EA040077B1 - ANTI-GITR ANTIBODIES AND METHODS OF THEIR APPLICATION - Google Patents

Description

Sequence listing

The present patent application contains a sequence listing that has been filed electronically in ASCII format and is incorporated herein by reference in its entirety.

The specified ASCII copy, created on May 27, 2015, is named 3617.009PC02_SL_PatentIn_ST25.txt and is 747129 bytes in size.

1. Technical field

The present invention provides antibodies that specifically bind to the glucocorticoid-induced TNFR family receptor (GITR) and compositions containing such antibodies. In a specific aspect, the antibodies specifically bind to human GITR and modulate GITR activity, eg, increase, activate or induce GITR activity. The present invention also provides methods for treating disorders such as cancer and infectious diseases by administering an antibody that specifically binds to human GITR and modulates GITR activity, eg increases, activates or induces GITR activity.

2. State of the art

Glucocorticoid-inducible TNFR-like protein (GITR), a member of the TNFR superfamily, is expressed in many components of the innate and adaptive immune system and stimulates both adaptive and innate immunity (Nocentini G et al. (1994) PNAS 94: 6216-6221; Hanabuchi S et al (2006) Blood 107: 3617-3623 Nocentini G & Riccardi C (2005) Eur J Immunol 35: 10161022 Nocentini G et al (2007) Eur J Immunol 37: 1165-1169). It is expressed in several cells and tissues, including T-, B-, dendritic cells (DCs) and natural killer (NK) cells, and is activated by its ligand, GITRL, expressed primarily on antigen-presenting cells (APCs), endothelial cells and also in tumor cells. The GITR/GITRL system is involved in the development of autoimmune/inflammatory responses and stimulates the response to infections and tumors. For example, treatment of animals with GITR-Fc fusion protein alleviates autoimmune/inflammatory diseases, in addition, initiation of GITR is effective in the treatment of viral, bacterial and parasitic infections, as well as in increasing the immune response against tumors (Nocentini G. et al. (2012) Br J Pharmacol 165: 208999). These effects are due to several parallel mechanisms, including coactivation of effector T cells, inhibition of regulatory T cells (Treg), coactivation of NK cells, macrophage activation, modulation of dendritic cell function, and regulation of the extravasation process. Membrane expression of GITR is upregulated after T cell activation (Hanabuchi S et al. (2006) supra; Nocentini G & Riccardi C supra). Its initiation coactivates effector T lymphocytes (McHugh RS et al. (2002) Immunity 16: 311-323; Shimizu J et al. (2002) Nat Immunol 3: 135-142; Roncheti S et al. (2004) Eur J Immunol 34: 613-622 Tone M et al (2003) PNAS 100: 15059-15064). GITR activation increases resistance to tumors and viral infections, is involved in autoimmune/inflammatory processes, and regulates leukocyte extravasation (Nocentini G & Riccardi C (2005) supra; Cuzzocrea S et al. (2004) J Leukoc Biol 76: 933-940; Shevach EM & Stephens GL (2006) Nat Rev Immunol 6: 613-618; Cuzzocrea S et al. (2006) J Immunol 177: 631-641; Cuzzocrea S et al. (2007) FASEB J 21: 117-129). Human GITR is expressed at very low levels in peripheral (non-activated) T cells. After T cell activation, there is a strong upregulation of GITR for several days in both CD4 ⁺ and CD8 ⁺ cells (Kwon B et al. (1999) J Biol Chem 274: 6056-6061; Gurney AL et al. ( 1999) Curr Biol 9: 215-218 Ronchetti S et al (2004) supra Shimizu J et al (2002) supra Ji HB et al (2004) supra Ronchetti S et al (2002) Blood 100 : 350-352; Li Z et al. (2003) J Autoimmun 21: 83-92), while CD4 ⁺ cells are characterized by a higher expression of GITR than CD8 ⁺ cells (Kober J et al. (2008) Eur J Immunol 38 (10): 2678-88 Bianchini R et al (2011) Eur J Immunol 41(8): 2269-78).

Given the role of human GITR in modulating immune responses, this document provides antibodies that specifically bind to GITR and the use of such antibodies to modulate GITR activity.

