EP0873358A2

EP0873358A2 - Capturing of microorganisms using complement components

Info

Publication number: EP0873358A2
Application number: EP96901269A
Authority: EP
Inventors: Paul Herbrink; Henk Van Den Munckhof; Wilhelmus Quint
Original assignee: Innogenetics NV SA; Delft Diagnostic Laboratory BV
Current assignee: Fujirebio Europe NV SA; Delft Diagnostic Laboratory BV
Priority date: 1995-01-13
Filing date: 1996-01-15
Publication date: 1998-10-28
Also published as: WO1996021675A2; AU4535896A; WO1996021675A3

Abstract

The invention relates to the field of detection of pathogenic microorganisms in biological samples. More particularly, it relates to the use of complement components or fragments thereof, possibly bound to a solid phase, for capturing a wide range of microorganisms from a sample, said complement components being preferably C1 or C1Q or C3b; as well as to the same components for use in the preparation of a diagnostic device, agent or kit.

Description

Capturing of microorganisms using complement components.

The present invention relates to the field of detection of pathogenic microorganisms in biological samples. More particularly it relates to a new method for capturing micro- organisms from a sample based on the use of complement components preferably bound to a solid support; it also relates to the complement components used as capturing agent in this new method, as well as to kits comprising the same.

Conventional laboratory techniques for the detection of pathogenic microorganisms are often laborious and time consuming. In many cases diagnosis can be accelerated by using short culture techniques, followed by identification with specific monoclonal antibodies or DNA/RNA probes (Han et al. 1986, Stamm et al. 1983). Detection assays like immunofluorescence, enzyme immuno assays or DNA hybridization techniques directly on the clinical specimen, have shown to be highly specific. However, sensitivity is often low compared to culture techniques(Meddens et al. 1988; Taylor-Robinson et al. 1987; Tjia et al. 1986). The polymerase chain reaction (PCR) has led to the development of assays with high sensitivity and specificity for the detection of RNA or DNA sequences (Melchers et al., 1989; Saiki et al. 1985, 1988).

Analysis of crude extracts from clinical specimens is hampered by the limited sample volume that can be tested in PCR and the presence of inhibitors for the PCR assay (Gerritsen et al. 1991 ; Thewessen et al. 1989; Widjojoatmodjo et al. 1992; Wilde et al. 1990). To overcome these problems assays have been developed using solid phase coated microbial specific antibodies for concentration and purification of microbial particles from crude clinical specimen, like blood, urine and faeces (Hedrun et al. 1992; Liang et alJ989; Niesters et al. 1991; Widjojoa odjo et al. 1992; Zeldis et al. 1989). In these assays intact microorganisms are captured to a solid phase coated with antibodies specific for microbial membrane antigens. Using such methodology microorganisms present in large volumes of clinical specimen can be concentrated. In addition, inhibitors for the PCR are removed by a washing step. The process of sample preparation remains quite laborious, often requiring a DNA/RNA extraction step. Liang et al.(1989) and Zeldis et al.(1989) described the use of solid pha¬ ses, coated with hepatitis B specific antibodies, for capturing the virus from human serum, thus avoiding the need for nucleic acid extraction. Widjojoatmodjo (29) used magnetic beads, coated with Salmonella specific antibodies, to concentrate and purify Salmonella bacteria from fecal samples. In addition, Niesters et al.(1991) and Hedrun e al.(1992) described a specific antibody directed antigen capture followed by PCR, base on the specific capture of chlamydial particles by solid phase coated with chlamydi specific antibodies. Although antibody directed antigen capture can be used for concentration of micro organisms from crude samples, each individual assay requires the coating o microorganism-specific antibodies to the solid phase. A more universal capture system enabling the capture of different microorganisms simultaneously would simplify th recovery from clinical specimen and reduce the work load. Microorganism-specifi detection could then be performed by PCR using specific primers, or any other type o specific bacterial assay.

It has been shown that the classical complement pathway is important in killing of gram negative bacteria like Klebsiella, E.coli, Shigella, Salmonella sp. and Mycoplasma sp. (Clas et al. 1985). Serum sensitive bacteria can bind high amounts of Clq from serum, independently of the presence of bacteria specific antibodies. Direct binding of Clq t serum sensitive bacteria has been reported by several laboratories (Betz et al. 1981 ; Cla et al. 1981; Loos et al. 1978; Tenner et al. 1981). It was shown that LPS and porin potentiate the binding of Clq in the absence of specific antibody (Loos et al. 1987; Cla et al. 1984). In addition, Clq was shown to bind to retroviruses (Clas et al. 1984). It is the aim of this invention to provide for a method of capturing microorganisms from sample, said capturing method resulting in a concentration and/or purification of sai microorganisms from the sample.

It is also an aim of the present invention to provide for a capturing method suitable for broad panel of different microorganisms. It is also an aim of the present invention to provide for a sample preparation method fo use in combination with any type of microorganisms detection assay. It is more particularly an aim of the present invention to provide for a sample preparatio method for use in combination with a PCR detection assay for microorganisms. It is also an aim of the present invention to provide for complement components preferably fixed to a solid phase for use in the preparation of a diagnostic device fo capturing microorganisms. It is more specifically an aim of the present invention to provide for Cl component, o CIQ component, or C3b component or a fragment thereof preferably fixed to a solid phase for use in the preparation of a diagnostic device or kit for capturing bacteria.

It is also an aim of the present invention to provide for a buffer system for use in the preparation of a diagnostic device for capturing microorganisms. It is also an aim of the present invention to provide for a composition comprising complement components bound to a solid phase, combined with a buffer system for use in the preparation of a diagnostic device or kit for capturing microorganisms from a sample.

It is also the aim of the present invention to provide for a kit for capturing micro¬ organisms from a sample. It is more particularly an aim of this invention to provide for a sample preparation kit for use in combination with any type of microorganism detection assay.

It is a more specific aim of this invention to provide for a sample preparation kit for use in combination with a PCR detection assay of microorganisms.

All of the above-mentioned aims have been achieved by the following embodiments of the invention.

The invention discloses the use of complement components or fragments thereof for capturing microorganisms from a sample.

The term "complement" refers to the complement system (human or animal), which is a system of serum proteins, activated by antibody-antigen complexes or by microorganisms, and active in the elimination of microorganisms invading the human body.

The term "microorganisms" refers most often to bacteria, but may also refer to viruses, or even to eucaryotic microorganisms (yeasts, fungi). The genera and species concerned are referred to below.

The term "complement components" refers to at least one of those serum proteins belonging to the complement system.

The term "fragment thereof" refers to any fragment of the complement components, with said fragments having retained the microorganism binding affinity of the complement component.

The term "capturing" refers to the binding of the microorganisms to the complement components resulting in a concentration and/or purification of said microorganisms from the sample.

The term "sample" may comprise any type of medium possibly containing micro- organisms, such as clinical specimens (faeces, sputum, broncheoalveolar lavage, cervical secretions, urine and possibly blood, cerebrospinal fluid, serum or tears...), food specimens, soil and water specimens, fermentation broth, etc.

In a preferred embodiment the invention discloses the use of complement components as described above, wherein said complement components are bound to a solid phase.

The term "solid phase" refers to any type of solid substrate known in the art which allows the binding of complement components for the above-described use, and which allows subsequently an easy recovery of the (complement component)-(microorganism) complexes. Examples of possible solid phases include: beads, plates, dipsticks, membranes, tubes or others made of for example polystyrene, poly vinyl, latex, sepharose or other polymers, and most preferably the solid phase is composed of paramagnetic beads, e.g. tosylactivated Dynabeads as commercialised by Dynal AS, Oslo, Norway. The type of binding of the complement components to the solid substrate can be covalent or passive binding, depending on the solid substrate used, according to any method known in the art.

In a still more specific embodiment the invention describes the use as described above, wherein said complement components are Cl or CIQ or C3b, or a fragment thereof, as long as said fragment is still able to bind microorganisms. The abbreviations "Cl ", "CIQ" and "C3b" refer to serum proteins being components or subcomponents of the complement system.

In a very specific embodiment the invention describes the use as described above, wherein said complement component is CIQ, or a fragment thereof, as long as said fragment is still able to bind microorganisms. The current invention describes a system capable of capturing a broad range of micro- organisms, using solid phase immobilized Clq for concentration and purification of Clq binding microorganisms. Chlamydia trachomatis was used as a model system (see example I).

An essential factor in the procedure is the capture of intact cells containing the microbial genome. Therefore, the capturing buffer should preferably be free of certain detergents like desoxycholate which lead to permeabilisation of the cell membrane (see example II). Moreover, the Clq-capturing procedure of the current invention enables the capturing of intact virus particles (virions) from a sample like serum or plasma, which reflects much more the infectivity of the sample than the free circulating viral nucleic acids, which are determined by the currently used methods of virus detection. In particular, this method for capturing virus particles in a serum or plasma sample, in stead of free circulating nucleic acids, may prove to be advantageous for differentiation between latent and non- latent viral infection phases.

