EP2393498A1

EP2393498A1 - Cancer diagnosis and treatment

Info

Publication number: EP2393498A1
Application number: EP10706706A
Authority: EP
Inventors: Dawn Coverley
Original assignee: Cizzle Biotechnology Ltd
Current assignee: Cizzle Biotechnology Ltd
Priority date: 2009-02-05
Filing date: 2010-02-05
Publication date: 2011-12-14
Also published as: GB0901837D0; WO2010089559A1

Abstract

This disclosure relates to small inhibitory RNAs [siRNA] in the treatment of cancer, in particular lung cancers and including methods of diagnosis and treatment and including models of cancer, particularly lung, lymphoma, liver, thyroid, and bladder cancer.

Description

Cancer Diagnosis and Treatment

The invention relates to small inhibitory RNAs [siRNA] in the treatment of cancer, in particular lung cancers; including methods of diagnosis and treatment and animal models.

Cancer is an abnormal disease state in which uncontrolled proliferation of one or more cell populations interferes with normal biological function. The proliferative changes are usually accompanied by other changes in cellular properties, including reversion to a less differentiated state. Cancer cells are typically referred to as "transformed". Transformed cells generally display several of the following properties: spherical morphology, expression of fetal antigens, growth-factor independence, lack of contact inhibition, anchorage-independence, and growth to high density. Cancer cells form tumours and are referred to as "primary" or "secondary" tumours. A primary tumour results in cancer cell growth in an organ in which the original transformed cell develops. A secondary tumour results from the escape of a cancer cell from a primary tumour and the establishment of a secondary tumour in another organ. The process is referred to as metastasis and this process may be aggressive, for example as in the case of hepatoma or lung cancer; or non aggressive, for example early prostate cancer. The transformation of a normal cell to a cancer cell involves alterations in gene expression that results in the altered phenotype of the cancer cell. In some examples the genes expressed by cancer cells are unique to a particular cancer.

In many cancers alterations is gene expression are associated with mutations in tumour suppressor genes or tumour promoter genes. Tumour suppressor genes encode proteins that function to inhibit cell growth or division, while tumour promoters may play a role in the promotion or execution of cell growth or division. Both are important with respect to maintaining proliferation, growth and differentiation of normal cells, and mutations often result in abnormal cell-cycle progression. Tumour suppressor and tumour promoter genes function in all parts of the cell (e.g. cell surface, cytoplasm, nucleus) to influence the passage of damaged cells through the cell- cycle (i.e. G1, S₁

G2, M and cytokinesis). Clearly mutations that result in a disruption of normal cell-cycle progression create potential sites of transformation. For example if the normal transition from G1 to S phase is affected resulting in a lack of control of DNA synthesis. Lung cancer is a generic term to describe cancers of lung tissue. The majority of lung cancers are carcinomas which are derived from epithelial cells. Of this type the cancer is either a small cell lung carcinoma or a non-small cell lung cancer. Other classes of lung cancer include carcinoid, sarcoma and metastatic cancers of different tissue origin. Lung cancers are amongst the most common cancers there being a strong correlation between the incidence of lung cancer and smoking tobacco. The prognosis of lung cancer patients is not good even with treatment. Treatment is either surgery if there is early detection or chemotherapy with agents such as cisplatin, paclitaxel, docetaxel, gemcitabine and vinorelbine. Therefore there is a continued need to develop diagnostic tests and treatments that improve the survival rates of patients suffering from cancers such as lung cancer.

A technique to specifically ablate gene function is through the introduction of double stranded RNA, also referred to as small inhibitory or interfering RNA (siRNA), into a cell which results in the destruction of mRNA complementary to the sequence included in the siRNA molecule. The siRNA molecule comprises two complementary strands of RNA (a sense strand and an antisense strand) annealed to each other to form a double stranded RNA molecule. The siRNA molecule is typically derived from exons of the gene which is to be ablated. The mechanism of RNA interference is being elucidated. Many organisms respond to the presence of double stranded RNA by activating a cascade that leads to the formation of siRNA. The presence of double stranded RNA activates a protein complex comprising RNase III which processes the double stranded RNA into smaller fragments (siRNAs, approximately 21-29 nucleotides in length) which become part of a ribonucleoprotein complex. The siRNA acts as a guide for the RNase complex to cleave mRNA complementary to the antisense strand of the siRNA thereby resulting in destruction of the mRNA.

The use of siRNA as a therapeutic strategy in the treatment of cancer, in particular lung cancer, is known. For example WO2005/090991 describes siRNA directed to mRNA encoded by the ADAM8 gene which has a metalloprotease domain and is overexpressed in non-small cell lung cancer. Over expression of ADAM8 is also used as a diagnostic tool for lung cancer. In WO2007/116923 the association of expression of SEZ6L2 as a prognostic marker is disclosed. In addition vector encoded siRNA directed to SEZ6L2 mRNA suppresses expression with a concomitant inhibition of non-small lung cell growth. WO2007/136758 describes the use of siRNA in the inhibition of phosphatidylinositol 3 kinases in breast colorectal and lung cancer. Further examples of diagnostic/prognostic assays for small cell lung cancers include detection of IMP-1 oncogene in lung cancers; see WO2008/020652; detection of KIF4A, MAPJD, NPTX or FGFR1OP in lung cancer; see WO2008/023840; and WO2008/120812 which describes the detection of the CDCA8-AURKB complex in non-small cell lung cancer.

Cip1 -interacting zinc finger protein 1 (Ciz1) is required for cell proliferation. Ciz1 localises to nuclear matrix bound foci that form sites of DNA replication during early S phase and promotes the initiation of DNA replication in association with cell cycle regulators including cyclin A/CDK2, cyclin E/CDK2 and p21cip1. In the context of transcription, CIZ1 is an oestrogen responsive gene that is itself a positive cofactor of the oestrogen receptor (ER), capable of enhancing the recruitment of ER to target chromatin. Ciz1 is alternatively spliced to produce conserved isoforms in mouse and man. Furthermore, mutation driven alternative splicing of exon 4 occurs in Ewings Sarcoma derived cells (Rahman, F.A., et al., Cancer-associated missplicing of exon 4 influences the subnuclear distribution of the DNA replication factor CIZ1. Human Mutation, 2007. 28: p. 993-1004.). This alters the sub-nuclear distribution of Ciz1 , but not its ability to promote DNA replication in vitro. An alternatively spliced Ciz1 transcript has also been isolated from a medullablastoma cDNA library and linked to this disease (Warder, D. E. and M.J. Keherly, Ciz1, Cip1 interacting zinc finger protein 1 binds the consensus DNA sequence ARYSR(0-2)YYAC. J Biomed Sci, 2003. 10(4): p. 406-17.)

This disclosure relates to molecular abnormalities in Ciz1 gene expression that could offer new markers and potentially new targets for selective intervention. Ciz1 plays a role in mammalian DNA replication that involves interaction with cyclin E and cyclin A, most likely tethering these activities to specific sites on the nuclear matrix where initiation of DNA replication takes place. Here we describe the development of molecular tools that efficiently and specifically detect expression of sequences that encode catalytic and anchorage domains of Ciz1 , and which discriminate between appropriately and inappropriately spliced transcripts. Their application to cell lines and to 27 tumour- derived RNAs and 27 matched control RNAs revealed that expression of domains involved in matrix attachment is disrupted in the majority of tumours tested. Moreover, in sample sets from neuroendocrine lung cancer patients one particular mis-spliced transcript is prevalent. The disclosure relates to methods to detect and influence the differential expression of catalytic and anchorage domains in tumours, and specifically to alternative splicing of CIZ1 exon 14 in SCLC, and explores their therapeutic and diagnostic potential. According to an aspect of the invention there is provided a small interfering RNA [siRNA] or short hairpin RNA [shRNA] comprising a nucleic acid sequence or a part of a nucleic acid sequence selected from the group consisting of: 5¹AAGAAGAGATCGAGGTGAGGT 3';

5¹ AAGAGATCGAGGTGAGGTCCA 3¹; 5' AGAAGAGATCGAGGTGAGGTC 3'; 5' GAAGAGATCGAGGTGAGGTCC 3'; 5' AGAGATCGAGGTGAGGTCCAG 3'; 5' GAGATCGAGGTGAGGTCCAGA 3';

5' AGATCGAGGTGAGGTCCAGAG 3'; 5' GATCGAGGTGAGGTCCAGAGA 3'; 5' ATCGAGGTGAGGTCCAGAGAT 3'; or

5¹ TCGAGGTGAGGTCCAGAGATA 3'; wherein said siRNA or shRNA is an inhibitor of CIZ1 expression.

In a preferred embodiment of the invention said siRNA or shRNA comprises a nucleic acid sequence selected from the group consisting of:

5'AAGAAGAGATCGAGGTGAGGT 3'; 5' AAGAGATCGAGGTGAGGTCCA 3';

5' AGAAGAGATCGAGGTGAGGTC 3';

5' GAAGAGATCGAGGTGAGGTCC 3'; or

5' AGAGATCGAGGTGAGGTCCAG 3'.

In a preferred embodiment of the invention said RNA molecule is between 19 nucleotides [nt] and 29nt in length. More preferably still said RNA molecule is between 21 nt and 27nt in length. Preferably said RNA molecule is about 21 nt in length.

In a preferred embodiment of the invention said siRNA consists of 21 bp.

In a preferred embodiment of the invention said siRNA or shRNA includes modified nucleotides.

The term "modified" as used herein describes a nucleic acid molecule in which; i) at least two of its nucleotides are covalently linked via a synthetic internucleoside linkage (i.e., a linkage other than a phosphodiester linkage between the 5' end of one nucleotide and the 3' end of another nucleotide). Alternatively or preferably said linkage may be the 5' end of one nucleotide linked to the 5' end of another nucleotide or the 3' end of one nucleotide with the 3' end of another nucleotide; and/or

ii) a chemical group, such as cholesterol, not normally associated with nucleic acids has been covalently attached to the double stranded nucleic acid.

iii) Preferred synthetic intemucleoside linkages are phosphorothioates, alkylphosphonates, phosphorodithioates, phosphate esters, alkylphosphonothioates, phosphoramidates, carbamates, phosphate triesters, acetamidates, peptides, and carboxymethyl esters.

The term "modified" also encompasses nucleotides with a covalently modified base and/or sugar. For example, modified nucleotides include nucleotides having sugars which are covalently attached to low molecular weight organic groups other than a hydroxyl group at the 3' position and other than a phosphate group at the 5' position.

Thus modified nucleotides may also include 2' substituted sugars such as 2'-O-methyl-;

2-O-alkyl; 2-O-allyl; 2'-S-alkyl; 2'-S-allyl; 2'- fluoro-; 2'-halo or 2;azido-ribose, carbocyclic sugar analogues a-anomeric sugars; epimeric sugars such as arabinose, xyloses or lyxoses, pyranose sugars, furanose sugars, and sedoheptulose.