3. The essence of the invention

In one aspect, provided herein are antibodies and fragments thereof that specifically bind to GITR (eg, human GITR). In one embodiment, an antibody or antigen-binding fragment thereof that specifically binds to GITR (e.g., human GITR) partially inhibits the binding of a GITR ligand (e.g., human GITRL) to GITR as assessed by a method known to one of skill in the art or described herein. (see, for example, sections 6.2.5.2 and 6.2.5.4 below). In a particular embodiment, the antibody or antigen-binding fragment thereof at a concentration of 1000 ng/ml inhibits less than 80% of 0.5 nM GITRL (e.g., human GITRL) from binding to bead-bound GITR (e.g., human GITR bound to Luminex® beads) in 5 pg/mL/bead versus 0.5 nM GITRL binding to bead-bound GITR at 5 pg/mL/bead in the absence of anti-GITR antibody or antigen-binding fragment thereof in a suspension matrix assay. In certain embodiments, the antibody or antigen-binding fragment thereof inhibits 40% to 70%, 50% to 70%, 50% to 80%, or 40% to 80% of GITRL (e.g., human GITRL) binding to GITR (e.g., human GITR) . In another specific embodiment, at least 20% of the amount of GITRL (e.g., human GITRL) that binds to GITR (e.g., human GITR) in the absence of an antibody or antigen-binding fragment thereof binds to GITR (e.g., human GITR) in the presence of an antibody or antigen-binding fragment thereof in an assay comprising: (a) binding of GITR (eg, human GITR) to beads at a concentration of 5 pg/ml/bead; (b) incubation associated with GITR (eg human GITR) beads at a concentration of 40 beads/µl with or without antibody in the well; (c) adding labeled GITRL (eg, labeled human GITRL) to the well to give a final concentration of 0.5 nM GITRL (eg, human GITRL) and 20 beads/µl GITR-bound beads; and (d) detecting labeled GITRL (eg, human GITRL) associated with GITR-related (eg, human GITR) beads by a method, eg, suspension matrix analysis. In some embodiments, 20 to 60%, 20 to 50%, 30 to 60%, or 30 to 50% of the amount of GITRL (e.g., human GITRL) that binds to GITR (e.g., human GITR) in the absence of antibody or an antigen-binding fragment thereof, binds to a GITR (eg, human GITR) in the presence of an antibody or antigen-binding fragment thereof.

In certain embodiments of the invention, the antibody or antigen-binding fragment contains:

(a) a heavy chain variable region (VH) hypervariable region (CDR) 1 comprising, consisting of, or predominantly consisting of the amino acid sequence X1YX2MX3 (SEQ ID NO: 1) wherein

X1 is D, E, G or A;

X ₂ is A, V, L, I, P, F, M, or Y; And

X ₃ represents Y, G, N, Q, S, T, C, W, F or H;

(b) a VH CDR2 comprising, consisting of, or predominantly consisting of the amino acid sequence X1IX2X3X4SGX5X6X7YX8QKFX9X10 (SEQ ID NO: 2), wherein

X1 is V, A, L, I, P, F, M or T;

X ₂ represents R, K, H, Q or A;

X ₃ is T, G, N, Q, S, C, W, Y, V, I, or P;

X ₄ is Y, G, N, Q, S, T, C, W, F, H, or A;

X ₅ is D, E, G or A;

X ₆ is V, A, L, I, P, F, M or T;

X ₇ is T, G, N, Q, S, C, W, Y, V, I, P, or A;

X ₈ is N, G, Q, S, T, C, W, Y, or A;

X ₉ is K, R, H, Q or A; And

X ₁₀ is D, E, G or A;

(c) a VH CDR3 comprising, consisting of, or predominantly consisting of the amino acid sequence SGTVRGX1X2X3 (SEQ ID NO: 3) wherein

X1 is F, A, V, L, I, P, M, Y, W, H, or S;

X ₂ is A or D; And

X ₃ represents Y, G, N, Q, S, T, C, W, F, H or V;

(d) a light chain variable region (VL) CDR1 comprising, consisting of, or predominantly consisting of the amino acid sequence KSSQSX1X2X3X4X5X6X7KX8YLX9 (SEQ ID NO: 4), wherein

X1 is L, A, V, I, P, F or M;

X2 is L, A, V, I, P, F, M, or S;

X3 is N, G, Q, S, T, C, W, Y, or A;

X4 is S, G, N, Q, T, C, W, Y, or A;

X ₅ is G, N, Q, S, T, C, W, Y, or A;

X ₆ is N, G, Q, S, T, C, W, Y, or A;

X ₇ is Q, G, N, S, T, C, W, Y, or A;

X ₈ is N, G, Q, S, T, C, W, Y, or A; And

X ₉ is T, G, N, Q, S, C, W, Y, V, I, or A;

(e) a VL CDR2 containing, consisting of, or predominantly consisting of the amino acid sequence X1ASTRX2X3 (SEQ ID NO: 5), where

X ₁ is W, G, N, Q, S, T, C, Y, F, H, or A;

X ₂ represents E, D or A; And

X3 is S, G, N, Q, T, C, W, Y, or A; and (f) a VL CDR3 comprising, consisting of, or predominantly consisting of the amino acid sequence QX1X2YX3X4PYT (SEQ ID NO: 6), wherein

X1 is N, G, Q, S, T, C, W or Y;

X2 is D, E or Y; And

X ₃ is S, G, N, Q, T, C, W, Y, or A, and

X ₄ is Y, G, N, Q, S, T, C, W, F, H, L, or A.

