EA040625B1 - METHODS OF TREATMENT OF POLYCYSTIC KIDNEY DISEASE - Google Patents

Description

Cross-reference to related applications

This application claims priority over U.S. Provisional Application No. 62/430164, filed December 5, 2016, which is hereby incorporated by reference in its entirety for all purposes.

Technical field

This document provides compositions and methods for the treatment of polycystic kidney disease.

Polycystic kidney disease is characterized by the accumulation of numerous fluid-filled cysts in the kidney. These cysts are lined with a single layer of epithelial cells called the cyst epithelium. Over time, cysts increase in size due to increased cell proliferation and active secretion of fluid by the cyst epithelium. Enlarged cysts compress the surrounding normal tissues, resulting in poor kidney function. The disease eventually progresses to end-stage renal disease requiring dialysis or kidney transplantation. At this stage, the cysts may be surrounded by areas of fibrosis containing atrophic tubules.

A number of genetic disorders can lead to polycystic kidney disease (PKD). The various forms of PKD differ in their mode of inheritance, such as autosomal dominant or autosomal recessive inheritance; organ involvement and manifestation of phenotypes outside the kidneys; age of onset of end-stage renal disease, such as at birth, childhood, or adulthood; and the underlying genetic mutation that is associated with the disease. See, for example, Kurschat et al., 2014, Nature Reviews Nephrology, 10: 687-699.

Brief description of the essence of the invention

Embodiment 1. A method of treating polycystic kidney disease comprising administering to a subject in need thereof a compound comprising a modified oligonucleotide consisting of 9 linked nucleosides, wherein the modified oligonucleotide has the following nucleoside structure in a 5' to 3' orientation:

NsNsNmN _f N _f N _f NmNsNs where the nucleosides followed by the M index are 2'-O-methylnucleosides, the nucleosides followed by the F index are 2'-fluoronucleosides, the nucleosides followed by the S index are are S-cEt nucleosides and all bonds are thiophosphate bonds; and where the nucleobase sequence of the modified oligonucleotide contains the 5'-CACUUU-3' nucleobase sequence, wherein each cytosine is independently selected from unmethylated cytosine and 5-methylcytosine; or their pharmaceutically acceptable salt.

Embodiment 2. The method of Embodiment 1, wherein the nucleotide sequence of the modified oligonucleotide comprises the nucleobase sequence 5'-GCACUUU-3', wherein each cytosine is independently selected from unmethylated cytosine and 5-methylcytosine.

Embodiment 3. The method of Embodiment 1 or 2, wherein the modified oligonucleotide's nucleobase sequence is 5'-AGCACUUUG-3', wherein each cytosine is independently selected from unmethylated cytosine and 5-methylcytosine.

Embodiment 4. The method of any one of Embodiments 1-3, wherein said compound consists of a modified oligonucleotide or a pharmaceutically acceptable salt thereof.

Embodiment 5. The method of any one of Embodiments 1-4 wherein the pharmaceutically acceptable salt is the sodium salt.

Embodiment 6. A method of treating polycystic kidney disease comprising administering to a subject in need thereof a modified oligonucleotide having the structure

- 1 040625

or a pharmaceutically acceptable salt thereof.

Embodiment 7. The method of Embodiment 6 wherein the modified oligonucleotide is a pharmaceutically acceptable salt of the indicated structure.

Embodiment 8. The method of Embodiment 7 wherein said modified oligonucleotide is the sodium salt of said structure.

Embodiment 9. A method of treating polycystic kidney disease comprising administering to a subject in need thereof a modified oligonucleotide having the structure

GI11

- 2 040625

Embodiment 10. A method of treating polycystic kidney disease comprising administering to a subject in need thereof a pharmaceutical composition comprising:

a) a compound containing a modified oligonucleotide consisting of 9 linked nucleosides, wherein the modified oligonucleotide has the following nucleoside structure in the 5' to 3' orientation:

NSNSNMNFNFNFNMNSNS where nucleosides followed by index M are 2'-O-methylnucleosides, nucleosides followed by index F are 2'-fluoronucleosides, nucleosides followed by index S are nucleosides S-cEt, and all bonds are thiophosphate bonds; and where the nucleotide sequence of the modified oligonucleotide contains the nucleobase sequence 5'-CACUUU-3', in which each cytosine is independently selected from unmethylated cytosine and 5-methylcytosine; or their pharmaceutically acceptable salt; and

b) a pharmaceutically acceptable diluent.

Embodiment 11. The method of Embodiment 10, wherein the nucleobase sequence of said modified oligonucleotide comprises the nucleobase sequence 5'-GCACUUU-3', wherein each cytosine is independently selected from unmethylated cytosine and 5-methylcytosine.

Embodiment 12. The method of Embodiment 10, wherein the nucleobase sequence of said modified oligonucleotide is 5'-AGCACUUUG-3', wherein each cytosine is independently selected from unmethylated cytosine and 5-methylcytosine.

Embodiment 13. The method of any one of Embodiments 10-12 wherein the compound consists of said modified oligonucleotide or a pharmaceutically acceptable salt thereof.

Embodiment 14. The method of any one of Embodiments 10-13 wherein the pharmaceutically acceptable salt is the sodium salt.

Embodiment 15. A method of treating polycystic kidney disease comprising administering to a subject in need thereof a pharmaceutical composition comprising:

a) a modified oligonucleotide having the structure

or a pharmaceutically acceptable salt thereof.

b) a pharmaceutically acceptable diluent.

Embodiment 16. A method of treating polycystic kidney disease comprising administering to a subject in need thereof a pharmaceutical composition comprising:

a) a modified oligonucleotide having the structure

- 3 040625

or a pharmaceutically acceptable salt thereof.

b) a pharmaceutically acceptable diluent.

Embodiment 17. A method of treating polycystic kidney disease comprising administering to a subject in need thereof a pharmaceutical composition comprising:

a) a modified oligonucleotide having the structure

b) a pharmaceutically acceptable diluent.

Embodiment 18 The method of any one of Embodiments 10-17 wherein the pharmaceutically acceptable diluent is a sterile aqueous solution.

Embodiment 19. The method of Embodiment 18 wherein the sterile aqueous solution is saline.

Embodiment 20. The method of any one of the preceding claims, wherein the subject has polycystic kidney disease.

Embodiment 21. The method of any one of the preceding claims, wherein the subject is suspected of having polycystic kidney disease.

Embodiment 22. The method of any one of the preceding claims, wherein the subject has been diagnosed with polycystic kidney disease prior to administration of said compound, modified oligonucleotide, or pharmaceutical composition.

Embodiment 23. The method of any one of the preceding claims, wherein prior to administration of said compound, modified oligonucleotide, or pharmaceutical composition, the subject is determined to have elevated levels of miR-17 in the kidney, urine, or blood.

Embodiment 24. The method of any one of the preceding claims, wherein the polycystic kidney disease is an autosomal recessive polycystic kidney disease.

Embodiment 25. The method of any one of Embodiments 1-23, wherein the polycystic kidney disease is autosomal dominant polycystic kidney disease.

Embodiment 26. The method of any one of the preceding claims, wherein the subject has a mutation selected from a mutation in the PKD1 gene or a mutation in the PKD2 gene.

Embodiment 27. The method of any one of the preceding claims, wherein the subject has increased total kidney volume.

Embodiment 28. The method of any one of the preceding claims, wherein the subject has hypertension.

Embodiment 29. The method of any one of the preceding claims, wherein the subject has impaired renal function.

Embodiment 30. The method of any one of the preceding claims, wherein the subject is in need of improved renal function.

Embodiment 31. The method of any one of the preceding claims, wherein said administration:

a) improves kidney function in the subject;

b) delays the deterioration of kidney function in the subject;

c) reduces the total volume of the kidneys in the subject;

d) slows down the increase in the total volume of the kidneys in the subject;

e) inhibits cyst growth in a subject;

f) slows down the increase in cyst growth in the subject;

g) reduces kidney pain in the subject;

h) slows down the worsening of kidney pain in the subject;

i) delays the onset of kidney pain in the subject;

j) reduces arterial hypertension in the subject;

k) slow down the exacerbation of hypertension in the subject;

l) delay the onset of hypertension in the subject;

m) reduces fibrosis in the subject's kidney;

n) slows down the increase in fibrosis in the kidney of the subject;

o) delays the onset of end-stage renal disease in a subject;

p) delays the time of initiation of dialysis for the subject;

q) delays the time of kidney transplantation for the subject; and/or

r) improves the lifespan of the subject.

Embodiment 32. A method according to any one of the preceding claims, wherein said administration:

a) reduces albuminuria in the subject;

b) slow the deterioration of albuminuria in the subject;

c) delay the onset of albuminuria in the subject;

d) reduce hematuria in the subject;

e) slows down the increase in hematuria in the subject;

f) delays the onset of hematuria in the subject;

g) reduces the level of urea nitrogen in the blood of the subject;

h) lowers the serum creatinine level in the subject;

i) improves creatinine clearance in a subject;

j) lowers the albumin:creatinine ratio in the subject;

k) improves the glomerular filtration rate in the subject;

l) slows down the rate of decline in glomerular filtration rate in a subject;

m) reduces the amount of lipocalin protein associated with neutrophil gelatinase (NGAL Neutrophil gelatinase-associated lipocalin) in the urine of the subject; and/or

n) reduces the level of kidney damage molecule 1 protein (KIM-1 - Kidney Injury Molecule-1) in the urine

- 5 040625 subject.

Implementation 33. The method according to one of the previous paragraphs, including:

a) measuring the total volume of the kidneys in the subject;

b) measuring the subject's hypertension;

c) measuring kidney pain in the subject;

d) measuring fibrosis in the subject's kidney;

e) measuring the level of urea nitrogen in the blood of the subject;

f) measuring the serum creatinine level of the subject;

g) measuring the creatinine clearance of the subject;

h) measuring albuminuria in the subject;

i) measuring the creatinine/albumin ratio of the subject;

j) measuring the glomerular filtration rate of the subject;

k) a decrease in the amount of neutrophil gelatinase-associated lipocalin (NGAL) protein in the subject's urine; and/or

l) reducing the level of kidney injury molecule 1 (KIM-1) protein in the subject's urine.

Embodiment 34. The method of any one of the preceding claims, wherein said administration reduces the total volume of the kidneys in the subject.

Embodiment 35. The method of any one of the preceding claims, wherein said administration slows the rate of increase in total kidney volume in the subject.

Embodiment 36. The method of any one of embodiments 27, 31, 33, 34, or 35, wherein the total kidney volume is growth-normalized total kidney volume.

Embodiment 37. The method of any one of the preceding claims, wherein said administration slows down the rate of decline in the glomerular filtration rate in the subject.

Embodiment 38. The method of any one of embodiments 32, 33, or 37, wherein the glomerular filtration rate is an estimated glomerular filtration rate.

Embodiment 39. The method of Embodiment 31 wherein the cyst is present in one or more kidneys in the subject.

Embodiment 40. The method of claim 31 wherein the cyst is present in the subject's liver.

Embodiment 41. The method of any one of the preceding claims, comprising administering at least one additional therapy, wherein the at least one additional therapy is an antihypertensive agent.

Embodiment 42. The method of any one of the preceding claims, comprising at least one additional therapy selected from an angiotensin II converting enzyme (ACE) inhibitor, an angiotensin II receptor blocker (ARB), a diuretic, a calcium channel blocker, a kinase inhibitor, an adrenergic antagonist receptor, vasodilator, benzodiazepine, renin inhibitor, aldosterone receptor antagonist, endothelin receptor blocker, mammalian rapamycin (mTOR) inhibitor, hormone analogue, vasopressin 2 receptor antagonist, aldosterone receptor antagonist, dialysis and kidney transplant.

Embodiment 43. The method of Embodiment 42 wherein the angiotensin II converting enzyme (ACE) inhibitor is selected from captopril, enalapril, lisinopril, benazepril, quinapril, fosinopril and ramipril.

Embodiment 44. The method of claim 42, wherein the angiotensin II receptor blocker (ARB) is selected from candesartan, irbesartan, olmesartan, losartan, valsartan, telmisartan, and eprosartan.

Embodiment 45. The method of Embodiment 42 wherein the vasopressin receptor 2 antagonist is tolvaptan.

Embodiment 46. The method of Embodiment 42 wherein the aldosterone receptor antagonist is spironolactone.

Embodiment 47. The method of Embodiment 42 wherein the kinase inhibitor is selected from bosutinib and KD019.

Embodiment 48. The method of Embodiment 42 wherein the mTOR inhibitor is selected from everolimus, rapamycin, and sirolimus.

Embodiment 49. The method of Embodiment 42 wherein the hormone analog is selected from somatostatin and adrenocorticotrophic hormone.

Embodiment 50. The method of any one of the preceding claims, comprising administering a therapeutically effective amount of a compound.

Embodiment 51. A method of treating polycystic kidney disease, comprising:

a) selecting a subject diagnosed with polycystic kidney disease using clinical, histopathological and/or genetic criteria;

b) administering to the subject a compound comprising a modified oligonucleotide consisting of 9 linked nucleosides, wherein said modified oligonucleotide has the following nucleoside structure in the 5' to 3' orientation:

NSNSNMNFNFNFNMNSNS,

- 6 040625 where the nucleosides followed by the index M are 2'-O-methylnucleosides, the nucleosides followed by the index F are 2'-fluoronucleosides, the nucleosides followed by the index S are the nucleosides S-cEt , and all bonds are thiophosphate bonds; and where the nucleobase sequence of the modified oligonucleotide contains the nucleobase sequence 5'-CACUUU-3', wherein each C is independently selected from unmethylated cytosine and 5-methylcytosine; or their pharmaceutically acceptable salt;

wherein the subject experiences an improvement in one or more polycystic kidney disease markers selected from:

i) total kidney volume;

ii) hypertension;

iii) glomerular filtration rate;

iv) pain in the kidneys.

Embodiment 52. A method of treating polycystic kidney disease, comprising:

a) selecting a subject diagnosed with polycystic kidney disease using clinical, histopathological and/or genetic criteria; where the subject has:

i) increase in kidney volume;

ii) hypertension;

iii) impaired glomerular filtration rate; and/or iv) kidney pain.

b) administering to the subject a compound comprising a modified oligonucleotide consisting of 9 linked nucleosides, wherein said modified oligonucleotide has the following nucleoside structure in the 5' to 3' orientation:

NsNsNmNfNfNfNmNsNs where the nucleosides followed by the M index are 2'-O-methylnucleosides, the nucleosides followed by the F index are 2'-fluoronucleosides, the nucleosides followed by the S index are S-cEt nucleosides, and all bonds are thiophosphate bonds; and where the nucleobase sequence of the modified oligonucleotide contains the nucleobase sequence 5'-CACUUU-3', wherein each C is independently selected from unmethylated cytosine and 5-methylcytosine; or their pharmaceutically acceptable salt;

c) wherein the subject improves upon administration of said compound of one or more polycystic kidney disease markers selected from:

i) total kidney volume;

ii) hypertension;

iii) glomerular filtration rate;

iv) pain in the kidneys.

Embodiment 53. The method of Embodiment 51 or 52, wherein the nucleotide sequence of the modified oligonucleotide comprises the nucleobase sequence 5'-GCACUUU-3', wherein each C is independently selected from unmethylated cytosine and 5-methylcytosine.

Embodiment 54. The method of Embodiment 51 or 52, wherein the modified oligonucleotide's nucleobase sequence is 5'-AGCACUUUG-3', wherein each C is independently selected from unmethylated cytosine and 5-methylcytosine.

Embodiment 55. The method of any one of Embodiments 51-54 wherein the compound consists of a modified oligonucleotide or a pharmaceutically acceptable salt thereof.

Embodiment 56. The method of any one of Embodiments 51-55 wherein the pharmaceutically acceptable salt is the sodium salt.

Embodiment 57. A method of treating polycystic kidney disease, comprising:

a) selecting a subject diagnosed with polycystic kidney disease using clinical, histopathological and/or genetic criteria;

b) administering to the subject a modified oligonucleotide having the structure

- 7 040625

or a pharmaceutically acceptable salt of said compound.

In this case, the subject, after administration of the compound, experiences an improvement in one or more markers of polycystic kidney disease, selected from:

i) total kidney volume;

ii) hypertension;

iii) glomerular filtration rate; and/or iv) kidney pain.

Embodiment 58. A method of treating polycystic kidney disease, comprising:

a) selecting a subject diagnosed with polycystic kidney disease using clinical, histopathological and/or genetic criteria; while the subject has

i) increase in kidney volume;

ii) hypertension;

iii) impaired glomerular filtration rate; and/or iv) renal pain; and

b) administering to the subject a modified oligonucleotide having the structure

- 8 040625

or a pharmaceutically acceptable salt of said compound.

In this case, the subject, after administration of the compound, experiences an improvement in one or more markers of polycystic kidney disease, selected from:

i) total kidney volume;

ii) hypertension;

iii) glomerular filtration rate; and/or iv) kidney pain.

Embodiment 59. A method of reducing deterioration of kidney function over time in a subject with polycystic kidney disease, comprising:

a) selecting a subject diagnosed with polycystic kidney disease using clinical, histopathological and/or genetic criteria;

b) administering to the subject a modified oligonucleotide having the structure

- 9 040625 or its pharmaceutically acceptable salt;

wherein the subject, following administration of the compound, experiences an improvement in one or more markers of kidney function selected from:

i) glomerular filtration rate;

ii) the level of urea nitrogen in the blood; and/or iii) serum creatinine level.