Modified nucleotides are known in the art and include, by example and not by way of limitation, alkylated purines and/or pyrimidines; acylated purines and/or pyrimidines; or other heterocycles. These classes of pyrimidines and purines are known in the art and include, pseudoisocytosine; N4, N4-ethanocytosine; 8-hydroxy-N6-methyladenine; 4- acetylcytosine, 5-(carboxyhydroxylmethyl) uracil; 5-fluorouracil; 5-bromouracil;5- carboxymethylaminomethyl-2-thiouracil; 5 carboxymethylaminomethyl uracil; dihydrouracil; inosine; N6-isopentyl-adenine; l-methyladenine; 1-methylpseudouracil; 1- methylguanine; 2,2-dimethylguanine; 2-methyladenine; 2-methylguanine; 3- methylcytosine; 5-methylcytosine; N6-methyladenine; 7-methylguanine; 5- methylaminomethyl uracil; 5-methoxy amino methyl-2-thiouracil; β-D-mannosylqueosine; 5-methoxycarbonylmethyluracil; 5-methoxyuracil; 2 methylthio-N6-isopentenyladenine; uracil-5-oxyacetic acid methyl ester; psueouracil; 2-thiocytosine; 5-methyl-2 thiouracil, 2- thiouracil; 4-thiouracil; 5-methyluracil; N-uracil-5-oxyacetic acid methylester; uracil 5 — oxyacetic acid; queosine; 2-thiocytosine; 5-propyluracil; 5-propylcytosine; 5-ethyluracil; 5-ethylcytosine; 5-butyluracil; 5-pentyluracil; 5-pentylcytosine; and 2,6,-diaminopurine; methylpsuedouracil; 1-methylguanine; 1-methylcytosine. Modified double stranded nucleic acids also can include base analogs such as C-5 propyne modified bases (see Wagner et al., Nature Biotechnology 14:840-844, 1996).

In an alternative preferred embodiment of the invention said siRNA or shRNA is part of an expression vector adapted for eukaryotic expression; preferably said siRNA or shRNA is operably linked to at least one promoter sequence.

In a preferred embodiment of the invention said vector is adapted by inclusion of a transcription cassette comprising a nucleic acid molecule wherein said cassette comprises the nucleic acid sequence GAAGAAGAGATCGAGGTGAGGTCCAGAGA which is adapted such that both sense and antisense nucleic acid molecules are transcribed from said cassette wherein said sense and antisense nucleic acid molecules are adapted to anneal over at least part of their length to form an siRNA or shRNA.

In a preferred embodiment of the invention said cassette is provided with at least two promoters adapted to transcribe both sense and antisense strands of said nucleic acid molecule.

In a further preferred embodiment of the invention said cassette comprises a nucleic acid molecule wherein said molecule comprises a first part linked to a second part wherein said first and second parts are complementary over at least part of their sequence and further wherein transcription of said nucleic acid molecule produces an RNA molecule which forms a double stranded region by complementary base pairing of said first and second parts thereby forming an shRNA.

"Promoter" is an art recognised term and, for the sake of clarity, includes the following features which are provided by example only. Enhancer elements are cis acting nucleic acid sequences often found 5' to the transcription initiation site of a gene (enhancers can also be found 3' to a gene sequence or even located in intronic sequences). Enhancers function to increase the rate of transcription of the gene to which the enhancer is linked. Enhancer activity is responsive to trans acting transcription factors which have been shown to bind specifically to enhancer elements. The binding/activity of transcription factors (please see Eukaryotic Transcription Factors, by David S Latchman, Academic Press Ltd, San Diego) is responsive to a number of physiological/environmental cues. Promoter elements also include so called TATA box and RNA polymerase initiation selection sequences which function to select a site of transcription initiation. These sequences also bind polypeptides which function, inter alia, to facilitate transcription initiation selection by RNA polymerase. Adaptations also include the provision of selectable markers and autonomous replication sequences which facilitate the maintenance of said vector in either the eukaryotic cell or prokaryotic host. Vectors which are maintained autonomously are referred to as episomal vectors.

Adaptations which facilitate the expression of vector encoded genes include the provision of transcription termination/polyadenylation sequences. Expression control sequences also include so-called Locus Control Regions (LCRs). These are regulatory elements which confer position-independent, copy number-dependent expression to linked genes when assayed as transgenic constructs. LCRs include regulatory elements that insulate transgenes from the silencing effects of adjacent heterochromatin, Grosveld et al., Cell (1987), 51 : 975-985.

There is a significant amount of published literature with respect to expression vector construction and recombinant DNA techniques in general. Please see, Sambrook et al (1989) Molecular Cloning: A Laboratory Manual, Cold Spring Harbour Laboratory, Cold Spring Harbour, NY and references therein; Marston, F (1987) DNA Cloning Techniques: A Practical Approach VoI III IRL Press, Oxford UK; DNA Cloning: F M Ausubel et al, Current Protocols in Molecular Biology, John Wiley & Sons, Inc. (1994).

The use of viruses or "viral vectors" as therapeutic agents is well known in the art. Additionally, a number of viruses are commonly used as vectors for the delivery of exogenous genes. Commonly employed vectors include recombinantly modified enveloped or non-enveloped DNA and RNA viruses, preferably selected from retroviridae baculoviridiae, pan/oviridiae, picornoviridiae, herpesveridiae, poxviridae, adenoviridiae, or picornnaviridiae. Chimeric vectors may also be employed which exploit advantageous elements of each of the parent vector properties (See e.g., Feng, et al. (1997) Nature Biotechnology 15:866-870). Such viral vectors may be wild-type or may be modified by recombinant DNA techniques to be replication deficient, conditionally replicating or replication competent.

Preferred vectors are derived from retroviral genomes [e.g. lentivirus].

Viral vectors may be conditionally replicating or replication competent. Conditionally replicating viral vectors are used to achieve selective expression in particular cell types while avoiding untoward broad spectrum infection. Examples of conditionally replicating vectors are described in Pennisi, E. (1996) Science 274:342-343; Russell, and S.J. (1994) Eur. J. of Cancer 30A(8):1165-1171. Additional examples of selectively replicating vectors include those vectors wherein a gene essential for replication of the virus is under control of a promoter which is active only in a particular cell type or cell state such that in the absence of expression of such gene, the virus will not replicate. Examples of such vectors are described in Henderson, et al., United States Patent No. 5,698,443 issued December 16, 1997 and Henderson, et al.; United States Patent No. 5,871 ,726 issued February 16, 1999 the entire teachings of which are herein incorporated by reference. Additionally, the viral genome may be modified to include inducible promoters which achieve replication or expression only under certain conditions. Examples of inducible promoters are known in the scientific literature (See, e.g. Yoshida and Hamada (1997) Biochem. Biophys. Res. Comm. 230:426-430; lida, et al. (1996) J. Virol. 70(9):6054- 6059; Hwang, et al. (1997) J. Virol 71 (9):7128-7131; Lee, et al. (1997) MoI. Cell. Biol. 17(9):5097-5105; and Dreher, et al. (1997) J. Biol. Chem 272(46); 29364-29371.

Preferably said vectors include promoters that are substantially lung or cancer specific; preferably said promoters are preferentially active in lung cancer cells.

According to a further aspect of the invention there is provided a pharmaceutical composition comprising one or more siRNA or shRNA selected from the group consisting of:

5'AAGAAGAGATCGAGGTGAGGT 3';

5¹ AAGAGATCGAGGTGAGGTCCA 3'; 5' AGAAGAGATCGAGGTGAGGTC 3';

5' GAAGAGATCGAGGTGAGGTCC 3";

5' AGAGATCGAGGTGAGGTCCAG 3';

5¹ GAGATCGAGGTGAGGTCCAGA 3¹;

5¹ AGATCGAGGTGAGGTCCAGAG 3'; 5' GATCGAGGTGAGGTCCAGAGA 3';

5' ATCGAGGTGAGGTCCAGAGAT 3¹; or 5' TCGAGGTGAGGTCCAGAGATA 3'; and optionally including at least one anti-cancer agent and at least one excipient or carrier.

In a preferred embodiment of the invention said composition comprises 2, 3, 4, 5, 6, 7, 8, 9 or 10 siRNAs or shRNAs. In a preferred embodiment of the invention said anti-cancer agent is a chemotherapeutic agent.

In a preferred embodiment of the invention said chemotherapeutic agent is selected from the group consisting of: cisplatin, paclitaxel, docetaxel, gemcitabine and vinorelbine.

When administered the compositions of the present invention are administered in pharmaceutically acceptable preparations. Such preparations may routinely contain pharmaceutically acceptable concentrations of salt, buffering agents, preservatives, compatible carriers and supplementary anti-cancer agents.

The compositions of the invention can be administered by any conventional route, including injection or by gradual infusion over time. Treatment may be topical or systemic. The administration may, for example, be oral, intravenous, intraperitoneal, intramuscular, intracavity, subcutaneous, transdermal, transepithelial or intra bone marrow administration.

The compositions of the invention are administered in effective amounts. An "effective amount" is that amount of a composition that alone, or together with further doses, produces the desired response. In the case of treating a particular disease, such as cancer, the desired response is inhibiting the progression of the disease. This may involve only slowing the progression of the disease temporarily, although more preferably, it involves halting the progression of the disease permanently. This can be monitored by routine methods.

Such amounts will depend, of course, on the particular condition being treated, the severity of the condition, the individual patient parameters including age, physical condition, size and weight, the duration of the treatment, the nature of concurrent therapy (if any), the specific route of administration and like factors within the knowledge and expertise of the health practitioner. These factors are well known to those of ordinary skill in the art and can be addressed with no more than routine experimentation. It is generally preferred that a maximum dose of the individual components or combinations thereof be used, that is, the highest safe dose according to sound medical judgment. It will be understood by those of ordinary skill in the art, however, that a patient may insist upon a lower dose or tolerable dose for medical reasons, psychological reasons or for virtually any other reasons.

The pharmaceutical compositions used in the foregoing methods preferably are sterile and contain an effective amount of an agent according to the invention for producing the desired response in a unit of weight or volume suitable for administration to a patient.

The doses of the siRNA/shRNA according to the invention administered to a subject can be chosen in accordance with different parameters, in particular in accordance with the mode of administration used and the state of the subject. Other factors include the desired period of treatment. In the event that a response in a subject is insufficient at the initial doses applied, higher doses (or effectively higher doses by a different, more localized delivery route) may be employed to the extent that patient tolerance permits.

In general, doses of siRNA/shRNA of between 1nM - 1 μM generally will be formulated and administered according to standard procedures. Preferably doses can range from 1nM-500nM, 5nM-200nM, and 10nM-100nM. Other protocols for the administration of compositions will be known to one of ordinary skill in the art, in which the dose amount, schedule of injections, sites of injections, mode of administration and the like vary from the foregoing. The administration of compositions to mammals other than humans, (e.g. for testing purposes or veterinary therapeutic purposes), is carried out under substantially the same conditions as described above. A subject, as used herein, is a mammal, preferably a human, and including a non-human primate, cow, horse, pig, sheep, goat, dog, cat or rodent.

