to which the enhancer is linked. Enhancer activity is responsive to trans acting transcription factors which have been shown to bind specifically to enhancer elements. The binding/activity of transcription factors (please see Eukaryotic Transcription Factors, by David S Latchman, Academic Press Ltd, San Diego) is responsive to a number of physiological/environmental cues.
- Promoter elements also include so called TATA box and RNA polymerase initiation selection sequences which function to select a site of transcription initiation. These sequences also bind polypeptides which function, inter alia, to facilitate transcription initiation selection by RNA polymerase. Adaptations also include the provision of selectable markers and autonomous replication sequences which facilitate the maintenance of said vector in either the eukaryotic cell or prokaryotic host. Vectors which are maintained autonomously are referred to as episomal vectors.
- LCRs Locus Control Regions
- viruses or "viral vectors" as therapeutic agents is well known in the art. Additionally, a number of viruses are commonly used as vectors for the delivery of exogenous genes. Commonly employed vectors include recombinantly modified enveloped or non-enveloped DNA and RNA viruses, preferably selected from retroviridae baculoviridiae, pan/oviridiae, picornoviridiae, herpesveridiae, poxviridae, adenoviridiae, or picornnaviridiae. Chimeric vectors may also be employed which exploit advantageous elements of each of the parent vector properties (See e.g., Feng, et al. (1997) Nature Biotechnology 15:866-870). Such viral vectors may be wild-type or may be modified by recombinant DNA techniques to be replication deficient, conditionally replicating or replication competent.
- Preferred vectors are derived from retroviral genomes [e.g. lentivirus].
- Viral vectors may be conditionally replicating or replication competent.
- Conditionally replicating viral vectors are used to achieve selective expression in particular cell types while avoiding untoward broad spectrum infection. Examples of conditionally replicating vectors are described in Pennisi, E. (1996) Science 274:342-343; Russell, and S.J. (1994) Eur. J. of Cancer 30A(8):1165-1171. Additional examples of selectively replicating vectors include those vectors wherein a gene essential for replication of the virus is under control of a promoter which is active only in a particular cell type or cell state such that in the absence of expression of such gene, the virus will not replicate. Examples of such vectors are described in Henderson, et al., United States Patent No.
- the viral genome may be modified to include inducible promoters which achieve replication or expression only under certain conditions.
- inducible promoters are known in the scientific literature (See, e.g. Yoshida and Hamada (1997) Biochem. Biophys. Res. Comm. 230:426-430; lida, et al. (1996) J. Virol. 70(9):6054- 6059; Hwang, et al. (1997) J. Virol 71 (9):7128-7131; Lee, et al. (1997) MoI. Cell. Biol. 17(9):5097-5105; and Dreher, et al. (1997) J. Biol. Chem 272(46); 29364-29371.
- said vectors include promoters that are substantially lung or cancer specific; preferably said promoters are preferentially active in lung cancer cells.
- composition comprising one or more siRNA or shRNA selected from the group consisting of:
- composition comprises 2, 3, 4, 5, 6, 7, 8, 9 or 10 siRNAs or shRNAs.
- anti-cancer agent is a chemotherapeutic agent.
- said chemotherapeutic agent is selected from the group consisting of: cisplatin, paclitaxel, docetaxel, gemcitabine and vinorelbine.
- compositions of the present invention are administered in pharmaceutically acceptable preparations.
- Such preparations may routinely contain pharmaceutically acceptable concentrations of salt, buffering agents, preservatives, compatible carriers and supplementary anti-cancer agents.
- compositions of the invention can be administered by any conventional route, including injection or by gradual infusion over time.
- Treatment may be topical or systemic.
- the administration may, for example, be oral, intravenous, intraperitoneal, intramuscular, intracavity, subcutaneous, transdermal, transepithelial or intra bone marrow administration.
- compositions of the invention are administered in effective amounts.
- An "effective amount” is that amount of a composition that alone, or together with further doses, produces the desired response.
- the desired response is inhibiting the progression of the disease. This may involve only slowing the progression of the disease temporarily, although more preferably, it involves halting the progression of the disease permanently. This can be monitored by routine methods.
- Such amounts will depend, of course, on the particular condition being treated, the severity of the condition, the individual patient parameters including age, physical condition, size and weight, the duration of the treatment, the nature of concurrent therapy (if any), the specific route of administration and like factors within the knowledge and expertise of the health practitioner. These factors are well known to those of ordinary skill in the art and can be addressed with no more than routine experimentation. It is generally preferred that a maximum dose of the individual components or combinations thereof be used, that is, the highest safe dose according to sound medical judgment. It will be understood by those of ordinary skill in the art, however, that a patient may insist upon a lower dose or tolerable dose for medical reasons, psychological reasons or for virtually any other reasons.