Embodiment 60. The method of any one of embodiments 57, 58, or 59, wherein the modified oligonucleotide is a pharmaceutically acceptable salt of the indicated structure.

Embodiment 61. The method of Embodiment 60 wherein the modified oligonucleotide is the sodium salt of said compound.

Embodiment 62. A method of treating polycystic kidney disease, comprising:

a) selecting a subject diagnosed with polycystic kidney disease using clinical, histopathological and/or genetic criteria;

b) administering to the subject a modified oligonucleotide having the structure

In this case, the subject, after administration of the compound, experiences an improvement in one or more markers of polycystic kidney disease, selected from:

i) total kidney volume;

ii) hypertension;

iii) glomerular filtration rate; and/or iv) kidney pain.

Embodiment 63. A method of treating polycystic kidney disease, comprising:

a) selecting a subject diagnosed with polycystic kidney disease using clinical, histopathological and/or genetic criteria; while the subject has:

i) increase in kidney volume;

ii) hypertension;

iii) impaired glomerular filtration rate; and/or iv) renal pain; and

b) administering to the subject a modified oligonucleotide having the structure

- 10 040625

In this case, the subject, after administration of the compound, experiences an improvement in one or more markers of polycystic kidney disease, selected from:

i) total kidney volume;

ii) hypertension;

iii) glomerular filtration rate; and/or iv) kidney pain.

Embodiment 64. A method of reducing the rate of deterioration of kidney function over time, comprising:

a) selecting a subject diagnosed with polycystic kidney disease using clinical, histopathological and/or genetic criteria;

b) administering to the subject a modified oligonucleotide having the structure

- 11 040625 wherein the subject, after administration of the compound, experiences an improvement in one or more markers of kidney function selected from:

i) glomerular filtration rate;

ii) the level of urea nitrogen in the blood; and/or iii) serum creatinine level.

Embodiment 65. The method of any of embodiments 51-64 wherein the polycystic kidney disease is polycystic kidney disease and is autosomal dominant polycystic kidney disease (ADPKD).

Embodiment 66. The method of any of embodiments 51-64, wherein the polycystic kidney disease is autosomal recessive polycystic kidney disease (ARKD).

Embodiment 67. The method of any one of Embodiments 1-64 wherein the polycystic kidney disease is nephronophthisis.

Embodiment 68. The method of any one of Embodiments 1-64, wherein the subject has Joubert syndrome and related disorders (JSRD), Meckel syndrome (MKS), or Bardet-Biedl syndrome (BBS).

Embodiment 69. The method of any one of Embodiments 1-68 wherein the subject is a human.

Embodiment 70. The method of any one of Embodiments 1-14, 18-56, or 65-69, wherein each cytosine is an unmethylated cytosine.

Embodiment 71 A compound comprising a modified oligonucleotide consisting of 9 linked nucleosides, wherein the modified oligonucleotide has the following nucleoside structure in the 5' to 3' orientation:

NsNsNmN _f N _f N _f NmNsNs where the nucleosides followed by the M index are 2'-O-methylnucleosides, the nucleosides followed by the F index are 2'-fluoronucleosides, the nucleosides followed by the S index are are S-cEt nucleosides and all bonds are thiophosphate bonds; and where the nucleobase sequence of the modified oligonucleotide contains the 5'-CACUUU-3' nucleobase sequence, wherein each cytosine is independently selected from unmethylated cytosine and 5-methylcytosine; or a pharmaceutically acceptable salt thereof for use in therapy.

Embodiment 72. The compound of Embodiment 71 wherein the therapy is the treatment of polycystic kidney disease.

Embodiment 73. The compound of Embodiment 72 wherein the polycystic kidney disease is autosomal dominant polycystic kidney disease (ADPKD).

Embodiment 74. The compound of Embodiment 72 wherein the polycystic kidney disease is autosomal recessive polycystic kidney disease (ARKD).

Embodiment 75. The compound of Embodiment 72 wherein the polycystic kidney disease is nephronophthisis (NF - NPHP - nephronophthisis).

Brief description of graphic materials

Fig. 1A-1B - (A) RG4326 activity in miR-17 luciferase assay. (B) RG4326 activity in luciferase assays of members of the miR-17 family;

fig. 2 - the value of a characteristic set of PD parameters in IMCD3 cells after treatment with RG4326 or control RG5124;

fig. 3A-3B miPSA (miRNA polysome shift assay) demonstrating miR-17 target interaction in (A) wild-type mouse kidney and (B) RG4326-treated mouse kidney;

fig. 4A-4C show the performance of RG4326 in PBP model Pkd2-KO. Effect of treatment on (A) kidney weight to body weight ratio, (B) blood urea nitrogen (BUN), and (C) cystic index;

fig. 5A-5C show the performance of the RG4326 in the Rsu PBP model. Effect of treatment on (A) kidney weight to body weight ratio, (B) blood urea nitrogen (BUN), and (C) cystic index.

Detailed Description of the Invention

Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as generally understood by those skilled in the art to which this invention pertains. Unless specifically defined, the nomenclature used in connection with the procedures and methods of analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein is well known and widely used in the art. In the event that there are multiple definitions in this document, those in this section shall prevail. Standard methods can be used for chemical synthesis, chemical analysis, pharmaceutical preparation, formulation and delivery and processing of subjects. Some such methods and procedures can be found, for example, in Carbohydrate Modifications in Antisense Research Edited by Sanghvi and Cook, American Chemical Society, Washington D.C., 1994; And

- 12 040625

Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa., 18th edition, 1990; which are incorporated into this application by reference for any purpose. Where applicable, all patents, patent applications, published applications and publications, GENBANK sequences, websites and other published materials mentioned in the text of the description of this document, unless otherwise indicated, are incorporated by reference in their entirety. If reference is made to a URL or other such identifier or address, it should be understood that such identifiers may change and specific information on the Internet may change, but equivalent information may be found using the Internet search function. A link to them indicates the availability and open dissemination of such information.

Before these compositions and methods are disclosed and described, it should be understood that the terminology used herein is for the sole purpose of describing particular embodiments of the invention and is not intended to be limiting. It should be noted that in the context of the description of the present invention and the appended claims of the present invention, singular nouns include plural nouns unless the context clearly indicates otherwise.

Definitions.

Polycystic kidney disease or PKD is a cystic kidney disease characterized by the accumulation of numerous fluid-filled cysts in the kidney. Multiple cysts form in at least one kidney, often leading to enlargement of the affected kidney(s) and progressive loss of kidney function.

A polycystic kidney disease marker means a medical parameter that is used to assess the severity of polycystic kidney disease, kidney function, and/or the response of a subject suffering from polycystic kidney disease to treatment. Non-limiting examples of markers for polycystic kidney disease include total kidney volume, hypertension, glomerular filtration rate, and kidney pain.

A kidney function marker means a medical parameter that is used to evaluate the kidney function of a subject. Non-limiting examples of markers of kidney function include glomerular filtration rate, blood urea nitrogen, and serum creatinine.

Autosomal dominant polycystic kidney disease, or ADPKD, is a polycystic kidney disease caused by one or more mutations in the PKD1 and/or PKD2 gene. 85% of ADPPD is caused by mutations in PKD1, which is located on chromosome 16, and most of the remaining cases of ADPPD are caused by mutations in PKD2, which is located on chromosome 4.

Autosomal recessive polycystic kidney disease, or ARPKD, is a polycystic kidney disease caused by one or more genetic mutations in the PKHD1 gene, which is located on chromosome 6. Up to 50% of newborns with ARPKD die from complications of intrauterine kidney disease, and about a third of those who survive develop terminal kidney disease. stage of renal failure (ESRD) within 10 years.

Nephronophthisis or NF means an autosomal recessive cystic kidney disease characterized by corticomedullary cysts, rupture of the tubular basement membrane, and tubulointerstitial nephropathy.

Total kidney volume or TVR is a measurement of the total volume of the kidneys, which can be determined by magnetic resonance imaging (MRI), computed tomography (CT) or ultrasound (ultrasound) imaging, as well as the volume calculated using a standard method, such as the ellipsoid volume formula ( for ultrasound) or quantitative stereology or edge tracking (for CT/MRI).

Height-adjusted total kidney volume (HtTKV-Height-adjusted total kidney volume) is a measure of total kidney volume per unit of height. Patients with a VRPP value >600 ml/m are predicted to develop stage 3 chronic renal failure within 8 years.

Kidney pain means clinically significant kidney pain requiring sick leave, pharmacological treatment (narcotics or painkillers of last resort), or invasive intervention.

Progression of hypertension means a change in blood pressure that requires the initiation or intensification of hypertension treatment.

Fibrosis means the formation or development of excess fibrous connective tissue in organs or tissues. In certain embodiments of the invention, fibrosis occurs as a restorative or reactive process. In certain embodiments of the invention, fibrosis occurs in response to damage or injury. The term fibrosis should be understood as the formation or development of excess fibrous connective tissue in an organ or tissue as a restorative or reactive process, as opposed to the formation of fibrous tissue as a normal constituent of an organ or tissue.

Hematuria means the presence of red blood cells in the urine.

Albuminuria means the presence of excess albumin in the urine and includes, without limitation,

- 13 040625 normal albuminuria, high/normal albuminuria, microalbuminuria and macroalbuminuria. Normally, the glomerular filtration permeability barrier, which consists of podocytes, glomerular basement membrane, and endothelial cells, prevents leakage of whey protein into the urine. Albuminuria may reflect damage to the glomerular filtration permeability barrier. Albuminuria can be calculated from a 24-hour urine sample, an overnight urine sample, or a single urine sample.

High/normal albuminuria means elevated albuminuria characterized by (i) excretion of 15 to < 30 mg of albumin in the urine in 24 hours and/or (ii) an albumin/creatinine ratio of 1.25 to < 2.5 mg/mmol (or from 10 to < 20 mg/g) in men or 1.75 to < 3.5 mg/mmol (or 15 to < 30 mg/g) in women.

Microalbuminuria means elevated albuminuria characterized by (i) excretion of 30 to 300 mg of albumin in the urine in 24 hours and/or (ii) an albumin/creatinine ratio of 2.5 to < 25 mg/mmol (or 20 to < 200 mg/mmol). d) in men or from 3.5 to < 35 mg / mmol (or from 30 to < 300 mg / g) in women.

Macroalbuminuria means increased albuminuria characterized by excretion of more than 300 mg of albumin in the urine in 24 hours and/or (ii) an albumin/creatinine ratio > 25 mg/mmol (or > 200 mg/g) in men or > 35 mg/mmol (or > 300 mg/g) in women.

The albumin/creatinine ratio refers to the ratio of urinary albumin (mg/dl) to urinary creatinine (g/dl) and is expressed in mg/g. In certain embodiments, the albumin/creatinine ratio can be calculated from a single urine sample and can be used as an estimate of albumin excretion over a 24 hour period.

Glomerular filtration rate or GFR refers to the rate of flow of filtered fluid through the kidney and is used as an indicator of kidney function in a subject. In certain embodiments, a subject's GFR is determined by calculating an estimated glomerular filtration rate. In certain embodiments, a subject's GFR is measured directly from the subject using an inulin method.

Estimated glomerular filtration rate or eGFR refers to a measure of how well the kidneys filter creatinine and is used to provide a rough estimate of glomerular filtration rate. Because direct measurement of GFR is difficult, eGFR is often used in clinical practice. Normal results may range from 90 to 120 ml/min/1.73 m ² . Levels below 60 ml/min/1.73 m ² for 3 or more months may be indicative of chronic kidney disease. Levels below 15 ml/min/1.73 m ² may be indicative of renal failure.

Proteinuria refers to the presence of excess serum proteins in the urine. Proteinuria may be characterized by urinary excretion >250 mg of protein in 24 hours and/or urine protein to creatinine ratio >0.20 mg/mg. Serum proteins elevated in association with proteinuria include, without limitation, albumin.

Blood urea nitrogen or BUN is a measure of the amount of nitrogen in the blood in the form of urea. The liver produces urea in the urea cycle as a waste product of protein digestion, and urea is excreted from the blood by the kidneys. Normal adult blood can contain 7 to 21 mg of urea nitrogen per 100 ml (7 to 21 mg/dl) of blood. The measurement of blood urea nitrogen is used as an indicator of kidney health. If the kidneys are unable to normally remove urea from the blood, the subject's BUN level rises.

Elevated means an increase in a medical value that is considered clinically significant. The healthcare professional can determine if the increase is clinically significant.

End-stage renal disease (ESRD) means complete or near-complete impairment of kidney function.

Quality of life means the extent to which the physical, psychological and social functioning of a subject is impaired by a disease and/or treatment of a disease. Quality of life may be reduced in patients with polycystic kidney disease.

Impaired kidney function means a decrease in kidney function relative to normal kidney function.

Slow progression and slow progression means a decrease in the rate at which a pathological state passes into a progressive state.

Delaying the time to dialysis means maintaining sufficient kidney function so that the need for dialysis treatment is delayed.

Postponing the timing of a kidney transplant means maintaining sufficient kidney function so that the need for a kidney transplant is delayed.

Increasing life expectancy means increasing the lifespan of a subject by treating one or more symptoms of a disease in the subject.

Subject means a human or non-human animal selected for treatment or therapy.

A subject in need means a subject who is identified as being in need of therapy or treatment.

A subject suspected of having means a subject exhibiting one or more clinical signs of a disease.

A disease associated with miR-17 means a disease or condition that is modulated by the activity of one or more members of the miR-17 family.

Administration means providing a pharmaceutical substance or composition to a subject and includes, but is not limited to, administration by a medical professional and self-administration.

Parenteral administration means administration by injection or infusion. Parenteral administration includes, but is not limited to, subcutaneous administration, intravenous administration, and intramuscular administration.

Subcutaneous administration means administration directly under the skin.

Intravenous administration means administration into a vein.

Concomitant administration refers to the co-administration of two or more agents in any form in which the pharmacological effects of both appear in the patient's body at the same time.

With concomitant administration, it is not necessary that both substances be administered in the same pharmaceutical composition, in the same dosage form, or by the same route of administration. The effects of both substances do not have to occur at the same time. The effects only need to overlap in time and do not have to be of the same duration.

Duration means the period of time during which an action or phenomenon continues. In certain embodiments of the invention, the duration of treatment is the period of time during which doses of a pharmaceutical substance or pharmaceutical composition are administered.

Therapy means a way to treat a disease. In certain embodiments of the invention, therapy includes, but is not limited to, administering one or more pharmaceutical substances to a subject having a disease.

To treat means the application of one or more specific procedures used to alleviate at least one indicator of a disease. In certain embodiments of the invention, a specific procedure is the introduction of one or more pharmaceutical agents. In certain embodiments, treatment of PKD includes, but is not limited to, reduction in total kidney volume, improvement in kidney function, reduction in hypertension, and/or reduction in kidney pain.

To alleviate means to reduce the severity of at least one indicator of a pathological condition or disease. In certain embodiments of the invention, alleviation includes delaying or slowing down the development of one or more indicators of a pathological condition or disease. The severity of the indicators can be determined by subjective or objective measures, which are known to specialists in this field of technology.

At risk of development means a state in which a subject is prone to develop a pathological condition or disease. In certain embodiments, a subject at risk of developing a condition or disease exhibits one or more symptoms of the condition or disease, but does not exhibit sufficient symptoms to warrant a diagnosis of the condition or disease. In certain embodiments of the invention, a subject at risk of developing a condition or disease exhibits one or more symptoms of the condition or disease, but to a lesser degree than is required for a diagnosis of the condition or disease.

Prevention of occurrence means preventing the development of a pathological condition or disease in a subject who is at risk of developing a disease or pathological condition. In certain embodiments, a subject at risk of developing a disease or condition receives treatment similar to that received by a subject who already has the disease or condition.

Delaying onset means to delay the development of a condition or disease in a subject who is at risk of developing the disease or condition. In certain embodiments, a subject at risk of developing a disease or condition receives treatment similar to that received by a subject who already has the disease or condition.

Dose means a certain amount of a pharmaceutical substance provided in a single administration. In certain embodiments of the invention, the dose may be administered as two or more boluses, tablets, or injections. For example, in certain embodiments of the invention in which subcutaneous administration is desired, the desired dose requires a volume that is not easily provided by a single injection. In such embodiments, two or more injections may be used to achieve the desired dose. In certain variants

- 15 040625 implementation of the invention the dose can be administered by two or more injections to minimize the reaction at the injection site in the individual. In certain embodiments of the invention, the dose is administered as a slow infusion.

Unit dosage means the form in which the pharmaceutical substance is provided. In certain embodiments, the dosage unit is a vial containing a lyophilized oligonucleotide. In certain embodiments, the dosage unit is a vial containing the resuspended oligonucleotide.

A therapeutically effective amount refers to the amount of a pharmaceutical agent that provides a therapeutic effect to an animal.

Pharmaceutical composition means a mixture of substances suitable for administration to an individual, which includes a pharmaceutical agent. For example, the pharmaceutical composition may contain a sterile aqueous solution.

Pharmaceutical agent means a substance that provides a therapeutic effect when administered to a subject.

An active pharmaceutical ingredient means a substance in a pharmaceutical composition that provides the desired effect.

Pharmaceutically acceptable salts means physiologically and pharmaceutically acceptable salts of the compound provided herein, that is, salts that retain the desired biological activity of the compound and do not have undesirable toxicological effects when administered to a subject.