When administered, the pharmaceutical preparations of the invention are applied in pharmaceutically-acceptable amounts and in pharmaceutically-acceptable compositions. The term "pharmaceutically acceptable" means a non-toxic material that does not interfere with the effectiveness of the biological activity of the active ingredients. Such preparations may routinely contain salts, buffering agents, preservatives, compatible carriers, and optionally other therapeutic agents' (e.g. anti-inflammatory agents such as steroids, non-steroidal anti-inflammatory agents). When used in medicine, the salts should be pharmaceutically acceptable, but non-pharmaceutically acceptable salts may conveniently be used to prepare pharmaceutically-acceptable salts thereof and are not excluded from the scope of the invention. Such pharmacologically and pharmaceutically-acceptable salts include, but are not limited to, those prepared from the following acids: hydrochloric, hydrobromic, sulfuric, nitric, phosphoric, maleic, acetic, salicylic, citric, formic, malonic, succinic, and the like. Also, pharmaceutically-acceptable salts can be prepared as alkaline metal or alkaline earth salts, such as sodium, potassium or calcium salts.

Compositions may be combined, if desired, with a pharmaceutically-acceptable carrier. The term "pharmaceutically-acceptable carrier" as used herein means one or more compatible solid or liquid fillers, diluents or encapsulating substances which are suitable for administration into a human. The term "carrier" in this context denotes an organic or inorganic ingredient, natural or synthetic, with which the active ingredient is combined to facilitate the application, (e.g. liposome or immuno-liposome). The components of the pharmaceutical compositions also are capable of being co-mingled with the molecules of the present invention, and with each other, in a manner such that there is no interaction which would substantially impair the desired pharmaceutical efficacy.

The pharmaceutical compositions may contain suitable buffering agents, including: acetic acid in a salt; citric acid in a salt; boric acid in a salt; and phosphoric acid in a salt. The pharmaceutical compositions also may contain, optionally, suitable preservatives, such as: benzalkonium chloride; chlorobutanol; parabens and thimerosal.

The pharmaceutical compositions may conveniently be presented in unit dosage form and may be prepared by any of the methods well-known in the art of pharmacy. All methods include the step of bringing the active agent into association with a carrier which constitutes one or more accessory ingredients. In general, the compositions are prepared by uniformly and intimately bringing the active compound into association with a liquid carrier, a finely divided solid carrier, or both, and then, if necessary, shaping the product.

Compositions suitable for oral administration may be presented as discrete units, such as capsules, tablets, lozenges, each containing a predetermined amount of the active compound. Other compositions include suspensions in aqueous liquids or non-aqueous liquids such as syrup, elixir or an emulsion or as a gel. Compositions may be administered as aerosols and inhaled.

Compositions suitable for parenteral administration conveniently comprise a sterile aqueous or non-aqueous preparation of agent, which is preferably isotonic with the blood of the recipient. This preparation may be formulated according to known methods using suitable dispersing or wetting agents and suspending agents. The sterile injectable preparation also may be a sterile injectable solution or suspension in a nontoxic parenterally-acceptable diluent or solvent, for example, as a solution in 1 , 3-butane diol. Among the acceptable solvents that may be employed are water, Ringer's solution, and isotonic sodium chloride solution. In addition, sterile, fixed oils are conventionally employed as a solvent or suspending medium. For this purpose any bland fixed oil may be employed including synthetic mono-or di-glycerides. In addition, fatty acids such as oleic acid may be used in the preparation of injectables. Carrier formulation suitable for oral, subcutaneous, intravenous, intramuscular, etc. administrations can be found in Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, PA.

According to an aspect of the invention there is provided a method to diagnose cancer in a subject comprising: i) providing an isolated biological sample to be tested; ii) forming a preparation comprising said sample and an oligonucleotide primer pair adapted to anneal to a nucleic acid molecule comprising a nucleic acid sequence as represented in Figure 6; a thermostable DNA polymerase, deoxynucleotide triphosphates and co-factors; iii) providing polymerase chain reaction conditions sufficient to amplify said nucleic acid molecule; iv) analysing the amplified products of said polymerase chain reaction for the presence or absence of a nucleic acid molecule comprising a nucleic acid sequence δ'GAAGAAGAGATCGAGGTGAGGTCCAGAGAS'; and optionally v) comparing the amplified product with a normal matched control.

As used herein, the term "cancer" refers to cells having the capacity for autonomous growth, i.e., an abnormal state or condition characterized by rapidly proliferating cell growth. The term is meant to include all types of cancerous growths or oncogenic processes, metastatic tissues or malignantly transformed cells, tissues, or organs, irrespective of histopathologic type or stage of invasiveness. The term "cancer" includes malignancies of the various organ systems, such as those affecting, for example, lung, breast, thyroid, lymphoid, gastrointestinal, and genito-urinary tract, as well as adenocarcinomas which include malignancies such as most colon cancers, renal-cell carcinoma, prostate cancer and/or testicular tumours, non-small cell carcinoma of the lung, cancer of the small intestine and cancer of the esophagus. The term "carcinoma" is art recognized and refers to malignancies of epithelial or endocrine tissues including respiratory system carcinomas, gastrointestinal system carcinomas, genitourinary system carcinomas, testicular carcinomas, breast carcinomas, prostatic carcinomas, endocrine system carcinomas, and melanomas. Exemplary carcinomas include those forming from tissue of the cervix, lung, prostate, breast, head and neck, colon and ovary. The term "carcinoma" also includes carcinosarcomas, e.g., which include malignant tumours composed of carcinomatous and sarcomatous tissues. An "adenocarcinoma" refers to a carcinoma derived from glandular tissue or in which the tumor cells form recognizable glandular structures. The term "sarcoma" is art recognized and refers to malignant tumors of mesenchymal derivation. Further examples include lung cancer for example small cell lung carcinoma or a non-small cell lung cancer. Other classes of lung cancer include neuroendocrine cancer, sarcoma and metastatic cancers of different tissue origin.

In a preferred method of the invention said amplified products are digested with a restriction endonuclease that does not cleave the nucleic acid sequence, 5'GAAGAAGAGATCGAGGTGAGGTCCAGAGAa'.

In a preferred method of the invention said restriction endonuclease is CAC81.

In an alternative method of the invention said oligonucleotide primer pair is adapted to specifically amplify a nucleic acid molecule comprising a nucleic acid sequence GAAGAAGAGATCGAGGTGAGGTCCAGAGA.

In a preferred method of the invention one of said oligonucleotide primers in said primer pair comprises or consists of the nucleic acid sequence: 5' GAAGAGATCGAGGTGAGGTC 3'.

In a preferred method of the invention said oligonucleotide primer pairs comprise or consist of nucleic acid sequences:

5' GAAGAGATCGAGGTGAGGTC 3'; and δ'GAAGAAGAGATCGAGGTGAGGTCCAGAGA.S'. In a preferred method of the invention, an amplified product containing the sequence GAAGAAGAGATCGAGGTGAGGTCCAGAGA is detected with an oligonucleotide probe comprising or consisting of the nucleotide sequence: 5' TGGACCTCACCTCGATCTCTTCTTCA 3'.

In a preferred method of the invention said biological sample comprises lung tissue.

In a preferred method of the invention of the invention said diagnosis is combined with a treatment regime suitable for the cancer diagnosed.

In a preferred method of the invention said treatment regime comprises the administration of an anti-cancer agent.

Preferably said siRNA or shRNA comprises a nucleic acid sequence selected from the group consisting of:

5'AAGAAGAGATCGAGGTGAGGT 3';

5' AAGAGATCGAGGTGAGGTCCA 3'; 5¹ AGAAGAGATCGAGGTGAGGTC 3';

5' GAAGAGATCGAGGTGAGGTCC 3';

5¹ AGAGATCGAGGTGAGGTCCAG 3';

5' GAGATCGAGGTGAGGTCCAGA 3';

5' AGATCGAGGTGAGGTCCAGAG 3'; 5¹ GATCGAGGTGAGGTCCAGAGA 3';

5¹ ATCGAGGTGAGGTCCAGAGAT 3'; or

5' TCGAGGTGAGGTCCAGAGATA 3'.

In a preferred method of the invention said agent is a chemotherapeutic agent.

Preferably said chemotherapeutic agent is selected from the group consisting of: cisplatin, paclitaxel, docetaxel, gemcitabine and vinorelbine.

In a preferred method of the invention said anti-cancer agent is a siRNA or shRNA which is not a siRNA or shRNA according to the invention. In a preferred method of the invention said treatment regime comprises the administration of at least one siRNA or shRNA and the chemotherapeutic agent is administered separately, simultaneously or sequentially.

In a preferred method of the invention said lung cancer is small cell lung carcinoma.

According to a further aspect of the invention there is provided a method to diagnose cancer in a subject by analyzing the expression of exon 14 of Ciz 1 comprising: i) providing an isolated biological sample to be tested; ii) forming a preparation comprising said sample and an antibody that specifically binds a polypeptide that comprises the peptide sequence DEEEIEVRSRDIS to form an antibody/polypeptide complex; iii) detecting the complex so formed; and iv) comparing the expression of said polypeptide with a normal matched control and optionally with other exons of Ciz1.

In a preferred method of the invention said antibody is a monoclonal antibody.

In an alternative preferred method of the invention said antibody is a polyclonal antibody.

According to a further aspect of the invention there is provided an antibody that binds a peptide sequence DEEEIEVRSRDIS or a polypeptide comprising the peptide sequence DEEEIEVRSRDIS and which binds said peptide sequence.

In a preferred embodiment of the invention said antibody is a monoclonal antibody.

According to a further aspect of the invention there is provided a hybridoma cell line that produces a monoclonal antibody according to the invention.

According to a further aspect of the invention there is provided a kit comprising oligonucleotide primers and probes adapted to specifically detect a nucleic acid molecule comprising a nucleic acid sequence 5' GAAGAAGAGATCGAGGTGAGGTCCAGAGA 3'.

In a preferred embodiment of the invention said kit comprises oligonucleotide primers and probes comprising or consisting of the nucleic acid sequences: 5¹ GAAGAGATCGAGGTGAGGTC 3';

5' TGGACCTCACCTCGATCTCTTCTTCA 3'; and

In a preferred embodiment of the invention said kit further comprises a thermostable DNA polymerase, deoxynucleotide triphosphates and co-factors; preferably said kit includes instructions required to selectively amplify said nucleic acid molecule.