Like antibody -directed capture systems the Clq-directed capture enables the concentration of microorganisms from large volumes of clinical specimens, with concomitant removal of inhibitors of PCR. This may lead to an increased sensitivity of capture-preceded PCR as compared to direct PCR. An important feature of the Clq-directed capture however as compared to the antibody-directed PCR is its utility toward a broad range of micro¬ organisms (see example III). Following a single concentration step using Clq coated solid phases, the nature of the captured microorganisms can subsequently be determined by PCR using microorganisms specific primers, or any other type of microorganism detection assay. In certain applications a more universal capturing system is clearly advantageous to specific capturing. This is the case for example, in clinical specimen where a number of different pathogens may be expected: e.g. pathogens causing gastero- enterological disorders in faeces (like Salmonella sp. , Shigella sp. , Enterococcus sp., Campy lobacter sp. etc.) or pathogens causing respiratory disorders in sputum or bronche- oalveolar lavages (like Streptococcus sp. , Mycobacteria sp. , Mycoplasma sp. , Moraxella sp. , Bordeϊella sp. etc.) or pathogens causing sexually transmitted diseases in cervical secretions (like Neisseria sp. , Chlamydia sp. etc.), etc. Simultaneous capturing of the different pathogens possibly present in a sample, followed by species-specific detection considerably lowers the work-load for sample preparation. If the capturing is followed by a specific detection method, like e.g. PCR, the presence of other microorganisms, even in a 1000-fold excess, simultaneously captured (e.g. non- sterile samples) does not interfere. This is illustrated in example IV where even in increasing ratios of E. colil Campy lobacter jejuni up to ratios of 1000/1, Clq-capturing and subsequent PCR-detection of Campylobacter jejuni is still possible. It is to be understood that the above-described complement components may be modified in order to make them more effective for the above-described use, e.g. in order to obtain a higher microorganism capture efficiency, and/or to obtain a capture specificity for a restricted group of microorganisms, and/or to enable a more efficient binding of the complement components to the solid substrate. Said modifications to the complemen components which are comprised in the current invention, may include e.g. fragmentatio of the molecules, addition of linker groups, binding to carrier molecules, mutation of th amino-acid sequence of said complement components, said mutation possibly includin addition, deletion or substitution of one or more amino acids.

In another embodiment the invention provides for the use of complement components fo the capturing of microorganisms in a sample, wherein said microorganisms belong to broad panel of different microorganisms, such as belonging to the group of viruses and/ o to eucaryotic microorganisms and/or to gram-negative and/or to gram-positive genera o bacteria, and more specifically belonging to at least one of the following genera: Chlamydia, Campy lobacter, Escherichia, Salmonella, Shigella, Enterococcus, Neisseria, Klebsiella, Pseudomonas, Mycoplasma, Streptococcus, Staphylococcus, Mycobacterium, Moraxella, Bordetella, Haemophilus, Branhamella, Legionella, Clostridium, Vibrio, Yersinia, Listeήa, Cryptococcus, Herpes simplex virus, Human Papilloma virus, Huma immunodeficiency virus, Hepatitis virus, Candida, Treponema, Trichomonas.

Depending on the application, capturing of all microorganisms or capturing of only specific group of microorganisms may be required. The capture incubation times may als depend on the application, but ideally the capture incubation time varies between 30 an 90 minutes (see example II). According to a more specific embodiment the invention provides for the use as describe above, wherein said microorganisms possibly belong to the group of viruses. According to a more specific embodiment the invention provides for the use as describe above, wherein said microorganisms possibly belong to the group of eucaryotic micro¬ organisms. According to a more specific embodiment the invention provides for the use as describe above, wherein said microorganisms possibly belong to the group of gram-negative bacteria.

According to another specific embodiment the invention provides for the use as described above, wherein said microorganisms belong to the group of gram-positive bacteria. In another specific embodiment the invention provides for the use as described above, wherein said sample is a clinical sample, such as faeces, sputum, broncheoalveola lavage, cervical secretion, urine, and possibly blood, cerebrospinal fluid, serum or tears. According to a still more specific embodiment the invention provides for the use as described above, wherein said sample is sputum or broncheoalveolar lavage, and wherein said microorganisms are at least one of the following species: Mycoplasma pneumoniae, Bordetella pertussis, Staphylococcus aureus, Streptococcus pneumoniae, Haemophilus influenzae, Mycobacterium sp. , Pseudomonas aeruginosa, Branhamella catarrhalis,

Legionella pneumophila, Streptococcus pyogenes, Rhinovirus, Corona virus, Influenza virus, Adeno virus, Parainfluenza type virus, Respiratory syncytial virus, or another pathogenic microorganism possibly causing respiratory tract infections. According to still another specific embodiment the invention provides for the use as described above, wherein said sample is a faecal sample, and wherein said micro¬ organisms are at least one of the following species: Salmonella sp., Shigella sp., Yersinia sp. , Campylobacter sp. , Clostridium difficile. Vibrio cholera or any other pathogenic microorganism possibly causing gastero-enteritic disorders. According to still another specific embodiment the invention provides for the use as described above, wherein said sample is urine or cervical secretion, and wherein said microorganisms are at least one of the following species: Chlamydia thrachomatis, Neisseria gonorrhoeae, Ureaplasma urealyticum, Mycoplasma genitalium, Mycoplasma hominis, Garderella vaginalis, Haemophilus ducreyi, Streptococcus agalactiae, Trichomo¬ nas vaginalis, Candida albicans, Veilonella parvula, Mobiluncus sp. , Peptostreptococcus sp., Treponema pallidum, Herpes simplex virus, Human papilloma virus, or any other pathogenic microorganism possibly causing urogenital disorders.

According to still another specific embodiment the invention provides for the use as described above, wherein said sample is blood, serum or cerebrospinal fluid, and wherein said microorganisms are at least one of the following species: Neisseria meningitidis, Haemophilus influenzae, Streptococcus pneumoniae, Listeria monocytogenes, Mycobacte¬ rium sp. , Streptococcus agalactiae, Cryptococcus neoformans, HIV, Hepatitis viruses, or any other pathogenic microorganism possibly present in the above-mentioned samples. In another specific embodiment the invention provides for the use as described above, wherein said sample is a food sample. In a still more specific embodiment the invention provides for the use as described above, wherein said sample is a food sample, and wherein said microorganisms are at least one of the following species: Escherichia coli, Salmonella sp., Campylobacter sp. , Brucella sp. , Listeria sp. , Clostridium sp. , Staphylococcus sp. , Yersinia enterocolitica, or an other pathogenic microorganism possibly causing food intoxication. In another specific embodiment the invention provides for the use as described above, wherein said sample is a soil or water sample. In another specific embodiment the invention provides for the use as described above, wherein said sample is a sample taken from a fermentation broth.

Another embodiment of the invention provides for the use as described above wherei said solid phase consists of paramagnetic beads. The invention thus provides for a method for capturing microorganisms in a sample, comprising the use of complement components preferably bound to a solid phase.

More particularly, the invention provides for a method for detecting microorganisms in sample, comprising the steps of

- capturing the microorganisms from the sample, using complement component preferably bound to a solid phase, and - detecting the microorganisms captured.

The detection of the microorganisms captured can be done according to any type of assay aiming at the detection and/or identification of microorganisms possibly present in sample. Examples of such assays are e.g. nucleic acid hybridisation, possibly preceded b any type of nucleic acid amplification, culture, staining techniques, or any othe microorganism characterization techniques.

Preferably said detection assay comprises a polymerase chain reaction (PCR, Saiki et al. 1988) or any other type of nucleic acid amplification, such as ligase chain reaction (LCR; Landgren et al. 1988; Wu and Wallace, 1989; Barany, 1991), nucleic acid sequence- based amplification (NASBA; Guatelli et al. 1990; Compton, 1991), transcription-base amplification system (TAS, Kwoh et al. 1989), strand displacement amplification (SDA, Duck, 1990; Walker et al. 1992) or amplification by means of Qβ replicase (Lizardi et al. 1988; Lomeli et al. , 1989) or any other suitable method to amplify nucleic aci molecules. During amplification, the amplified products can be conventiently labele either using labeled primers or by incorporating labeled nucleotides. Labels may b isotopic (³²P, 35S, etc.) or non-isotopic (biotin, digoxigenin, etc.). The amplificatio reaction is repeated between 20 and 70 times, advantageously between 25 and 45 times. The invention thus provides for a method for capturing microorganisms from a sampl comprised in or for use in combination with any type of microorganism detection assay, said microorganism capturing method comprising the use of complement components possibly bound to a solid phase for capturing microorganisms from the sample, as described above. The invention also provides for a capturing agent, consisting of complement components or fragments thereof preferably bound to a solid phase, said complement components being preferably Cl or CIQ or C3b, for use in the preparation of a diagnostic agent, kit or device for capturing microorganisms possibly present in a sample as described above.