Non-limiting exemplary pharmaceutically acceptable salts of the compounds provided herein include the sodium and potassium salt forms. As used herein, the terms compound, oligonucleotide, and modified oligonucleotide include the pharmaceutically acceptable salts thereof, unless specifically indicated otherwise.

Saline solution means a solution of sodium chloride in water.

Improved organ function means a change in organ function within normal limits. In certain embodiments of the invention, organ function is assessed by measuring molecules found in the subject's blood or urine. For example, in certain embodiments of the invention, improvement in kidney function is measured by a decrease in blood urea nitrogen, a decrease in proteinuria, a decrease in albuminuria, and so on.

An acceptable safety profile means a set of side effects that is within clinically acceptable limits.

Side effect means a physiological response due to treatment other than the desired effects. In certain embodiments, side effects include, without limitation, injection site reactions, liver function test abnormalities, renal function abnormalities, hepatotoxicity, nephrotoxicity, central nervous system disorders, and myopathies. Such side effects may be detected directly or indirectly. For example, elevated serum aminotransferase levels may indicate hepatotoxicity or impaired liver function. For example, elevated bilirubin may indicate hepatotoxicity or impaired liver function.

As used herein, the term blood encompasses whole blood and blood fractions such as serum and plasma.

Anti-miR means an oligonucleotide having a nucleic base sequence complementary to miRNA. In certain embodiments, the anti-miR is a modified oligonucleotide.

Anti-miR-17 means a modified oligonucleotide having a nucleic base sequence complementary to one or more members of the miR-17 family. In certain embodiments, the anti-miR-17 is fully complementary (ie, 100% complementary) to one or more members of the miR-17 family. In certain embodiments, anti-miR-17 is at least 80%, at least 85%, at least 90%, or at least 95% complementary to one or more members of the miR-17 family.

miR-17 is a mature miRNA having the 5'-CAAAGUGCUUACAGUGCAGGUAG-3' nucleobase sequence (SEQ ID NO: 1).

miR-20a is a mature miRNA having the 5'-UAAAGUGCUUAUAGUGCAGGUAG-3' nucleobase sequence (SEQ ID NO: 2).

miR-20b is a mature miRNA having the 5'-CAAAGUGCUCAUAGUGCAGGUAG-3' nucleobase sequence (SEQ ID NO: 3).

miR-93 is a mature miRNA having the 5'-CAAAGUGCUGUUCGUGCAGGUAG-3' nucleobase sequence (SEQ ID NO: 4).

miR-106a is a mature miRNA having the 5'-AAAAGUGCUUACAGUGCAGGUAG-3' nucleobase sequence (SEQ ID NO: 5).

- 16 040625 miR-106b means a mature miRNA having a nucleic base sequence

5'-UAAAGUGCUGACAGUGCAGAU-3' (SEQ ID NO: 6).

The central sequence of miR-17 means the sequence of nucleic bases

5'-AAAGUG-3, which is present in each of the members of the miR-17 family.

A member of the miR-17 family means a mature miRNA having a nucleic base sequence containing the central sequence of miR-17, and which is selected from miR-17, miR20a, miR-20b, miR-93, miR-106a and miR-106b.

The miR-17 family means the following group of microRNAs: miR-17, miR-20a, miR-20b, miR-93, miR-106a and miR-106b, each of which has a nucleic base sequence including the miR-17 central sequence.

Target nucleic acid means the nucleic acid to which the oligomeric compound hybridizes as intended.

Targeting means the process of designing and selecting a nucleic acid sequence that will hybridize to a target nucleic acid.

Targeting means the presence of a nucleotide sequence that will allow hybridization with the target nucleic acid.

Modulation means a change in function, amount or activity. In certain embodiments, modulation means an increase/increase in function, amount, or activity. In certain embodiments, modulation means a reduction/weakening of function, amount, or activity.

Expression refers to any functions and steps by which the encoded information of a gene is converted into structures that are present and work in the cell.

Nucleic base sequence refers to the order of contiguous nucleobases in an oligomeric compound or nucleic acid, usually listed in a 5' to 3' orientation and independent of any sugar, bond and/or nucleobase modifications.

Adjacent nucleic bases means nucleic bases directly adjacent to each other in a nucleic acid.

Complementarity of nucleic bases means the ability of two nucleic bases to pair non-covalently through a hydrogen bond.

Complementary means that one nucleic acid is capable of hybridizing with another nucleic acid or oligonucleotide. In certain embodiments, complementary refers to an oligonucleotide capable of hybridizing to a target nucleic acid.

Fully complementary means that each nucleic base of the oligonucleotide is capable of pairing with the nucleic base at each corresponding position in the target nucleic acid. In certain embodiments, the oligonucleotide is fully complementary (also referred to as 100% complementary) to the miRNA, i.e., each oligonucleotide nucleobase is complementary to the nucleobase at the corresponding position in the miRNA. The modified oligonucleotide may be fully complementary to the microRNA and contain a number of linked nucleosides that is less than the length of the microRNA. For example, an oligonucleotide with 16 linked nucleosides in which each nucleobase of the oligonucleotide is complementary to the nucleotide base at the corresponding position in the miRNA is fully complementary to the miRNA. In certain embodiments of the invention, the oligonucleotide in which each nucleobase has complementarity to a nucleobase in the region of the miRNA hairpin sequence is fully complementary to the miRNA hairpin sequence.

Percent complementarity means the percentage of nucleic bases of an oligonucleotide that are complementary to an equal length region of the target nucleic acid. The percent complementarity is calculated by dividing the number of nucleobases in the oligonucleotide that are complementary to the nucleobases at the corresponding positions in the target nucleic acid by the total number of nucleobases in the oligonucleotide.

Percent identity means the number of nucleic bases in the first nucleic acid that are identical to the nucleic bases at the corresponding positions in the second nucleic acid divided by the total number of nucleic bases in the first nucleic acid. In certain embodiments, the first nucleic acid is a microRNA and the second nucleic acid is a microRNA. In certain embodiments, the first nucleic acid is an oligonucleotide and the second nucleic acid is an oligonucleotide.

Hybridize means the annealing of complementary nucleic acids, which occurs due to the complementarity of nucleic bases.

Mismatched means a nucleic base of the first nucleic acid that is not capable of Watson-Crick pairing with the nucleic base at the corresponding position of the second nucleic acid.

Identical in the context of nucleobase sequences means having an identical nucleobase sequence, regardless of the sugar, bond and/or modifications of the nucleobase, and regardless of the methylation state of any pyrimidines present.

MiRNA refers to an endogenous non-coding RNA between 18 and 25 nucleobases in length, which is a cleavage product of pre-miRNA by the Dicer enzyme. Examples of mature microRNAs are found in the miRNA database known as miRBase (microma.sanger.ac.uk/). In certain embodiments, the miRNA is abbreviated as miR.

Regulated microRNA transcript means a transcript that is regulated by microRNA.

Complementary to the central sequence means a nucleobase sequence that is complementary to the central sequence and has the same length as the central sequence.

An oligomeric compound means a compound that contains a plurality of linked monomeric subunits. Oligomeric compounds include oligonucleotides.

Oligonucleotide means a compound containing a plurality of linked nucleosides, each of which may be modified or unmodified, independently of each other.

A naturally occurring internucleoside bond means a 3'-5' phosphodiester bond between nucleosides.

Natural sugar means the sugar found in DNA (2'-H) or RNA (2'-OH).

Internucleoside bond means a covalent bond between adjacent nucleosides.

Linked nucleosides means nucleosides linked by a covalent bond.

A nucleobase means a heterocyclic component capable of non-covalently pairing with another nucleobase.

Nucleoside means a nucleobase linked to a sugar moiety.

Nucleotide means a nucleoside containing a phosphate group covalently linked to the sugar moiety of the nucleoside.

A compound containing a modified oligonucleotide consisting of a number of linked nucleosides means a compound that includes a modified oligonucleotide having the specified number of linked nucleosides. Thus, the connection may include additional substituents or conjugates. Unless otherwise indicated, the modified oligonucleotide does not hybridize to the complementary strand and the compound does not include any additional nucleosides other than those of the modified oligonucleotide.

Modified oligonucleotide means a single stranded oligonucleotide having one or more modifications related to a naturally occurring terminal portion, sugar, nucleobase and/or internucleoside bond.

The modified oligonucleotide may contain unmodified nucleosides.

A modified nucleoside means a nucleoside having any change from a naturally occurring nucleoside. The modified nucleoside may contain a modified sugar and an unmodified nucleobase. The modified nucleoside may contain a modified sugar and a modified nucleobase. The modified nucleoside may contain a natural sugar and a modified nucleobase. In certain embodiments, the modified nucleoside is a bicyclic nucleoside. In certain embodiments, the modified nucleoside is a non-bicyclic nucleoside.

Modified internucleoside bond means any alteration of an internucleoside bond of natural origin.

A thiophosphate internucleoside bond means a bond between nucleosides in which one of the non-bridging atoms is a sulfur atom.

A modified sugar component means a substitution and/or any modification of a natural sugar.

Unmodified nucleobase means the naturally occurring heterocyclic bases of RNA or DNA: the purine bases adenine (A) and guanine (G) and the pyrimidine bases thymine (T), cytosine (C) (including 5-methylcytosine) and uracil (U).

5-methylcytosine means a cytosine containing a methyl group attached at the 5 position.

Unmethylated cytosine means a cytosine that does not contain a methyl group attached at the 5 position.

Modified nucleobase means any nucleobase that is not an unmodified nucleobase.

The sugar component means a naturally occurring furanosyl or modified sugar component.

Modified sugar component means a substituted sugar component or sugar substitute.

2'-O-methyl sugar or 2'-OMe sugar means a sugar containing an O-methyl modification in

2' position.

2'-O-methoxyethyl sugar or 2'-MOE sugar means a sugar containing an O-methoxyethyl modification in the 2' position.

2'-fluoro or 2'-F means a sugar having a fluorine modification in the 2' position.

Bicyclic sugar moiety means a modified sugar moiety containing a 4-7 membered ring (including but not limited to furanosyl) containing a bridge linking two atoms of the 4-7 membered ring to form a second ring resulting in a bicyclic structure. In certain embodiments, the 4-7 membered ring is a sugar ring. In certain embodiments, the 4-7 membered ring is furanosyl. In certain embodiments of the invention, the bridge connects the 2'-carbon and 4'-carbon of furanosyl.

Non-limiting exemplary bicyclic sugar moieties include ZNA, NNA, cEt, S-cEt, and R-cEt.

The sugar fragment of a locked nucleic acid (LNA-locked nucleic acid) means a substituted sugar fragment containing a (CH ₂ )-O bridge between the 4' and 2' atoms of the furanose ring.

The sugar component of ENA (ethylene-bridged nucleic acid) means a substituted sugar component containing a (CH ₂ ) ₂ -O bridge between the 4' and 2' atoms of the furanose ring.

An ethyl hindered sugar component (cEt) means a substituted sugar component containing a CH(CH ₃ )-0 bridge between the 4' and 2' atoms of the furanose ring. In certain embodiments of the invention, the CH(CH ₃ )—O bridge is sterically hindered in the S orientation. In certain embodiments of the invention, CH(CH ₃ )—O is sterically hindered in the R orientation.

The sugar moiety S-cEt means a substituted sugar moiety containing a sterically hindered CH(CH ₃ )-O bridge between the 4' and 2' atoms of the furanose ring.

The sugar component R-cEt means a substituted sugar component containing an R hindered CH(CH ₃ )-O bridge between the 4' and 2' atoms of the furanose ring.

2'-O-methyl nucleoside means a 2'-modified nucleoside having a 2'-O-methyl sugar modification.

2'-O-methoxyethyl nucleoside means a 2'-modified nucleoside having a 2'-Omethoxyethyl sugar modification. The 2'-O-methoxyethyl nucleoside may contain a modified or unmodified nucleobase.

2'-fluoro nucleoside means a 2'-modified nucleoside having a 2'-fluoro sugar modification. The 2'-fluoro nucleoside may contain a modified or unmodified nucleobase.

Bicyclic nucleoside means a 2'-modified nucleoside having a bicyclic sugar moiety.

The bicyclic nucleoside may have a modified or unmodified nucleobase.

Nucleoside cEt means a nucleoside containing a cEt sugar moiety. The nucleoside cEt may contain a modified or unmodified nucleobase.

Nucleoside S-cEt means a nucleoside containing the sugar component S-cEt.

Nucleoside R-cEt means a nucleoside containing the sugar component R-cEt.

β-O-deoxyribonucleoside means a naturally occurring DNA nucleoside.

β-O-ribonucleoside means a naturally occurring RNA nucleoside.

An LNA nucleoside means a nucleoside containing a sugar component of an LNA.

Nucleoside ENK means a nucleoside containing a sugar component of ENK.

Review.

Polycystic kidney disease (PKD) is an inherited form of kidney disease in which fluid-filled cysts develop in the kidneys, leading to kidney failure and often advanced kidney disease. Some PBPs are also characterized by enlargement of the kidneys. Excessive proliferation of cysts is a hallmark of PKD pathology. In the treatment of polycystic diseases, the main goal of treatment is to treat symptoms such as hypertension and infections, maintain kidney function, and prevent the onset of end-stage renal disease (ESRD), which in turn improves life expectancy in subjects with PKD.

The miR-17-92 miRNA cluster of members of the miR-17 family is elevated in a mouse model of PBP. Genetic deletion of the miR-17-92 cluster in a mouse model of PKD reduces renal cyst growth, improves renal function, and prolongs survival (Patel et al., PNAS, 2013; 110(26): 10765-10770).

- 19 040625

Inhibition of miR-17 by an experimental compound has been shown to reduce the ratio of kidney weight to body weight and improve kidney function in an experimental model of PKD. In addition, miR-17 inhibition also inhibited the proliferation and growth of primary cultures derived from human donor cysts.

In order to identify inhibitors of one or more members of the miR-17 family that would be sufficiently effective, safe and convenient to administer to subjects with PKD, approximately 200 modified oligonucleotides were designed containing a nucleic base sequence complementary to the central sequence of miR-17, which have a different length and chemical composition. The length of the compounds ranged from 9 to 20 linked nucleosides, and the compounds differed in the number, type, and placement of chemical modifications. Because pharmacology, pharmacokinetic behavior, and safety cannot be predicted simply from the chemical structure of a compound, compounds have been evaluated both in vitro and in vivo for characteristics such as potency, efficacy, pharmacokinetic behavior, safety, and metabolic stability in a series of assays. designed to eliminate compounds with unfavorable properties. As described herein, each of the nearly 200 compounds was first tested in multiple in vitro assays (e.g., activity, toxicology, metabolic stability) to identify a smaller set of compounds suitable for further testing in more complex in vivo assays (e.g., pharmacokinetic profile, efficacy, toxicology). This selection process has identified a candidate pharmaceutical agent for the treatment of PBP.

Certain Compounds of the Invention.

This document provides compounds containing a modified oligonucleotide consisting of 9 linked nucleosides, in which the modified oligonucleotide has the following nucleoside structure in the 5' to 3' orientation:

NsNsNmN _f N _f N _f NmNsNs, where the nucleosides followed by the M index are 2'-O-methylnucleosides, the nucleosides followed by the F index are 2'-fluoronucleosides, the nucleosides followed by the S index, are S-cEt nucleosides; and wherein said nucleobase sequence of the modified oligonucleotide contains the nucleobase sequence 5'-CACUUU-3', each cytosine being either an unmethylated cytosine or 5-methylcytosine; or a pharmaceutically acceptable salt thereof. In certain embodiments, the nucleotide sequence of the modified oligonucleotide is 5'-AGCACUUUG-3', with each cytosine being either an unmethylated cytosine or 5-methylcytosine. In certain embodiments, each cytosine is an unmethylated cytosine. In certain embodiments, each bond is independently selected from a phosphodiester bond and a thiophosphate bond. In certain embodiments, all bonds are thiophosphate bonds.

This document provides compounds of the structure ASGSCMAFCFUFUMUSGS in which the nucleosides followed by the index M are 2'-O-methylnucleosides, the nucleosides followed by the index F are 2'-fluoronucleosides, the nucleosides followed by the index S, are S-cEt nucleosides, each cytosine is either unmethylated cytosine or 5-methylcytosine; or a pharmaceutically acceptable salt thereof. In certain embodiments, each cytosine is an unmethylated cytosine. In certain embodiments, each bond is independently selected from a phosphodiester bond and a thiophosphate bond. In certain embodiments, all bonds are thiophosphate bonds.

This document provides compounds of the structure ASGSCMAFCFUFUMUSGS in which the nucleosides followed by the index M are 2'-O-methylnucleosides, the nucleosides followed by the index F are 2'-fluoronucleosides, the nucleosides followed by the index S, are S-cEt nucleosides, each cytosine is an unmethylated cytosine; or a pharmaceutically acceptable salt thereof. In certain embodiments, each bond is independently selected from a phosphodiester bond and a thiophosphate bond. In certain embodiments, all bonds are thiophosphate bonds.

This document provides compounds containing a modified oligonucleotide consisting of 9 linked nucleosides, in which the modified oligonucleotide has the following nucleoside structure in the 5' to 3' orientation:

NsNsNmNfNfNfNmNsNs, where nucleosides followed by index M are 2'-O-methylnucleosides, nucleosides followed by index F are 2'-fluoronucleosides, nucleosides followed by index S are nucleosides S-cEt , and all bonds are thiophosphate bonds; and wherein the nucleobase sequence of the modified oligonucleotide contains the 5'-CACUUU-3' nucleobase sequence, each

- 20 040625 cytosine is either unmethylated cytosine or 5-methylcytosine; or a pharmaceutically acceptable salt thereof. In certain embodiments, the nucleotide sequence of the modified oligonucleotide is 5'-AGCACUUUG-3', with each cytosine being either unmethylated cytosine or 5-methylcytosine. In certain embodiments, each cytosine is an unmethylated cytosine.