- compositions used in the foregoing methods preferably are sterile and contain an effective amount of an agent according to the invention for producing the desired response in a unit of weight or volume suitable for administration to a patient.
- the doses of the siRNA/shRNA according to the invention administered to a subject can be chosen in accordance with different parameters, in particular in accordance with the mode of administration used and the state of the subject. Other factors include the desired period of treatment. In the event that a response in a subject is insufficient at the initial doses applied, higher doses (or effectively higher doses by a different, more localized delivery route) may be employed to the extent that patient tolerance permits.
- doses of siRNA/shRNA of between 1nM - 1 ⁇ M generally will be formulated and administered according to standard procedures. Preferably doses can range from 1nM-500nM, 5nM-200nM, and 10nM-100nM. Other protocols for the administration of compositions will be known to one of ordinary skill in the art, in which the dose amount, schedule of injections, sites of injections, mode of administration and the like vary from the foregoing.
- the administration of compositions to mammals other than humans, is carried out under substantially the same conditions as described above.
- a subject, as used herein is a mammal, preferably a human, and including a non-human primate, cow, horse, pig, sheep, goat, dog, cat or rodent.
- the pharmaceutical preparations of the invention When administered, the pharmaceutical preparations of the invention are applied in pharmaceutically-acceptable amounts and in pharmaceutically-acceptable compositions.
- pharmaceutically acceptable means a non-toxic material that does not interfere with the effectiveness of the biological activity of the active ingredients.
- Such preparations may routinely contain salts, buffering agents, preservatives, compatible carriers, and optionally other therapeutic agents' (e.g. anti-inflammatory agents such as steroids, non-steroidal anti-inflammatory agents).
- the salts should be pharmaceutically acceptable, but non-pharmaceutically acceptable salts may conveniently be used to prepare pharmaceutically-acceptable salts thereof and are not excluded from the scope of the invention.
- Such pharmacologically and pharmaceutically-acceptable salts include, but are not limited to, those prepared from the following acids: hydrochloric, hydrobromic, sulfuric, nitric, phosphoric, maleic, acetic, salicylic, citric, formic, malonic, succinic, and the like.
- pharmaceutically-acceptable salts can be prepared as alkaline metal or alkaline earth salts, such as sodium, potassium or calcium salts.
- compositions may be combined, if desired, with a pharmaceutically-acceptable carrier.
- pharmaceutically-acceptable carrier means one or more compatible solid or liquid fillers, diluents or encapsulating substances which are suitable for administration into a human.
- carrier in this context denotes an organic or inorganic ingredient, natural or synthetic, with which the active ingredient is combined to facilitate the application, (e.g. liposome or immuno-liposome).
- the components of the pharmaceutical compositions also are capable of being co-mingled with the molecules of the present invention, and with each other, in a manner such that there is no interaction which would substantially impair the desired pharmaceutical efficacy.
- the pharmaceutical compositions may contain suitable buffering agents, including: acetic acid in a salt; citric acid in a salt; boric acid in a salt; and phosphoric acid in a salt.
- suitable buffering agents including: acetic acid in a salt; citric acid in a salt; boric acid in a salt; and phosphoric acid in a salt.
- suitable preservatives such as: benzalkonium chloride; chlorobutanol; parabens and thimerosal.
- compositions may conveniently be presented in unit dosage form and may be prepared by any of the methods well-known in the art of pharmacy. All methods include the step of bringing the active agent into association with a carrier which constitutes one or more accessory ingredients. In general, the compositions are prepared by uniformly and intimately bringing the active compound into association with a liquid carrier, a finely divided solid carrier, or both, and then, if necessary, shaping the product.
- compositions suitable for oral administration may be presented as discrete units, such as capsules, tablets, lozenges, each containing a predetermined amount of the active compound.
- Other compositions include suspensions in aqueous liquids or non-aqueous liquids such as syrup, elixir or an emulsion or as a gel.
- Compositions may be administered as aerosols and inhaled.
- compositions suitable for parenteral administration conveniently comprise a sterile aqueous or non-aqueous preparation of agent, which is preferably isotonic with the blood of the recipient.
- This preparation may be formulated according to known methods using suitable dispersing or wetting agents and suspending agents.
- the sterile injectable preparation also may be a sterile injectable solution or suspension in a nontoxic parenterally-acceptable diluent or solvent, for example, as a solution in 1 , 3-butane diol.
- the acceptable solvents that may be employed are water, Ringer's solution, and isotonic sodium chloride solution.
- sterile, fixed oils are conventionally employed as a solvent or suspending medium.
- any bland fixed oil may be employed including synthetic mono-or di-glycerides.
- fatty acids such as oleic acid may be used in the preparation of injectables.
- Carrier formulation suitable for oral, subcutaneous, intravenous, intramuscular, etc. administrations can be found in Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, PA.