According to a further aspect of the invention there is provided a method to diagnose cancer in a subject by comparing the expression of the Ciz 1 replication domain and Ciz 1 immobilisation domain comprising the steps: i) providing an isolated biological sample to be tested; ii) forming a preparation comprising said sample and oligonucleotide primer pairs adapted to anneal to a nucleic acid molecule comprising a nucleic acid sequence as represented in Figure 7a, 7b, 8a, 8b, a thermostable DNA polymerase, deoxynucleotide triphosphates and co-factors; iii) providing polymerase chain reaction conditions sufficient to amplify said nucleic acid molecules; iv) quantitatively comparing the relative expression of said Ciz 1 replication domain and immobilization domains; and optionally v) comparing the ratio of expression of each domain with a normal matched control.

In a preferred method of the invention said oligonucleotide primer pair that amplifies the Ciz 1 replication domain is selected from the group consisting of:

CACAACTGGCCACTCCAAAT and CCTCTACCACCCCCAATCG;

ACACACCAGAAGACCAAGATTTACC and TGCTGGAGTGCG I I I I I CCT.

In a preferred embodiment of the invention said amplified replication domain is detected with an oligonucleotide comprising the sequence:

CGCCAGTCCTTGCTGGGACC or CCCTGCCCAGAGGACATCGCC In a preferred method of the invention said oligonucleotide primer pair that amplifies the Ciz 1 immobilization domain is selected from the group consisting of:

CAGGGGCATAAGGACAAAG with GGCTTCCTCAGACCCCTCTG

CGAGGGTGATGAAGAAGAGGA with CCCCTGAGTTGCTGTGATA.

In a preferred embodiment of the invention said amplified immobilization domain is detected with an oligonucleotide comprising the sequence:

TGGTCCTCATCTTGGCCAGCA or CACGGGCACCAGGAAGTCCA ; or CACTGCAAGTCCCTGGGCCA.

In a preferred method of the invention said method is combined with an analysis of expression of exon 14 of Ciz 1 according to the invention.

In a preferred method of the invention said method of diagnosis is combined with a method of treatment according to the invention.

According to a further aspect of the invention there is provided a method to diagnose cancer in a subject by comparing the expression of the Ciz 1 replication domain and Ciz 1 immobilisation domain comprising the steps: i) providing an isolated biological sample to be tested; ii) forming a preparation comprising said sample an antibody that specifically binds the Ciz 1 replication domain or the

Ciz 1 immobilization domain to form an antibody/domain complex; iii) detecting the complex so formed; iv) quantitatively comparing the relative amounts of said Ciz 1 replication domain protein and immobilization domain protein; and optionally v) comparing the ratio of expression of each domain with a normal matched control. According to a further aspect of the invention there is provided a kit comprising oligonucleotide primers adapted to specifically amplify a nucleic acid molecule comprising the replication domain of Ciz 1 and the immobilisation domain of Ciz 1.

In a preferred embodiment of the invention said oligonucleotide primers that amplify the replication domain are:

CACAACTGGCCACTCCAAAT and CCTCTACCACCCCCAATCG;

ACACACCAGAAGACCAAGATTTACC and TGCTGGAGTGCG I I I I I CCT.

In a preferred method of the invention said oligonucleotide primers that amplify the immobilization domain are:

CAGGGGCATAAGGACAAAG with GGCTTCCTCAGACCCCTCTG

CGAGGGTGATGAAGAAGAGGA with CCCCTGAGTTGCTGTGATA.

In a preferred embodiment of the invention said kit includes oligonucleotide probes that detect the amplified Ciz 1 replication domain and are selected from the group consisting of: CGCCAGTCCTTGCTGGGACC or CCCTGCCCAGAGGACATCGCC

In a preferred embodiment of the invention said kit includes oligonucleotide probes that detect the amplified Ciz 1 immobilization domain and are selected from the group consisting of TGGTCCTCATCTTGGCCAGCA or CACGGGCACCAGGAAGTCCA ; or CACTGCAAGTCCCTGGGCCA.

According to a further aspect of the invention there is provided a kit comprising a first antibody that specifically binds the replication domain of Ciz 1 protein and a second antibody that binds the immobilization domain of Ciz 1 protein.

According to an aspect of the invention there is provided a non-human transgenic mammal wherein said mammal is modified with a nucleic acid molecule comprising a nucleic acid sequence selected from the group consisting of: i) a nucleic acid molecule comprising or consisting* of a nucleic acid sequence as represented in Figure 7a or Figure 7b; ii) a nucleic acid sequence that hybridizes to a nucleic acid molecule under stringent hybridization conditions to the nucleic acid sequences in i) above and which encodes a polypeptide with DNA replication initiation activity; iii) a nucleic acid molecule comprising or consisting of a nucleic acid sequence as represented in Figure 8a or Figure 8b; iv) a nucleic acid sequence that hybridizes to a nucleic acid molecule under stringent hybridization conditions to the nucleic acid sequences in iii) above and which encodes a polypeptide with nuclear matrix binding activity.

In a preferred embodiment of the invention the expression of said nucleic acid molecule is regulatable.

Preferably said expression is inducible or repressible.

Preferably said expression is tissue or developmentally regulated.

In a preferred embodiment of the invention said non-human mammal is a rodent; preferably a rat or mouse.

In an alternative preferred embodiment of the invention said mammal is a non-human primate.

Throughout the description and claims of this specification, the words "comprise" and "contain" and variations of the words, for example "comprising" and "comprises", means "including but not limited to", and is not intended to (and does not) exclude other moieties, additives, components, integers or steps.

Throughout the description and claims of this specification, the singular encompasses the plural unless the context otherwise requires. In particular, where the indefinite article is used, the specification is to be understood as contemplating plurality as well as singularity, unless the context requires otherwise. Features, integers, characteristics, compounds, chemical moieties or groups described in conjunction with a particular aspect, embodiment or example of the invention are to be understood to be applicable to any other aspect, embodiment or example described herein unless incompatible therewith.

An embodiment of the invention will now be described by example only and with reference to the following figures:

Figure 1 illustrates: a schematic representation of the Ciz1 gene showing exon structure. Regions that code for functional domains involved in DNA replication ³, and attachment to the nuclear matrix ¹ are indicated by black lines above. Dotted lines indicate uncertainty regarding domain boundaries. Gaps indicate sequences that are spliced out of variants with full activity in vitro. The location of PCR primers and probes are shown in relation to the known functional domains. Pink bar: probe T5 in exon 5, green bar: probe T7 at the junction between exons 6 and 7, yellow bar: probe T4 in exon 14, blue bar: probe T3 in exon 16. B) Quantification of Ciz1 expression (dCT values after normalization to actin), using the probes shown in A) across 46 cDNAs derived from lung carcinomas and normal adjacent tissues (Origene cDNA array HLRT504). Both reagent sets that amplify sequences within the Ciz1 replication domain (RD) generate a similar profile across the array. Conversely, reagent sets that amplify sequences in the nuclear matrix anchor domain (AD) generate a very similar profile to each other, but this is distinctly different to RD. C) To develop a single numerical indicator of the extent to which the balance between replication and anchor domain expression is altered in the tumor compared to matched control, RQ for the two replication domain probes or the two anchor domain probes (calibrated to the control tissues in sample set 1/2) were averaged. The average RQ for the tumour sample was divided by the average RQ for its matched control to give an individual measure of change relative to surrounding tissues for each domain. Values were combined by dividing the change in replication domain by the change in anchor domain so that, for example, increased expression of the replication domain that is balanced by increased expression of the anchor domain would result in a value close to 1. Conversely, increased expression of the replication domain that is exacerbated by decreased expression of the anchor domain would result in a value that is significantly greater than 1. Results are expressed on a log scale. Changes that are less than two-fold (indicated by grey region) are considered to be insignificant. This analysis does not reveal balanced under or over expression of Ciz1 , and only reveals changes in expression relative to surrounding tissue. The degree of RD and AD imbalance increases with tumour stage;

Fig. 2 Uncoupled expression of DNA replication and nuclear matrix anchor domains in a range of solid tumours, as indicated. Histograms show relative quantification (RQ) of Ciz1 exon 7 (RD₁ white bars) and Ciz1 exon 16 (AD, black bars) in sample sets represented in cDNA array CSRT1. For each tissue type, analysis of 9 independent tumours of increasing stage (left to right) are shown alongside 3 unmatched control samples derived from apparently normal tissue from cancer patients (identified as stage 0). Results for the two probes were normalized to an average of the controls (C) shaded in grey, for RD, so that RQ = 2 ( ^{" ( ct exon test " ct ex 7 average sta9e 0)}). Results for lung tumours stages I to III are comparable to the sample set analysed in Fig. 1 and are shaded in grey. For all tumour types examples of stage IV tumours are also included. For most of these expression of RD is equal to or exceeds RD (indicated with an ^*). B) Right panels show the ratio of expression of AD and RD (Ratio = Ct exon 16/Ct exon7) with increasing stage from left to right. The first data point represents the averaged control and the last data point a stage IV sample. Quadratic regression trend lines were generated using excel. For all tumour types except liver, the trend shows a proportional increase in AD relative to RD in early stage tumours compared to controls and a reversal of this trend at later stages, so that for most stage IV tumours RD often exceeds AD;

Fig. 3 A) Analysis as in figure 2, indicates altered expression in favour of AD in 40 malignant melanomas compared to control (stage 0) samples. Results for the two sets of detection tools are normalized to 1 for the first stage 0 sample. Right panel, summary of results for stage II, III and IV tumours indicating the % of samples in which anchor domain expression exceeds that of the replication domain;

Fig. 4 A) Ways in which uncoupled expression of Ciz1 replication domain (black line) and nuclear matrix anchor domain (yellow circle) could influence immobilization of Ciz1 and the sub-nuclear localization of its DNA replication activity. Grey barrels represent DNA replication proteins assembled at replication origins, grey ovals represent nuclear matrix-associated docking sites for Ciz1. The model assumes that nuclear matrix- associated docking sites are limiting. Right panel shows a variant of Ciz1 with impaired ability to become assembled into the nuclear matrix. B) Summary of two types of Ciz1 mis-expression seen in human tumours, i) Uncoupled expression as seen in most common solid tumours and described in figs. 1-3, ii) b-variant as seen in a high proportion of small cell lung cancers, thyroid cancers and lymphomas;

Fig. 5. Generation and Validation of Ciz1 replication domain (RD) and anchor domain (AD) antibodies, and analysis of RD and AD protein expression.. A) Schematic representation of Ciz1 exons (shaded rectangles) showing the regions used as immunogen for polyclonal antibodies (upper panel) and . monoclonal antibodies (lower panel). B) Representative immuno-fluorescence images of endogenous Ciz1 detected with Ciz1-RD antibody (red) in normal fetal lung cells (WI38) and three representative human cancer cell lines as indicated, without treatment prior to fixation ('unextracted'), after extraction of soluble proteins in the presence of 0.1 % triton X100 ('detergent resistant') and after incubation with DNAse 1 ('DNase resistant'). Images were collected under identical conditions with standardized exposure times, so that within and between cell lines the intensity of Ciz1 and of DNA reflects the level of Ciz1 and DNA remaining in the cell under the different conditions. Total DNA is stained with Hoechst 33258 (blue). Bar is 10 microns. Similar results were obtained for four other cancer cell lines of different origins. C) As in B₁ except that detection is with Ciz1-AD antibody (green). Results illustrate i) uncoupled and imbalanced expression of Ciz1-RD and Ciz1-AD at the protein level, ii) elevated Ciz1-RD protein that is not immobilized in cancer cells, iii) Immobilization of the majority of Ciz1-AD protein; D) Effect of recombinant AD protein on immobilization of endogenous Ciz1. High-magnification images of the DNAse-resistant fraction of endogenous Ciz1-RD (red) in NIH3T3 cells without (left panel) or with (right panels) expression of recombinant GFP-C275 (green), which encodes murine AD protein. Total DNA is stained with Hoechst 33258 (blue). Note the reduced focal staining in cells transfected with GFP-C275. E) Images show NIH3T3 nuclei with focal pattern of GFP-Ciz1 , non-focal pattern of GFP-C275 and cells co-transfected with both vectors, after extraction with detergent. Green is GFP₁ blue shows nuclei stained with Hoecsht 33258. GFP-C275 interferes with the formation of GFP-Ciz1 subnuclear foci.