This document presents compounds of the structure ASGSCMAFCFUFUMUSGS, wherein the nucleosides followed by the index M are 2'-O-methylnucleosides, the nucleosides followed by the index F are 2'-fluoronucleosides, the nucleosides followed by the index S, are S-cEt nucleosides, each cytosine is either unmethylated cytosine or 5-methylcytosine, and all bonds are thiophosphate bonds; or a pharmaceutically acceptable salt thereof. In certain embodiments, each cytosine is an unmethylated cytosine.

This document presents compounds of the structure ASGSCMAFCFUFUMUSGS, wherein the nucleosides followed by the index M are 2'-O-methylnucleosides, the nucleosides followed by the index F are 2'-fluoronucleosides, the nucleosides followed by the index S, are S-cEt nucleosides, each cytosine is an unmethylated cytosine, and all bonds are thiophosphate bonds; or a pharmaceutically acceptable salt thereof.

This document provides a modified oligonucleotide named RG4326, wherein the structure of the modified oligonucleotide is

This document also provides pharmaceutically acceptable salts of the modified RG4326 oligonucleotide. Thus, in certain embodiments, the modified oligonucleotide has the structure

- 21 040625

or a pharmaceutically acceptable salt thereof. A non-limiting illustrative pharmaceutically acceptable salt of RG4326 has the structure

In some embodiments, the pharmaceutically acceptable salt of the modified oligonucleotide contains fewer cationic counterions (such as Na ⁺ ) than there are thiophosphate and/or phosphodiester bonds per molecule (i.e., some thiophosphate and/or phosphodiester bonds are protonated). In certain embodiments, the pharmaceutically acceptable salt of RG4326 contains less than 8 cationic counterions (such as Na ⁺ ) per molecule of RG4326. That is, in certain embodiments, a pharmaceutically acceptable salt of RG4326 may contain an average of 1, 2, 3, 4, 5, 6, or 7 cationic counterions per molecule of RG4326, wherein

- 22 040625 the remaining thiophosphate groups are protonated.

Certain Applications of the Invention.

Provided herein are methods for inhibiting the activity of one or more members of the miR-17 family in a cell, comprising contacting the cell with a compound provided herein that contains a nucleic base sequence complementary to the miR-17 central sequence.

Provided herein are methods for inhibiting the activity of one or more members of the miR-17 family in a subject, comprising administering to the subject a pharmaceutical composition provided herein. In certain embodiments, the subject has a disease associated with one or more members of the miR-17 family.

Provided herein are methods of treating polycystic kidney disease (PKD) comprising administering to a subject in need thereof a compound provided herein that contains a nucleic base sequence complementary to the miR-17 central sequence. In certain embodiments, the subject has polycystic kidney disease. In certain embodiments, the polycystic kidney disease is selected from autosomal dominant polycystic kidney disease (ADPKD), autosomal recessive polycystic kidney disease (ARKD), and nephronophthisis (NF). In certain embodiments, the polycystic kidney disease is selected from autosomal dominant polycystic kidney disease (DCKD) and autosomal recessive polycystic kidney disease (ARKD).

In certain embodiments, the subject has a disorder that is characterized by multiple non-renal symptoms as well as polycystic kidney disease. Such disorders include, for example, Joubert's syndrome and related disorders (JSRD), Meckel's syndrome (MKS), or Bardet-Biedl syndrome (BBS). Accordingly, provided herein are methods of treating polycystic kidney disease (PKD) comprising administering to a subject a compound provided herein that includes a nucleic base sequence complementary to the miR-17 central sequence, wherein the subject has Joubert's syndrome and related disorders. (JSRD), Meckel syndrome (MKS), or Bardet-Biedl syndrome (BBS). This document provides methods for the treatment of polycystic kidney disease (PKD) comprising administering a compound provided herein that contains a nucleic base sequence complementary to the miR-17 central sequence, wherein the subject is suspected of having Joubert syndrome and related disorders (JSRD ), Meckel syndrome (MKS) or Bardet-Biedl syndrome (BBS).

In certain embodiments, the polycystic kidney disease is autosomal dominant polycystic kidney disease (ADPKD). ADPPD is caused by mutations in the PKD1 or PKD2 gene. ADKD is a progressive disease in which cyst formation and enlargement of the kidneys lead to kidney failure and eventually end-stage renal disease in 50% of patients by age 60. Patients with ADPBP may require lifelong dialysis and/or a kidney transplant. ADPKD is the most common genetic cause of kidney failure. Excessive proliferation of cysts is the hallmark of the pathological feature of ADPPD. In the treatment of polycystic kidney disease (PKD), the main goal of treatment is to maintain kidney function and prevent the onset of end-stage renal disease (ESRD), which in turn improves the life expectancy of patients with polycystic kidney disease. Total kidney volume usually increases steadily in patients with ADKD, with the increase correlated with worsening kidney function. Provided herein are methods for treating ADPPD comprising administering to a subject having or suspected of having ADPPD a compound provided herein that contains a nucleic base sequence complementary to the miR-17 central sequence.

In certain embodiments, the polycystic kidney disease is autosomal recessive polycystic kidney disease (ARKD). ARPPD is caused by mutations in the PKHD1 gene and is the cause of chronic kidney disease in children. The typical renal phenotype of ARPPD is enlarged kidneys; however, ARPDA has a marked effect on other organs, especially the liver. Patients with ARPKD progress to end-stage renal disease and require a kidney transplant at the age of 15 years. Provided herein are methods for treating ARPPD comprising administering to a subject having or suspected of having ARPPD a compound provided herein that contains a nucleic base sequence complementary to the miR-17 central sequence.

In certain embodiments, the polycystic kidney disease is nephronophthisis (NF).

Nephronophthisis is an autosomal recessive cystic kidney disease that is a common cause of ESRD in children. NF is characterized by kidneys of normal or reduced size, cysts concentrated at the cortico-medullary junction, and tubulointerstitial fibrosis. Mutations in one of several NF genes, such as NPHP1, have been identified in patients

- 23 040625 with NF. Provided herein are methods of treating NF comprising administering to a subject having or suspected of having NF a compound provided herein that contains a nucleic base sequence complementary to the miR-17 central sequence.

In certain embodiments, the subject having polycystic kidney disease has Joubert syndrome and related disorders (JSRD). JSRD includes a wide range of distinguishing features, including brain, retinal, and skeletal abnormalities. Some subjects with JSRD have polycystic kidney disease, in addition to the characteristic features of JSRD. Accordingly, provided herein are methods of treating polypolycystic kidney disease in a subject suffering from JSRD, comprising administering to the subject suffering from JSRD a compound provided herein that contains a nucleic base sequence complementary to the miR-17 central sequence. In certain embodiments, the subject is suspected of having JSRD.

In certain embodiments, the subject having polycystic kidney disease has Meckel syndrome (MKS). MKS is a disorder with severe signs and symptoms in many parts of the body, including the central nervous system, skeletal system, liver, kidneys, and heart. The common features of MKS are the presence of numerous fluid-filled cysts in the kidneys and enlargement of the kidneys. Accordingly, provided herein are methods for treating MKS comprising administering to a subject having MKS a compound provided herein that includes a nucleic base sequence complementary to the central sequence of miR-17. In certain embodiments, the subject is suspected of having MKS.

In certain embodiments, the subject having polycystic kidney disease has Bardet-Biedl syndrome (BBS). BBS is a disease that affects many parts of the body, including the eyes, heart, kidneys, liver, and digestive system. The hallmark of BBS is the presence of renal cysts. Accordingly, provided herein are methods for treating polypolycystic kidney disease in a subject having a BBS, comprising administering to the subject having a BBS a compound provided herein that contains a nucleic base sequence complementary to the miR-17 central sequence. In certain embodiments, the subject is suspected of having a BBS.

In certain embodiments, the subject was diagnosed with PRP prior to administration of the compound containing the modified oligonucleotide. Diagnosis of PKD can be achieved by evaluation of parameters including, but not limited to, the subject's family history, clinical features (including, but not limited to, hypertension, albuminuria, hematuria, and impaired GFR), renal imaging studies (including, but not limited to, MRI, ultrasound, and CT scanning), and/ or histological analysis.

In certain embodiments, the diagnosis of PKD includes screening for mutations in one or more of the PKD1 or PKD2 genes. In certain embodiments, the diagnosis of ARPPD includes screening for mutations in the PKHP1 gene. In certain embodiments, the diagnosis of NF includes screening for one or more mutations in one or more of the NPHP1, NPHP2, NPHP3, NPHP4, NPHP5, NPHP6, NPHP7, NPHP8, or NPHP9 genes. In certain embodiments, diagnosing JSRD includes screening for mutations in the NPHP1, NPHP6, AHI1, MKS3, or RPGRIP1L genes. In certain embodiments, the diagnosis of MKS includes screening for mutations in the NPHP6, MKS3, RPGRIP1L, NPHP3, CC2D2A, BBS2, BBS4, BBS6, or MKS1 genes. In certain embodiments, diagnosing BBS includes screening for mutations in the BBS2, BBS4, BBS6, MKS1, BBS1, BBS3, BBS5, BBS7, BBS7, BBS8, BBS9, BBS10, BBS11, or BBS12 genes.

In certain embodiments, the subject has an increased total kidney volume. In certain embodiments, total kidney volume is growth-adjusted total kidney volume (GROVR). In certain embodiments, the subject has hypertension. In certain embodiments, the subject has impaired renal function. In certain embodiments, the subject is in need of improved renal function. In certain embodiments, the subject is identified as having impaired renal function.

In certain embodiments, levels of one or more members of the miR-17 family are elevated in the kidney of a subject having PBP. In certain embodiments, prior to administration, it is determined that the subject has elevated levels of one or more members of the miR-17 family in the kidney. The level of miR-17 family member can be measured in kidney biopsy materials. In certain embodiments, an elevated level of one or more members of the miR-17 family in the urine or blood of the subject is determined prior to administration.

In any of the embodiments provided herein, the subject may undergo certain tests to diagnose polypolycystic kidney disease in the subject, for example, to determine the cause of the polypolycystic kidney disease, to assess the extent of the subject's polypolycystic kidney disease, and/or to determine the subject's response to treatment. Such tests can assess markers of polycystic kidney disease. Some of these tests, such as glomerular velocity

- 24 040625 filtration and the level of urea nitrogen in the blood are also indicators of kidney function. Markers of polycystic disease include, without limitation: measurement of total kidney volume in a subject; measuring arterial hypertension in the subject; assessment of kidney pain in the subject; measuring fibrosis in the subject; measuring the level of urea nitrogen in the blood of the subject; measuring the serum creatinine level of the subject; measuring the creatinine clearance of the subject; measurement of albuminuria in the subject; measuring the ratio of albumin:creatinine in the subject; measuring the glomerular filtration rate in the subject; measuring hematuria in the subject; measuring the NGAL protein in the subject's urine; and/or measuring the KIM-1 protein in the subject's urine. Unless otherwise noted, blood urea nitrogen, serum creatinine, creatinine clearance, albuminuria, creatinine to albumin ratio, glomerular filtration rate, and hematuria refer to a measurement in the blood (such as whole blood or serum) of a subject.

Markers of polycystic kidney disease are determined by laboratory tests. Reference ranges for individual markers may vary from laboratory to laboratory. The variation may be due, for example, to differences in the specific assays used. Thus, the upper and lower limits of the normal distribution of a marker in a population, also known as the upper limit of normal (ULN) and lower limit of normal (ULN), respectively, may vary from laboratory to laboratory. For any particular marker, a healthcare professional can determine which levels outside of the normal distribution are clinically significant and/or indicative of a disease. For example, a healthcare professional may determine the glomerular filtration rate, which may indicate a decrease in the rate of kidney function in a subject with polycystic kidney disease.

In certain embodiments, said administration of a compound provided herein results in one or more clinically beneficial results. In certain embodiments, said administration improves kidney function in a subject. In certain embodiments, said administration slows down the rate of decline in kidney function in a subject. In certain embodiments, the implementation of the specified introduction reduces the total volume of the kidneys in the subject. In certain embodiments, the implementation of the specified introduction slows the rate of increase in the total volume of the kidneys in the subject. In certain embodiments, the implementation of the specified introduction reduces the total volume of the kidneys, adjusted for growth (GAR). In certain embodiments, the implementation of the specified introduction slows down the rate of increase in RSS.

In certain embodiments, the implementation of the specified introduction inhibits the growth of cysts in the subject. In certain embodiments, said administration slows the rate of increase in cyst growth in a subject. In certain embodiments, the cyst is present in the subject's kidney. In certain embodiments, the cyst is present in an organ other than the kidney, such as the liver.

In certain embodiments, said administration alleviates kidney pain in a subject. In certain embodiments, the implementation of the specified introduction slows down the worsening of pain in the kidneys in the subject. In certain embodiments, said administration delays the onset of kidney pain in a subject.

In certain embodiments, said administration reduces arterial hypertension in a subject. In certain embodiments, said administration slows the worsening of hypertension in a subject. In certain embodiments, said administration delays the onset of hypertension in a subject.

In certain embodiments, said administration reduces fibrosis in the subject's kidney. In certain embodiments, the implementation of the specified introduction slows the deterioration of fibrosis in the kidney of the subject.

In certain embodiments, said administration delays the onset of end-stage renal disease in a subject. In certain embodiments, said administration delays the dialysis time for the subject. In certain embodiments, said administration delays the time of kidney transplantation for the subject. In certain embodiments, the administration improves the life expectancy of the subject.

In certain embodiments, said administration reduces albuminuria in a subject. In certain embodiments, said administration slows the deterioration of albuminuria in a subject. In certain embodiments, said administration delays the onset of albuminuria in a subject. In certain embodiments, said administration reduces hematuria in a subject. In certain embodiments, said administration slows the deterioration of hematuria in a subject. In certain embodiments, said administration delays the onset of hematuria in a subject. In certain embodiments, the implementation of the specified introduction reduces the level of urea nitrogen in the blood of the subject. In certain embodiments, said administration reduces the serum creatinine level in a subject. In certain embodiments, said administration improves creatinine clearance in a subject. In certain embodiments, said administration reduces the albumin:creatinine ratio in a subject.

In certain embodiments, said administration improves the glomerular filtration rate in a subject. In certain embodiments, said administration slows down the rate of decline in the glomerular filtration rate in a subject. In certain embodiments, the glomerular filtration rate is the estimated glomerular filtration rate (pGFR). In certain embodiments, the implementation of the glomerular filtration rate is a measured glomerular filtration rate (iGFR).

In certain embodiments, said administration reduces the level of neutrophil gelatinase-associated protein lipocalin (NGAL) in the subject's urine. In certain embodiments, said administration reduces the level of kidney injury molecule 1 (KIM-1) in the urine of a subject.

In any of the embodiments provided herein, the subject may be subjected to certain tests to assess the degree of development of the disease in the subject. Such tests include, without limitation, measuring the total volume of the kidneys in the subject; measuring arterial hypertension in the subject; measuring kidney pain in the subject; measuring fibrosis in the subject's kidney; measuring the level of urea nitrogen in the blood of the subject; measuring the serum creatinine level of the subject; measuring the creatinine clearance in the subject's blood; measurement of albuminuria in the subject; measuring the ratio of albumin:creatinine in the subject; measuring the glomerular filtration rate in the subject, wherein the rate of glomerular adaptation is assessed or measured; measuring the protein lipocalin associated with neutrophilic gelatinase (NGAL) in the urine of the subject; and/or measuring kidney injury molecule-1 (KIM-1) protein in the subject's urine.

In certain embodiments, a subject having polycystic kidney disease experiences a reduced quality of life. For example, a subject having polycystic kidney disease may experience kidney pain, which may reduce the subject's quality of life. In certain embodiments, said administration improves the subject's quality of life.

In any of the embodiments presented herein, the subject is a human. In certain embodiments, the human subject is an adult. In certain embodiments, the adult is at least 21 years old. In certain embodiments, the human subject is a pediatric subject, that is, a subject less than 21 years of age. Pediatric populations may be defined by regulatory authorities. In certain embodiments, the human subject is a teenager. In certain embodiments, the adolescent is at least 12 years of age and less than 21 years of age. In certain embodiments, the human subject is a child. In certain embodiments, the child is at least two years old and less than 12 years old. In certain embodiments, the human subject is an infant. In certain embodiments, the infant is at least one month old and less than two years old. In certain embodiments, the subject is a neonate. In certain embodiments, the newborn is less than one month old.

Any of the compounds described herein may be used in therapy. Any of the compounds provided herein can be used to treat polycystic kidney disease. In certain embodiments, the implementation of the polycystic kidney disease is an autosomal dominant polycystic kidney disease. In certain embodiments, the implementation of the polycystic kidney disease is an autosomal recessive polycystic kidney disease. In a particular embodiment, the polycystic kidney disease is nephronophthisis. In certain embodiments, the subject has Joubert syndrome and related disorders (JSRD), Meckel syndrome (MKS), or Bardet-Biedl syndrome (BBS).

Any of the modified oligonucleotides described herein can be used for therapy. Any of the modified oligonucleotides provided herein can be used to treat polycystic kidney disease.