These complement components or fragments thereof, may be purified from human or animal serum, or made by recombinant DNA techniques, or synthesised chemically, by any methods known in the art for polypeptide synthesis.

The invention also provides for a buffer for use in a capturing method as described above. More particularly, the invention provides for a buffer enabling efficient capturing of the microorganisms possibly present in a sample, said buffer being free from membrane permeabilizing agents such as desoxycholate.

The invention more particularly provides for a capturing buffer as described above, preferably comprising the following components:

0.008 M PBS (ph 7.3) containing 0.1 % BSA (=PBSA buffer) or, 0.05 M Tris-HCl (pH 7.3) containing 0J % BSA (=TA buffer) or,

0.05 M Tris-HCl (pH 7.3) containing 0.1 % casein (=TC buffer) or,

0.05 M Tris-HCl (pH 8.0) containing 0.01 M EDTA and 0.1 % Bovine Serum albumin (BSA) (=TEA buffer) or,

0.05 M Tris-HCl (pH 8.0) containing 0.01 M EDTA and 0.1 % BSA and 1-25 mM dithiothreitol (DTT) or, 0.1 M Tris-HCl pH 8.0, 20 mM EDTA, 20 mM dithiotreitol, 0.5 % Triton X-100 and most preferably being constituted by at least one of the following components:

0.05 M Tris-HCl (pH 8.0) containing 0.01 M EDTA and 0.1 % BSA ( =TEA buffer) or,

0.05 M Tris-HCl (pH 8.0) containing 0.01 M EDTA and 0.1 % BSA and 1-25 mM DTT or,

0J M Tris-HCl pH 8.0, 20 mM EDTA, 20 mM dithiotreitol, 0.5 % Triton X-100. The expression "efficient capturing" implies that the microorganisms which need to b detected are purified and/or concentrated from the sample in a quick and reliable way Depending on the application, "efficient capturing" may mean capturing of all micr organisms possibly present in the sample, or capturing of a specific group of micr organisms. Changing buffer composition may result in different capturing specificities. In a very specific embodiment the invention provides for a capturing buffer to whic mucus dissolvers and/or agarose dissolvers are added, such as e.g. dithiotreitol (DTT) hyaluronidase, N-acetyl-cysteine or Nal.

In a more preferential embodiment, the mucus dissolver added to the capture buffer i DTT, at concentrations of 1 to 50 mM, and most preferably at a concentration of 1, 5 o 25 mM.

In a specific embodiment the invention also provides for a buffer suitable for washing o the captured cells, said washing buffer being constituted preferably by at least th following components: NaCl (0.875%), Na₂HPO₄.2aq. (0.116%) and KH₂P0₄ (0.022% (=PBS-buffer). In another specific embodiment the invention also provides for a buffer suitable for lysin the captured cells, said lysing buffer being constituted preferably by at least the followin components: PBS, 50μg/ml proteinase K and 0.75% Triton X-100. The invention also provides for a composition comprising a capturing agent, as describe above, and a capturing buffer, or components necessary to produce the buffer, a described above.

The invention also provides for a kit for capturing microorganisms from a sample, said kit comprising at least the following elements:

- if necessary, a means for pretreatment of the sample possibly containing the micro organisms; - a complement component or fragment thereof preferably bound to a solid phase fo capturing the microorganisms, as described above;

- a capturing buffer, or components necessary to make the buffer, as described above; - if necessary, a means for separating the captured microorganisms from the remainder of the sample.

In particular, the invention provides for a kit as described above, said kit being a sample preparation kit for any type of microorganism detection assay .

More particularly, the invention provides for a kit as described above, said kit being a sample preparation kit for a PCR-based microorganism detection assay.

Figure legends

Figure 1 : Clq capture of Chlamydia trachomatis using beads with different Clq coating concentrations. lane 1 : coating with 5 μg Clq/mg beads lane 2: coating with 10 μg Clq/mg beads lane 3: coating with 20 μg Clq/mg beads lane 4: coating with 40 μg Clq/mg beads

Figure 2: Comparison of different capture buffers for Clq capture PCR of Salmonella lanes 1 ,3,5,7: captured fraction lanes 2,4,6,8: uncaptured fraction lanes 1 and 2: capture buffer PBS A lanes 3 and 4: capture buffer TA lanes 5 and 6: capture buffer TC lanes 7 and 8: capture buffer TEA

Figure 3: Comparison of PBS and Tris-HCl as buffer component in the washing and lysis buffer in Clq capture PCR of Salmonella. lanes 1 ,3,5: Tris-HCl in washing and lysis buffer lanes 2,4,6: PBS in washing and lysis buffer lanes 1 and 2: capture buffer PBSA lanes 3 and 4: capture buffer TA lanes 5 and 6: capture buffer TEA

Figure 4: Comparison of different capture incubation times for Neisseria gonorrhoeae using Clq capture PCR, as well as the influence of addition of DTT or hyaluronidase to the capture buffer. lanes 1,2,3,4,8: capture time 90 min lanes 1,2,3: with DTT in capture buffer, in increasing amounts: 1 mM, 5mM and 25 mM respectively lane 4: with hyaluronidase in capture buffer lane 5: capture time 30 min lane 6,7: capture time 60 min lane 7: double amount of beads added (20 μl in stead of 10 μl) lane 9: capture time 120 min lanes 5,6,7,8,9: no additives in capture buffer

Figure 5: Influence of N-acetyl cysteine and Nal in capture buffer on efficacy of Clq capture PCR of Chlamydia trachomatis (lanes 1 to 7) and Neisseria gonorrhoeae (lanes 11 to 17). lanes 1 and 11 : no additives in capture buffer lanes 2 and 12: 3 mM DTT in capture buffer lanes 3 and 13: 6 mM Nal in capture buffer lanes 4 and 14: 6 mM Nal and 3 mM DTT in capture buffer lanes 5 and 15: 0.6 mM Nal in capture buffer lanes 6 and 16: 0.6 mM Nal and 3 mM DTT in capture buffer lanes 7 and 17: 15 mM N-acetyl cysteine in capture buffer lane 8: positive PCR control: 100 ng of isolated endogeneous plasmid DNA of Chlamydia trachomatis lane 9: MW marker lane 10: positive PCR control: 100 ng of isolated genomic DNA of Neisseria gonorrhoeae

Figure 6: Agarose gel electrophoresis of the PCR-amplified rRNA spacer region after capturing of the microorganisms by Clq-coated beads (example III). lane 1 : Salmonella D lane 2: Neisseria gonorrhoeae lane 3: negative Clq-capture control: addition of blanc capture buffer to Clq-coated beads lane 4 Marker 1 kbp DNA ladder lane 5 Staphylococcus aureus lane 6 Staphylococcus epidermidis lane 7 Streptococcus faecalis lane 8 Escherichia coli lane 9 Pseudomonas aeruginosa lane 10 Enterobacter cloacae lane 11 Citrobacter diversus lane 12 Haemophilus influenzae lane 13 Klebsiella pneumoniae lane 14: Streptococcus pneumoniae lane 15: marker 1 kbp DNA ladder lane 16: negative PCR control lane 17: negative PCR control

Figure 7: Clq capture PCR of Campylobacter jejuni in the presence of increasing amounts of E. coli. A constant amount of C. jejuni cells (1,5 JO⁵ cells) is mixed with decreasing amount of E. coli cells (lanes 1-9). lane 1 : 2J0⁸ E. coli cells lane 2: 2 JO⁷ E. coli cells lane 3: 2J0⁶ E. coli cells lane 4: 2J0⁵ E. coli cells lane 5: 2J0⁴ E. coli cells lane 6: 2J0³ E. coli cells lane 7: 2 JO² E. coli cells lane 8: 2J0 E. coli cells lane 9: no E. cσ// cells lane 10: negative control: no C. jejuni DNA lane 11 and 12: direct PCR with C. jejuni genomic DNA (100 ng) lane 13: MW marker DNA

Fi^gure 8: HCV RNA detection in duplo by 5'UTR PCR with an internal assay control after virion capture with CIQ.

EXAMPLE I : CIQ capturing of Chlamydia trachomatis

1. MATERIALS AND METHODS

1J. Clinical specimen Clinical specimens used were samples submitted to the routine microbiology laborator for detection of Chlamydia trachomatis. The samples were taken with an ENT swab Boehringer, Mannheim ) and placed in 2 ml transport medium (0.2 M sucrose i phosphate buffer). The specimens for chlamydial culture were stored at 4°C or, when no tested within 24 hours after collection, at -70°C. All specimens were processed within days. The remainder of the samples was stored at -70°C untill further testing.