Fig. 6 A) Scheme indicating the products generated using b-type transcript junction spanning primer (red arrow) and the location of junction-spanning taqman probe (red line). B) Mobility variation observed in cloned products with b-variant exon from a SCLC cell line and full length products from a normal cell line. C) Junction-spanning primer was verified using reporter plasmids expressing normal transcript (clone 19) or b-type transcript (clone 20). Gels show plasmid derived PCR products from selective primer pair P3/4 or unselective Ciz1 primer pair P1/2. D) PCR products generated from cDNA prepared from 2 neuroendocrine lung cancer cell lines (L95, SBC5) and one normal fetal lung cell line (HFL1) using primer set P11/P12 (actin, lower panel), primer set P1/P2 (Ciz1 , upper panel), or b-type transcript junction-spanning primer set P4/P3 (middle panel). Products were sequence verified, noT is a no template control lane. E) Primers from either side of the variable region (P1/P2 or P6/P7) were coupled with taqman probes that either span the unique junction in b-type transcript (12) or which recognise a region that is not alternatively spliced (T4 and T3). Application to mixtures of plasmid clones 19 and 20, that containedeither 100, 75, 50, 25, or 0 % clone 20, demonstrate selective detection of b-type transcripts. Graph shows that cycle number required to reach the threshold is constant for un-selective detection tools, but affected by plasmid mixture composition for variant-selective tools;

Fig. 7 A) QPCR for RD (left panel) or AD (centre panel) as in Figs 1-3, of b-variant using templates from three 'normal' embryonic lung cell lines and three neuroendocrine lung tumour cell lines, plus one neuroendocrine carcinoid. Results are normalized to actin and calibrated to IMR90 RD. D) Human lung cancer tissues. The same detection tools were applied to cDNA from 3 SCLC patients and three normal adjacent tissue from the same individuals. Expression of b-type transcript is dramatically elevated in these neuroendocrine tumours;

Fig. 8 A) Expression of b-type transcripts (black bars) in matched sample sets from 23 lung cancer patients (same sets as Fig. 1) ranging from grade I to grade III (Origene cDNA array HLRT504). Expression is normalized to actin and expressed relative to the 'normal' sample (white bars) in each pair, which is given an arbitrary value of 1. B) Similar analysis of a separate set of non-small cell lung tumours and unmatched controls from the stages indicated (Origene array CSRT303). Histogram shows b-variant RQ after normalization to actin. C) Comparable results for liver tumours and D) kidney tumours also derived from CSRT303. Results are calibrated to an average of the control tissues (stage 0) samples, indicated by a grey block. For all sample sets shown in Fig. 8, b-variant is elevated in a small number of random cases;

Fig. 9 illustrates analysis as in Fig. 8 for lymphoma, thyroid and bladder cancers. For both indications, elevated b-variant transcript is detected in a high proportion of patients.

Fig. 10 Generation and Validation of exon 14b-variant protein detection tools. A) Immunogenic peptide lacking intervening sequence (grey) to generate unique EEIEVRSR junction within a 16 amino-acid peptide (lower line), and full length peptide used to remove antibody species that react with junction flanking epitopes (upper line). Polyclonal sera and hybridomas were negatively screened against immobilized full- legnth peptide and positively selected or affinity purified using 14b junction containing peptide. B) Immuno-fluourescence with anti-b-variant antibody using NIH3T3 cells expressing GFP-hCiz1 or GFP-hCiz1 b-variant (green). Recombinant 14b protein is detected in red, and DNA is stained in blue. C) Western blots showing selective detection of over-expressed GFP-Ciz1 protein harboring the 14b exon junction. Results with anti-b-variant serum, pre-immune serum and anti-Ciz1 polyclonal antibody are shown. D) Immuno-detection of endogenous 14b protein with affinity purified anti-b- variant polyclonal antibody in SCLC cells and representative normal cells as indicated. SCLC cells react with anti-b-variant serum but normal cells do not. E) Detection of Ciz1 in the same cells is shown for comparison. F) High-magnification (60Ox) images of SCLC cells as in D, revealing discrete foci in the nucleus that are similar in size but fewer in number than DNA replication foci.

Fig. 11 Development of b-type transcript selective RNA interference tools. A) Top panel, schematic showing a panel of siRNA sequences spanning the unique exon junction. Lower panels show their effect on Ciz1 AD transcript levels and b-type transcript levels, 24 hours after transient transfection into SCLC cells. Results are normalised to actin and calibrated to samples from cells transfected with control siRNA (Dcon). B) Results are expressed as a ratio of AD to b-type transcript, where control siRNA has a ratio of 1. The most effective and selective siRNA sequence was chosen for further testing (starred) C). Variant-selective effect on expression of recombinant Ciz1 protein. Clones 19 and 20 were co-transfected with b-type transcript selective siRNA or control siRNA as indicated, into mouse 3T3 cells. B-type transcript siRNA suppresses expression of protein from expression clone 20, but not endogenous mouse Ciz1 or human Ciz1 from expression clone 19;

Fig. 12 Effect of inducible expression of b-variant selective shRNA on SCLC cell proliferation in culture. A) Stable expression of the chosen b-type selective sequence and a control sequence (against luciferase) from a dox-regulated shRNA vector (Clonetech). Results show increase in cell number over 4 days. Dox was added to test samples at 0 and 3 days (black arrow heads). Control cells (SCLC expressing luciferase shRNA) are largely unaffected by induction while test cells (SCLC expressing b-type selective sequence) are prevented from proliferating at the normal rate. B) An independent experiment in which dox was added at day 0 and cell number was quantified in triplicate at 4 days. Error bars show SEM. C) Gel images show RT-PCR products and the selectivity of the chosen sequence for b-type transcripts versus total Ciz1 expression. By 26 hours after induction b-type transcript levels have recovered, while a second dose one hour before samples were isolated reveals selective suppression of b-type transcripts. D) Supression of b-variant protein in SBC5 cells, detected with b-variant polyclonal antibody 48 hours after induction of shRNA expression with doxycyclin. E) SBC5 harbourig inducible b-variant shRNA vector cells after 1 month in culture in low tet serum without induction. Chronic leaky expression has visible and progressive effects on cells;

Fig. 13 In vivo study (Southern Research Institute, USA). A) Two cohorts of 15 NOD/SCID mice were injected with 1.5x107 cells harbouring dox-regulated b-type variant selective shRNA vector on day 0. At 21 days mice with tumours less than 100 mg were discounted creating groups with equal mean tumour weight and low inherent variation. Dox was administered in drinking water to group 2 (black circles) at 21 days and tumour size was measured twice weekly thereafter. Graphs show mean tumour weight with SEM B) An additional 10 mice were maintained on Dox from 3 days prior to injection with SCLC cells. Results show their mean tumour weight with SEM, compared to mean tumour weight of 15 mice that did not receive dox. C) Quantitative RT-PCR showing the relative levels of b-type transcript in whole blood-derived cDNA of two mice with tumours from group 1 (open circles in Fig. 14A) and two mice without tumours from group 3 (closed squares in Fig. 14B). Histogram shows duplicate analyses (each is average of triplicate samples) after normalization to murine actin, and calibration to sample SRI-3-8. Estimated size of subcutaneous tumour carried by the four mice is also shown.

Figure 14 is the nucleotide sequence of exons 13-17 of Ciz 1;

Figure 15a is the nucleotide sequence of the minimal replication domain of Ciz 1 that encodes a polypeptide with replication activity; Figure 15b is the nucleotide sequence of the replication domain; Figure 15c is the minimal amino acid sequence of Ciz 1 replication domain; Figure 15d is the amino acid sequence of the replication domain;

Figure 16a is the nucleotide sequence of the anchor domain of Ciz 1 that encodes a polyeptide that anchors Ciz 1 to nuclear matrix sites; Figure 16b is the nucleotide sequence of the Ciz 1 anchor domain; Figure 16c is the minimal amino acid sequence of Ciz 1 anchor domain; Figure 16d is the amino acid sequence of the Ciz 1 anchor domain; and

Figure 17 Suppression of Ciz1 expression by RNAi restrains lung cancer cell proliferation. A) Effect of Ciz1 siRNAs A, B, C, D or a mixture of all 4 on Ciz1 expression 24 and 48 hours after transfection into SBC5 cells. Ciz1 transcript was detected in QPCR reactions using primers P1 and P2 and probe T4. Results are expressed relative to actin. B) Proliferation of SBC5 cells over 5 days after transient transfection with Ciz1 siRNA B and two other Ciz1 siRNAs (referred to as Ciz1 siRNA 3 and 2). Error bars show SEM derived from three independent populations. C) Effect of Ciz1 siRNA 3 on Ciz1 protein levels when delivered from a stably integrated shRNA vector. Western blot shows endogenous Ciz1 p100 24 hours after induction of the indicated shRNAs are shown. Ineffective Ciz1 siRNA sequence 1 and a control shRNA against luciferase are shown for comparison. D) Effect of control shRNA (luciferase) and Ciz1 shRNA sequence 3 on proliferation of SBC5 cells. Results are expressed as fold increase in cell number 4 days after induction of shRNA expression with doxycycline, and are averages of triplicate samples, with SEM.

Table 1 Summary of oligonucleotide primers and probes.