- a method to diagnose cancer in a subject comprising: i) providing an isolated biological sample to be tested; ii) forming a preparation comprising said sample and an oligonucleotide primer pair adapted to anneal to a nucleic acid molecule comprising a nucleic acid sequence as represented in Figure 6; a thermostable DNA polymerase, deoxynucleotide triphosphates and co-factors; iii) providing polymerase chain reaction conditions sufficient to amplify said nucleic acid molecule; iv) analysing the amplified products of said polymerase chain reaction for the presence or absence of a nucleic acid molecule comprising a nucleic acid sequence ⁇ 'GAAGAAGAGATCGAGGTGAGGTCCAGAGAS'; and optionally v) comparing the amplified product with a normal matched control.
- cancer refers to cells having the capacity for autonomous growth, i.e., an abnormal state or condition characterized by rapidly proliferating cell growth.
- the term is meant to include all types of cancerous growths or oncogenic processes, metastatic tissues or malignantly transformed cells, tissues, or organs, irrespective of histopathologic type or stage of invasiveness.
- cancer includes malignancies of the various organ systems, such as those affecting, for example, lung, breast, thyroid, lymphoid, gastrointestinal, and genito-urinary tract, as well as adenocarcinomas which include malignancies such as most colon cancers, renal-cell carcinoma, prostate cancer and/or testicular tumours, non-small cell carcinoma of the lung, cancer of the small intestine and cancer of the esophagus.
- carcinoma is art recognized and refers to malignancies of epithelial or endocrine tissues including respiratory system carcinomas, gastrointestinal system carcinomas, genitourinary system carcinomas, testicular carcinomas, breast carcinomas, prostatic carcinomas, endocrine system carcinomas, and melanomas. Exemplary carcinomas include those forming from tissue of the cervix, lung, prostate, breast, head and neck, colon and ovary.
- carcinomas include those forming from tissue of the cervix, lung, prostate, breast, head and neck, colon and ovary.
- carcinosarcomas e.g., which include malignant tumours composed of carcinomatous and sarcomatous tissues.
- An "adenocarcinoma” refers to a carcinoma derived from glandular tissue or in which the tumor cells form recognizable glandular structures.
- lung cancer refers to malignant tumors of mesenchymal derivation.
- Further examples include lung cancer for example small cell lung carcinoma or a non-small cell lung cancer.
- Other classes of lung cancer include neuroendocrine cancer, sarcoma and metastatic cancers of different tissue origin.
- said amplified products are digested with a restriction endonuclease that does not cleave the nucleic acid sequence, 5'GAAGAAGAGATCGAGGTGAGGTCCAGAGAa'.
- restriction endonuclease is CAC81.
- said oligonucleotide primer pair is adapted to specifically amplify a nucleic acid molecule comprising a nucleic acid sequence GAAGAAGAGATCGAGGTGAGGTCCAGAGA.
- one of said oligonucleotide primers in said primer pair comprises or consists of the nucleic acid sequence: 5' GAAGAGATCGAGGTGAGGTC 3'.
- oligonucleotide primer pairs comprise or consist of nucleic acid sequences:
- an amplified product containing the sequence GAAGAAGAGATCGAGGTGAGGTCCAGAGA is detected with an oligonucleotide probe comprising or consisting of the nucleotide sequence: 5' TGGACCTCACCTCGATCTCTTCTTCA 3'.
- said biological sample comprises lung tissue.
- said diagnosis is combined with a treatment regime suitable for the cancer diagnosed.
- said treatment regime comprises the administration of an anti-cancer agent.
- siRNA or shRNA comprises a nucleic acid sequence selected from the group consisting of:
- said agent is a chemotherapeutic agent.
- chemotherapeutic agent is selected from the group consisting of: cisplatin, paclitaxel, docetaxel, gemcitabine and vinorelbine.
- said anti-cancer agent is a siRNA or shRNA which is not a siRNA or shRNA according to the invention.
- said treatment regime comprises the administration of at least one siRNA or shRNA and the chemotherapeutic agent is administered separately, simultaneously or sequentially.
- said lung cancer is small cell lung carcinoma.
- a method to diagnose cancer in a subject by analyzing the expression of exon 14 of Ciz 1 comprising: i) providing an isolated biological sample to be tested; ii) forming a preparation comprising said sample and an antibody that specifically binds a polypeptide that comprises the peptide sequence DEEEIEVRSRDIS to form an antibody/polypeptide complex; iii) detecting the complex so formed; and iv) comparing the expression of said polypeptide with a normal matched control and optionally with other exons of Ciz1.
- said antibody is a monoclonal antibody.
- said antibody is a polyclonal antibody.
- an antibody that binds a peptide sequence DEEEIEVRSRDIS or a polypeptide comprising the peptide sequence DEEEIEVRSRDIS and which binds said peptide sequence.