1.2. Cell culture

Chlamydia trachomatis was cultured in cycloheximide-treated McCoy cells, grown in 9 wells microtiter plates as described by Thewessen et al.(27). Briefly, 2 wells per plat were each inoculated with 0.2 ml of patient sample. After centrifugation for 60 min a 1 ,400 x g, the supernatant was replaced with 0J ml of complete growth medium ( Eagl minimal essential medium; Flow ) containing 10 % fetal calf serum, 1 % vitamins ( Flo ), 5 μg/ml gentamicin, 1 % 200 mM L-glutamin ( Flow ), 5 μg/ml of amphotericin B, 1 ml/1 of 7.5 % NaHCO₃, 25 μg/ml of vancomycin, 4.5 g of glucose per liter and 0. μg/ml of cycloheximide ( Sigma ). The plates were incubated at 37°C for 48 h. Thereaf ter, the monolayers were fixed, stained with a fluorescent monoclonal anti-Chlamydi antibody ( MicroTrak ) and examined for inclusions. Culture results were scored as des cribed by Kluytmans et al.(1993): 0: no inclusions per two wells; 1: 1 to 5 inclusions pe two wells; 2: 6 to 20 inclusions per two wells; and 3: > 20 inclusions per two wells.

1.3. Isolation of human Clq.

Human Clq was isolated as described by Tenner et al.(1981). Briefly, fresh human seru was adjusted to 5 mM EDTA and applied to a Biorex 70 column, equilibrated wit starting buffer ( 82 mM NaCl, 2 mM EDTA, 50 mM sodium phosphate, pH 7.2 ). Afte washing with 1000 ml of starting buffer, the column was eluted with an ionic strengt gradient composed of 600 ml starting buffer and 600 ml buffer pH 7.2 containing 30 mM NaCl, 2 mM EDTA and 50 mM sodium phosphate. Fractions containing Clq, a measured by immunodiffusion, were pooled and concentrated by precipitation at 33 % satured ammonium sulphate. The precipitate was dissolved in 50 mM Tris-HCl, pH 7.2, containing 500 mM NaCl, 1 mM EDTA, and applied to a Biogel A5m gel filtration column, equilibrated with the same buffer. Clq containing fractions were pooled and concentrated by 33 % ammonium sulphate precipitation. The pellet was dissolved in 5 ml of 0.002 M (NH₄)HCO₃ and dialyzed extensively against the same buffer. Following lyophilization, purified Clq was stored at -20°C. Purity was determined by sodium dodecyl sulphate gel electrophoresis.

4. Clq coating of paramagnetic beads

Coating of paramagnetic beads with Clq was performed according to the manufacturers 's instructions. Tosylactivated Dynabeads ( 500 μl; M-280, Dynal AS, Oslo, Norway, 6-7 x 10⁸ beads/ml ) were pelleted by placing the tube in the powerful magnetic field of a magnetic particle concentrator ( Dynal MPC-6 ). Following removal of storage buffer, the beads were washed once with 1 ml of coating buffer ( 0.05 M borate pH 9.5 ). After a final concentration, 250 μl coating buffer was added, the beads were suspended and 250 μl human Clq ( 0.4 mg/ml coating buffer ) was added. Coupling of Clq was performed by gentle rotation for 24 hr at 37°C. Thereafter, the beads were washed 3 times with PBS pH 7.2 containing 0J % BSA (PBS A). Following an overnight wash at 4°C with the same buffer, the beads were suspended in 0.5 ml of 0J % PBSA and stored at 4°C.

5. Cell capture.

For each assay, 10 μl of Clq coated bead suspension was transferred to a 1.5 ml tube.

All buffers were sterilized by filtration using a 0.22 μm filtration device. Thereafter, 940 μl of capture buffer ( 0.1 M Tris-HCl pH 8.0, 20 mM EDTA, 20 mM dithiotreitol, 0.5 % Triton X-100 ) and 50 μl of clinical sample was added. For samples with low inclusion numbers in cell culture 740 μl capture buffer and 250 μl of clinical sample was used. The suspension was incubated for 1.5 hrs at 37°C by gentle rotation. The beads were washed twice with PBS containing 0.5 % Triton X- 100 as described above. 6. Polymerase chain reaction

6.1. Proteϊnase K treatment of beads

After magnetic concentration 50 μl of lysis buffer ( 50 μg/ml proteϊnase-K, 0.75 % Triton X-100 ) was added. The beads were incubated for 60 min at 37°C and the proteϊnase-K was inactivated by a 15 min incubation at 100 °C. The sample was cooled to room temperature for 5 min in the air. Ten μl was used for the PCR. From samples with low inclusion numbers 50 μl was used for PCR.

6.2. Amplification and detection of Chlamydial DNA. The polymerase chain reaction (Saiki et al. , 1988) was used for the amplification of Chlamydia trachomatis target DNA. The primer sequences were selected from the common endogenous plasmid of Chlamydia trachomatis (Claas et al. , 1990, 1991) which generates a species specific fragment of 517 basepairs with all known C. trachomatis serovars ( PI : 5' GGACAAATCGTATCTCGG 3'; P2: 5' GAAACCAACTCTACGCTG 3' ). This PCR product was positively identified by using an internal labelled oligonucleo- tide probe ( 5' CGCAGCGCTAGAGGCCGGTCTATTTATGAT 3'). The primers and probes were synthesized on an Applied Biosystem 381 A DNA synthesizer using the β- cyanoethyl phosporamidite method. Specificity has been determined as described (Claas et al. 1990). A spatial separation of the different steps of the technique was routinely used to prevent contamination of the samples.

6.2.1. DNA amplification

The reaction was performed in a volume of 100 μl containing 10 mM Tris-HCl, pH 8.3,

50 mM KC1, 2.5 mM MgCl₂ 0.01 % gelatin, 200 μM dNTPs, 50 pmol of both primers and 0.25 units of Taq DNA polymerase [Sphero Q]. Ten μl, respectively 50 μl for samples with low inclusion numbers, of sample was routinely used. The reaction mixture was overlay ed with 3 drops of mineral oil [SIGMA M-3516] and subjected to 40 cycles of amplification in a thermocycler ( Biomed, Germany ). Each cycle consisted of a DNA denaturation step of 1 min at 94°C, a primer annealing step of 1 min at 42°C and an elongation step of 1 min at 74 °C. As a positive control for the PCR reaction, 1 ng of DNA from Chlamydia trachomatis infected cells was used. Water was used as a negative control. 6.2.2. Analysis of the PCR product.

The clinical specimen were analyzed by Southern blot hybridization. Hybridization was performed as described by Claas et al. (Claas et al. 1990, 1991). Briefly, prehybridization was performed at 37 °C for 15 min in a solution containing 5x SSC [75 mM sodiumcitra- te, 750 mM NaCl], 5x Denhardt [0.1 % bovine serum albumin, 0.1 % Ficoll, 0.1 % poly vinyl pyrrolidone], 0.5% SDS, 5 mM EDTA and 0J mg/ml denatured, sonicated herring sperm DNA. Hybridization was performed in the same mixture by adding the probe to the prehybridization mixture. Hybridization was routinely done for 16 hrs. After hybridization, the blots were washed twice for 15 min at 42°C in 2x SSC containing 0J % SDS. Autoradiography was performed for 4 hr on a Kodak Royal X-Omat film using 2 intensifying screens at -70 °C.