- 2 040077

In other embodiments of the invention, the antibody or antigen-binding fragment contains:

(a) A heavy chain variable region (VH) CDR1 comprising, consisting of, or predominantly consisting of the amino acid sequence X ₁ YX ₂ MX ₃ (SEQ ID NO: 7), wherein

X ₁ is D, E or G;

X2 is A or V; And

X ₃ represents Y or H;

(b) a VH CDR2 comprising, consisting of, or predominantly consisting of the amino acid sequence X ₁ IX ₂ TX ₃ SGX ₄ X ₅ X ₆ YNQKFX ₇ X ₈ (SEQ ID NO: 8), wherein

X ₁ is V or L;

X2 is R, K or Q;

X3 is Y or F;

X4 is D, E or G;

X ₅ is V or L;

X ₆ is T or S;

X ₇ is K, R or Q; And

X ₈ is D, E or G;

(c) a VH CDR3 containing, consisting of, or predominantly consisting of the amino acid sequence SGTVRGFAY (SEQ ID NO: 9);

(d) a light chain variable region (VL) CDR1 comprising, consisting of, or predominantly consisting of the amino acid sequence KSSQSLLNSX1NQKNYLX2 (SEQ ID NO: 10), wherein

X ₁ is G or S; And

X2 is T or S;

(e) a VL CDR2 containing, consisting of, or predominantly consisting of the amino acid sequence WASTRES (SEQ ID NO: 11); and (f) a VL CDR3 comprising, consisting of, or predominantly consisting of the amino acid sequence QNX ₁ YSX2PYT (SEQ ID NO: 12), wherein

X ₁ is D or E; And

X ₂ is Y, F or S.

In some embodiments of the invention, provided herein is an antibody, or antigen-binding fragment thereof, that specifically binds to GITR (e.g., human GITR), comprising:

(a) a heavy chain variable region (VH) hypervariable region (CDR) 1 comprising, consisting of, or predominantly consisting of the amino acid sequence X1YX2MX3 (SEQ ID NO: 1) wherein

X1 is D, E, G or A;

X ₂ is A, V, L, I, P, F, M, or Y; And

X ₃ represents Y, G, N, Q, S, T, C, W, F or H;

(b) a VH CDR2 comprising, consisting of, or predominantly consisting of the amino acid sequence X ₁ IX ₂ X ₃ X ₄ SGX ₅ X ₆ X ₇ YX ₈ QKFX ₉ X ₁₀ (SEQ ID NO: 2), wherein

X ₁ is V, A, L, I, P, F, M or T;

X2 is R, K, H, Q or A;

X ₃ is T, G, N, Q, S, C, W, Y, V, I, or P;

X4 is Y, G, N, Q, S, T, C, W, F, H, or A;

X ₅ is D, E, G or A;

X6 is V, A, L, I, P, F, M or T;

X ₇ is T, G, N, Q, S, C, W, Y, V, I, P, or A;

X ₈ is N, G, Q, S, T, C, W, Y, or A;

X9 is K, R, H, Q or A; And

X ₁₀ is D, E, G or A;

(c) a VH CDR3 containing, consisting of, or predominantly consisting of the amino acid sequence SGTVRGX ₁ X ₂ X ₃ (SEQ ID NO: 3), wherein

X ₁ is F, A, V, L, I, P, M, Y, W, H, or S;

X2 is A or D; And

X3 is Y, G, N, Q, S, T, C, W, F, H, or V;

(d) a light chain variable region (VL) CDR1 comprising, consisting of, or predominantly consisting of the amino acid sequence KSSQSX ₁ X ₂ X ₃ X ₄ X ₅ X ₆ X ₇ KX ₈ YLX ₉ (SEQ ID NO: 4), wherein

X1 is L, A, V, I, P, F or M;

X ₂ is L, A, V, I, P, F, M, or S;

X ₃ is N, G, Q, S, T, C, W, Y, or A;

- 3 040077

X4 is S, G, N, Q, T, C, W, Y, or A;

X ₅ is G, N, Q, S, T, C, W, Y, or A;

X ₆ is N, G, Q, S, T, C, W, Y, or A;

X ₇ is Q, G, N, S, T, C, W, Y, or A;

X ₈ is N, G, Q, S, T, C, W, Y, or A; And

X ₉ is T, G, N, Q, S, C, W, Y, V, I, or A;

(e) a VL CDR2 containing, consisting of, or predominantly consisting of the amino acid sequence X1ASTRX ₂ X ₃ (SEQ ID NO: 5), where

X ₁ is W, G, N, Q, S, T, C, Y, F, H, or A;