- said antibody is a monoclonal antibody.
- hybridoma cell line that produces a monoclonal antibody according to the invention.
- kits comprising oligonucleotide primers and probes adapted to specifically detect a nucleic acid molecule comprising a nucleic acid sequence 5' GAAGAAGAGATCGAGGTGAGGTCCAGAGA 3'.
- said kit comprises oligonucleotide primers and probes comprising or consisting of the nucleic acid sequences: 5 1 GAAGAGATCGAGGTGAGGTC 3';
- said kit further comprises a thermostable DNA polymerase, deoxynucleotide triphosphates and co-factors; preferably said kit includes instructions required to selectively amplify said nucleic acid molecule.
- a method to diagnose cancer in a subject by comparing the expression of the Ciz 1 replication domain and Ciz 1 immobilisation domain comprising the steps: i) providing an isolated biological sample to be tested; ii) forming a preparation comprising said sample and oligonucleotide primer pairs adapted to anneal to a nucleic acid molecule comprising a nucleic acid sequence as represented in Figure 7a, 7b, 8a, 8b, a thermostable DNA polymerase, deoxynucleotide triphosphates and co-factors; iii) providing polymerase chain reaction conditions sufficient to amplify said nucleic acid molecules; iv) quantitatively comparing the relative expression of said Ciz 1 replication domain and immobilization domains; and optionally v) comparing the ratio of expression of each domain with a normal matched control.
- said oligonucleotide primer pair that amplifies the Ciz 1 replication domain is selected from the group consisting of:
- said oligonucleotide primer pair that amplifies the Ciz 1 immobilization domain is selected from the group consisting of:
- a method to diagnose cancer in a subject by comparing the expression of the Ciz 1 replication domain and Ciz 1 immobilisation domain comprising the steps: i) providing an isolated biological sample to be tested; ii) forming a preparation comprising said sample an antibody that specifically binds the Ciz 1 replication domain or the
- Ciz 1 immobilization domain to form an antibody/domain complex; iii) detecting the complex so formed; iv) quantitatively comparing the relative amounts of said Ciz 1 replication domain protein and immobilization domain protein; and optionally v) comparing the ratio of expression of each domain with a normal matched control.
- a kit comprising oligonucleotide primers adapted to specifically amplify a nucleic acid molecule comprising the replication domain of Ciz 1 and the immobilisation domain of Ciz 1.
- said oligonucleotide primers that amplify the immobilization domain are:
- said kit includes oligonucleotide probes that detect the amplified Ciz 1 replication domain and are selected from the group consisting of: CGCCAGTCCTTGCTGGGACC or CCCTGCCCAGAGGACATCGCC
- said kit includes oligonucleotide probes that detect the amplified Ciz 1 immobilization domain and are selected from the group consisting of TGGTCCTCATCTTGGCCAGCA or CACGGGCACCAGGAAGTCCA ; or CACTGCAAGTCCCTGGGCCA.
- kits comprising a first antibody that specifically binds the replication domain of Ciz 1 protein and a second antibody that binds the immobilization domain of Ciz 1 protein.
- said antibody is a monoclonal antibody.
- a non-human transgenic mammal wherein said mammal is modified with a nucleic acid molecule comprising a nucleic acid sequence selected from the group consisting of: i) a nucleic acid molecule comprising or consisting* of a nucleic acid sequence as represented in Figure 7a or Figure 7b; ii) a nucleic acid sequence that hybridizes to a nucleic acid molecule under stringent hybridization conditions to the nucleic acid sequences in i) above and which encodes a polypeptide with DNA replication initiation activity; iii) a nucleic acid molecule comprising or consisting of a nucleic acid sequence as represented in Figure 8a or Figure 8b; iv) a nucleic acid sequence that hybridizes to a nucleic acid molecule under stringent hybridization conditions to the nucleic acid sequences in iii) above and which encodes a polypeptide with nuclear matrix binding activity.
- the expression of said nucleic acid molecule is regulatable.
- said expression is inducible or repressible.
- said expression is tissue or developmentally regulated.
- said non-human mammal is a rodent; preferably a rat or mouse.
- said mammal is a non-human primate.
- Figure 1 illustrates: a schematic representation of the Ciz1 gene showing exon structure. Regions that code for functional domains involved in DNA replication 3 , and attachment to the nuclear matrix 1 are indicated by black lines above. Dotted lines indicate uncertainty regarding domain boundaries. Gaps indicate sequences that are spliced out of variants with full activity in vitro. The location of PCR primers and probes are shown in relation to the known functional domains. Pink bar: probe T5 in exon 5, green bar: probe T7 at the junction between exons 6 and 7, yellow bar: probe T4 in exon 14, blue bar: probe T3 in exon 16.