Any of the compounds presented in this document can be used to prepare a medicinal product. Any of the compounds provided herein can be used in the preparation of a medicament for the treatment of polycystic kidney disease.

Any of the modified oligonucleotides provided herein can be used to formulate a drug. Any of the modified oligonucleotides provided herein can be used to formulate a medicament for the treatment of polycystic kidney disease.

Any pharmaceutical composition provided herein can be used to treat polycystic kidney disease.

Some additional therapies.

Methods of treatment for polycystic kidney disease or any of the pathological conditions listed herein may include more than one therapy. Thus, in certain embodiments of the invention provided herein, methods of treating a subject having or suspected of having polycystic kidney disease are provided, comprising administering at least one therapeutic agent in addition to administering a compound provided in this invention containing the sequence nucleotide bases complementary to the miR-17 central sequence.

In certain embodiments, at least one additional therapy comprises a pharmaceutical agent.

In certain embodiments, the pharmaceutical agent is an antihypertensive agent.

Antihypertensive agents are used to control the subject's blood pressure.

In certain embodiments, the pharmaceutical agent is a vasopressin 2 receptor antagonist. In certain embodiments, the vasopressin 2 receptor antagonist is tolvaptan.

In certain embodiments, the pharmaceutical agents include angiotensin II receptor blockers (ARBs). In certain embodiments, the angiotensin II receptor blocker is candesartan, irbesartan, olmesartan, losartan, valsartan, telmisartan, or eprosartan.

In certain embodiments, the pharmaceutical agents include angiotensin II converting enzyme (ACE) inhibitors. In certain embodiments, the ACE inhibitor is captopril, enalapril, lisinopril, benazepril, quinapril, fosinopril, or ramipril.

In certain embodiments, the pharmaceutical agent is a diuretic. In certain embodiments, the pharmaceutical agent is a calcium channel blocker.

In certain embodiments, the pharmaceutical agent is a kinase inhibitor. In certain embodiments, the kinase inhibitor is bosutinib or KD019.

In certain embodiments, the pharmaceutical agent is an adrenergic receptor antagonist.

In certain embodiments, the pharmaceutical agent is an aldosterone receptor antagonist. In certain embodiments, the aldosterone receptor antagonist is spironolactone. In certain embodiments, spironolactone is administered at a dose of 10 to 35 mg per day. In certain embodiments, spironolactone is administered at a dose of 25 mg per day.

In certain embodiments, the pharmaceutical agent is a mammalian target of rapamycin (mTOR) inhibitor. In certain embodiments, the mTOR inhibitor is everolimus, rapamycin, or sirolimus.

In certain embodiments, the pharmaceutical agent is a hormone analogue. In certain embodiments, the hormone analog is somatostatin or adrenocorticotrophic hormone.

In certain embodiments, the pharmaceutical agent is an anti-fibrotic agent. In certain embodiments, the antifibrotic agent is a modified oligonucleotide complementary to miR-21.

In certain embodiments, the additional therapy is dialysis. In certain embodiments, the adjunctive therapy is a kidney transplant.

In certain embodiments, pharmaceutical agents include anti-inflammatory agents. In certain embodiments, the anti-inflammatory agent is a steroidal anti-inflammatory agent. In certain embodiments, the steroidal anti-inflammatory agent is a corticosteroid. In certain embodiments, the corticosteroid is prednisone. In certain embodiments, the anti-inflammatory agent is a non-steroidal anti-inflammatory drug. In certain embodiments, the non-steroidal anti-inflammatory agent is ibuprofen, a COX-1 inhibitor, or a COX-2 inhibitor.

In certain embodiments, the pharmaceutical agent is a pharmaceutical agent that blocks one or more responses to fibrogenic signals.

In certain embodiments, the complementary therapy may be a pharmaceutical agent that enhances the body's immune system, including low doses of cyclophosphamide, thystimulin, vitamins, and nutritional supplements (e.g., antioxidants, including vitamins A, C, E, β-carotene, zinc, selenium, glutathione, coenzyme Q-10, and echinacea) and vaccines, such as the immunostimulatory complex (ISCOM), which contains a vaccine composition that combines multimeric antigen and adjuvant presentation.

In certain embodiments, the implementation of additional therapy is selected to treat or reduce the side effects of one or more pharmaceutical compositions according to this invention. Such side effects include, without limitation, injection site reactions, hepatic dysfunction, renal dysfunction, hepatotoxicity, renal toxicity, central nervous system disorders, and myopathies. For example, elevated serum aminotransferase levels may indicate hepatotoxicity or impaired liver function. For example, elevated bilirubin may indicate hepatotoxicity or impaired liver function.

- 27 040625

Certain sequences of nucleic bases of microRNA.

The miR-17 family includes miR-17, miR-20a, miR-20b, miR-93, miR-106a and miR-106b. Each miR-17 family member has a nucleobase sequence containing the 5'-AAAGUG-3' nucleobase sequence or miR-17 central sequence, which is the nucleobase sequence at positions 2 to 7 of SEQ ID NO: 1. In addition, each member of the miR-17 family shares some nucleobase sequence identity outside the central region. Accordingly, a modified oligonucleotide containing a nucleic base sequence complementary to the miR-17 central sequence can target other microRNAs of the miR-17 family in addition to miR-17. In certain embodiments, the modified oligonucleotide targets two or more miR-17 family microRNAs. In certain embodiments, the modified oligonucleotide targets three or more miR-17 family microRNAs. In certain embodiments, the modified oligonucleotide targets four or more miR-17 family microRNAs. In certain embodiments, the modified oligonucleotide targets five or more microRNAs of the miR-17 family. In certain embodiments, the modified oligonucleotide targets six microRNAs of the miR-17 family. For example, a modified oligonucleotide that has the 5'-AGCACUUUG-3' nucleobase sequence targets all members of the miR-17 family.

In certain embodiments, the modified oligonucleotide contains the 5'-CACUUU-3' nucleobase sequence. In certain embodiments, the modified oligonucleotide contains the 5'-GCACUUUG-3' nucleobase sequence. In certain embodiments, the modified oligonucleotide contains the 5'-AGCACUUU-3' nucleobase sequence. In certain embodiments, the nucleobase sequence of the modified oligonucleotide is 5'-AGCACUUUG-3'.

In certain embodiments, the modified oligonucleotide contains the 5'-CACTTT-3' nucleobase sequence. In certain embodiments, the modified oligonucleotide contains the 5'-CACUTT-3' nucleobase sequence. In certain embodiments, the modified oligonucleotide contains the 5'-CACUUT-3' nucleobase sequence. In certain embodiments, the modified oligonucleotide contains the 5'-CACTUT-3' nucleobase sequence. In certain embodiments, the modified oligonucleotide contains the 5'-CACUTT-3' nucleobase sequence. In certain embodiments, the modified oligonucleotide contains the 5'-CACTTU-3' nucleobase sequence.

In certain embodiments, each cytosine is independently selected from unmethylated cytosine and 5-methylcytosine. In certain embodiments, at least one cytosine is an unmethylated cytosine. In certain embodiments, each cytosine is an unmethylated cytosine. In certain embodiments, at least one cytosine is 5-methylcytosine. In certain embodiments, each cytosine is 5-methylcytosine.

In certain embodiments, the number of linked nucleosides of the modified oligonucleotide is less than the length of its target miRNA. A modified oligonucleotide is considered a modified oligonucleotide having a nucleotide base sequence that is fully complementary (also referred to as 100% complementary) to a region of the target microRNA sequence if it has a number of linked nucleosides that are shorter than the length of the target microRNA, with each nucleotide base of the modified oligonucleotide is complementary to the nucleic base in the corresponding position of the target miRNA. For example, a modified oligonucleotide consisting of 9 linked nucleosides, in which each nucleobase is complementary to the corresponding position of miR-17, is fully complementary to miR-17.

In certain embodiments, the modified oligonucleotide has a nucleobase sequence having one mismatch with respect to the nucleobase sequence of the target miRNA. In certain embodiments, the modified oligonucleotide has a nucleobase sequence having two mismatches with respect to the nucleobase sequence of the target miRNA. In some such embodiments, the modified oligonucleotide has a nucleobase sequence having no more than two mismatches with respect to the nucleobase sequence of the target miRNA. In some such embodiments, the mismatched nucleobases are contiguous. In some such embodiments, the mismatched nucleobases are not contiguous.

Although the sequence listing accompanying this submission identifies each nucleobase sequence as either RNA or DNA, as required, in practice these sequences may be modified by a combination of the chemical modifications specified in this

- 28 040625 document. One of ordinary skill in the art will readily appreciate that the designation RNA or DNA in a sequence listing to describe modified oligonucleotides is somewhat arbitrary. For example, a modified oligonucleotide provided herein containing a nucleoside containing a 2'-O-methoxyethyl saccharide group and a thymine base can be described as a DNA residue in a sequence listing even if the nucleoside is modified and is not a naturally occurring DNA nucleoside.

Accordingly, the nucleic acid sequences provided in the sequence listing are intended to encompass nucleic acids containing any combination of natural or modified RNA and/or DNA, including, but not limited to, such nucleic acids having modified nucleic bases. As a further example and without limitation, a modified oligonucleotide having the nucleobase sequence ATCGATCG in the sequence listing encompasses any oligonucleotide having such a nucleobase sequence, whether or not modified, including, but not limited to, compounds containing RNA bases such as having the sequence AUCGAUCG and those having some DNA bases and some RNA bases such as AUCGATCG and oligonucleotides having other modified bases such as AT ^me CGAUCG, where ^me C is 5-methylcytosine.

certain modifications.

In certain embodiments, the oligonucleotides provided herein may contain one or more nucleotide base, sugar, and/or internucleoside bond modifications and, as such, are modified oligonucleotides. The modified nucleotide base, sugar and/or internucleoside linkage may be selected in unchanged form for desirable properties such as, for example, increased cellular uptake, increased affinity for other oligonucleotides or nucleic acid targets, and increased stability in the presence of nucleases.

In certain embodiments, the modified oligonucleotide contains one or more modified nucleosides.

In certain embodiments, the modified nucleoside is a sugar-modified nucleoside. In some such embodiments, the sugar-modified nucleosides may further comprise a natural or modified heterocyclic basic group and/or may be linked to another nucleoside via a natural or modified internucleoside bond and/or may include additional modifications independent of the sugar modification. In certain embodiments, the sugar-modified nucleoside is a 2'-modified nucleoside, wherein the sugar ring is modified at the 2' carbon of natural ribose or 2'-deoxyribose.

In certain embodiments, the 2'-modified nucleoside has a bicyclic sugar moiety. In some such embodiments, the bicyclic sugar moiety is a D-sugar in the α-configuration. In some such embodiments, the bicyclic sugar moiety is a D-sugar in the β-configuration. In some such embodiments, the bicyclic sugar moiety is an L-sugar in the α-configuration. In some such embodiments, the bicyclic sugar moiety is an L sugar in the β configuration.

Nucleosides containing such bicyclic sugar moieties are referred to as bicyclic nucleosides or BNAs. In certain embodiments, the bicyclic nucleosides include, but are not limited to, (A) aL-methyleneoxy (4'-CH ₂ -O-2') BNA; (B) eD-methyleneoxy (4'-CH2-O2') BNA; (C) ethyleneoxy (4'-(CH ₂ ) ₂ -O-2') BNA; (D) aminooxy (4'-Ch ₂ -ON(R)-2') BNA; (E) hydroxyamino (4'CH2-N(R)-O-2') BNA; (F) methyl (methyleneoxy) (4'-CH(CH3)-O-2') BNA (also called ethyl or cEt); (G) methylenethio (4'-CH2-S-2') BNA; (H) methyleneamino (4'-CH2-N(R)-2') BNA; (I) methylcarbocyclic (4'-CH ₂ -CH(CH ₃ )-2') BNA; (J) c-MOE (4'-CH (CH ₂ -0Me)-0-2') BNA and (K) propylenecarbocyclic (4'-(CH ₂ )3-2') BNA as shown below

- 29 040625

where Bx is a nucleobase group and R is independently H, a protecting group, or C1-C12 alkyl.

In certain embodiments, the 2'-modified nucleoside contains a 2' substituent group selected from F, OCF3, O-CH3 (also referred to as 2'-OMe), OCH2CH2OCH3 (also referred to as 2'-O-methoxyethyl or 2'-MOE) , 2'-O(CH ₂ ) ₂ SCH ₃ , O-(CH ₂ ) ₂ -O-H(CH ₃ ) ₂ , -O(CH2)2O(CH2)2N(CH3)2 and O-CH2-C (=O)^(H)CH3.

In certain embodiments, the 2'-modified nucleoside contains a 2' substituent group selected from F, O-CH3, and OCH ₂ CH ₂ OCH3.

In certain embodiments, the sugar-modified nucleoside is a 4'-thio-modified nucleoside. In certain embodiments, the sugar-modified nucleoside is a 4'-thio-2'-modified nucleoside. The 4'-thio-modified nucleoside has a β-D-ribonucleoside with 4'-O replaced by 4'-S. A 4'-thio-2'-modified nucleoside is a 4'-thio-modified nucleoside having a 2'-OH substituted with a 2'-substituent group. Suitable 2'-substituent groups include 2'-OCH ₃ , 2'OCH2CH2OCH3 and 2'-F.

In certain embodiments, the modified oligonucleotide contains one or more internucleoside modifications. In some such embodiments, each internucleoside bond of the modified oligonucleotide is a modified internucleoside bond. In certain embodiments, the modified internucleoside bond contains a phosphorus atom.

In certain embodiments, the modified oligonucleotide contains at least one thiophosphate internucleoside bond. In certain embodiments, each internucleoside bond of the modified oligonucleotide is a thiophosphate internucleoside bond.

In certain embodiments, the modified oligonucleotide contains one or more modified nucleobases. In certain embodiments, the modified nucleotide base is selected from 5-hydroxymethylcytosine, 7-deazaguanine, and 7deazaadenine. In certain embodiments, the modified nucleotide base is selected from 7-deazaadenine, 7-deazaguanosine, 2-aminopyridine, and 2-pyridone. In certain embodiments, the modified nucleotide base is selected from 5-substituted pyrimidines, 6-azapyrimidines, and N-2, N-6, and O-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil, and 5-propynylcytosine.

In certain embodiments, the modified nucleotide base contains a polycyclic heterocycle. In certain embodiments, the modified nucleotide base contains a tricyclic heterocycle. In certain embodiments, the modified nucleotide base comprises a phenoxazine derivative. In certain embodiments, phenoxazine can be further modified to form a nucleobase, known in the art as a G-clamp.

In certain embodiments, the modified oligonucleotide is conjugated to one or more moieties that enhance activity, cellular distribution, or cellular uptake of the resulting antisense oligonucleotides. In some such embodiments, the fragment is a cholesterol fragment. In certain embodiments, the fragment is a lipid fragment. Additional moieties for conjugation include carbohydrates, peptides, antibodies or antibody fragments, phospholipids, biotin, phenazine, folate,

- 30 040625 phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines, coumarins and dyes. In certain embodiments, the carbohydrate moiety is K-acetyl-O-galactosamine (GalNac). In certain embodiments, the implementation of the conjugate group is attached directly to the oligonucleotide. In certain embodiments, the conjugate group is attached to the modified oligonucleotide via a linking moiety selected from amino, azido, hydroxyl, carboxylic acid, thiol, unsaturated groups (e.g., double or triple bonds), 8-amino-3,6-dioxaoctanoic acid (ADO ), succinimidyl-4-(N-maleimidomethyl)cyclohexane-1-carboxylate (SMCC), 6-aminohexanoic acid (ANEX or AHA), substituted C1-C10 alkyl, substituted or unsubstituted C2-C10 alkenyl, and substituted or unsubstituted C2-C10 alkynyl. In some such embodiments, the substituent group is selected from hydroxyl, amino, alkoxy, azido, carboxy, benzyl, phenyl, nitrile, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl, and alkynyl.

In some such embodiments, the compound comprises a modified oligonucleotide having one or more stabilizing groups that are attached to one or both ends of the modified oligonucleotide to improve properties such as, for example, nuclease stability. The stabilizing groups include cap structures. These terminal modifications protect the modified oligonucleotide from degradation by exonucleases and may aid in intracellular delivery and/or localization. Said cap may be present at the 5' end (5' cap) or at the 3' end (3' cap) or may be present at both ends. Cap structures include, for example, inverted deoxybase caps.

Some pharmaceutical compositions.

Provided herein are pharmaceutical compositions containing a compound or modified oligonucleotide provided herein and a pharmaceutically acceptable diluent. In certain embodiments, the pharmaceutically acceptable diluent is an aqueous solution. In certain embodiments, the aqueous solution is saline. Used in this document, pharmaceutically acceptable diluents are understood as sterile diluents. Suitable routes of administration include, without limitation, intravenous and subcutaneous administration.

In certain embodiments, the implementation of the pharmaceutical composition is administered in the form of a dose unit. For example, in certain embodiments, the dosage unit is in the form of a tablet, capsule, or bolus injection.

In certain embodiments, the pharmaceutical agent is a modified oligonucleotide that has been prepared in a suitable diluent, adjusted to pH 7.0-9.0 with an acid or base during preparation, and then lyophilized under sterile conditions. The lyophilized modified oligonucleotide is then reconstituted with a suitable diluent, for example an aqueous solution such as water, or physiologically compatible buffers such as saline, Hank's solution, or Ringer's solution. The reconstituted product is administered as a subcutaneous injection or intravenous infusion. The lyophilized medicinal product may be packaged in a 2 ml type I clear glass vial (treated with ammonium sulfate), stoppered with bromobutyl rubber and sealed with an aluminum surface sealant.