X2 is E, D or A; And

X ₃ represents S, G, N, Q, T, C, W, Y or A; and (f) a VL CDR3 comprising, consisting of, or predominantly consisting of the amino acid sequence QX1X2YX3X4PYT (SEQ ID NO: 6), wherein

X1 is N, G, Q, S, T, C, W or Y;

X2 is D, E or Y; And

X ₃ is S, G, N, Q, T, C, W, Y, or A, and

X ₄ is Y, G, N, Q, S, T, C, W, F, H, L, or A. a sequence selected from the group consisting of SEQ ID NOs: 13, 19-23 and 117-119. In certain embodiments, the antibody or antigen-binding fragment thereof comprises a VH CDR1 comprising, consisting of, or predominantly consisting of an amino acid sequence selected from the group consisting of SEQ ID NO: 35 and SEQ ID NO: 116. In some embodiments, the antibody or its the antigen-binding fragment contains a VH CDR2 containing, consisting of or predominantly consisting of an amino acid sequence selected from the group consisting of SEQ ID NOs: 14, 24-33 and 120-188. In some embodiments, the antibody or antigen-binding fragment thereof comprises a VH CDR2 comprising, consisting of, or predominantly consisting of an amino acid sequence selected from the group consisting of SEQ ID NOs: 114, 115, and 194. In certain embodiments, the antibody or antigen-binding fragment thereof contains a VH CDR3 containing, consisting of or predominantly consisting of an amino acid sequence selected from the group consisting of SEQ ID NOs: 15, 34 and 189. In some embodiments, the antibody or antigen-binding fragment contains a VL CDR1 containing, consisting of or predominantly consisting from an amino acid sequence selected from the group consisting of SEQ ID NOs: 16 and 101-104. In certain embodiments, the antibody or antigen-binding fragment thereof comprises a VL CDR2 comprising, consisting of, or predominantly consisting of an amino acid sequence selected from the group consisting of SEQ ID NOs: 17 and 105. In some embodiments, the antibody or antigen-binding fragment thereof comprises a VL A CDR3 comprising, consisting of, or predominantly consisting of an amino acid sequence selected from the group consisting of SEQ ID NOs: 18, 106-109, 192, and 193. In specific embodiments, the antibody or antigen-binding fragment thereof comprises the amino acid sequence VH CDR1, VH CDR2 and VH CDR3 antibodies from table. 2. In specific embodiments of the invention, the antibody or its antigen-binding fragment contains the amino acid sequences VH CDR1, VH CDR2 and VH CDR3 of the antibody from Table. 6. In another specific embodiment of the invention, the antibody or its antigen-binding fragment contains the amino acid sequence of VL CDR1, VL CDR2 and VL CDR3 antibodies from table. 1. In another specific embodiment of the invention, the antibody or its antigen-binding fragment contains the amino acid sequences of VL CDR1, VL CDR2 and VL CDR3 antibodies from table. 5. In some embodiments, the antibody or antigen-binding fragment thereof partially inhibits the binding of GITRL (e.g., human GITRL) to GITR (e.g., human GITR) as assessed by a method known to one of skill in the art or described herein (see, e.g., , sections 6.2.5.2 and 6.2.5.4 below). In certain embodiments, the antibody or antigen-binding fragment thereof at a concentration of 1000 ng/mL inhibits less than 80% of 0.5 nM GITRL (e.g., human GITRL) from binding to bead-bound GITR (e.g., human GITR bound to Luminex® beads) in 5 pg/mL/bead versus 0.5 nM GITRL binding to bead-bound GITR at 5 pg/mL/bead in the absence of anti-GITR antibody or antigen-binding fragment thereof in a suspension matrix assay. In certain embodiments, the antibody or antigen-binding fragment thereof inhibits 40% to 70%, 50% to 70%, 50% to 80%, or 40% to 80% of GITRL (e.g., human GITRL) binding to GITR (e.g., human GITR) . In specific embodiments, at least 20% of the amount of GITRL (e.g., human GITRL) that binds to GITR (e.g., human GITR) in the absence of an antibody or antigen-binding fragment thereof binds to GITR (e.g., human GITR) in the presence of

- 4 040077 antibodies or its antigennegative fragment in the analysis, which includes the following steps: (a) binding GITR (for example, human GITR) with beads at a concentration of 5 pg/ml/bead; (b) incubation associated with GITR (eg, human GITR) beads at a concentration of 40 beads/µl with or without antibody in the well; (c) adding labeled GITRL (eg, labeled human GITRL) to the well to give a final concentration of 0.5 nM GITRL (eg, human GITRL) and 20 beads/µl GITR-bound beads; and (d) detecting labeled GITRL (eg, human GITRL) associated with GITR-related (eg, human GITR) beads by a method, eg, suspension matrix analysis. In some embodiments, 20 to 60%, 20 to 50%, 30 to 60%, or 30 to 50% of the amount of GITRL (e.g., human GITRL) that binds to GITR (e.g., human GITR) in the absence of antibody or an antigen-binding fragment thereof, binds to a GITR (eg, human GITR) in the presence of an antibody or antigen-binding fragment thereof.