- Ciz1 expression dCT values after normalization to actin
- Results are expressed on a log scale. Changes that are less than two-fold (indicated by grey region) are considered to be insignificant. This analysis does not reveal balanced under or over expression of Ciz1 , and only reveals changes in expression relative to surrounding tissue. The degree of RD and AD imbalance increases with tumour stage;
- Results for lung tumours stages I to III are comparable to the sample set analysed in Fig. 1 and are shaded in grey. For all tumour types examples of stage IV tumours are also included. For most of these expression of RD is equal to or exceeds RD (indicated with an * ).
- FIG. 3 A Analysis as in figure 2, indicates altered expression in favour of AD in 40 malignant melanomas compared to control (stage 0) samples. Results for the two sets of detection tools are normalized to 1 for the first stage 0 sample. Right panel, summary of results for stage II, III and IV tumours indicating the % of samples in which anchor domain expression exceeds that of the replication domain;
- Fig. 4 Ways in which uncoupled expression of Ciz1 replication domain (black line) and nuclear matrix anchor domain (yellow circle) could influence immobilization of Ciz1 and the sub-nuclear localization of its DNA replication activity. Grey barrels represent DNA replication proteins assembled at replication origins, grey ovals represent nuclear matrix-associated docking sites for Ciz1. The model assumes that nuclear matrix- associated docking sites are limiting. Right panel shows a variant of Ciz1 with impaired ability to become assembled into the nuclear matrix.
- B Summary of two types of Ciz1 mis-expression seen in human tumours, i) Uncoupled expression as seen in most common solid tumours and described in figs. 1-3, ii) b-variant as seen in a high proportion of small cell lung cancers, thyroid cancers and lymphomas;
- Ciz1 replication domain (RD) and anchor domain (AD) antibodies and analysis of RD and AD protein expression.
- Results illustrate i) uncoupled and imbalanced expression of Ciz1-RD and Ciz1-AD at the protein level, ii) elevated Ciz1-RD protein that is not immobilized in cancer cells, iii) Immobilization of the majority of Ciz1-AD protein; D) Effect of recombinant AD protein on immobilization of endogenous Ciz1.
- High-magnification images of the DNAse-resistant fraction of endogenous Ciz1-RD red
- NIH3T3 cells without (left panel) or with (right panels) expression of recombinant GFP-C275 (green), which encodes murine AD protein.
- Total DNA is stained with Hoechst 33258 (blue).
- Fig. 6 A) Scheme indicating the products generated using b-type transcript junction spanning primer (red arrow) and the location of junction-spanning taqman probe (red line). B) Mobility variation observed in cloned products with b-variant exon from a SCLC cell line and full length products from a normal cell line. C) Junction-spanning primer was verified using reporter plasmids expressing normal transcript (clone 19) or b-type transcript (clone 20). Gels show plasmid derived PCR products from selective primer pair P3/4 or unselective Ciz1 primer pair P1/2.
- Fig. 7 A QPCR for RD (left panel) or AD (centre panel) as in Figs 1-3, of b-variant using templates from three 'normal' embryonic lung cell lines and three neuroendocrine lung tumour cell lines, plus one neuroendocrine carcinoid. Results are normalized to actin and calibrated to IMR90 RD.
- D Human lung cancer tissues. The same detection tools were applied to cDNA from 3 SCLC patients and three normal adjacent tissue from the same individuals. Expression of b-type transcript is dramatically elevated in these neuroendocrine tumours;
- Fig. 8 A) Expression of b-type transcripts (black bars) in matched sample sets from 23 lung cancer patients (same sets as Fig. 1) ranging from grade I to grade III (Origene cDNA array HLRT504). Expression is normalized to actin and expressed relative to the 'normal' sample (white bars) in each pair, which is given an arbitrary value of 1.
- Fig. 9 illustrates analysis as in Fig. 8 for lymphoma, thyroid and bladder cancers. For both indications, elevated b-variant transcript is detected in a high proportion of patients.
- Fig. 10 Generation and Validation of exon 14b-variant protein detection tools.
- Recombinant 14b protein is detected in red, and DNA is stained in blue.
- FIG. 11 Development of b-type transcript selective RNA interference tools.
- Clones 19 and 20 were co-transfected with b-type transcript selective siRNA or control siRNA as indicated, into mouse 3T3 cells.
- B-type transcript siRNA suppresses expression of protein from expression clone 20, but not endogenous mouse Ciz1 or human Ciz1 from expression clone 19;
- Fig. 12 Effect of inducible expression of b-variant selective shRNA on SCLC cell proliferation in culture.
- Fig. 13 In vivo study (Southern Research Institute, USA).