7. Direct PCR on clinical specimen

For direct PCR 800 μl sample was centrifuged at room temperature for 30 min at 14,000 g. The supernatant was removed and the pellet resuspended in 300 μl PBS by vortexing. To 60 μl of the resuspended sample, 10 μl 6 % Triton X-100 and 10 μl proteϊnase-K ( 6.25 μg/ml ) was added. After vortexing briefly, the sample was incubated for 1 hr at 37°C. The proteϊnase-K was inactivated by a 15 minute incubation at 100 °C. After addition of 100 μl aqua dest to the sample 10 μl, corresponding to 9 μl of the initial crude clinical sample, was used in the PCR. For samples with low inclusion numbers in cell culture, 400 μl of clinical sample was centrifuged at room temperature for 30 min at 14,000 x g. The pellet was resuspended in 40 μl of lysis buffer ( 50 mM Tris-HCl, pH 7.5, 1 % Triton X-100, 1 mM EDTA, 400 μg proteinase K per ml ) For samples with low inclusion numbers in cell culture 8 μl, corresponding to 80 μl of the initial crude clinical sample, was used for PCR. 2. RESULTS

To compare the sensitivity of Clq directed antigen capture PCR, direct PCR and cell culture for detection of Chlamydia, serial dilutions of a freshly prepared suspension o Chlamydia trachomatis strain LGV-2 were tested (results not shown). Sensitivity of direct

PCR and Clq directed antigen capture PCR was identical to cell culture. In addition, the sensitivity of Clq directed antigen capture PCR in relation to direct PCR was determined using 34 patient specimens, positive by direct PCR. All samples, positive by direct PCR, were also positive by Clq directed antigen capture PCR (results not shown). To compare the sensitivity of Clq directed antigen capture PCR with direct PCR and cell culture for clinical testing, 71 consecutive clinical specimens were tested. The results are shown in table 1. Of these 71 clinical specimens, 11 samples were positive by cell culture, direct PCR and Clq directed antigen capture PCR. Of the 11 specimens with a positive cell culture 9 showed a 3 + score ( more than 20 inclusions ) and 2 showed a 2 + score ( 6-20 inclusions ). By direct PCR and Clq directed antigen capture PCR an additional 2 clinical specimens were positive. None of the samples, negative by direct PCR or Clq directed antigen capture PCR was found positive by cell culture. Since the 11 culture positive samples all showed a 2+ or 3+ score in cell culture, the sensitivity of Clq directed antigen capture PCR was further assessed by testing 20 clinical specimens with a 1 + score ( 1 to 5 inclusions per 2 wells ) and 20 clinical specimens with a 2+ score ( 6 to 20 inclusions per 2 wells ) in cell culture. For optimal comparison with cell culture a comparable amount ( 250 μl ) of initial clinical specimen was used for Clq directed antigen capture PCR. For direct PCR 80 μl of initial clinical specimen was used. The results are shown in table 2. Out of 20 clinical samples yielding 6 to 20 inclusions in cell culture, 19 were found positive by Clq directed antigen capture PCR, whereas 18 o 20 clinical samples were positive by direct PCR. For the clinical samples yielding 1 to 5 inclusions in cell culture 18 out of 20 were positive by Clq directed antigen capture PCR, whereas direct PCR yielded a positive result for 15 of the 20 clinical specimen.

3. DISCUSSION AND CONCLUSION

Using serial dilutions of Chlamydia trachomatis LGV-2 strain and 34 well-defined clinical samples, Clq directed antigen capture PCR revealed a sensitivity equal to direct PCR and cell culture.

Comparison of cell culture, direct PCR and Clq directed antigen capture PCR in 71 consecutive clinical samples revealed 2 clinical samples, negative by cell culture and positive by Clq directed antigen capture PCR and direct PCR. These 2 additional positive samples probably reflect the presence of non- infectious Chlamydia particles (e.g. dead cells). Alternatively, the discrepancy between cell culture and Clq directed antigen capture might be explained by sampling error, due to low numbers of Chlamydia cells in the sample. Since the positive samples mainly consisted of samples with high inclusion numbers in cell culture, it was decided to analyze the sensitivity of both direct PCR and Clq directed antigen capture PCR using larger volumes of clinical specimen ( 80 μl, respectively 250 μl ) with low inclusion numbers in cell culture. In this setting a sensitivity for Clq directed antigen capture PCR of 90 % and 95 % was obtained for samples containing 1-5, respectively 6-20 inclusions in cell culture, whereas direct PCR revealed a sensitivity of 75 % , respectively 90 % as compared to culture. Of the 40 clinical samples with low inclusion numbers only 3 were negative by Clq directed antigen capture PCR, probably due to sampling errors. This is further supported by the fact that the 2 samples with 1 to 5 inclusions in cell culture, which were negative in Clq directed antigen capture PCR, were only positive in 1 of the 2 wells, that had been inoculated in cell culture.

In conclusion, using Clq coated solid phases Clq binding Chlamydia cells can be concentrated from large volumes with concomitant removal of inhibitors of PCR, enabling the use of large volumes of clinical samples for clinical testing. Since Clq has been shown to bind to a range of gram-negative and gram-positive bacteria (see example III), the newly developed techniques have utility toward a broad range of bacteria. Table 1. Comparison between cell culture, direct PCR and Clq directed antigen capture PCR for detection of Chlamydia trachomatis in 71 consecutive clinical samples.

Culture pos neg

pos 11 2

Direct PCR neg 0 58

pos 11

Clq capture neg 0 58

Table 2. Comparison between cell culture, direct PCR and Clq directed antigen capture PCR for detection of Chlamydia trachomatis in 40 clinical samples with low inclusion numbers.

1 to 5 inclusions 6-20 inclusions in cell culture in cell culture

pos 18 19 Clq capture neg

pos 15 18 direct PCR neg

EXAMPLE II: Optimisation of Clq capture PCR.

Introduction

In order to optimize the capture of microbial cells to Clq several variables were tested. 1. The optimal coating concentration of beads with Clq.

2. Optimal buffer systems.

Four buffers were tested. In addition, 2 different wash and lysis buffers were tested.

3. Influence of capture incubation time. 4. Influence of addition of mucus dissolvers (DTT, hyaluronidase, N-acetyl-cysteine) and agarose dissolver (Nal).

Materials and methods

Bacterial strain As test microorganisms Salmonella D, Neisseria gonorrhoeae and Chlamydia trachomatis LGV-2 were used. The strains were obtained from the Diagnostic

Centre SSDZ, Delft, The Netherlands.

Clq coating of magnetic beads This was performed exactly as described in example I. Antigen capture For each assay, 10 μl Clq coated beads was transferred to a 1.5-ml tube. Thereafter, bacterial suspension in 500 μl of capture buffer was added. The following capture buffers were used 1. PBSA (0.008 M PBS (pH 7.3) containing 0.1 % BSA), 2. TA (0.05 M Tris-HCl (pH 7.3) containing 0.1 % BSA) 3. TC (0.05 M Tris-HCl (pH 7.3) containing 0.1 % casein), 4. TEA (0.05 M Tris-HCl (pH 8.0) containing 0.01 M EDTA and 0.1 % BSA). To analyze the effect of addition of mucus or agarose dissolvers, 1-25 mM dithiotreitol (DTT), respectively 15 mM N-Acetyl-L-cysteine (NALC), 0.125% hyaluronidase, 0.6 M or 6 M Sodium Iodide (Nal) was added to TEA buffer. The suspension was incubated for 1.5 h at room temperature with gentle rotation. The beads were pelleted by placing the tube in a powerful magnetic field of a magnetic particle concentrator (Dynal MPC-6). The capture buffer with not-captured bacteria was transfer¬ red to a new 1.5-ml tube. After centrifugation at 12,000 x g, the pellet was washed twice with PBS. The beads with captured bacteria were washed four times by addition of 500 μl PBS or 0.05 M Tris-HCl (pH 7.3), followed by resuspension, pelletation with the magnetic particle concentrator and removal of the supernatant. To the final pellet of not- captured bacteria and the beads with captured bacteria, 50 μl of lysis buffer (50 μg proteinase K per ml PBS or 0.05 M Tris-HCl (pH 7.3), 0.75% Triton X-100) was added. The samples were incubated for 60 min. at 37 °C, and the proteinase K was inactivated by a 15-min. incubation at 100°C. The samples were cooled to room temperature for 5 min. in air and 10 μl was used for PCR.

PCR amplification PCR was used for the amplification with general primers (5' 16S primer : 5' ATATTGGATCCGAGAGTTTGATCCTGGCTCAG 3'; 3' 16S primer : 5' AAAGGATCCTGCAGACCTTGTTACGACTTCACCCCA 3') obtained from the 16S ribosomal region of bacterial DNA (Giesendorf et al. 1992), respectively C. trachomatis specific primers as descripted in example 1 and Neisseria gonorrhoeae specific primers (primer 1 : 5' CGCTACCAAGCAATCAAGTTGCCC 3' (SEQ ID NO 1); primer 2 : 5' GACGGCAGCACAGGGAAGCTTGCTTCTCGGG 3' (SEQ ID NO 2). The reaction was performed in a volume of 100 μl containing 10 mM Tris-HCl (pH 9.0), 50 mM KC1, 2.5 mM MgCl₂, 0.01 % gelatin, 200 μM (each) deoxynucleoside triphosphates, 50 pmol of both primers, and 0.25 U SuperTaq DNA polymerase (Sphaero Q, Leiden, The Netherlands). Ten microliters of sample was used. The reaction mixture was overlayed with 3 drops of mineral oil (Sigma M-3516) and subjected to 40 cycles of amplification in a thermocycler (Bio-med, Theres, Germany). Each cycle consisted of a 1-min DNA denaturation step at 94°C, a 2-min primer annealing step at 42°C, and a 3-min extension step at 74°C. Water was used as negative control for the PCR.

Analysis of amplified samples PCR products were separated on a 2% agarose gel and stained with ethidiumbromide.