In another embodiment, provided herein is an antibody, or antigen-binding fragment thereof, that specifically binds to GITR (e.g., human GITR), comprising:

(a) A heavy chain variable region (VH) CDR1 comprising, consisting of, or predominantly consisting of the amino acid sequence X ₁ YX ₂ MX ₃ (SEQ ID NO: 7), wherein

X ₁ is D, E or G;

X ₂ is A or V; And

X ₃ represents Y or H;

(b) a VH CDR2 comprising, consisting of, or predominantly consisting of the amino acid sequence X ₁ IX ₂ TX ₃ SGX ₄ X ₅ X ₆ YNQKFX ₇ X ₈ (SEQ ID NO: 8), wherein

X ₁ is V or L;

X2 is R, K or Q;

X3 is Y or F;

X ₄ is D, E or G;

X ₅ is V or L;

X6 is T or S;

X ₇ is K, R or Q; And

X ₈ is D, E or G;

(c) a VH CDR3 containing, consisting of, or predominantly consisting of the amino acid sequence SGTVRGFAY (SEQ ID NO: 9);

(d) a light chain variable region (VL) CDR1 comprising, consisting of, or predominantly consisting of the amino acid sequence KSSQSLLNSX1NQKNYLX2 (SEQ ID NO: 10), wherein

X ₁ is G or S; And

X2 is T or S;

(e) a VL CDR2 containing, consisting of, or predominantly consisting of the amino acid sequence WASTRES (SEQ ID NO: 11); and (f) a VL CDR3 comprising, consisting of, or predominantly consisting of the amino acid sequence QNX ₁ YSX2PYT (SEQ ID NO: 12), wherein

X ₁ is D or E; And

X2 is Y, F or S.

In certain embodiments, the antibody or antigen-binding fragment thereof comprises a VH CDR1 comprising, consisting of, or predominantly consisting of an amino acid sequence selected from the group consisting of SEQ ID NOs: 13, 19-23, and 117-119. In certain embodiments, the antibody or antigennegative fragment thereof comprises a VH CDR1 comprising, consisting of, or predominantly consisting of an amino acid sequence selected from the group consisting of 35 and 116. In some embodiments, the antibody or antigennegative fragment thereof comprises a VH CDR2 comprising, consisting or predominantly consisting of an amino acid sequence selected from the group consisting of SEQ ID NOs: 14, 24-33 and 120-188. In some embodiments, the antibody or antigen-binding fragment thereof comprises a VH CDR2 comprising, consisting of, or predominantly consisting of an amino acid sequence selected from the group consisting of SEQ ID NOs: 114, 115, and 194. In certain embodiments, the antibody or antigen-binding fragment thereof contains a VH CDR3 containing, consisting of or predominantly consisting of an amino acid sequence selected from the group consisting of SEQ ID NOs: 15, 34 and 189. In some embodiments, the antibody or antigen-binding fragment contains a VL CDR1 containing, consisting of or predominantly consisting from an amino acid sequence selected from the group consisting of SEQ ID NOs: 16 and 101-104. In certain embodiments, the antibody or antigen-binding fragment thereof comprises a VL CDR2 comprising, consisting of, or predominantly consisting of an amino acid sequence selected from the group consisting of