In certain embodiments, the implementation of the pharmaceutical compositions presented herein may additionally contain other additional components commonly found in pharmaceutical compositions, at their level of use in the prior art of the respective fields. Thus, for example, said compositions may contain additional compatible pharmaceutically active materials such as, for example, antipruritics, astringents, local anesthetics or anti-inflammatory agents.

In certain embodiments, the pharmaceutical compositions provided herein may contain additional materials useful in the physical formulation of the various dosage forms of the compositions of this invention, such as colorants, flavors, preservatives, antioxidants, deactivators, thickeners, and stabilizers; such additional materials also include, but are not limited to, excipients such as alcohol, polyethylene glycols, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, and polyvinylpyrrolidone. In various embodiments, such materials, when added, should not unduly affect the biological activity of the components of the compositions of this invention. The formulations may be sterilized and, if desired, mixed with adjuvants such as lubricants, preservatives, stabilizers, wetting agents, emulsifiers, osmotic salts, buffers, colorants, fragrances and/or fragrances, and the like, which do not adversely interact with the oligonucleotide(s) of the formulation. Certain injectable pharmaceutical compositions are suspensions, solutions or emulsions in oily or aqueous vehicles and may contain prescription agents such as suspending, stabilizing and/or dispersing agents. Some solvents suitable for use in injectable pharmaceutical compositions include, but are not limited to, lipophilic solvents and fatty oils such as

- 31 040625 sesame oil, synthetic fatty acid esters such as ethyl oleate or triglycerides, and liposomes. Aqueous injection suspensions may contain substances that increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol or dextran.

Optionally, such suspensions may also contain suitable stabilizers or agents which increase the solubility of the pharmaceutical agents, allowing highly concentrated solutions to be obtained.

Lipid fragments have been used in nucleic acid therapy in a variety of ways. In one method, the nucleic acid is introduced into preformed liposomes or lipoplexes made from mixtures of cationic lipids and neutral lipids. In another method, DNA complexes with mono- or polycationic lipids are formed without the presence of a neutral lipid. In certain embodiments, the implementation of the lipid fragment is chosen to increase the distribution of the pharmaceutical agent in a particular cell or tissue. In certain embodiments, the implementation of the lipid fragment is selected to increase the distribution of the pharmaceutical agent in adipose tissue. In certain embodiments, the implementation of the lipid fragment is selected to increase the distribution of the pharmaceutical agent in muscle tissue.

In certain embodiments, the pharmaceutical composition provided herein contains a polyamine compound or lipid moiety complexed with a nucleic acid. In certain embodiments, such preparations include one or more compounds, each of which individually has the structure defined by formula (Z), or a pharmaceutically acceptable salt thereof x ^a Xx ^& h r ₂ n ^{z 4} N NRj where each X ^a and X ^b , for each occurrence, is independently C1-6 alkylene; n is 0, 1, 2, 3, 4 or 5; each R is independently H, wherein at least n+2 R moieties in at least about 80% of the molecules of the compound of formula (Z) in the formulation are not H; m is 1, 2, 3 or 4; Y is O, NR ² or S; R ¹ is alkyl, alkenyl or alkynyl; each of which is optionally substituted with one or more substituents; and R ² is H, alkyl, alkenyl or alkynyl; each of which is optionally substituted with one or more substituents; with the proviso that if n=0, then at least n+3 R fragments are not H. Such preparations are described in PCT Publication WO/2008/042973, which is incorporated herein by reference in its entirety for the disclosure of lipid preparations. Some additional formulations are described in Akinc et al., Nature Biotechnology 26, 561-569 (01 May 2008), which is incorporated herein by reference in its entirety for the disclosure of lipid formulations.

In certain embodiments, the pharmaceutical composition provided herein is prepared using known techniques, including, but not limited to, mixing, dissolving, granulating, drageeing, levitating, emulsifying, encapsulating, encapsulating, or tableting processes.

In certain embodiments, the pharmaceutical composition provided herein is a solid (eg, powder, tablet, and/or capsule). In some of these embodiments, a solid pharmaceutical composition containing one or more oligonucleotides is prepared using ingredients known in the art, including, but not limited to, starches, sugars, diluents, granulating agents, lubricants, binders, and disintegrants.

In certain embodiments, the pharmaceutical composition provided herein is formulated as a depot formulation. Some of these depot drugs tend to last longer than non-depot drugs. In certain embodiments, such preparations are administered by implantation (eg, subcutaneously or intramuscularly) or by intramuscular injection. In certain embodiments, depot formulations are formulated using suitable polymeric or hydrophobic materials (eg, emulsions in a suitable oil) or ion exchange resins, or as sparingly soluble derivatives, eg, as a sparingly soluble salt.

In certain embodiments, the pharmaceutical composition provided herein includes a delivery system. Examples of delivery systems include, but are not limited to, liposomes and emulsions. Certain delivery systems are useful for preparing certain pharmaceutical compositions, including those containing hydrophobic compounds. In certain embodiments, certain organic solvents are used, such as dimethyl sulfoxide.

In certain embodiments, a pharmaceutical composition provided herein comprises one or more tissue-specific delivery molecules designed to deliver one or more pharmaceutical agents of this invention to specific tissues or cell types. For example, in certain embodiments, the pharmaceutical compositions include liposomes coated with a tissue-specific antibody.

- 32 040625

In certain embodiments, the pharmaceutical composition provided herein contains a sustained release system. A non-limiting example of such a sustained release system is a semi-permeable matrix of solid hydrophobic polymers. In certain embodiments, sustained release systems may, depending on their chemical nature, release pharmaceutical agents over hours, days, weeks, or months.

Some pharmaceutical compositions for injection are presented in unit dosage form, for example in ampoules or in multi-dose containers.

In certain embodiments, the pharmaceutical composition provided herein contains the modified oligonucleotide in a therapeutically effective amount. In certain embodiments, the therapeutically effective amount is sufficient to prevent, alleviate, or ameliorate the symptoms of a disease, or to prolong the survival of the subject being treated.

In certain embodiments, one or more of the modified oligonucleotides provided herein are formulated as a prodrug. In certain embodiments, when administered in vivo, the prodrug is chemically converted to a biologically, pharmaceutically, or therapeutically more active form of the oligonucleotide. In certain embodiments, prodrugs are useful because they are easier to administer than the corresponding active form. For example, in some cases, the prodrug may be more bioavailable (eg, when administered orally) than the corresponding active form. In some cases, the prodrug may have improved solubility compared to the corresponding active form. In certain embodiments, the prodrugs are less water soluble than the corresponding active form. In some cases, such prodrugs have a better property of passing through cell membranes, in which water solubility adversely affects motility. In certain embodiments, the prodrug is an ester. In some such embodiments, the ester is metabolically hydrolyzed to a carboxylic acid upon administration. In some cases, the carboxylic acid-containing compound is the corresponding active form. In certain embodiments, the prodrug comprises a short peptide (polyamino acid) linked to an acid group. In some of these embodiments, the peptide is cleaved upon administration to form the corresponding active form.

In certain embodiments, the prodrug is obtained by modifying the pharmaceutically active compound such that the active compound will be regenerated upon administration in vivo. A prodrug may be designed to alter the metabolic stability or transport characteristics of a drug, to mask side effects or toxicity, to improve the taste of the drug, or to alter other characteristics or properties of the drug.

Through knowledge of pharmacodynamic processes and in vivo drug metabolism, those skilled in the art, when the pharmaceutically active compound is known, can create prodrugs of the compound (see, for example, Nogrady (1985) Medicinal Chemistry A Biochemical Approach, Oxford University Press, New York, pages 388- 392).

Additional routes of administration include, but are not limited to, oral, rectal, transmucosal, intestinal, enteral, topical, suppository, inhalation, intrathecal, intracardiac, intraventricular, intraperitoneal, intranasal, intraocular, intratumoral, intramuscular, and intramedullary administration. In certain embodiments, pharmaceutical intrathecals are administered to achieve local rather than systemic effects. For example, pharmaceutical compositions can be administered directly to the site of the desired effect (eg, the kidney).

certain sets.

This invention also provides kits. In certain embodiments, the kits include one or more compounds containing the modified oligonucleotide disclosed herein. In certain embodiments, said kits may be used to administer a compound to a subject.

In certain embodiments, the kit includes a pharmaceutical composition ready for administration. In certain embodiments, the pharmaceutical composition is present in a vial. A plurality of vials, for example 10, may be present, for example, in dosage packs. In certain embodiments, the implementation of the vial is made so as to be accessible to the syringe. The kit may also contain instructions for using the compounds.

In certain embodiments, the kit contains a pharmaceutical composition present in a pre-filled syringe (such as single dose syringes, e.g., with a 27 gauge, 1/2 inch (1.27 cm) needle guard) rather than a vial. A plurality of pre-filled syringes, for example 10, may be present, for example, in dosage packs. The kit may also contain instructions for administering compounds containing the modified oligonucleotide described herein.

- 33 040625

In certain embodiments, the kit contains the modified oligonucleotide provided herein as a lyophilized drug product and a pharmaceutically acceptable diluent. In preparation for administration to a subject, the lyophilized drug product is reconstituted in a pharmaceutically acceptable diluent.

In certain embodiments, in addition to compounds containing the modified oligonucleotide disclosed herein, the kit may further include one or more of the following: a syringe, an alcohol swab, a cotton swab, and/or a gauze pad.

Certain experimental models.

In certain embodiments, this invention provides methods for using and/or testing modified oligonucleotides of this invention in an experimental model. Those skilled in the art may select and modify protocols for such experimental models to evaluate a pharmaceutical agent of the invention.

Typically, the modified oligonucleotides are first tested in cultured cells. Suitable cell types include those that are of the cell type to which in vivo delivery of the modified oligonucleotide is desired. For example, suitable cell types for studying the methods described herein include primary or cultured cells.

In certain embodiments, the degree to which the modified oligonucleotide interferes with the activity of one or more members of the miR-17 family is assessed in cultured cells. In certain embodiments, inhibition of miRNA activity can be assessed by measuring the level of one or more predicted or confirmed regulated miRNA transcripts. Inhibition of miRNA activity can lead to an increase in the level of the miR-17 family member-regulated transcript and/or the protein encoded by the miR-17 family member-regulated transcript (i.e., the miR-17 family member-regulated transcript is derepressed). In addition, in certain embodiments, certain phenotypic outcomes can be measured.

Several animal models are available to those skilled in the art for studying one or more members of the miR-17 family in human disease models. Models of polycystic kidney disease include, but are not limited to, models with mutations and/or deletions in Pkd1 and/or Pkd2; and models containing mutations in other genes. Non-limiting illustrative models of PKD containing mutations and/or deletions in Pkd1 and/or Pkd2 include hypomorphic models, such as those containing missense mutations in Pkd1, and models with reduced or unstable expression of Pkd2; inducible models of conditional knockout; and conditional knockout models. Non-limiting illustrative models of PBP containing mutations in genes other than Pkd1 and Pkd2 include those with mutations in Pkhd1, Nek8, Kif3a and/or Nphp3. FBP models are discussed, for example, in Shibazaki et al., Human Mol. Genet., 2008; 17(1 1): 1505-1516; Happe and Peters, Nat. Rev. Nephrol., 2014; 10(10): 587-601; and Patel et al, PNAS, 2013; 1 10(26): 10765-10770.

Certain quantitative analyses.

In certain embodiments, miRNA levels are quantified in cells or tissues in vitro or in vivo. In certain embodiments, changes in miRNA levels are performed using microarray analysis. In certain embodiments, changes in microRNA levels are performed using one of several commercially available PCR assays, such as the TaqMan® miRNA assay (Applied Biosystems).

Modulation of miRNA activity by an anti-miR mimetic or miRNA can be assessed by mRNA profiling on microarrays. mRNA sequences that are modulated (increased or decreased) by an anti-miR mimetic or miRNA are examined for the presence of a central miRNA sequence to compare the modulation of mRNAs that are targets of that microRNA with that of mRNAs that are not targets of that miRNA. Thus, the interaction of an anti-miR with its target microRNA or a miRNA mimetic with its targets can be assessed. In the case of anti-miR, mRNAs whose expression levels are elevated are screened for mRNA sequences that contain a sequence complementary to the central sequence of the miRNA sequence with which the anti-miR is complementary.

Modulation of miRNA activity by an anti-miR compound can be assessed by measuring the level of the miRNA target messenger RNA, or by measuring the level of the messenger RNA itself or the protein transcribed from it. Antisense inhibition of miRNAs typically results in an increase in the level of messenger RNA and/or target miRNA messenger RNA protein, ie anti-miR treatment results in derepression of one or more target messenger RNAs.

Examples

The following examples are presented in order to more fully illustrate some embodiments of the invention. However, they should in no way be construed as limiting the broad scope of the invention. Those skilled in the art will readily adopt the underlying principles of this discovery to develop various compounds without departing from the essence.

- 34 040625 of this invention.

Example 1 Role of miR-17 in PBP.

Members of the miR-17-92 microRNA cluster of the miR-17 family are upregulated in a mouse model of PRP. Genetic deletion of the miR-17-92 cluster in a mouse model of PKD reduces renal cyst growth, improves renal function, and prolongs survival (Patel et al., PNAS, 2013; 1 10 (26): 10765-10770). The miR-17-92 cluster contains 6 different miRNAs, each with a different sequence: miR17, miR-18a, miR-19a, miR-19-b-1, and miR-92a-1.

The miR-17-92 cluster includes two miRNAs, miR-17 and miR-20a, which are members of the miR-17 miRNA family. Each member of this family shares a core sequence identity and varying degrees of sequence identity outside the core sequence region. Other members of the miR-17 family are miR-20b, miR-93, miR-106a and miR106b. miR-20b and miR-106a, which are in the miR-106a-363 cluster on the human X chromosome, and miR93 and miR-106b are in the miR-106b-25 cluster on human chromosome 7. The sequences of miR-17 family members are shown in Table 1. 1.

Table 1. MicroRNAs of the miR-17 family

miRNA SEQUENCE (from 5' to 3') central sequence area in bold SEQID NO: miR-17 CAAAGUGCUUACAGUGCAGGUAG 1 miR-20a UAAAGUGCUUAUAGUGCAGGUAG 2 miR-20b CAAAGUGCUCAUAGUGCAGGUAG 3 miR-93 CAAAGUGCUGUUCGUGCAGGUAG 4 miR-10 ba AAAAGUGCUUACAGUGCAGGUAG 5 miR-10 6b UAAAGUGCUGACAGUGCAGAU 6

Previous studies using the instrumental research compound anti-miR-17 have identified the role of miR-17 in PKD in two different PKD models, the Pkd2-KO model (also known as Pkhd1/cre; Pkd2 ^F/F model) and the Rcy model. An instrumental research modified oligonucleotide complementary to miR-17 was tested in a mouse model of PRP. The anti-miR-17 compound was a fully thiophosphate oligonucleotide in 19-linked nucleosides of length (5'-CTGCACTGTAAGCACTTTG-3'; SEQ ID NO: 7) with DNA, 2'-MOE and S-cEt sugar moieties. Although this compound has mismatches with other members of the miR-17 family, testing in in vitro assays has shown that it hybridizes and inhibits all members of the miR-17 family.

Pkd2-KO mice spontaneously develop polycystic kidney disease. Mice were treated with 20 mg/kg of anti-miR-17 instrumental compound or control oligonucleotide or PBS. The results showed that treatment of anti-miR-17 mice with Pkd2-KO reduced the primary treatment measure, kidney weight to body weight, by 17% compared to control treatment (p=0.017). Anti-miR-17 treatment also significantly reduced BUN and mRNA expression of the kidney injury biomarkers, Kim1 and Nga1, in Pkd2-KO mice. Finally, anti-miR-17 treatment resulted in a trend towards lower serum creatinine and lower cystic index in Pkd2-KO mice. These results were not observed with the anti-miR control, indicating that they are specifically associated with miR-17 inhibition.

Pcy mice carrying a mutation in Nphp3 spontaneously develop polycystic kidney disease with slower disease progression than Pkd2-KO mice. Mice were treated with 50 mg/kg of anti-miR-17 instrumental compound or PBS once a week for 26 weeks. The mean kidney weight to body weight ratio in Pcy mice treated with anti-miR-17 was 19% lower than the mean kidney weight to body weight ratio in Psy treated Pcy mice alone (p=0.0003). Rcy mice treated with anti-miR-17 showed a reduction in cystic index by an average of 28% compared to Rcy mice injected with PBS alone (p=0.008).

These data demonstrated that, in two different experimental models of PKD, miR-17 is a validated target for the treatment of PKD.

Example 2 Compound Design and Screening.

While the instrumental research compound has shown efficacy in models of PBP, said compound has been found to be slightly pro-inflammatory in an in vivo study. In addition, the instrumental research compound has not been effective enough to be developed as a pharmaceutical for the treatment of PKD.

Accordingly, screening was performed to identify inhibitors of one or more members of the miR-17 family that are sufficiently potent, convenient to administer, and safe.

- 35 040625 for administration to subjects with PBP. An additional criterion was a sufficiently high ratio of delivery to the kidneys to delivery to the liver, to increase the proportion of the anti-miR-17 compound that is delivered to the target organ.