Results 1. Using serial dilutions of Clq good results were obtained using a coating concentra¬ tion of at least 40 μg Clq/mg beads (see fig. 1). 2. Optimal buffer system.

Optimal capture of Salmonella was obtained using 0.05 M Tris-HCl, pH=8.0, containing 0.01 M EDTA and 0.1 % BSA (TEA) (see fig. 2). Using this buffer the same capturing efficacy was obtained for Clq capture PCR of Chlamydia trachomatis as with the buffer mentioned in example I (data not shown). The effect of Tris-HCl or PBS as washing or lysis buffer is shown in fig. 3. The use of Tris-HCl in washing and lysis buffer showed a deleterious effect on the Clq capmre PCR result.

3. Influence of capture incubation time. Several capmre incubation times (30, 60, 90 and 120 minutes) were tested. The optimal capmre incubation time was found to be between 30 and 90 minutes (see fig. 4).

4. Influence of mucus dissolvers and agarose dissolver on capture PCR efficacy.

The effect of addition of DTT and hyaluronidase to the capture buffer is also shown in fig. 4. DTT has no significant effect on the efficacy of Clq capture PCR of N. gonorrhoeae whilst hyaluronidase showed a deleterious effect. The effect of addition of N-acetyl-cysteine and Nal to the capture buffer is shown in fig. 5. N- acetyl-cysteine does not effect the efficacy of capmre. Addition of Nal showed a deleterious effect on the capture PCR efficacy. It should be noted that the effect of additives to the capture buffer may be dependent on the type of microorganism to be captured. For example, in the case of Chlamydia trachomatis capturing, as compared to N. gonorrhoeae, the addition of DTT to the capmre buffer showed a clear beneficial effect on the capturing efficacy, while the effect of hyaluronidase was less detrimental than for Neisseria gonorrhoeae (results not shown).

Conclusions

Good results were obtained using coating concentration of Clq to tosyl activated Dyna beads of at least 40 μg Clq/mg beads. - The optimal capmre buffers are:

1. 0.05 M Tris-HCl, pH 8.0, containing 10 mM EDTA and 0.1 % BSA (TEA)

2. TEA + 25 mM DTT

3. 0.1 M Tris H.C1 (pH 8.0) containing 20 mM EDTA, 20 mM DTT and 0.5% Triton X-100 - Optimal capturing incubation time is in the range of 30 to 90 minutes.

Tris-HCl in washing and lysis buffer has a deleterious effect on Clq capmre PCR. PBS should be used. Addition of N-acetyl cysteine has no significant effect on the efficacy of Clq capmre PCR.

Addition of DTT may have a beneficial effect on the efficacy of the Clq capmre PCR. - Addition of hyaluronidase or Nal has a deleterious effect on the efficacy of Clq capmre PCR.

An essential point of the capmre procedure is the capmre of intact microbial cells, containing the microbial genome. Therefore, the capture buffer should be free of certain detergents like desoxycholate, which lead to permeabillisation of the cell membrane (results not shown).

EXAMPLE III: Application of the ClQ-capture method on a wide variety of bacteria Introduction

In order to assess the general applicability of the CIQ capture system as described in examples I and II, the system was tested on a variety of gram-negative and gram-positive bacteria. As an example from both groups the following microorganisms were taken: Salmonella D, Neisseria gonorrhoeae, Staphylococcus aureus, Staphylococcus epidermi- dis, Streptococcus faecalis, Escherichia coli, Pseudomonas aeruginosa, Enterobacter cloacae, Citrobacter diversus, Haemophilus influenzae, Klebsiella pneumoniae, Strepto¬ coccus pneumoniae.

Detection of the presence of microbial DNA after capmre was performed by PCR using universal primers obtained from the 16S and 23S ribosomal RNA genes.

Materials and Methods

Bacterial strains. All bacterial strains were obtained from the Diagnostic Centre SSDZ, Delft, The Netherlands, and the State Institute for Quality Control of Agricultural Products (RIKILT-DLO), Wageningen, The Netherlands. Clq coating of paramagnetic beads / cell capture / DNA isolation. This was performed exactly as described in example I. PCR performance. PCR was used for the amplification of microbial DNA present in the capmred sample. Use was made of the delta/omega universal primers derived from the 16S and 23S ribosomal RNA genes as described by Rossau et al. (WO 91/16454). The reaction was performed in a volume of 100 μl containing 10 mM Tris-HCl [pH8.3], 50 mM KC1, 1.5 mM MgC12, 0.01 % gelatin, 200 μM (each) deoxynucleoside triphosp- hates, 100 pmol of both primers, and 0.25 U SuperTaq DNA polymerase (Sphaera Q, Leiden, the Netherlands). Ten microliters of sample was used. The reaction mixture was overlayed with 3 drops of mineral oil (Sigma M-3516) and subjected to 30 cycles of amplification in a thermocycler (Bio-med, Theres, Germany). Each cycle consisted of a 1-min DNA denaturation step at 95 °C, a 1-min primer annealing step at 50 °C, and a 1-min extension step at 72 °C. The final extension was performed 10 min. at 72 °C.

Water was used as negative control for the PCR.

Analysis of amplified samples. PCR products were separated on a 2% agarose gel and stained with ethidium bromide.

Results and conclusion:

The results of PCR amplification with primer set delta/omega after Clq capmre for the different microorganisms are shown in figure 6.

From the results it can be concluded that all tested microorganisms, belonging to both gram-negative and gram-positive genera, are successfully capmred by Clq and can subsequently be detected by PCR. Therefore, the newly described technique seems to be applicable on a wide variety of microorganisms.

Example IV: Sensitivity of Clq capture PCR for detection of Campylobacter jejuni in the presence of excess E. coli.

Introduction Faecal samples contain large amounts of enterobacteria like E. coli. These bacteria can also bind Clq coated solid phases possibly leading to a diminished binding, due to competition, of the bacteria to be detected.

To evaluate the influence of the presence of other bacteria on the sensitivity of detection of Campylobacter jejuni by capmre PCR, a fixed amount of C. jejuni cells (1 ,5 x 10⁵) was mixed with a dilution series of E. coli and processed for Clq capmre PCR.

Materials and methods

Bacterial strains The Campylobacter jejuni strain was obtained from the State Instimte for Quality Control of Agricultural Products (RIKILT-DLO), Wageningen, The Netherlands. Clq coating of magnetic beads/antigen capture/DNA isolation/PCR/amplimer analysis were performed exactly as described in example I.

Results

Addition of increasing amounts of E. coli cells to a fixed amount of C. jejuni cells results in a decreasing signal obtained in the Clq capmre PCR. However, using Clq capmre PCR C. jejuni could still be detected at a ratio of C. jejuni : E. coli of 1 : 1000 (see fig. 7).

Conclusion Even if other bacteria are present in a large excess, C. jejuni can still be detected using

Clq capmre PCR. Example V: HCV virion capture onto paramagnetic beads coated with Clq

Introduction. In general, HCV viremia is determined by detection of the viral RNA genome isolated from serum of plasma by the proteinase K or guanidiniumthiocyanate method. By these methods circulating virus particles as well as free HCV RNA are detected. The detected HCV RNA by RT-PCR does not really reflect infectivity of a sample. Therefore, an assay was developed that captures the infectious particles in serum.

Materials and Methods. Paramagnetic particles (Dynabeads M-280, Dynal, Oslo, Norway) were coated with Clq as described by Herbrink et al. (J. Clin. Microbiol. 1995; 33:283-286). After capturing of virus particles at 37 °C for 2h, the beads were incubated with a proteinase K solution at 55 °C for 30min. Subsequently, proteinase K was inactivated and the released HCV RNA was detected by standard 5'UTR RT-PCR. Before cDNA synthesis, synthetic HCV RNA was added as an internal control, resulting in an amplicon of slightly larger size (346bp) due to an inserted sequence.

Serum from one chronically infected chimpanzee, one acute infected patient and three chronically infected patients were analysed in this study.

Results. The four serum samples from the acute and chronically infected patients and the chimpanzee serum were HCV RNA positive using the guanidiniumthiocyanate isolation method and standard 5'UTR RT-PCR (with internal assay control) (results not shown). Using Clq coated beads for virus isolation, the HCV RNA amplicon of 296bp was detected in the acute infected patient whereas HCV RNA was hardly or not detectable in three chronically infected patients and the chimpanzee (Figure 8). In the three chronic samples only the internal assay control amplification of 346bp can be seen. By using beads coated with BSA or antibodies directed to the E2 antigen of HCV no amplicons of 296bp were detected after capturing. In another experiment it was not possible to detect synthetic HCV RNA by capturing (data not shown). These results indicated that Clq coated beads were not able to capmre free circulating HCV RNA in serum.