- 5 040077

SEQ ID NOs: 17 and 105. In some embodiments, the antibody or antigen-binding fragment thereof comprises a VL CDR3 comprising, consisting of, or predominantly consisting of an amino acid sequence selected from the group consisting of SEQ ID NOs: 18, 106-109, 192 and 193. In specific embodiments of the invention, the antibody or antigennegative fragment contains the amino acid sequence of VH CDR1, VH CDR2 and VH CDR3 antibodies from table. 2. In another specific embodiment of the invention, the antibody or its antigen-binding fragment contains the amino acid sequence of VL CDR1, VL CDR2 and VL CDR3 antibodies from table. 1. In some embodiments, the antibody or antigen-binding fragment thereof does not prevent GITRL (e.g., human GITRL) from binding to GITR (e.g., human GITR) as assessed by a method known to one of skill in the art or described herein (see, e.g., , sections 6.2.5.2 and 6.2.5.4 below). In certain embodiments, the antibody or antigen-binding fragment thereof at a concentration of 1000 ng/mL inhibits less than 80% of 0.5 nM GITRL (e.g., human GITRL) from binding to bead-bound GITR (e.g., human GITR bound to Luminex® beads) in 5 pg/mL/bead versus 0.5 nM GITRL binding to bead-bound GITR at 5 pg/mL/bead in the absence of anti-GITR antibody or antigen-binding fragment thereof in a suspension matrix assay. In certain embodiments, the antibody or antigen-binding fragment thereof inhibits 40% to 70%, 50% to 70%, 50% to 80%, or 40% to 80% of GITRL (e.g., human GITRL) binding to GITR (e.g., human GITR) . In specific embodiments, at least 20% of the amount of GITRL (e.g., human GITRL) that binds to GITR (e.g., human GITR) in the absence of antibody or antigen-binding fragment thereof binds to GITR (e.g., human GITR) in the presence of antibody or an antigen-binding fragment thereof in an assay comprising the following steps: (a) binding GITR (eg, human GITR) to beads at a concentration of 5 pg/ml/bead; (b) incubation associated with GITR (eg human GITR) beads at a concentration of 40 beads/µl with or without antibody in the well; (c) adding labeled GITRL (eg, labeled human GITRL) to the well to give a final concentration of 0.5 nM GITRL (eg, human GITRL) and 20 beads/µl GITR-bound beads; and (d) detecting labeled GITRL (eg, human GITRL) associated with GITR-related (eg, human GITR) beads by a method, eg, suspension matrix analysis. In some embodiments, 20 to 60%, 20 to 50%, 30 to 60%, or 30 to 50% of the amount of GITRL (e.g., human GITRL) that binds to GITR (e.g., human GITR) in the absence of antibody or an antigen-binding fragment thereof, binds to a GITR (eg, human GITR) in the presence of an antibody or antigen-binding fragment thereof.

In a specific embodiment, this document provides an antibody or fragment thereof that specifically binds to human GITR, comprising: (a) a heavy chain variable region (VH) CDR1 containing the amino acid sequence DYAMY (SEQ ID NO: 13); (b) VH CDR2 containing the amino acid sequence VIRTYSGDVTYNQKFKD (SEQ ID NO: 14); (c) VH CDR3 containing the amino acid sequence SGTVRGFAY (SEQ ID NO: 15); (d) a light chain variable region (VL) CDR1 containing the amino acid sequence KSSQSLLNSGNQKNYLT (SEQ ID NO: 16); (e) VL CDR2 containing the amino acid sequence WASTRES (SEQ ID NO: 17); and (f) VL CDR3 containing the amino acid sequence QNDYSYPYT (SEQ ID NO: 18). In another embodiment of the invention, this document provides an antibody or fragment thereof that specifically binds to human GITR, containing VL CDR1, VL CDR2, VL CDR3, VH CDR1, VH CDR2 and VH CDR 3 of antibody 22 from table. 1 and table. 2. In some embodiments, the antibody or antigen-binding fragment thereof partially inhibits the binding of GITRL (e.g., human GITRL) to GITR (e.g., human GITR) as assessed by a method known to one of skill in the art or described herein (see, e.g., , sections 6.2.5.2 and 6.2.5.4 below). In certain embodiments, the antibody or antigen-binding fragment thereof at 1000 ng/mL inhibits less than 80% of bead-bound GITR (e.g., human GITR associated with Luminex® beads) at 5 pg/mL/bead compared to binding 0.5 nM GITRL (eg, human GITRL) with bead-bound GITR (eg, human GITR associated with Luminex® beads) at 5 pg/mL/bead in the absence of anti-GITR antibody or antigen-binding fragment thereof in a suspension matrix assay . In some embodiments, the antibody, or antigen-binding fragment thereof, inhibits 50 to 70% of the binding of human GITRL to human GITR. In specific embodiments, at least 20% of the amount of GITRL (e.g., human GITRL) that binds to GITR (e.g., human GITR) in the absence of antibody or antigen-binding fragment thereof binds to GITR (e.g., human GITR) in the presence of antibody or an antigen-binding fragment thereof in an assay comprising the following steps: (a) binding a GITR (eg, human GITR) to

- 6 040077 granules at a concentration of 5 pg/ml/granule; (b) incubation associated with GITR (eg, human GITR) beads at a concentration of 40 beads/µl with or without antibody in the well; (c) adding labeled GITRL (eg, labeled human GITRL) to the well to give a final concentration of 0.5 nM GITRL (eg, human GITRL) and 20 beads/µl GITR-bound beads; and (d) detecting labeled GITRL (eg, human GITRL) associated with GITR-related (eg, human GITR) beads by a method, eg, suspension matrix analysis. In some embodiments, 20 to 60%, 20 to 50%, 30 to 60%, or 30 to 50% of the amount of GITRL (e.g., human GITRL) that binds to GITR (e.g., human GITR) in the absence of antibody or an antigen-binding fragment thereof, binds to a GITR (eg, human GITR) in the presence of an antibody or antigen-binding fragment thereof. In some embodiments, 30 to 50% of the amount of human GITRL that binds to human GITR in the absence of an antibody or antigen-binding fragment thereof binds to human GITR in the presence of an antibody or antigen-binding fragment thereof. In certain embodiments of the invention, the antibody or antigen-binding fragment is agonistic.