Materials and Methods

cDNA arrays TissueScan qPCR arrays containing 2-3 ng of cDNA from 48 different lui samples (HLRT101), and 24 matched pairs of lung carcinoma and adjacent tissue from t same patient (HLRT504), or 10 sets of tissue samples from different cancers (CSRT504) we from OriGene Technologies, Inc. (Rockville, MD). Tumour classifications and abstract pathology reports for the lung/normal matched pair tissue array are as given http://www.oriqene.com/geneexpression/disease-panels/products/HLRT504.aspx. The level cDNA in each well was standardized for ^*b-actin expression by the supplier and we used c own amplification of ^*b-actin to normalize results for Ciz1 expression, in multiplex reactions ¹ the data in Fig. 3B and single reactions for all other arrays. Thresholds were set and analysis performed using ABI 700 software.

Human tissue derived RNA. Three pairs of lung tumour/normal RNA from tissues collect under IRB approved protocols, were from Cytonr (http://www.cvtomvx.com/cvtomvx/cvtomvx biorepository.asp). Additional samples of hum lung tissue, collected with informed donor consent, were obtained from ILSt (http://www.ilsbio.com/). RNA was isolated from tissues using TRIzol according manufacturers instructions; tissue homogenisation was carried out using an RNase free 1 ml. Pellet Pestle (Anachem). RNA samples were reverse transcribed with random primers, a mixture of oligo dT and random primers as follows. Approximately 1.6 *mg of total RNA w incubated with 1 μl_ 10 mM dNTPs, 0.5 μl_ 0.5 μg/μL random primers (Promega) and 0.5 | 0.5 μg/μL oligo dT₁₂.i8 primer (Invitrogen) to a total volume of 12 μL in DEPC wat< Alternatively, total RNA was incubated with 1 μL 500 μg/mL random primers, 1 μL 10 m dNTPs to a total volume of 13 μL in DEPC water. Samples were incubated at 65⁰C for minutes in a PTC-200 Peltier Thermal Cycler (MJ Research), followed by incubation on ice f 5 minutes. To the random primed reactions the following were added to a volume of 20 μL: First-Strand buffer, 5 mM DTT, 200 U Superscript III and 40 U RNaseOUT (all Invitroger Reactions were incubated at 46 ⁰C for 3 hours, followed by 7O⁰C for 15 minutes. To tl random primer/oligo dT reactions the following were added in a final volume of 20 μL: 1x f MLV reaction buffer, 10 mM DTT, 200 U M-MLV reverse transcriptase (all Promega) and 40 RNaseOUT (Invitrogen). Reactions were incubated at 42⁰C for 52 minutes, followed by 70^c for 15 minutes.

PCR and QPCR Primer pair combination used for fragment amplification included p8/p2 usir Taq polymerase (NEB, Herts, UK), 94°C/5 minutes and then 33 cycles of 94°C/15 second 55°C/30 seconds and 68⁰C for 1 minute, and a final step at 68⁰C for 7 minutes), p1/p2 usir phusion polymerase (Finnzymes, Espoo, Finland) 98°C/30 seconds and 33 cycles of 98⁰C/' seconds, 62°C/30 seconds and 72⁰C for 40 sec, and 72/⁰C for 7 minutes and p4/p3 using Ts olymerase(NEB, Herts, UK), 94°C/5 minutes and then 33 cycles of 94°C/30 seconds, 62°C/C seconds and 72°C/40 seconds followed by a final step at 72⁰C for 7 minutes). PCR reactior were run on an MJ thermal cycler PTC-200. Quantitative PCR reactions were carried out MicroAmp™ optical 96-well reaction plates with optical adhesive film (Applied Biosystems) in total volume of 25 μL. For each reaction cDNA was incubated with 1x TaqMan^® PCR m (Applied Biosystems), 0.4 μM forward primer, 0.4 μM reverse primer and 0.4 μM prob Samples were run on the ABI Prism 7000 or 7300 Sequence Detection system using tr relative quantification assay, and the following programme; 50 ⁰C [2 minutes], 95 ⁰C [1 minutes], followed by 40 cycles of 95 ⁰C denaturation [15 seconds], 60 ⁰C annealing ar elongation [1 minute]. The cycle number at which the sample passed the threshold level is tr Ct value. One sample was selected as the 'calibrator' sample and all other expression valu« expressed relative to it (RQ) [26]. Unless stated otherwise primers were from Sigma Aldric probes were from MWG, and sequence verification of clones and PCR products was carric out by MWG.

Cell culture and transfection Cell lines (Table 2) were obtained from the European cell culture collection (http://www.ecacc.org.uk/) or the Japanese Collection of Research Bioresource (http://cellbank.nibio.go.ip/). or were a kind gift from J. Southgate. All cell lines were cultured as recommended. NIH3T3 cells were grown as previously described [36] and transfected with GFP-Ciz1 or GFP-C275 [13], using Mirus 3T3. Nuclear Fractionation Nuclear fractionation was essentially as described [13]. Typically cells on coverslips were rinsed with cold PBS, then cold CSK buffer (10 mM Pipes/KOH Ph6.8, 10OmM NaCI, 1 mM EGTA₁ 30OmM sucrose) plus 1mM DTT, and protease inhibitor cocktail (Roche), with our without detergent (0.1%TX100) as indicated. For DNase treatment cells were further rinsed in CSK (0.1 or 0.5M NaCI as indicated), followed by PBS, followed by incubation with DNase 1 in digestion buffer (1OmM Tris [pH 7.6], 2.5 mM MgCI₂, 0.5 mM CaCI₂) at 25°C for 20 minutes, as recommended (Roche). Where indicated DNAse treated cells were rinsed with 0.5M NaCI for 1 minute prior to fixation. All preparations were fixed with fresh 4% paraformaldehyde for 20 minutes at room temperature,.

Immunofluorescence Fixed cells on coverslips were washed with PBS then blocked with antibody buffer (10% protease-free BSA₁ 0.02% SDS, 0.1% Triton X-100 in PBS). Ciz1- RD was detected with anti-Ciz1 polyclonal antibody 1793 [18] and Ciz1-AD with polyclonal antibody 2C affinity purified using Ciz 1 anchor domain peptide DEDEEEIEVEEELCKQVRSRDISR. DNA was counterstained with Hoechst 33258 (Sigma). Images were collected using a Zeiss Axiovert 200 M and Openlab image acquisition software, using identical exposure parameters within an experiment, typically 300ms for TRITC-labelled Ciz1 , 400ms for GFP, 15ms for Hoescht. Where images were digitally enhanced to remove background fluorescence or increase brightness using Adobe photoshop, identical manipulations were applied to images within one experiment. So, for example the intensity of Ciz1 staining before and after extraction reflects the effect of the treament. Fluorescence intensity was quantified from raw images acquired under identical imaging parameters using the Openlab 'Profile' tool. EXAMPLE 1

Uncoupled expression of DNA replication and anchor domains The two well-characteriz functions of Ciz1 (cyclin-dependent stimulation of DNA replication and association with t nuclear matrix) are encoded by separate protein domains. These are called RD (replicati domain) and AD (anchor domain). In vitro, Ciz1 does not require its nuclear matrix anchor order to promote DNA replication. In fact Ciz1 fragments lacking AD appear to be more acti than those that would be attached to the nuclear matrix ³, implying that immobilization is constraining feature rather than one that is intrinsic to function. Here, we present evidence tr expression of RD and AD are not coincident in most cancer cells. Expression of one or oth of the domains is altered and imbalanced in the majority of lung cancers, as well as a range other common solid tumours.

Quantitative PCR reagents (Fig. 1a) that detect expression of RD or AD were used interrogate a cDNA array that contains 46 lung-derived cDNAs (Fig. 1b). Across the arrj both RD probes revealed a consistent pattern of expression. Similarly, both AD prob revealed a consistent pattern of expression. However, expression of RD and AD are far frc identical to one another. This demonstrates that the two domains are not always express together, and that they are probably not always both present in Ciz1 protein.

Uncoupled expression in lung tumours In contrast to the adjacent control samples, t tumours themselves exhibit a far less convincing trend. Although Ciz1 expression is clea uncoupled and imbalanced, for some patients this is manifest as decreased RD and for othe as increased RD (relative to the stage IA samples), giving rise to a near horizontal trend Ii with poor fit.

The combined effect of increased expression of one domain and decreased expression of t other is also revealing. When the combined results for RD and AD expression is present relative to each individual adjacent control (Fig. 1 E), the data show that disruption of th balance ratio correlates with tumour stage. For tumours from patients with stage 1 disea; 12.5% (1 of 8) have a greater than two-fold change in the balance between AD and F compared to surrounding tissue, while for stage Il tumours this is 90% (9/10), and for stage tumours 60% (3/5). This trend supports the conclusion that Ciz1 expression is uncoupled a unbalanced during tumourigenesis.

Uncoupled expression in other types of tumour To generate an overview of Ciz1 transci expression, RD and AD were sampled in a number of common solid tumours (Fig, 2). AC over-represented in almost all stage I, Il and III tumours relative to the (unmatched) stage samples for most tumour types. This is most apparent for breast, lung and thyroid canα (evident from the dip in the ratio curves shown in Fig. 2B).

Uncoupled expression in stage IV disease Notably, in more than half of the stage IV tumoi from all tissues types the reverse applies (indicated with asterisk in Fig. 2A). In these sampl RD transcript is over-represented, suggesting that expression is disrupted in favour of RD ir subset of tumours that have undergone or will undergo metastasis.

We applied similar analysis to 40 malignant melanoma samples, including 19 samples frc patients with stage IV disease (Fig. 3A). In the majority of tumours of all grades AD expressi exceeds RD, while for all three stage 0 samples this is not the case. Therefore, maligns melanomas do not follow the trend described above, indicating that a switch to dominj expression of RD does not accompany metastatic capability for this type of tumour.

When considered at the protein level and in the light of what we already know about Ci function, the impact of excess RD or excess AD on cellular DNA replication could be ve similar, with possible differences in severity. Specifically, we know that the replication dom« of Ciz1 is capable of functioning to stimulate initiation of DNA replication in the absence of nuclear matrix anchor ³, but that nuclear matrix attachment is the norm for the majority of Ci in NIH3T3 cells ¹, and most other established cell lines of non-tumour origin that we ha tested (not shown). We suggest that expression of the replication domain in the absence of nuclear matrix anchor would result in unanchored activity, and that this would have consequence for the spatio-temporal organization of DNA replication. Similarly, expression C-terminal immobilization domains in the context of a protein that does not possess cataly function could have a dominant negative effect by competing with full-length protein immobilization sites on the nuclear matrix (Fig. 4A).

EXAMPLE 2

Protein detection tools We have developed a set of monoclonal and polyclonal antibodi against RD and AD (Fig. 5A), with which to detected Ciz1 expression at the protein lev These have potential as molecular diagnostic tools, and are currently being used to ansv questions about Ciz1 protein function and behaviour in cancer cell lines. So far we hε demonstrated that Ciz1 RD and AD both exist independently at the protein level (Fig. 5B,< that AD is attached to the nuclear matrix in some cancer cells in which RD is not (Fig. 5C), a that over expression of AD disrupts the normal sub-cellular localization and immobilization endogenous RD (Fig. 5D₁E). All of these observations are consistent with the idea th disruption of the ratio between Ciz1 RD and AD alters the architecture of the nucleus.