Conclusion. HCV particles (=virions) were specifically detected in serum by application of Clq coated beads. Literature

Barany F. (1991). Genetic disease detection and DNA amplification using cloned thermostable ligase. Proc. Natl. Acad. Sci. USA: 189-193.

Betz, S.J., Isliker, H. 1981. Antibody independent interactions between E, coli J5 and human complement components. J. Immunol. 127: 1748-1754.

Claas, H.C., Melchers, .J., de Bruijn, I.H., de Graaf, M., van Dijk, W.C.,

Lindeman, J., Quint, W.G. 1990. Detection of Chlamydia trachomatis in clinical specimens by the polymerase chain reaction. Eur. J. Clin. Microbiol. Inf. Dis. 9, 864-

868. Claas, H.C., Wagenvoort, J.H.T., Niesters, H.G.M., Tio, T.T., van Rijsoort-Vos,

J.H., Quint, W.G. 1991. Diagnostic value of the polymerase chain reaction for

Chlamydia detection as determined by follow-up study. J. Clin. Microbiol. 29, 42-45.

Clas, F., Loos, M. 1981. Antibody independent binding of the first component of complement (Cl) and its subcomponent Clq to the S and R forms of Salmonella minnesota, Infect. Immun. 31 : 1138-1144.

Clas, F., Golecki, J.R. and Loos, M. 1984. Electron microscopic study showing antibody independent binding of Clq, a subcomponent of the first component of complement, to serum-sensitive Salmonellae. Infect, and Immun. 45: 795- 797.

Clas, F., Schmidt, G., Loos, M. 1985. The role of the classical pathway for the bactericidal effect of normal sera against gram negative bacteria. Curr. Top. Microbiol.

Immunol. 121 : 19-72.

Compton J (1991). Nucleic acid sequence-based amplification. Nature, 350: 91-92.

Duck P (1990). Probe amplifier system based on chimeric cycling oligonucleotides.

Biotechniques 9, 142-147. Gerritsen, M.J., Olyhoek, T., Smits, M.A., Bokhout, B.A. 1991. Sample preparation method for polymerase chain reaction-based semiquantitative detection of Leptospira interrogans serovar hardjo subtype hardjobovis in bovine urine. J. Clin. Microbiol. 29:

2805-2808.

Giesendorf et al. 1992. Rapid and sensitive detection of Campylobacter species in chicken products using PCR. Appl. Environm. Microbiol. 58, 3804-3808.

Grimprel, E., Sanchez, P.J., Wendel, G.D., Burstain, J.M., McCracken, G.H.,

Radolf, J.D., Norgard, M.V. 1991. Use of polymerase chain reaction and rabbit infectivity testing to detect Treponema pallidum in amnionic fluid, fetal and neonatal sera, and cerebrospinal fluid. J.Clin. Microbiol. 29: 1711-1718.

Guatelli J, Whitfield K, Kwoh D, Barringer K, Richman D, Gengeras T (1990)

Isothermal, in vitro amplification of nucleic acids by a multienzyme reaction modeled after retroviral replication. Proc Natl Acad Sci USA 87: 1874-1878.

Hall, R.T., Strugnell, T., Wu, X., Devine, D.V., Stiver, H.G. 1993. Characterization of kinetics and target proteins for binding of human complement component C3 to the surface-exposed outer membrane of Chlamydia trachomatis serovar L2. Infection and

Immunity 61 : 1829-1834. Han, J.E., Hammer, M.L., Falkow, S., Quinn, T.C. 1986. Detection of Chlamydia trachomatis in tissue culture and cervical scrapes by in situ DNA hybridisation. J.In- fect.Dis. 153: 1155-1159.

Hedrun A., Lundeberg, J., Pahlson, C, Uhler, M. 1992. Immunomagnetic recovery of

Chlamydia trachomatis from urine with subsequent colorimetric DNA detection. PCR methods and applications. 2: 167-171.

Kluytmans, J.A.J.W., Goessens, W.H.F., Mouton, J.W., van Rijsoort-Vos, J.H.,

Niesters, H.G.M., Quint, W.G.V., Habbema, L., Stolz, E., Wagenvoort, J.H.T.

1993. Evaluation of clearview and magic lite tests, polymerase chain reaction and cell culmre for detection of Chlamydia trachomatis in urogenital specimen. J.Clin. Microbiol. 31:, 3204-3210.

Kwoh D, Davis G, Whitfield K, Chappelle H, Dimichele L, Gingeras T (1989).

Transcription-based amplification system and detection of amplified human immunodeficiency virus type 1 with a bead-based sandwich hybridization format. Proc

Natl Acad Sci USA, 86: 1173-1177. Kwok, S., Higuchi, R. 1989. Avoiding false positives with PCR. Nature 339, 237-238.

Landgren U, Kaiser R, Sanders J, Hood L (1988). A ligase-mediated gene detection technique. Science 241 : 1077-1080.

Liang, T.J., Isselbacher, K.J., Wands, J.R. 1989. Rapid identification of low level hepatitis B-related viral genome in serum. J. Clin. Invest. 84, 1367-1371. Lizardi P, Guerra C, Lomeli H, Tussie-Luna I, Kramer F (1988). Exponential amplification of recombinant RNA hybridization probes. Bio/Technology 6: 1197-1202.

Lomeli H, Tyagi S, Printchard C, Lisardi P, Kramer F (1989). Quantitative assays based on the use of replicatable hybridization probes. Clin Chem 35: 1826-1831. Loos, M., Wellek, B., Thesen, R., Opferkuch, W. 1978. Antibody independent interaction of the first component of complement with gram-negative bacteria. Infect. Immun. 22: 5-9. Loos, M. and Clas, F. 1987. Antibody-independent killing of gram-negative bacteria via the classical pathway of complement. Immunology Letters 14: 203-208. Meddens, M.J., Quint, W.G.V., van der Willigen, H., Wagenvoort, J.T., van Dijk, W.C., Lindeman, J., Herbrink, P. 1988. Detection of Chlamydia trachomatis in culmre and urogenital smears by in situ DNA hybridization using biotinylated DNA probe. Molecular and cellular probes 2: 261-268.

Megran, D.W., Stiver, H.G., Bowie, W.R. 1985. Complement activation and stimulation of chemotaxis by Chlamydia trachomatis. Infect.Immun. 49: 670-673. Melchers. W.J.G., Schift, R., Stolz, E., Lindeman, J., Quint, W.G.V. 1989. Human papillomavirus detection in urine samples from male patients by the polymerase chain reaction. J. Clin.Microbiol. 27, 1711-1714.

Niesters, HGM, Quint, WGV and Herbrink, P. 1991. Antigen capmre directed polymerase chain reaction for detection of Chlamydia trachomatis. In: Techniques in Diagnostic Pathology, vol. 2, ELISA techniques- new developments and practical applications in a broad field, pg 157-169. Eds. Bullock, GR, v.Velzen, D. , Warhol, MJ and Herbrink, P, Acad. Press.

Saiki, R., Scharf, S., Falcona, F., Mullis, K.B., Horn, G.T., Erlich, N.A., Arnheim, N. 1985. Enzymatic amplification of beta-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anaemia. Science 230: 1350-1354. Saiki R, Gelfand D, Stoffel S, Scharf S, Higuchi R, Horn G, Mullis K, Erlich H (1988). Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 239 : 487-491.

Stamm, W.E., Tarn, M.R., Koester, M., Cles, R. 1983. Detection of Chlamydia trachomatis inclusions in McCoy cell cultures with fluorescein conjugated monoclonal antibodies. J. Clin.Microbiol. 17: 666-668. Taylor-Robinson, D., Thomas, B.D., Osborn, M.F. 1987. Evaluation of enzyme immunoassay ( Chlamydiazyme ) for detecting Chlamydia trachomatis in genital tract specimens. J.Clin. Pathol. 40: 194-199. Tenner, A.J., Lesavre, P.H., Cooper, N.R. 1981. Purification and radiolabeling of human Clq. J. Immunol. 127: 648-653.

Tenner, A.J., Ziccardi, R.J., Cooper, N.R. 1984. Antibody independent Cl activation by E. coli. J.Immunol. 133, 886-891. Thewessen, E.A.P.M., Freundt, I., van Rijsoort-Vos, J.H., Stolz, E., Michel, M.F. and Wagenvoort, J.H.T. 1989. Comparison of HeLa 229 and McCoy cell culmre for detection of Chlamydia trachomatis in clinical specimens. J.Clin. Microbiol. 27: 1339-

1400.

Tjiam, K.H., van Eijk, R.V.M., van Heist, B.Y.M., Stolz, E. 1986. Evaluation of the direct fluorescent antibody test for diagnosis of chlamydia infections. Eur.J.Clin. Microbi- ol.Inf.Dis. 4: 548-552.