In certain embodiments, an antibody or fragment thereof provided herein that specifically binds to GITR (e.g., human GITR) comprises a heavy chain variable region sequence comprising one, two, three, or four framework regions of a heavy chain variable region sequence of SEQ ID NO: 203. In some embodiments, an antibody or fragment thereof provided herein that specifically binds to GITR (e.g., human GITR) comprises one, two, three, or four heavy chain variable region sequence framework regions that are at least 75%, 80%, 85%, 90%, 95%, or 100% identical to one, two, three, or four framework regions of a heavy chain variable region sequence selected from the group consisting of SEQ ID NO: 201, SEQ ID NO: 206, and SEQ ID NO : 215-389. In another embodiment, an antibody or fragment thereof provided herein that specifically binds to GITR (eg, human GITR) comprises a heavy chain variable region containing human-derived framework regions. In another embodiment, an antibody as provided herein, or an antigen-binding fragment thereof, that specifically binds to GITR (e.g., human GITR) comprises a heavy chain variable region framework that is or is derived from an amino acid sequence encoded by the human gene, wherein the amino acid sequence is selected from the group consisting of IGHV1-2*02 (SEQ ID NO: 601), IGHV1-3*01 (SEQ ID NO: 602), IGHV1-46*01 (SEQ ID NO: 603), IGHV1-18 *01 (SEQ ID NO: 604), IGHV1-69*01 (SEQ ID NO: 605) and IGHV7-4-1*02 (SEQ ID NO: 606). In specific embodiments, a heavy chain variable region framework that is derived from said amino acid sequence consists of said amino acid sequence containing up to 10 amino acid substitutions, deletions and/or insertions, preferably up to 10 amino acid substitutions. In a particular embodiment, the heavy chain variable region framework that is derived from the specified amino acid sequence consists of the specified amino acid sequence with 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acid residues that have been substituted an amino acid at a similar position in the corresponding non-human framework region of the heavy chain variable region. In a particular embodiment, an antibody or fragment thereof provided herein that specifically binds to GITR (e.g., human GITR) comprises a heavy chain variable region framework that is derived from the amino acid sequence of SEQ ID NO: 601, wherein at least one, two, three, four, or five (up to 10 in certain embodiments) amino acids of the amino acid sequence of SEQ ID NO: 601 are replaced with an amino acid at a similar position in the corresponding non-human heavy chain variable region framework. In certain embodiments of the invention, the amino acid substitution is at an amino acid position selected from the group consisting of 24, 48, 67, 71, 73, and 94, with the amino acid position of each member of the group indicated according to Kabat numbering. In specific embodiments, the amino acid substitution is selected from the group consisting of 24G, 48I, 67A, 71V, 73K, and 94K, with the amino acid position of each member of the group indicated according to Kabat numbering.

In another embodiment, provided herein is an antibody or fragment thereof that specifically binds to GITR (e.g., human GITR) comprising a heavy chain variable region sequence comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 201, 206 and SEQ ID NO: 215-389. In a specific embodiment, provided herein is an antibody or fragment thereof that specifically binds to GITR (e.g., human GITR) comprising a heavy chain variable region sequence comprising the amino acid sequence of SEQ ID NO: 203. In another specific embodiment, this document proposes an antibody or fragment thereof that specifically binds to GITR (for example, human GITR), containing

- 7 040077 heavy chain variable region sequence comprising the amino acid sequence of SEQ ID NO: 206.

In another embodiment, provided herein is an antibody or fragment thereof that specifically binds to GITR (e.g., human GITR) comprising a heavy chain sequence comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 553, 554 and from 567 to 570. In another embodiment, provided herein is an antibody or fragment thereof that specifically binds to GITR (eg, human GITR) comprising a heavy chain sequence comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 581 and 582.