- A) Two cohorts of 15 NOD/SCID mice were injected with 1.5x107 cells harbouring dox-regulated b-type variant selective shRNA vector on day 0. At 21 days mice with tumours less than 100 mg were discounted creating groups with equal mean tumour weight and low inherent variation. Dox was administered in drinking water to group 2 (black circles) at 21 days and tumour size was measured twice weekly thereafter. Graphs show mean tumour weight with SEM
- An additional 10 mice were maintained on Dox from 3 days prior to injection with SCLC cells. Results show their mean tumour weight with SEM, compared to mean tumour weight of 15 mice that did not receive dox.
- Figure 14 is the nucleotide sequence of exons 13-17 of Ciz 1;
- Figure 15a is the nucleotide sequence of the minimal replication domain of Ciz 1 that encodes a polypeptide with replication activity
- Figure 15b is the nucleotide sequence of the replication domain
- Figure 15c is the minimal amino acid sequence of Ciz 1 replication domain
- Figure 15d is the amino acid sequence of the replication domain
- Figure 16a is the nucleotide sequence of the anchor domain of Ciz 1 that encodes a polyeptide that anchors Ciz 1 to nuclear matrix sites;
- Figure 16b is the nucleotide sequence of the Ciz 1 anchor domain;
- Figure 16c is the minimal amino acid sequence of Ciz 1 anchor domain;
- Figure 16d is the amino acid sequence of the Ciz 1 anchor domain;
- FIG. 17 Suppression of Ciz1 expression by RNAi restrains lung cancer cell proliferation.
- cDNA arrays TissueScan qPCR arrays containing 2-3 ng of cDNA from 48 differentizi samples (HLRT101), and 24 matched pairs of lung carcinoma and adjacent tissue from t same patient (HLRT504), or 10 sets of tissue samples from different cancers (CSRT504) we from OriGene Technologies, Inc. (Rockville, MD). Tumour classifications and abstract pathology reports for the lung/normal matched pair tissue array are as given http://www.oriqene.com/geneexpression/disease-panels/products/HLRT504.aspx.
- RNA samples were reverse transcribed with random primers, a mixture of oligo dT and random primers as follows.
- RNA was incubated with 1 ⁇ L 500 ⁇ g/mL random primers, 1 ⁇ L 10 m dNTPs to a total volume of 13 ⁇ L in DEPC water.
- PCR and QPCR Primer pair combination used for fragment amplification included p8/p2 usir Taq polymerase (NEB, Herts, UK), 94°C/5 minutes and then 33 cycles of 94°C/15 second 55°C/30 seconds and 68 0 C for 1 minute, and a final step at 68 0 C for 7 minutes), p1/p2 usir phusion polymerase (Finnzymes, Espoo, Finland) 98°C/30 seconds and 33 cycles of 98 0 C/' seconds, 62°C/30 seconds and 72 0 C for 40 sec, and 72/ 0 C for 7 minutes and p4/p3 using Ts olymerase(NEB, Herts, UK), 94°C/5 minutes and then 33 cycles of 94°C/30 seconds, 62°C/C seconds and 72°C/40 seconds followed by a final step at 72 0 C for 7 minutes).
- PCR reactior were run on an MJ thermal cycler PTC-200. Quantitative PCR reactions were carried out MicroAmpTM optical 96-well reaction plates with optical adhesive film (Applied Biosystems) in total volume of 25 ⁇ L. For each reaction cDNA was incubated with 1x TaqMan ® PCR m (Applied Biosystems), 0.4 ⁇ M forward primer, 0.4 ⁇ M reverse primer and 0.4 ⁇ M prob Samples were run on the ABI Prism 7000 or 7300 Sequence Detection system using tr relative quantification assay, and the following programme; 50 0 C [2 minutes], 95 0 C [1 minutes], followed by 40 cycles of 95 0 C denaturation [15 seconds], 60 0 C annealing ar elongation [1 minute].
- the cycle number at which the sample passed the threshold level is tr Ct value.
- One sample was selected as the 'calibrator' sample and all other expression valu « expressed relative to it (RQ) [26].
- primers were from Sigma Aldric probes were from MWG, and sequence verification of clones and PCR products was carric out by MWG.
- Ciz1- RD was detected with anti-Ciz1 polyclonal antibody 1793 [18] and Ciz1-AD with polyclonal antibody 2C affinity purified using Ciz 1 anchor domain peptide DEDEEEIEVEEELCKQVRSRDISR. DNA was counterstained with Hoechst 33258 (Sigma).
- Ciz1 cyclin-dependent stimulation of DNA replication and association with t nuclear matrix
- RD replicati domain
- AD anchor domain
- Ciz1 does not require its nuclear matrix anchor order to promote DNA replication.
- Ciz1 fragments lacking AD appear to be more acti than those that would be attached to the nuclear matrix 3 , implying that immobilization is constraining feature rather than one that is intrinsic to function.