Approximately 200 modified oligonucleotides were constructed containing a nucleic base sequence complementary to the miR17 central sequence, of various lengths and chemistry. The length of the compounds ranged from 9 to 20 linked nucleosides, and the compounds differed in the number, type, and placement of chemical modifications. Because efficacy and safety cannot be predicted based on the chemical structure of a nucleic base compound, compounds have been evaluated both in vitro and in vivo for characteristics such as potency, efficacy, pharmacokinetic behavior, viscosity, safety and metabolic stability in a series of assays. designed to eliminate compounds with unfavorable properties. In some assays, the anti-miR-17 instrumental compound was used as a reference against which library compounds were compared. As described below, each of the nearly 200 compounds was first tested in multiple in vitro assays (e.g. potency, toxicology, metabolic stability) to identify a smaller set of compounds suitable for further testing in more complex in vivo assays (e.g. pharmacokinetic profile , efficacy, toxicology). The screening process was designed to identify a potential pharmaceutical agent based on aggregated data from all assays, focusing on efficacy, pharmacokinetic profile (eg, delivery to the kidneys), and safety characteristics.

Potency and efficacy in vitro and in vivo.

In vitro efficacy was assessed using a luciferase reporter assay. Luciferase reporter plasmid for miR-17 with two fully complementary miR-17 binding sites in tandem in the 3'-UTR of the luciferase gene. Longer compounds were selected if their maximum inhibition was greater than that of the anti-miR-17 instrumental compound. Because shorter compounds, such as 9-mers, are generally not maximally active under the same assay conditions used for longer compounds, shorter compounds were selected based on maximum inhibition relative to their respective control compounds. Thus, compounds that differ in length and chemical composition were included in further tests.

In vivo activity was assessed using microRNA polysome shift assay (miPSA - microRNA polysome shift assay). This assay was used to determine the extent to which the compounds directly interacted with the miR-17 target in the kidneys of normal and PRP mice. MiPSA is based on the principle that active miRNAs bind to their mRNA targets in translationally active high molecular weight (HMW) polysomes, while inhibited miRNAs reside in low MW (LMW) polysomes. Anti-miR treatment leads to miRNA shift from HMM polysomes to LMM polysomes. Thus, miPSA provides a direct measurement of target microRNA interactions with complementary anti-miR (Androsavich et al., Nucleic Acids Research, 2015, 44: e 13).

Selected compounds that passed multiple screening criteria were evaluated for efficacy in experimental models of PBP, eg, the Pkd2-KO mouse model and the Rcy mouse model. Mice were treated with an anti-miR-17 compound and evaluated for clinically relevant measurable parameters including kidney weight to body weight ratio, blood urea nitrogen, serum creatinine levels, and renal cystic index.

pharmacokinetic properties.

Metabolic stability was assessed by incubating each anti-miR-17 compound in mouse liver lysate. After 24 hours, the percentage of intact compound remaining was calculated. Compounds that are not stable after 24 hours of incubation are potentially not stable in vivo.

Pharmacokinetic properties and tissue distribution of selected compounds were evaluated in C57BL6 wild-type mice and JCK mice (PBP experimental model). The compound was administered to wild-type mice at 0.3, 3 or 30 mg/kg or to JCK mice at 3, 30 or 100 mg/kg. The mice were sacrificed after seven days. Kidney and liver tissues were collected. The concentration of anti-miR-17 compounds was measured in the liver and kidneys. Compounds that accumulate more in the kidney than in the liver (ie have a higher ratio of kidney accumulation to liver accumulation) were preferred.

A complete pharmacokinetic profile for selected compounds that passed multiple screening criteria was obtained in C57BL6 mice. In one study, mice were given a single subcutaneous injection of an anti-miR-17 compound at a dose of 30 mg/kg. In another study, mice were given three subcutaneous injections of an anti-miR-17 compound at 39 mg/kg over a two-month period. In each study, liver and kidney samples were collected at 1, 4, 8 hours, 1, 4, 7, 14, 28, and 56 days post-injection.

- 36 040625

toxicological data.

In in vitro assays, the potential for toxicity was assessed using a biochemical fluorescent binding assay (FBA-biochemical fluorescent binding assay) and analysis of liver or kidney sections. FBA is performed by incubating a fluorescent dye with each compound and immediately measuring the fluorescence. Highly fluorescent compounds have the ability to induce toxicity in vivo. Analysis of liver or kidney sections is performed by incubating a tissue section from a liver core sample isolated from a rat. After a 24 hour incubation, RNA is isolated from the tissue section and expression levels of 18 pro-inflammatory genes are measured. The induction of pro-inflammatory gene expression indicates the potential for pro-inflammatory effects in vivo.

Additional in vivo toxicological evaluations were performed by administering to normal mice (Svl29 mice) a single subcutaneous injection of 300 mg/kg of the anti-miR-17 compound. Mice were sacrificed four days later, blood was collected for serum chemistry, liver and spleen were weighed, and RNA was isolated from kidney and liver tissues. The level of expression of the pro-inflammatory gene, interferon-induced protein with tetratricopeptide repeats (IFIT - interferon-induced protein with tetratricopeptide repeats), was measured. Since induction of IFIT expression is potentially indicative of toxicity, compounds that do not induce IFIT expression are preferred.

Throughout the screening process, some anti-miR-17 compounds performed well in several assays. Although no compound was superior in every assay, after several screening steps, some compounds showed particularly favorable characteristics such as high potency and a relatively high ratio of kidney to liver accumulation. Of the nearly 200 compounds that were tested in in vitro assays, approximately 20 met the criteria for further in vivo testing. These 20 compounds were eventually reduced to five compounds, and finally to one compound, RG4326, which had the best overall profile and was selected as a potential pharmaceutical agent. Following the identification of this compound, additional studies were conducted to evaluate potency, pharmacokinetic profile, and efficacy.

RG4326 has the following sequence and chemical modification scheme: ASGSCMAFCFUFUMUSGS in which the nucleosides followed by the index M are 2'-O-methyl-nucleosides, the nucleosides followed by the index F are 2'fluoronucleosides, the nucleosides followed by index S follows, are S-cEt nucleosides, each cytosine is an unmethylated cytosine, and all bonds are thiophosphate bonds. As illustrated in the following examples, this compound exhibited a strong target interaction with miR-17 in vivo, efficacy in a mouse model of PBP, and a pharmacokinetic profile that favored distribution to the kidneys.

In addition, the viscosity of RG4326 was found to be 6 cP at a concentration of approximately 150 mg/ml (in water at 20°C), thus RG4326 in solution is suitable for administration by subcutaneous injection.

Example 3 Additional short anti-miR-17 compounds.

An additional nine nucleotide compound (RG4047), in which each nucleoside is an S-cEt nucleoside, was tested in separate assays to compare activity, safety and pharmacokinetic profile with RG4326.

One of the assays used was a luciferase assay. As noted above, short (eg, 9-nucleotide) anti-miR-17 compounds, while they may be advantageous in in vivo studies, do not necessarily perform well in in vitro transfection assays. Accordingly, the transfection conditions in the luciferase assay were optimized for short anti-miR-17 compounds so that the inhibitory activity of the compounds could be measured.

RG5124 was used as a control compound. RG5124 is 9 linked nucleosides long and has the same sugar modification pattern as RG4326, but has a nucleobase sequence that is not complementary to miR-17.

The luciferase reporter plasmid for miR-17 contained a fully complementary miR-17 binding site in the 3'UTR of the luciferase gene. HeLa cells were transfected with miRNA mimetic and its cognate luciferase reporter, followed by transfection with anti-miR-17 at doses of 0.001, 3, 10, 30, 100, and 300 nM. At the end of the 24 hour transfection period, luciferase activity was measured. As shown in Table. 2, RG4047, although not as potent as RG4326, inhibited miR-17 activity in a dose dependent manner. SD indicates the standard deviation.

- 37 040625

Table 2. Luciferase reporter assay

The multiplicity of luciferase derepression in each concentration of anti-mHI-17 (nM) 300 nM 100 nM thirty nM 10 nM 3 nM 0.00 1 nM RG4326 A ₃ 6 _a C, LrS _R i _g i _m i _a G _a Average 11.7 13.9 14.1 10.4 5.3 1 SO 3.6 6, 5 6, 9 4.9 18 0.2 RG5124 Ad C d A^ApU pGp CpfAg C d Average 1 0.7 1 2.6 1.2 1 SO 0.3 0.4 0.4 2.8 0.4 0.2 RG4047 A _S G _S C _S A _S C _S U _S U _S U _S G _S Average 7.5 8.2 3.5 2.2 16 1 SO 3 3 3 3 3 60

RG4047 was evaluated for in vivo activity, safety, and renal and hepatic distribution. As with the large library screen, in vitro activity did not predict in vivo behavior. RG4047 elicited a weak pro-inflammatory signal in both kidney and liver, was a less potent inhibitor of miR-17 than RG4326 in vivo in both WT and PKD mice, and had a much lower kidney-to- accumulation in the liver. These studies showed that the activity and properties of RG4047 were not improved compared to RG4 326.

Example 4 RG4326 activity in additional in vitro assays.

Additional in vitro studies were conducted to further investigate the activity of RG4326. A luciferase reporter assay was used to test the ability of RG4326 to inhibit members of the miR-17 family: miR-17, miR-20a, miR-93 and miR-106b. A luciferase reporter plasmid was constructed for each of miR-20a, miR-93 and miR-106b with a fully complementary miRNA binding site in the 3'-UTR of the luciferase gene. HeLa cells were transfected with a miRNA mimetic and its cognate luciferase reporter, followed by transfection with anti-miR-17 at a dose of 100 nM. As shown in Table. 3, miR-17, miR-20a, miR-93, and miR-106b were each inhibited by RG4326, demonstrating that the anti-miR-17 compound inhibited several members of the miR-17 family. Since RG4326 is 100% complementary to other untested members of the miR-17 family, miR-20b and miR-106b, they are also expected to inhibit these miRNAs. The data in the table. 3 are also shown in FIG. 1A.

Table 3. Inhibition of the miR-17 family in vitro

Mean value (times) of luciferase derepression SO miR-17 13, 1 16 miR-2 0 21.7 2.8 miR-93 10, 9 0.9 miR-106 17.7 5, 5

To test the ability of RG4326 to inhibit the regulation of miR-17 endogenous targets, miR-17 target gene derepression was assessed in vitro in several kidney cell types from the kidneys of normal and PKD mice. Mouse collecting duct cells (IMCD3) were treated with 0.3, 1.2, 4.7, 18.8, 75 and 300 nM RG4326 or control oligonucleotide RG5124. Additional controls included untreated cells and mock-transfected cells (cells treated with transfection reagent only). After a 24 hour transfection period, cells were harvested and RNA was extracted. The mRNA levels of the 18 miR-17 target genes were measured and averaged to provide the pharmacodynamic value of the characteristic set of parameters (PD value of the characteristic set of parameters) represented as Log2-fold change (Log2FC) relative to sham transfection. As shown in Table. 4, RG4326, but not control treatment, derepressed miR-17 targets in a dose dependent manner. The data is also shown in Fig. 2B.

- 38 040625

Table 4. PD value of a characteristic set of miR-17 parameters in IMCD3 cells

aHTH-miR-17 compound concentration (nM) 0.3 1.2 4.7 18.8 75 300 RG4326 Average -0.075 -0.067 0.027 0.272 0.369 0.373 Log2FC SO 0.020 0.017 0.014 0.037 0.006 0.002 RG5124 Average Log2FC -0.083 -0.103 -0.097 -0.108 -0.124 -0.065 SO 0.033 0.013 0.026 0.041 0.039 0.037

The ability of RG4326 to derepress miR-17 targets was also evaluated in additional kidney cell types derived from the kidneys of both normal and PBP mice. Cells were treated with 30 nM RG4326 or control oligonucleotide RG5124. After a 24 hour transfection period, cells were harvested and RNA was extracted. The mRNA levels of the 18 miR-17 target genes were measured and averaged to provide the pharmacodynamic value of the characteristic set of parameters (PD value of the characteristic set of parameters) represented as Log2-fold change (Log2FC) relative to sham transfection. As shown in Table. 5, RG4326, but not the control oligonucleotide, derepressed miR-17 targets in several different cell types derived from healthy and diseased kidneys. P < 0.05 indicates a p value of less than 0.05 calculated using one-way ANOVA (analysis of variation). NC indicates a change that is not statistically significant.

Table 5. Derepression of miR-17 targets in kidney cells

Mouse kidney cell type Cell line nomenclature Mouse Origin kidney RG4326 PD value of characteristic set of parameters (Log2FC@30 nM) RG5124 PD value of characteristic set of parameters (Log2FC@30 nM) collecting ducts DBA-DT Normal 0.40±0.09; p<0.05 0.10±0.05; NZ collecting ducts DBA-PBP PBP 0.52±0.06; p<0.05 -0.07±0.02; NZ collecting ducts IMCD3 Normal 0.57±0.06; p<0.05 -0.03±0.05; NZ Collective ducts ml Normal 0.18±0.18; p<0.05 -0.08±0.02; NZ Distal tubules MSCT Normal 0.10±0.01; p<0.05 0.03±0.01; NZ Proximal tubules LTL-DT Normal 0.35±0.02; p<0.05 -0.04±0.02; NZ Proximal tubules LTL-PBP PBP 0.39±0.01; p<0.05 -0.03±0.04; NZ

Example 5 Potency of RG4326 in vivo.

MicroRNA polysome shift assay (miPSA) was used to identify compounds that directly bind to miR-17 in the kidneys of normal and PRP mice. MiPSA is based on the principle that active miRNAs bind to their mRNA targets in translationally active high molecular weight (HMW) polysomes, while inhibited miRNAs reside in low MW (LMW) polysomes. Anti-miR treatment leads to miRNA shift from HMM polysomes to LMM polysomes. Thus, miPSA provides a direct measurement of target microRNA interactions with complementary anti-miR (Androsavich et al., Nucleic Acids Research, 2015, 44: e13).

For this experiment, the model chosen for PKD was JCK, a mouse model of slowly progressive polycystic kidney disease associated with the same gene that causes human type 9 nephronophthisis. Renal cysts in this mouse develop in several areas of the nephron.

C57BL6 mice were treated with a single subcutaneous dose of 0.3, 3 and 30 mg/kg of RG4326 or instrumental anti-miR-17 (described in Example 1). JCK mice were treated with a single subcutaneous dose of 3, 30 and 100 mg/kg of RG4326 or instrumental anti-miR-17. FSB treatment was used as

- 39 040625 additional controls.

Seven days after treatment, mice were sacrificed and kidney tissue was isolated for miPSA. The calculated bias estimates shown in Table. 6 demonstrated a strong target interaction of RG4326 in both normal and PKD kidneys. The replacement rates after treatment with RG4326 were higher than those after treatment with anti-miR-17 instrumentation. Data for wild-type mice and JCK mice are also shown in FIG. 3A and 3B, respectively.

Table 6. Target interaction with RG4326 in vivo

Normal mice JSK mice Dose of antimiR Dose of anti-miR 0.3 mg/ kg 3 mg/ kg thirty mg/ kg 3 mg/ kg 30 mg/ kg 100 mg/ kg RG4326 Average 2.29 2.91 3.19 Average 1, 63 2.58 2.73 co 0.52 0.97 0.81 co 0.04 0.32 0.53 Instrumental antimiR-17 Average 1.51 2.05 2.77 Average 0.97 1.67 2.08 SO 0.51 0.79 0.55 SO 0.21 0.27 0.46 PBS Average 0.03 Average 0.00 co 0.52 co 0.28

Example 6 In vivo efficacy of RG4326 in experimental PBP models.

Two experimental PBP models were used to evaluate the effectiveness. Pkd2-KO mice spontaneously develop polycystic kidney disease and have been used as a model for ADPKD. See Patel et al., PNAS, 2013; 110(26):10765-10770. Pcy mice carrying a mutation in Nphp3 spontaneously develop polycystic kidney disease with slower disease progression than Pkd2-KO mice. The Rcy model is used as a model for nephronophthisis. See Narre and Peters, Nat. Rev. Nephrol., 2014; 10:587-601.

Model Pkd2-KO.

RG4326 has been tested in the Pkd2-KO mouse model of ADPBP. This model is also referred to as the PKD2-KO model. Wild-type mice were used as control mice. An oligonucleotide complementary to miRNA unrelated to miR-17 was used as a specificity treatment control (RG5124).

On each of days 10, 11, 12 and 19 from birth, sex-matched mice of the same litter were injected subcutaneously with RG4326 at a dose of 20 mg/kg (n=12), RG5124 at a dose of 20 mg/kg (n=12), instrumental anti -miR-17 at a dose of 20 mg/kg (n=12) or PBS (n=12). Mice were sacrificed at 28 days of age and kidney weight, body weight, cystic index, serum creatinine, and blood urea nitrogen (BUN) were measured. The BUN level is a marker of kidney function. Higher BUN levels are correlated with worsening kidney function, so a decrease in BUN levels is indicative of reduced kidney injury and damage and improved function. Statistical significance was calculated by one-way ANOVA with Dunnett's multiple correction.