Walker G, Little M, Nadeau J, Shank D (1992). Isothermal in vitro amplification of

DNA by a restriction enzyme/DNA polymerase system. Proc Natl Acad Sci USA 89:392-

396. Widjojoatmodjo, M.N., Fluit, A.C., Torensma, R., Verdonk, G.P.H.T., Verhoef, J.

1992. The magnetic immuno polymerase chain reaction assay for direct detection of

Salmonella in fecal samples. J.Clin. Microbiol. 30: 3195-3199.

Wilde, J., Eiden, J., Yolken, R. 1990. Removal of inhibitory substances from human fecal specimens for detection of group A rotaviruses by reverse transcriptase and polymerase chain reaction. J.Clin. Microbiol. 28: 1300-1307.

Wu D, Wallace B (1989). The ligation amplification reaction (LAR) - amplification of specific DNA sequences using sequential rounds of template-dependent ligation. Genomics

4: 560-569. Barany F (1991). Genetic disease detection and DNA amplification using cloned thermostable ligase. Proc Natl Acad Sci USA 88: 189-193. Zeldis, J.B., Lee, J.H., Mamish, D., Finegols, D.J., Sircar, R., Ling, Q., Knudsen,

P.J., Kuramoto, I.K., Mimms, L.T. 1989. Direct method for detecting small quantities of hepatitis B virus DNA in serum and plasma using the polymerase chain reaction.

J.Clin.Invest. 84, 1503-1508. SEQUENCE LISTING

(1) GENERAL INFORMATION:

(i) APPLICANT:

(A) NAME: Innogenetics N.V.

(B) STREET: Industriepark Zwijnaarde 7 Bus 4

(C) CITY: Gent

(E) COUNTRY: Belgium (F) POSTAL CODE (ZIP): 9052

(G) TELEPHONE: 00-32-09.241.07.11 (H) TELEFAX: 00-32-09.241.07.99

(A) NAME: Delft Diagnostic Laboratory B.V. (B) STREET: Reinier de Graafweg 7

(C) CITY: Delft

(E) COUNTRY: The Netherlands

(F) POSTAL CODE (ZIP): 2625 AD

(G) TELEPHONE: 00 31 15 60 45 81 (H) TELEFAX: 00 31 15 60 45 50

(ii) TITLE OF INVENTION: Capmring of micro-organisms using complement components.

(iii) NUMBER OF SEQUENCES: 2

(iv) COMPUTER READABLE FORM:

(A) MEDIUM TYPE: Floppy disk

(B) COMPUTER: IBM PC compatible (C) OPERATING SYSTEM: PC-DOS/MS-DOS

(D) SOFTWARE: Patentln Release #1.0, Version #1.25 (EPO) (2) INFORMATION FOR SEQ ID NO: 1 :

(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 24 base pairs (B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO

(iii) ANTI-SENSE: NO

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 1 : CGCTACCAAG CAATCAAGTT GCCC 24

(2) INFORMATION FOR SEQ ID NO: 2:

(i) SEQUENCE CHARACTERISTICS. (A) LENGTH: 31 base pairs (B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO

(iii) ANTI-SENSE: NO

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 2: GACGGCAGCA CAGGGAAGCT TGCTTCTCGG G 31

Claims

1. Complement components or fragments thereof for use in a method for capmring microorganisms from a sample, with said complement components being preferably bound to a solid phase.

2. Complement components or fragments thereof for use in a method for capmring microorganisms in a sample, wherein said complement components are Cl, or CIQ, or C3b.

3. Method for capmring microorganisms in a sample, comprising the use of complement components preferably bound to a solid phase.

4. Method for detecting microorganisms in a sample, comprising the steps of - capmring the microorganisms from the sample, using complement components preferably bound to a solid phase, and - detecting the microorganisms captured.

5. Method for detecting microorganisms in a sample as defined in claim 4, wherein the the detection method comprises a polymerase chain reaction (PCR).

6. Method according to any of claims 3 to 5, wherein said microorganisms belong to a broad panel of different microorganisms, such as those belonging to the group of viruses and/or to eucaryotic microorganisms and/or to gram-negative and/or to gram-positive genera of bacteria, and more specifically belonging to at least one of the following gene¬ ra: Chlamydia, Campylobacter, Escherichia, Salmonella, Shigella, Enterococcus, Neisseri- a, Klebsiella, Pseudomonas, Mycoplasma, Streptococcus, Staphylococcus, Mycobacterium, Moraxella, Bordetella, Haemophilus, Branhamella, Legionella, Clostridium, Vibrio, Yersinia, Listeria, Cryptococcus, Herpes simplex virus, Human Papilloma virus, Human immunodeficiency virus, Hepatitis virus, Candida, Treponema, Trichomonas.

7. Method according to any of claims 3 to 5, wherein said sample is a clinical sample, such as faeces, sputum, broncheoalveolar lavage, cervical secretion, urine, and possibly blood, cerebrospinal fluid, serum or tears, or a food sample, or a fermentation broth sample, or a water or soil sample.

8. Method according to any of claims 3 to 5 wherein said solid phase consists of paramagnetic beads.

9. Complement components or fragments thereof, said complement components being preferably Cl , CIQ or C3b, and said complement components being preferably bound to a solid phase, for use in the preparation of a diagnostic agent, device or kit for use in a method of any of claims 3 to 8.

10. Capturing buffer enabling efficient capmring of microorganisms in a method as defined in any of claims 3 to 8, said buffer being free from membrane permeabilizing agents, like desoxycholate.

11. Capmring buffer according to claim 10, preferably comprising the following components:

0.05 M Tris-HCl (pH 8.0) containing 0.01 M EDTA and 0.1 % BSA or,

0J M Tris-HCl (pH 8.0), 20 mM EDTA, 20 mM DTT, 0.5 % Triton X-100.

12. Kit for capmring microorganisms from a sample, said kit comprising the following elements:

- if necessary, a means for pretreatment of the sample possibly containing the micro¬ organisms;

- a complement component of fragment thereof according to any of claims 1 to 2; - a capturing buffer, or components necessary to make the buffer, according to claim 10 to 11;

- if necessary, a means for separating the captured microorganisms from the remainder of the sample.

13. Kit for capturing microorganisms from a sample according to claim 12, for use in the sample preparation of any type of microorganism detection assay.

14. Kit according to claim 13 wherein said microorganism detection assay comprises a polymerase chain reaction (PCR).

15. Method according to any of claims 3 to 5, wherein said sample is sputum or broncheoalveolar lavage, and wherein said microorganisms are at least one of the following species: Mycoplasma pneumoniae, Bordetella pertussis, Staphylococcus aureus, Streptococcus pneumoniae, Haemophilus influenzae, Mycobacterium sp., Pseudomonas aeruginosa, Branhamella catarrhalis, Legionella pneumophila, Streptococcus pyogenes, Rhinovirus, Corona virus, Influenza virus, Adeno virus, Parainfluenza type virus, Respiratory syncytial virus, or another pathogenic microorganism possibly causing respiratory tract infections.

16. Method according to any of claims 3 to 5, wherein said sample is a faecal sample, and wherein said micro-organisms are at least one of the following species: Salmonella sp. , Shigella sp. , Yersinia sp. , Campylobacter sp. , Clostridium difficile, Vibrio cholera or any other pathogenic microorganism possibly causing gastero-enteritic disorders.

17. Method according to any of claims 3 to 5, wherein said sample is urine or cervical secretion, and wherein said microorganisms are at least one of the following species: Chlamydia thrachomatis, Neisseria gonorrhoeae, Ureaplasma urealyticum, Mycoplasma genitalium, Mycoplasma hominis, Garderella vaginalis, Haemophilus ducreyi, Streptococcus agalactiae, Trichomonas vaginalis, Candida albicans, Veilonella parvula, Mobiluncus sp. , Peptostreptococcus sp., Treponema pallidum, Herpes simplex virus, Human papilloma virus, or any other pathogenic microorganism possibly causing urogenital disorders. 96/21

38

18. Method according to any of claims 3 to 5, wherein said sample is blood, serum or cerebrospinal fluid, and wherein said microorganisms are at least one of the following species: Neisseria meningitidis, Haemophilus influenzae, Streptococcus pneumoniae, Listeria monocytogenes, Mycobacterium sp., Streptococcus agalactiae, Cryptococcus neoformans, HIV, Hepatitis viruses, or any other pathogenic microorganism possibly present in the above-mentioned samples.

19. Method according to any of claims 3 to 5, wherein said sample is a food sample, and wherein said microorganisms are at least one of the following species: Escherichia coli, Salmonella sp. , Campylobacter sp. , Brucella sp. , Listeria sp. , Clostridium sp. , Staphylococcus sp. , Yersinia enterocolitica, or any other pathogenic microorganism possibly causing food intoxication.