- tr expression of RD and AD are not coincident in most cancer cells. Expression of one or oth of the domains is altered and imbalanced in the majority of lung cancers, as well as a range other common solid tumours.
- Ciz1 expression is clea uncoupled and imbalanced, for some patients this is manifest as decreased RD and for othe as increased RD (relative to the stage IA samples), giving rise to a near horizontal trend Ii with poor fit.
- RD and AD were sampled in a number of common solid tumours (Fig, 2). AC over-represented in almost all stage I, Il and III tumours relative to the (unmatched) stage samples for most tumour types. This is most apparent for breast, lung and thyroid can ⁇ (evident from the dip in the ratio curves shown in Fig. 2B).
- stage IV disease Notably, in more than half of the stage IV tumoi from all tissues types the reverse applies (indicated with asterisk in Fig. 2A). In these sampl RD transcript is over-represented, suggesting that expression is disrupted in favour of RD ir subset of tumours that have undergone or will undergo metastasis.
- Ciz1 RD and AD both exist independently at the protein level (Fig. 5B, ⁇ that AD is attached to the nuclear matrix in some cancer cells in which RD is not (Fig. 5C), a that over expression of AD disrupts the normal sub-cellular localization and immobilization endogenous RD (Fig. 5D 1 E). All of these observations are consistent with the idea th disruption of the ratio between Ciz1 RD and AD alters the architecture of the nucleus.
- Ciz1 transcripts that span the region that is alternatively spliced in b-type transcripts were detected in a total of 23 different libraries, 10 carcinomas and 13 non-carcinomas.
- Ciz1 variant protein High affinity variant-specific polyclonal antibodies have been generat and validated using recombinant proteins (Fig. 10A, 1OB, and 10C) and endogenous b-vari ⁇ protein in SCLC cell lines (Fig. 10D). This shows that variant transcripts are indeed translat into variant protein in lung cancer cells, and that our tools are capable of effective a selective detection in a cellular context. Cizzle is also engaged in production and validation monoclonal antibodies with the same high degree of specificity.
- Ciz1 Depletion of Ciz1 from cultured mouse cells using RNA interference, inhibits progression through the cell cycle and restrains cell proliferation 3 . Therefore, agents that inhibit Ciz1 have potential as therapeutic molecules that restrain proliferation of cancer cells.
- RNA isolated from whole peripheral blood of a subset of mice bearing subcutaneous tumours was used to test the sensitivity of b-type transcript detection tools (Fig. 13C). B-variant was easily detected in both the mice with tumours but not in both mice from the control group, raising the possibility that b-variant could form the basis of a blood test for SCLC.
- Ciz1 binds to the nuclear matrix. J Cell Sci 120, 115-124 (2007).
- Coverley, D., Marr, J. & Ainscough, J.F.-X. Ciz1 promotes mammalian DNA replication. Journal of Cell Science 118, 101-112 (2005). 4.
- Cip1 interacting zinc finger protein 1 binds the consensus DNA sequence ARYSR(0-2)YYAC. Journal of Biomedical Science 10, 406-417 (2003).
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Pharmacology & Pharmacy (AREA)
- Engineering & Computer Science (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Organic Chemistry (AREA)
- Epidemiology (AREA)
- Genetics & Genomics (AREA)
- Biochemistry (AREA)
- Immunology (AREA)
- Biomedical Technology (AREA)
- Biophysics (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Oncology (AREA)
- General Engineering & Computer Science (AREA)
- Inorganic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Microbiology (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Urology & Nephrology (AREA)
- Hematology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Hospice & Palliative Care (AREA)
- Cell Biology (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Food Science & Technology (AREA)
- Analytical Chemistry (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Plant Pathology (AREA)
Abstract
Description
Claims
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
GBGB0901837.5A GB0901837D0 (en) | 2009-02-05 | 2009-02-05 | Cancer diagnosis and treatment |
PCT/GB2010/000204 WO2010089559A1 (en) | 2009-02-05 | 2010-02-05 | Cancer diagnosis and treatment |
Publications (1)
Publication Number | Publication Date |
---|---|
EP2393498A1 true EP2393498A1 (en) | 2011-12-14 |
Family
ID=40469583
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
EP10706706A Withdrawn EP2393498A1 (en) | 2009-02-05 | 2010-02-05 | Cancer diagnosis and treatment |
Country Status (3)
Country | Link |
---|---|
EP (1) | EP2393498A1 (en) |