EXAMPLE 3

B-tvpe variant We surveyed expressed sequence tags (ESTs) that map to the Ciz1 Unigene cluster Hs. 212395 (http://www.ncbi.nlm.nih.gov/sites/entrez?db=unigene) for evidence of alternative splicing in the Ciz1 coding sequence. This suggested that neuroendocrine lung cancers (primarily small cell lung cancers, SCLC) express a form of Ciz1 that is alternatively spliced (to yield b-type transcripts), far more frequently than non-cancer tissues (illustrated in Fig. 4B). Ciz1 transcripts that span the region that is alternatively spliced in b-type transcripts were detected in a total of 23 different libraries, 10 carcinomas and 13 non-carcinomas. For the carcinoma-derived transcripts 40% were b-type transcripts, compared to only 3% from non-cancer libraries.

Selective detection tools We developed molecular tools that detect b-type transcripts. These are primers located either side of the exon junction, a primer that spans the exon junction and only gives a product from b-type transcripts, and a Q-PCR probe that also spans the exon junction and only recognizes b-type transcripts. Initially these were applied to a panel of lung cancer cell lines to a) validate the tools and b) generate confirmatory data on expression of b-type transcripts.

Expression in SCLC Application of selective transcript detection tools showed that cell lines derived from SCLC patients express b-type variant more often than the control cell lines (Fig. 6, 7A). Application to RNA samples derived from a small sampling of tumours from neuroendocrine lung cancer patients and also from normal adjacent lung tissue from the same patient confirms that b-type transcripts are preferentially expressed in all three SCLC patients (Fig. JB).

B-variant expression in non-small cell lung cancer QPCR reagents that are selective for b-ty| transcripts were applied to the matched lung tumour/normal tissue cDNA arrays used in Fig. Six of the sample sets expressed greater than 2 fold more b-type transcript in the tumo compared to normal adjacent control tissue (Fig. 8A). This includes the single neuroendocrii tumour on the array (set 9/10). Similarly, within a separate set of NSCLC samples, b-varis was elevated in a small subset of cases compared to unmatched controls (Fig. 8B). Th expression of b-type transcripts, although prevalent in neuroendocrine tumours, is not limit to this type of lung cancer.

B-variant expression in other types of cancer We surveyed a range of other common cance using similar cDNA arrays (Origene), that include tumours of different grade plus a set unmatched samples from apparently normal tissue. When compared to controls, elevated variant was detected in a subset of liver tumours (Fig. 8C) and kidney tumours (Fig. 8D). contrast both thyroid tumours and lymphomas express high levels of b-variant in a hi proportion of cases (Fig. 9). Therefore these two tumour types are strong altemati indications for the application of Ciz1 b-variant selective diagnostic and therapeutic tools.

Ciz1 variant protein High affinity variant-specific polyclonal antibodies have been generat and validated using recombinant proteins (Fig. 10A, 1OB, and 10C) and endogenous b-variό protein in SCLC cell lines (Fig. 10D). This shows that variant transcripts are indeed translat into variant protein in lung cancer cells, and that our tools are capable of effective a selective detection in a cellular context. Cizzle is also engaged in production and validation monoclonal antibodies with the same high degree of specificity.

EXAMPLE 4

Depletion of Ciz1 from cultured mouse cells using RNA interference, inhibits progression through the cell cycle and restrains cell proliferation ³. Therefore, agents that inhibit Ciz1 have potential as therapeutic molecules that restrain proliferation of cancer cells. We have generated and tested human specific RNA interference molecules that inhibit Ciz1 expression, either by targeting Ciz1 generally, or by selectively targeting lung cancer- associated b-type transcripts. Both suppress proliferation of neuroendocrine lung cancer cells.

B-type transcript suppression Our main strategy is to suppress b-type transcripts in a selective way with the aim of selectively suppressing the growth of lung cancer cells that express it. Candidate b-type transcript specific RNA interference molecules were compared for their ability to suppress b-type transcript expression, while leaving other forms of Ciz1 unaffected. The most effective and selective siRNA sequences were further tested for selective suppression of Ciz1 protein (Fig. 11). After transfer to an inducible shRNA delivery vector a marked effect on proliferation of SCLC cells that express endogenous b-type transcripts was recorded (Fig. 12A), along with selective suppression of b-variant transcript (Fig. 12B) and protein (Fig. 12C). Over a 4 day time course growth was suppressed to approximately 35% of similarly treated control cells (Fig. 12D). During prolonged culture with b-variant suppression notable changes in cellular morphology were observed (Fig. 12E).

Target suppression in vivo The same SCLC cells harbouring an inducible shRNA delivery vector were used to produce tumours in mice by sub-cutaneous injection. Whether activated from the date of cell injection, or switched on after tumours had formed, b-type transcript-selective RNAi effectively inhibited tumour growth in vivo (Fig. 13A₁ B). These data indicate that targeting the SCLC-associated Ciz1 splice variant (fa- type transcript) is a potentially viable strategy for selective suppression of cell proliferation in tumour types that express it. Additional validation is planned to encompass a lymphoma-based model and systemic delivery of stabilized siRNA.

Detection of circulating tumour cells RNA isolated from whole peripheral blood of a subset of mice bearing subcutaneous tumours was used to test the sensitivity of b-type transcript detection tools (Fig. 13C). B-variant was easily detected in both the mice with tumours but not in both mice from the control group, raising the possibility that b-variant could form the basis of a blood test for SCLC.

References

1. Ainscough, J. F. et al. C-terminal domains deliver the DNA replication factor Ciz1 to the nuclear matrix. J Cell Sci 120, 115-124 (2007). 2. Copeland, N.A., Sercombe, H. E., Ainscough, J., F-X. & Coverley, D. Ciz1 cooperates with cyclin A/CDK2 to activate mammalian DNA replication in vitro. Journal of Cell Science (in press). 3. Coverley, D., Marr, J. & Ainscough, J.F.-X. Ciz1 promotes mammalian DNA replication. Journal of Cell Science 118, 101-112 (2005). 4. den Hollander, P., Rayala, S.K., Coverley, D. & Kumar, R. Ciz1 , a novel DNA- , binding coactivator of the estrogen receptor α, confers hypersensitivity to estrogen action. Cancer Research SG, 11021-11030 (2006).

5. Warder, D. E. & Keherly, M.J. Ciz1, Cip1 interacting zinc finger protein 1 binds the consensus DNA sequence ARYSR(0-2)YYAC. Journal of Biomedical Science 10, 406-417 (2003).

6. Rahman, F.A., Ainscough, J. F., Copeland, N. & Coverley, D. Cancer-associated missplicing of exon 4 influences the subnuclear distribution of the DNA replication factor CIZ1. Human Mutation 28, 993-1004 (2007).

7. Dahmcke, CM., Buchmann-Moller, S., Jensen, N.A. & Mitchelmore, C. Altered splicing in exon 8 of the DNA replication factor CIZ1 affects subnuclear distribution and is associated with Alzheimer's disease. Molecular and cellular neurosciences 38, 589-594 (2008).

8. Zink, D., Fischer, A.H. & Nickerson, J.A. Nuclear structure in cancer cells. Nature reviews 4, 677-687 (2004).

Claims

1 A small interfering RNA [siRNA] or short hairpin RNA [shRNA] comprising a nucleic acid sequence selected from the group consisting of:

5'AAGAAGAGATCGAGGTGAGGT 3¹;

5' AAGAGATCGAGGTGAGGTCCA 3¹;

5' AGAAGAGATCGAGGTGAGGTC 3";

5' GAAGAGATCGAGGTGAGGTCC 3"; 5' AGAGATCGAGGTGAGGTCCAG 3';

5' GAGATCGAGGTGAGGTCCAGA 3';

5' AGATCGAGGTGAGGTCCAGAG 3';

5' GATCGAGGTGAGGTCCAGAGA 3";

5¹ ATCGAGGTGAGGTCCAGAGAT 3'; or 5¹ TCGAGGTGAGGTCCAGAGATA 3"; wherein said siRNA or shRNA is an inhibitor of CIZ1 expression.

2. A siRNA or shRNA according to claim 1 wherein said siRNA or shRNA comprises a nucleic acid sequence selected from the group consisting of: 5'AAGAAGAGATCGAGGTGAGGT 3';

5' AAGAGATCGAGGTGAGGTCCA 3';

5' AGAAGAGATCGAGGTGAGGTC 3';

5' GAAGAGATCGAGGTGAGGTCC 3'; or

5' AGAGATCGAGGTGAGGTCCAG 3'.

3. A siRNA or shRNA accoridng to claim 1 or 2 wherein said RNA molecule is between 21 nucleotides [nt] and 29nt in length.

4. A siRNA or shRNA according to claim 3 wherein said RNA molecule is between 21 nt and 27nt in length .

5. A siRNA or shRNA according to claim 4 wherein said RNA molecule is about 21 nt in length.

6. A siRNA or shRNA according to any of claims 1-5 wherein said siRNA or shRNA includes modified nucleotides.

7. A siRNA or shRNA according to any of claims 1-5 wherein said siRNA or shRNA is part of an expression vector adapted for eukaryotic expression.

8. A siRNA or shRNA according to claim 7 wherein said vector is adapted by inclusion of a transcription cassette comprising a nucleic acid molecule wherein said cassette comprises the nucleic acid sequence

GAAGAAGAGATCGAGGTGAGGTCCAGAGA which is adapted such that both sense and antisense nucleic acid molecules are transcribed from said cassette wherein said sense and antisense nucleic acid molecules are adapted to anneal of at least part of their length to form an siRNA or shRNA.

9. A siRNA or shRNA according to claim 7 or 8 wherein said cassette is provided with at least two promoters adapted to transcribe both sense and antisense strands of said nucleic acid molecule.

10. A siRNA or shRNA according to claim 7 or 8 wherein said cassette comprises a nucleic acid molecule wherein said molecule comprises a first part linked to a second part wherein said first and second parts are complementary over at least part of their sequence and further wherein transcription of said nucleic acid molecule produces an RNA molecule which forms a double stranded region by complementary base pairing of said first and second parts thereby forming an shRNA.

11. A siRNA or shRNA according to any of claims 7-10 wherein said vector includes a promoter that is substantially cancer specific.

12. A siRNA or shRNA according to claim 11 wherein said promoter is preferentially active in cancer cells selected from the group consisting of: lung cancer cells, kidney cancer cells, liver cancer cells, bladder cells, lymphoid cancer cells or thyroid cancer cells.