The cystic index is a histological measurement of the cystic area relative to the total area of the kidneys. For this analysis, one kidney was perfused with cold PBS and 4% (w/v) paraformaldehyde and then taken for analysis. The kidneys were fixed with 4% paraformaldehyde for 2 h and then embedded in paraffin for dissection. Sagittal sections of the kidneys were stained with hematoxylin and eosin (H&E). All image processing steps were automated and performed in freely available open source software: the R1 script, which used functions from the Image Bioconductor 2 UB package and the ImageMagick3 image processing toolkit. The Aperio SVS H&E kidney images were converted to TIFF images and the first frame was saved for image analysis. First, the total cross-sectional area of the kidney was calculated using image segmentation. Image segmentation was used in a similar manner to find all internal structures, including the renal cyst. A filter has been applied to remove all objects that have a radius less than three pixels. The cystic index is the area of the image associated with cysts divided by the total area of the kidneys. The cystic index was calculated separately for longitudinal and transverse sections of the kidneys for each individual animal.

The combined cystic index of individual animals was compared for each treatment group.

The results are presented in table. 7. The mean kidney mass to body weight ratio (MP/BW ratio) in Pkd2-KO mice treated with RG4326 was 29% lower than the mean MP/BW ratio in Pkd2-KO mice injected with PBS (p=0, 0099). Pkd2-KO mice treated with RG4326 showed a mean 12% reduction in cystic index compared to Pkd2-KO mice injected with PBS, although the difference was not statistically significant. Mean BUN levels were reduced by 13% in Pkd2-KO mice treated with PBS, although the difference was not statistically significant. Mean serum creatinine levels in Pkd2-KO mice treated with RG4326 were 18% lower than in Pkd2KO mice injected with PBS, although the result was not statistically significant. These results were not observed with the control oligonucleotide, indicating that they are specifically related to miR-17 inhibition. While a previous study demonstrated a decrease in the MP/MT ratio, BUN, and cystic index in Pkd2-KO after anti-miR-17 treatment, no statistically significant changes were observed in this study. Treatment with the control oligonucleotide, RG5124, did not reduce kidney weight to body weight, cystic index, or BUN.

MP/MT ratio, BUN, and cystic index are also shown in FIG. 4A, 4B and 4C, respectively.

Table 7. Efficiency of RG4326 in the PBP Pkd2-KO model

MP/MT mg/g Ratio BUN mg/dL cystic index Serum creatinine mg/dL RG4326 Average 40, 98 72.92 50.3 0.26 SO 5,973 15, 1 10.21 0.05 RG5124 Average 55, 35 86, 67 56, 67 0.31 SO 11.73 20, 18 6,679 0.08 FSB Average 57.72 83.58 56.86 0.31 SO 18.47 23, 96 7.928 0.14

These results demonstrate that treatment with RG4326 results in a positive result in Pkd2-KO mice for the biological measurable parameter related to PBP treatment, kidney volume relative to body weight. With respect to this particular measured parameter, RG4326 was more effective than the anti-miR-17 instrumental compound. Treatment with RG4326 resulted in a trend towards a decrease in BUN and a decrease in cystic index in Pkd2-KO mice.

Rsu model.

RG4326 has been tested on a mouse model of Rsu. Wild type mice were used as a control group. From four weeks of age, Rcy mice were treated once a week with a subcutaneous injection of RG4326 at a dose of 25 mg/kg, instrumental anti-miR-17 at a dose of 25 mg/kg, control oligonucleotide RG5124 at a dose of 25 mg/kg, or PBS. Each treatment group contained 15 male mice. Three treatments were given at 55, 56 and 57 days of age and then weekly at 6, 7, 8, 9, 10, 11, 12, 13 and 14 weeks of age. Tolvaptan, a V2 vasopressin receptor (VRA) antagonist given to some patients with polycystic kidney disease, has also been tested. Mice were sacrificed at 15 weeks of age. Body weight was recorded. One of the kidneys was extracted and weighed, and the others were processed for histological analysis to calculate the cystic index, as described for the study in Pkhd1/cre; Pkd2 ^F/F . Blood urea nitrogen (BUN) and serum creatinine levels were measured. Statistical significance was calculated by one-way ANOVA with Dunnett's multiple correction.

The results are presented in table. 8. Relative to the mean MP/MT ratio in PBS-treated mice, the mean MP/MT ratio in Rsu-treated mice was 19% lower in the 25 mg/kg RG4326 group (p=0.0055). In addition, the cystic index was reduced by 34% in Rcy mice treated with RG4326 compared to Rcy mice injected with PBS (p=0.016). Treatment with RG4326 reduced BUN in Rsu mice by 16% compared to BUN in PBS-treated Rsu mice (p=0.0070). Treatment with a control oligonucleotide or anti-miR-17 instrumental compound did not result in a statistically significant reduction in MP/MT ratio, BUN, or cystic index. Tolvaptan was not effective in this study. The data in the table. 8 are also shown in FIG. 5.

- 41 040625

Table 8. Efficiency of RG4326 in RSU model

MP/MT Ratio AMC cystic Index RG4326 Average 18.1 19, 7 0.16 SO 20 2.8 0.06 RG5124 Average 21.4 21.2 0.23 SO 3, 4 2.3 0.08 Tolvaptan Average 20, 1 24.4 026 SO 4.5 3.4 0.09 FSB Average 22.5 23.4 0.24 SO 3, 9 3, 8 0.07

These data demonstrate in a complementary PBP model that treatment with RG4326 results in a reduction in kidney mass, BUN, and cystic index.

Example 7 Pharmacokinetic evaluation of RG4326.

Due to their reduced ability to bind to serum proteins, which is a property that determines the distribution of oligonucleotides in the body, short oligonucleotides are not strongly expected to have pharmacokinetic properties that make them suitable for use as drugs. RG4326 was incubated in mouse, monkey or human liver homogenate. The identity and concentration of RG4326 and metabolites were determined after 24 hours of incubation. RG4326 and metabolites were extracted using liquid-liquid extraction (LLE) and/or solid-phase extraction (SPE), which were then analyzed for identity and concentration using reversed-phase ion-pairing-pairing high-performance liquid chromatography (ion-pairing-reversed-phase) combined with time-of-flight mass spectrometry (IP-RP-HPLC-TOF). As shown in Table. 9, despite its short length, RG4326 was found to have a particularly favorable pharmacokinetic profile, with over 95% of the parent compound RG4326 remaining intact after 24 hours of incubation.

Table 9 In Vitro Metabolic Stability in Mouse, Monkey and Human Liver Lysate

Ex Vivo liver lysate (% analyte) Compound Subsequence Mouse Monkey Human RG4326 5'- AsGsCmAfCfUfUmUsGs-3' 99.1 95.9 98.7 Metabolite 1 5'-A _s G _s CmAfCf-3' 0.3 18 0.6 Metabolite 2 5'-A _s GsCmAf-3' 0.6 2.3 0.7

Pharmacokinetic behavior was assessed by administering a single 30 mg/kg subcutaneous dose of RG4326 or an anti-miR-17 instrumental compound to wild-type mice. At 1, 4, 8 hours, 1, 7, 14, 28 and 56 days after a single injection, mice were sacrificed and the average concentration of the anti-miR compound in kidney and liver tissue (µg/g) was measured as described above. The area under the curve (AUC) was calculated for kidney and liver tissue using the formula µg*h/g, with µg being the amount of oligonucleotide in the tissue, h being the tissue collection time in hours, and g being the weight of the tissue. The ratio of renal AUC to liver AUC was determined. Kidney tissue was also treated for miPSA to determine the target interaction for each compound in this study. PSA AUC was calculated using the formula Log2FC*h, where Log2FC is the replacement value, h is the time of tissue collection in hours. Kidney potential on day 7 was calculated using the formula Log2FC+g/μg, with Log2FC being the amount of substitution determined by miPSA, r being the mass of kidney tissue, and μg being the amount of anti-miR in kidney tissue on day 7.

As shown in Table. 10, the ratio of kidney AUC to liver AUC for RG4326 is higher than for instrumental anti-miR-17. Strikingly, although AUC in the kidney is lower for RG4326 than for a compound with an anti-miR-17 agent, the activity determined by miPSA is significantly higher. Thus, RG4326 is more active at lower concentrations in the kidney, the main target tissue for PBP.

- 42 040625

Table 10. Pharmacokinetic profile of RG4326

In vivo profile after a single dose at 30 mg/kg Instrumental Anti-miR-17 RG4326 Pharmacokinetics Kidney AUC (mcg*h/g; one hour to 56 days) 20711 5347 Liver AUC (mcg*h/g; one hour to 56 days) 20275 1206 Kauc/Lauc ratio 1.0 4.4 miR-17 inhibition Renal miPSA AUC(Log2FC*h; 8 hours to 7 days) 296 463 potency Kidney D7 (Log2FC * g/mcg) 0.047 0.351

The pharmacokinetic behavior of RG4326 was further characterized in wild-type (C57B16) and PBP (JCK) mice. Groups of 5 mice received three subcutaneous injections of 10 mg/kg on each of three consecutive days. At 1, 4, 7, 14 and 21 days after the third and final injection, mice were sacrificed and plasma, kidney and liver samples were collected. For RG4326 measurement, RG4326 was extracted using liquid-liquid extraction (LLE) and/or solid-phase extraction (SPE), and then analyzed for identity and concentration using ion-pairing-reversed-phase high performance liquid chromatography in combined with time-of-flight mass spectrometry (IP-RP-HPLC-TOF).

The data are summarized in Table. 11. RG4326 was observed to be stable in both plasma and tissues, with over 90% of the parent compound remaining after 21 days. Anti-miR is rapidly distributed in tissues within a few hours after injection and, above all, in the kidney. The half-life is approximately eight days in the liver and kidneys of wild-type mice, approximately six days in the liver of JCK mice, and approximately 8 days in the kidneys of JCK mice. In wild-type mice, the ratio of kidney AUC to liver AUC was 17. In PKD mice, the ratio of kidney AUC to liver AUC was 13. These data demonstrate that the pharmacokinetic profile of RG4326 is comparable in normal and PKD mice.

Table 11. Pharmacokinetic profile of RG4326 in normal and PBP mice

mouse model Normal PBP mouse line C57BL6 JCK Tissue matrix Liver Bud Liver Bud /Parents >90% >90% >90% >90% From ₂ 4h 1.6 µg/g 61.4 µg/g 5.9 µg/g 66.5 µg/g T 1/2 ~ 8 days ~ 8 days ~ 6 days ~ 8 days AUC 0-21days 17 mcg * day / g 282 mcg * day / g 37 mcg * day / g 497 mcg * day / g Po/Pe Ratio (AUC) 17 13 Po/Pe Ratio (C24h) 38 eleven

Example 8: RG4326 Safety Assessment.

The potential for renal and hepatic toxicity was assessed in in vitro, ex vivo and in vivo assays.

The potential for toxicity was assessed using a biochemical fluorescent binding assay (FBA biochemical fluorescent binding assay). FBA is performed by incubating a fluorescent dye with each compound and immediately measuring the fluorescence. Results are expressed as fold change (linear FC) relative to controls.

Highly fluorescent compounds have the ability to induce toxicity in vivo.

Ex vivo analyzes were performed using liver or kidney tissue sections. Analysis of liver or kidney sections is performed by incubating a tissue section from a liver or kidney core sample isolated from a rat.

After a 24 hour incubation, RNA is extracted from the tissue section and expression levels of 18 pro-inflammatory genes, including IFIT, are measured. A log2 transformation of the multiplicity change was performed (Log2-

Claims (14)

FC) regarding FSB processing. The induction of pro-inflammatory gene expression indicates the potential for pro-inflammatory effects in vivo. The in vivo assay was performed on normal Sv129 mice. A single subcutaneous dose of RG4326 300 mg/kg was administered. PBS and two non-miR-17 anti-miRs were included as controls, one known to be pro-inflammatory (positive control) and the other non-pro-inflammatory (negative control). Four days later, the mice were sacrificed. Kidney and liver tissue was isolated for RNA isolation. The expression level of the IFIT gene, which is known to be induced during an inflammatory response, was measured and normalized to mouse GAPDH. A fold change log2 transformation (Log2-FC) was performed with respect to FSB processing. Table 12. RG4326 Security Profile Positive control Negative control RG4326 Biochemical Fluorescence Binding Assay Relative Fluorescence Unit (Linear EC) 136.4 ± 14.9 46.3 ± 14.7 24.9 ± 3.1 Ex Vivo analysis of kidney sections Characteristic distribution of the pro-inflammatory parameter (Log2-FC) 1.35±0.35 0.39±0.07 -0.30±0.22 Analysis of liver sections Ex Vivo Expression of IFIT3 (Log2-FC) 7.57±0.62 0.54±0.60 1.11±0.32 In Vivo Acute Phase Analysis Kidney IFIT Expression (Log2-FC) Expression of IFIT in the liver (Log2-FC) 1.29±0.58 2.24±0.84 0.28±0.31 0.62±0.54 0.34 (n=1) 0.21 ± 0.08 These data demonstrated that RG4326 showed a favorable safety profile and a low risk of inflammatory propensity based on multiple analyses. CLAIM 1. A method of treating polycystic kidney disease, comprising administering to a subject in need thereof a modified oligonucleotide, wherein the subject has been diagnosed with polycystic kidney disease, wherein said modified oligonucleotide consisting of 9 linked nucleosides has the following nucleoside distribution pattern in the direction from 5 'to 3': NsNsNmNfNfNfNmNsNs, where nucleosides followed by subscript M are 2'-O-methylnucleosides, nucleosides followed by subscript F are 2'-fluoronucleosides, nucleosides followed by subscript S are S-cEt nucleosides and all bonds are thiophosphate bonds; and wherein the nucleobase sequence of said modified oligonucleotide contains the nucleobase sequence 5'-AGCACUUUG-3', each cytosine being independently selected from unmethylated cytosine and 5-methylcytosine; or their pharmaceutically acceptable salt. 2. The method according to claim 1, where the modified oligonucleotide has the structure - 44 040625 or a pharmaceutically acceptable salt thereof. 3. The method according to claim 1, where the modified oligonucleotide has the structure 4. The method according to any one of claims 1 to 3, characterized in that the compound is present in a pharmaceutically acceptable diluent. 5. The method of claim 4, wherein the pharmaceutically acceptable diluent is saline. 6. The method according to any one of the preceding claims, wherein the polycystic kidney disease is autosomal recessive polycystic kidney disease or autosomal dominant polycystic kidney disease. - 45 040625 7. The method according to any one of the preceding claims, wherein the subject has a mutation selected from a mutation in the PKD1 gene or a mutation in the PKD2 gene. 8. A method according to any one of the preceding claims, wherein the subject has one or more of the following: a) an increase in the total volume of the kidneys; b) arterial hypertension; and/or c) impaired renal function. 9. The method according to any of the previous paragraphs for: a) improving kidney function in the subject; b) delaying the deterioration of kidney function in the subject; c) reducing the total volume of the kidneys in the subject; d) slowing the increase in the total volume of the kidneys in the subject; e) inhibition of cyst growth in a subject; f) slowing the growth of cysts in the subject; g) reducing kidney pain in a subject; h) slowing down the worsening of kidney pain in the subject; i) delaying the onset of kidney pain in the subject; j) reducing arterial hypertension in the subject; k) slowing the exacerbation of hypertension in the subject; l) delaying the onset of hypertension in the subject; m) reducing fibrosis in the subject's kidney; n) slowing the progression of fibrosis in the subject's kidney; o) delaying the onset of end-stage renal disease in a subject; p) delaying the start time of dialysis for the subject; q) delaying the time of kidney transplantation for the subject; and/or r) increasing the lifespan of the subject. 10. The method according to any of the previous paragraphs for: a) reducing albuminuria in the subject; b) slowing the deterioration of albuminuria in the subject; c) delaying the onset of albuminuria in the subject; d) reducing hematuria in the subject; e) slowing the increase in hematuria in the subject; f) delaying the onset of hematuria in the subject; g) reducing the level of urea nitrogen in the blood of the subject; h) reducing the serum creatinine level in the subject; i) improving creatinine clearance in a subject; j) reducing the albumin:creatinine ratio in the subject; k) improving the glomerular filtration rate in the subject; l) slowing the rate of decline in glomerular filtration rate in a subject; m) reducing the amount of neutrophil gelatinase-associated lipocalin (NGAL) protein in the subject's urine; and/or n) reducing the level of kidney injury molecule 1 (KIM-1) protein in the subject's urine. 11. The method according to any one of claims 8 or 9, wherein the total kidney volume is growth-normalized total kidney volume. 12. The method according to any one of the preceding claims, comprising the use of at least one additional therapy, wherein at least one additional therapy is an antihypertensive agent. 13. The method according to any of the preceding claims, comprising the use of at least one additional therapy selected from an angiotensin Π-converting enzyme (ACE) inhibitor, an angiotensin II receptor blocker (ARB), a diuretic, a calcium channel blocker, a kinase inhibitor, an adrenergic receptor antagonist , vasodilator, benzodiazepine, renin inhibitor, aldosterone receptor antagonist, endothelin receptor blocker, mammalian rapamycin (mTOR) inhibitor, hormone analogue, vasopressin 2 receptor antagonist, aldosterone receptor antagonist, dialysis and kidney transplant. 14. The method according to claim 13, characterized in that: a) an angiotensin II converting enzyme (ACE) inhibitor is selected from captopril, enalapril, lisinopril, benazepril, quinapril, fosinopril and ramipril; b) an angiotensin II receptor blocker (ARB) is selected from candesartan, irbesartan, olmesartan, losartan, valsartan, telmisartan and eprosartan; c) the vasopressin 2 receptor antagonist is tolvaptan; d) the aldosterone receptor antagonist is spironolactone; e) the kinase inhibitor is selected from bosutinib and KD019; -