GB (1) | GB0901837D0 (en) |
WO (1) | WO2010089559A1 (en) |
Families Citing this family (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2012017208A1 (en) * | 2010-08-04 | 2012-02-09 | Cizzle Biotechnology Limited | Methods and compounds for the diagnosis and treatment of |
GB201518466D0 (en) * | 2015-10-19 | 2015-12-02 | Cizzle Biotechnology Ltd | Use |
WO2019079914A1 (en) * | 2017-10-23 | 2019-05-02 | 蔡胜和 | Anti-ciz1 antibody |
CN108796083B (en) * | 2018-06-25 | 2021-03-19 | 山东大学 | Application of CIZ1 as molecular marker for diagnosing and treating tongue hemangioma |
CN114410780A (en) * | 2021-12-30 | 2022-04-29 | 武汉科技大学 | Application of KIF4A in diagnosis, prognosis and treatment of breast cancer |
Family Cites Families (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
GB0228337D0 (en) * | 2002-12-05 | 2003-01-08 | Yorkshire Cancer Res Campaign | Replication protein |
-
2009
- 2009-02-05 GB GBGB0901837.5A patent/GB0901837D0/en not_active Ceased
-
2010
- 2010-02-05 EP EP10706706A patent/EP2393498A1/en not_active Withdrawn
- 2010-02-05 WO PCT/GB2010/000204 patent/WO2010089559A1/en active Application Filing
Non-Patent Citations (1)
Title |
---|
See references of WO2010089559A1 * |
Also Published As
Publication number | Publication date |
---|---|
GB0901837D0 (en) | 2009-03-11 |
WO2010089559A1 (en) | 2010-08-12 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Kim et al. | PTEN and TNF-α regulation of the intestinal-specific Cdx-2 homeobox gene through a PI3K, PKB/Akt, and NF-κB–dependent pathway | |
Parajuli et al. | Twist1 activation in muscle progenitor cells causes muscle loss akin to cancer cachexia | |
US20160367572A1 (en) | Methods and compositions for inhibiting the growth and/or proliferation of myc-driven tumor cells | |
WO2014017491A1 (en) | Fusion gene of cep55 gene and ret gene | |
KR20140047138A (en) | Fusion gene of kif5b gene and ret gene, and method for determining effectiveness of cancer treatment targeting fusion gene | |
CN104603288A (en) | Method for the diagnosis, prognosis and treatment of lung cancer metastasis | |
KR20150122731A (en) | Method for the prognosis and treatment of cancer metastasis | |
KR20150014919A (en) | Method for the prognosis and treatment of cancer metastasis | |
US9283244B2 (en) | Treatment of cancer by inhibiting activity or expression of late SV-40 factor | |
KR20160061424A (en) | Method for the prognosis and treatment of metastasizing cancer of the bone originating from breast cancer | |
US20130210663A1 (en) | Methods and compounds for the diagnosis and treatment of cancer | |
CN111518884B (en) | Application of miRNA30 cluster as Alzheimer disease diagnostic marker | |
EP2393498A1 (en) | Cancer diagnosis and treatment | |
US20110236396A1 (en) | Methods and compositions for diagnosing and treating a colorectal adenocarcinoma | |
Waugh et al. | Association between regulator of G protein signaling 9–2 and body weight | |
WO2009029054A1 (en) | P53 isoform gene(s) and uses thereof | |
JP2016127833A (en) | Fra-1 target gene as drug target for cancer treatment | |
JP2019525903A (en) | Methods for diagnosis and treatment of metastatic cancer | |
KR20230088634A (en) | Liver cancer specific biomarkers and use thereof | |
TW201204393A (en) | Diagnostic agent and therapeutic agent of cancer | |
JP5219818B2 (en) | Breast cancer and ovarian cancer therapeutics, detection methods and detection kits | |
JP6839707B2 (en) | Prevention, diagnosis and treatment of cancers that overexpress GPR160 | |
JP5297389B2 (en) | Biomarkers for allergic diseases and uses thereof | |
WO2020018611A1 (en) | Compositions and methods for identification, assessment, prevention, and treatment of ewing sarcoma using tp53 dependency biomarkers and modulators | |
CN113498437B (en) | Pharmaceutical composition for preventing or treating cancer comprising terminal uridylyltransferase 4/7 expression modulator |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
17P | Request for examination filed |
Effective date: 20110901 |
|
AK | Designated contracting states |
Kind code of ref document: A1 Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO SE SI SK SM TR |
|
DAX | Request for extension of the european patent (deleted) | ||
17Q | First examination report despatched |
Effective date: 20121130 |
|
GRAP | Despatch of communication of intention to grant a patent |
Free format text: ORIGINAL CODE: EPIDOSNIGR1 |
|
RIC1 | Information provided on ipc code assigned before grant |
Ipc: G01N 33/50 20060101AFI20150309BHEP Ipc: C12Q 1/68 20060101ALI20150309BHEP |
|
INTG | Intention to grant announced |
Effective date: 20150415 |
|
STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN |
|
18D | Application deemed to be withdrawn |
Effective date: 20150826 |