13. A pharmaceutical composition comprising one or more siRNA or shRNA selected from the group consisting of: 5'AAGAAGAGATCGAGGTGAGGT 3';

5' AAGAGATCGAGGTGAGGTCCA 3';

5' AGAAGAGATCGAGGTGAGGTC 3';

5¹ GAAGAGATCGAGGTGAGGTCC 3';

5' AGAGATCGAGGTGAGGTCCAG 3'; 5' GAGATCGAGGTGAGGTCCAGA 3¹;

5' AGATCGAGGTGAGGTCCAGAG 3';

5¹ GATCGAGGTGAGGTCCAGAGA 3";

5' ATCGAGGTGAGGTCCAGAGAT 3'; or

5' TCGAGGTGAGGTCCAGAGATA 3'; and optionally including at least one anti-cancer agent and at least one excipient or carrier.

14. A composition according to claim 13 wherein said composition comprises 2, 3, 4, 5, 6, 7, 8, 9 or 10 siRNAs or shRNAs.

15. A composition according to claim 13 or 14 wherein said anti-cancer agent is a chemotherapeutic agent.

16. A composition according to claim 15 wherein said chemotherapeutic agent is selected from the group consisting of: cisplatin, paclitaxel, docetaxel, gemcitabine and vinorelbine.

17. A method to diagnose cancer in a subject by analyzing the expression of exon 14 of Ciz 1 comprising: i) providing an isolated biological sample to be tested; ii) forming a preparation comprising said sample and an oligonucleotide primer pair adapted to anneal to a nucleic acid molecule comprising a nucleic acid sequence as represented in Figure 6; a thermostable DNA polymerase, deoxynucleotide triphosphates and co-factors; iii) providing polymerase chain reaction conditions sufficient to amplify said nucleic acid molecule; iv) analysing the amplified product of said polymerase chain reaction for the presence or absence of a nucleic acid molecule comprising a nucleic acid sequence as represented in 5' GAAGAAGAGATCGAGGTGAGGTCCAGAGA 3'; and optionally v) comparing the amplified product with a normal matched control.

18. A method according to claim 17 wherein said amplified products are digested with a restriction endonuclease that does not cleave the nucleic acid sequence δ'GAAGAAGAGATCGAGGTGAGGTCCAGAGAS'.

19. A method according to claim 18 wherein said restriction endonuclease is CAC1 81.

20. A method according to claim 17 wherein said oligonucleotide primer pair is adapted to specifically amplify a nucleic acid molecule comprising a nucleic acid sequence as represented in 5' GAAGAAGAGATCGAGGTGAGGTCCAGAGA 3'.

21. A method according to claim 20 wherein one of said oligonucleotide primers in said primer pair comprises or consists of the nucleic acid sequence: 5' GAAGAGATCGAGGTGAGGTC 3'.

22. A method according to claim 20 wherein said oligonucleotide primer pairs comprise or consist of nucleic acid sequences:

5' GAAGAAGAGATCGAGGTGAGGTCCAGAGA 3". and 5' GAAGAGATCGAGGTGAGGTC 3'.

23. A method according to any of claims 17-22 wherein said amplified product containing the sequence GAAGAAGAGATCGAGGTGAGGTCCAGAGA is detected with an oligonucleotide probe comprising or consisting of the nucleotide sequence: 5' TGGACCTCACCTCGATCTCTTCTTCA 3'.

24. A method to diagnose cancer in a subject by analyzing the expression of exon 14 of Ciz 1 comprising: i) providing an isolated biological sample to be tested; ii) forming a preparation comprising said sample an antibody that specifically binds a polypeptide that comprises the peptide sequence

DEEEIEVRSRDIS to form an antibody/polypeptide complex; iii) detecting the complex so formed; and iv) comparing the expression of said polypeptide with a normal matched control.

25. A method according to claim 24 wherein said antibody is a monoclonal antibody.

26. A method according to any of claims 17-25 wherein said diagnosis is combined with a treatment regime suitable for the cancer diagnosed.

27. A method according to claim 26 wherein said treatment regime comprises the administration of an anti-cancer agent.

28. A method according to claim 27 wherein said anti-cancer agent is a siRNA or shRNA which is not a siRNA or shRNA according to any of claims 1-12.

29. A method according to claim 27 wherein said siRNA or shRNA comprises a nucleic acid sequence selected from the group consisting of:

5'AAGAAGAGATCGAGGTGAGGT 3';

5" AAGAGATCGAGGTGAGGTCCA 3';

5¹ AGAAGAGATCGAGGTGAGGTC 3'; 5' GAAGAGATCGAGGTGAGGTCC 3';

5' AGAGATCGAGGTGAGGTCCAG 3';

5' GAGATCGAGGTGAGGTCCAGA 3";

5' AGATCGAGGTGAGGTCCAGAG 3';

5' GATCGAGGTGAGGTCCAGAGA 3"; 5' ATCGAGGTGAGGTCCAGAGAT 3'; or

5¹ TCGAGGTGAGGTCCAGAGATA 3'.

30. A method according to claim 27 wherein said agent is a chemotherapeutic agent.

31. A method according to claim 30 wherein said chemotherapeutic agent is selected from the group consisting of: cisplatin, paclitaxel, docetaxel, gemcitabine and vinorelbine.

32. A method according to any of claims 27-31 wherein said treatment regime comprises the administration of at least one siRNA or shRNA and the chemotherapeutic agent is administered separately, simultaneously or sequentially.

33. A method according to any of claims 17-32 wherein said biological sample comprises lung tissue, kidney tissue, bladder tissue, liver tissue, lymphoid tissue or thyroid tissue.

34. A kit comprising oligonucleotide primers adapted to specifically amplify a nucleic acid molecule comprising a nucleic acid sequence as represented in 5' GAAGAAGAGATCGAGGTGAGGTCCAGAGA 3' or a monoclonal antibody according to claim 27.

35. A kit according to claim 34 wherein said primers are 5¹ GAAGAGATCGAGGTGAGGTC 3'; and

5' TGGACCTCACCTCGATCTCTTCTTCA 3'.

36. A kit according to claim 34 or 35 wherein said kit further comprises a thermostable DNA polymerase, deoxynucleotide triphosphates and co-factors; preferably said kit includes instructions required to selectively amplify said nucleic acid molecule.

37. - A non-human transgenic mammal wherein said mammal is modified with a nucleic acid molecule comprising a nucleic acid sequence selected from the group consisting of: i) a nucleic acid molecule comprising or consisting of a nucleic acid sequence as represented in Figure 7a or 7b; ii) a nucleic acid sequence that hybridizes to a nucleic acid molecule under stringent hybridization conditions to the nucleic acid sequences in i) above and which encodes a polypeptide with DNA replication initiation activity; iii) a nucleic acid molecule comprising or consisting of a nucleic acid sequence as represented in Figure 8a or Figure 8b; iv) a nucleic acid sequence that hybridizes to a nucleic acid molecule under stringent hybridization conditions to the nucleic acid sequences in iii) above and which encodes a polypeptide with nuclear matrix binding activity.

38. A non-human transgenic mammal according to claim 37 wherein the expression of said nucleic acid molecule is regulatable.

39. A non-human transgenic mammal according to claim 38 wherein said expression is inducible or repressible.

40. A non-human transgenic mammal according to claim 39 wherein said expression is tissue or developmentally regulated.

41. A non-human mammal according to any of claims 37-40 wherein said mammal is a rodent; preferably a rat or mouse.

42. A non-human mammal according to any of claims 37-40 wherein said mammal is a non-human primate.

43. A method to diagnose cancer in a subject by comparing the expression of the Ciz 1 replication domain and Ciz 1 immobilisation domain comprising the steps: i) providing an isolated biological sample to be tested; ii) forming a preparation comprising said sample and oligonucleotide primer pairs adapted to anneal to a nucleic acid molecule comprising a nucleic acid sequence as represented in Figure 7a, 7b, 8a or 8b a thermostable DNA polymerase, deoxynucleotide triphosphates and co-factors; iii) providing polymerase chain reaction conditions sufficient to amplify said nucleic acid molecules; iv) quantitatively comparing the relative expression of said Ciz 1 replication domain and immobilization domains; and optionally v) comparing the ratio of expression of each domain with a normal matched control.

44. A method according to claim 45 wherein said oligonucleotide is selected from the group consisting of:

CACAACTGGCCACTCCAAAT and CCTCTACCACCCCCAATCG; ACACACCAGAAGACCAAGATTTACC and TGCTGGAGTGCG I I I I I CCT.

45. A method according to claim 45 or 46 wherein said oligonucleotide is selected from the group consisting of:

CAGGGGCATAAGGACAAAG with GGCTTCCTCAGACCCCTCTG CGAGGGTGATGAAGAAGAGGA with CCCCTGAGTTGCTG TGATA.

46. A method according to any of claims 43-45 wherein said method is combined with an analysis of expression of exon 14 of Ciz 1 according to any of claims 17-25.

47. A method according to claim 46 wherein said method of diagnosis is combined with a method of treatment according to any of claims 26-33.

48. A kit comprising oligonucleotide primers adapted to specifically amplify a nucleic acid molecule comprising the replication domain of Ciz 1 and the immobilisation domain of Ciz 1.

49. A kit according to claim 48 wherein said oligonucleotide primers that amplify the replication domain are:

50. A kit according to claim 48 or 49 wherein said oligonucleotide primers that amplify the immobilization domain are:

CAGGGGCATAAGGACAAAG with GGCTTCCTCAGACCCCTCTG CGAGGGTGATGAAGAAGAGGA with CCCCTGAGTTGCTGTGATA.

51. A kit according to any of claims 48-50 wherein said kit includes oligonucleotide probes that detect the amplified Ciz 1 replication domain and are selected from the group consisting of:

CGCCAGTCCTTGCTGGGACC or CCCTGCCCAGAGGACATCGCC

52. A kit according to any of claims 48-51 wherein said kit includes oligonucleotide probes that detect the amplified Ciz 1 immobilization domain and are selected from the group consisting of TGGTCCTCATCTTGGCCAGCA or CACGGGCACCAGGAAGTCCA or CACTGCAAGTCCCTGGGCCA.

53. A method to diagnose cancer in a subject by comparing the expression of the Ciz 1 replication domain and Ciz 1 immobilisation domain comprising the steps: i) providing an isolated biological sample to be tested; ii) forming a preparation comprising said sample an antibody that specifically binds the Ciz 1 replication domain or the Ciz 1 immobilization domain to form an antibody/domain complex; iii) detecting the complex so formed; iv) quantitatively comparing the relative amounts of said Ciz 1 replication domain protein and immobilization domain protein; and optionally v) comparing the ratio of expression of each domain with a normal matched control and optionally with other exons of Ciz1.

54. A kit comprising a first monoclonal antibody that specifically binds the replication domain of Ciz 1 protein and a second monoclonal antibody that binds the immobilization domain of Ciz 1 protein.

55. A antibody that binds a peptide sequence DEEEIEVRSRDIS or a polypeptide comprising the peptide sequence DEEEIEVRSRDIS and which binds said peptide sequence.

56. A hybridoma cell line that produces a monoclonal antibody according to claim 55.