In another embodiment, an antibody or fragment thereof that specifically binds to GITR (e.g., human GITR) comprises a light chain variable region sequence comprising one, two, three, or four framework regions of a light chain variable region sequence of SEQ ID NO: 204, or SEQ ID NO: 205. In another embodiment, an antibody or fragment thereof that specifically binds to GITR (e.g., human GITR) comprises one, two, three, or four framework regions of a light chain variable region sequence that are at least 75 , 80, 85, 90, 95, or 100% identical to one, two, three, or four framework regions of a light chain variable region sequence selected from the group consisting of SEQ ID NO: 202, SEQ ID NO: 207, SEQ ID NO: 208 and SEQ ID NO: 400-518. In another embodiment, an antibody or fragment thereof that specifically binds to GITR (e.g., human GITR) contains one, two, three, or four framework regions of a light chain variable region sequence that are at least 75, 80, 85, 90 , 95%, or 100% identical to one, two, three, or four framework regions of the light chain variable region sequence of SEQ ID NO: 519. In another embodiment, an antibody or fragment thereof that specifically binds to GITR (e.g., human GITR) contains a light chain region containing human-derived framework regions. In another embodiment, an antibody or fragment thereof that specifically binds to GITR (e.g., human GITR) comprises a light chain variable region framework that is or is derived from an amino acid sequence encoded by the human gene, wherein the amino acid sequence is selected from the group , consisting of IGKV4-1*01 (SEQ ID NO: 607) and IGKV3-7*02 (SEQ ID NO: 608). In particular embodiments, a light chain variable region framework that is derived from said amino acid sequence consists of said amino acid sequence minus up to 10 amino acid substitutions, deletions and/or insertions, preferably up to 10 amino acid substitutions. In a specific embodiment, the light chain variable region framework that is derived from the specified amino acid sequence consists of the specified amino acid sequence with 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acid residues that have been substituted an amino acid at a similar position in the corresponding non-human framework region of the light chain variable region. In another embodiment, an antibody or fragment thereof that specifically binds to GITR (e.g., human GITR) comprises a light chain variable region framework that is or is derived from the amino acid sequence of SEQ ID NO: 607 or SEQ ID NO: 608, wherein at least one, two, three, four, or five (in certain embodiments, up to 10) amino acids of the amino acid sequence of SEQ ID NO: 607 or SEQ ID NO: 608 are replaced with an amino acid located at a similar position in the corresponding non-human variable framework region light chain regions. In certain embodiments of the invention, the amino acid substitution is at amino acid position 87, with the amino acid position indicated according to Kabat numbering. In specific embodiments of the invention, the amino acid substitution is an 87H amino acid substitution, with the amino acid position indicated according to Kabat numbering. In another embodiment, provided herein is an antibody or fragment thereof that specifically binds to GITR (e.g., human GITR) comprising a light chain variable region sequence comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 202, SEQ ID NO: 207, SEQ ID NO: 208 and SEQ ID NO: 400-518. In another embodiment, provided herein is an antibody or fragment thereof that specifically binds to GITR (e.g., human GITR) comprising a light chain variable region sequence comprising the amino acid sequence of SEQ ID NO: 519. In a particular embodiment, herein provided is an antibody or fragment thereof that specifically binds to GITR (e.g., human GITR) comprising a light chain variable region sequence comprising the amino acid sequence of SEQ ID NO: 204 or SEQ ID NO: 205. In another specific embodiment, this document provides an antibody or fragment thereof that specifically binds to GITR (e.g., human GITR) comprising a light chain variable region sequence comprising the amino acid sequence of SEQ ID NO: 207. In another specific embodiment, herein, What is proposed is an antibody or fragment thereof that specifically binds to GITR (e.g., human GITR) comprising a light chain variable region sequence comprising the amino acid sequence of SEQ ID NO: 208.

In another embodiment, provided herein is an antibody or fragment thereof that specifically binds to GITR (e.g., human GITR) comprising a light chain sequence comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 555, 556, and 571 -576.

In another embodiment, provided herein is an antibody or fragment thereof that specifically binds to GITR (eg, human GITR) comprising a heavy chain variable region and a light chain variable region comprising the amino acid sequences of the antibody from the table in FIG. 23 or any of FIG. 24A-24C. In another embodiment, provided herein is an antibody or fragment thereof that specifically binds to GITR (eg, human GITR) comprising a heavy chain variable region and a light chain variable region comprising the amino acid sequences of the antibody from Table 1. 17. In a specific embodiment of the invention, provided herein is an antibody or fragment thereof that specifically binds to GITR (eg, human GITR) comprising (a) a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 206; and (b) a light chain variable region comprising the amino acid sequence of SEQ ID NO: 207. In another specific embodiment, this document provides an antibody or fragment thereof that specifically binds to GITR (e.g., human GITR) comprising (a) a heavy chain region containing the amino acid sequence of SEQ ID NO: 206; and (b) a light chain variable region comprising the amino acid sequence of SEQ ID NO: 208.

In a specific embodiment, provided herein is an antibody or fragment thereof that specifically binds to GITR (e.g., human GITR) comprising a heavy chain variable region (VH) comprising VH CDR1, VH CDR2, VH CDR3, and framework regions derived from of a human immunoglobulin, wherein VH CDR1 contains, consists of, or predominantly consists of the amino acid sequence DYAMY (SEQ ID NO: 13), VH CDR2 contains, consists of, or predominantly consists of the amino acid sequence VIRTYSGDVTYNQKFKD (SEQ ID NO: 14), and VH CDR3 contains, consists of, or predominantly consists of the amino acid sequence SGTVRGFAY (SEQ ID NO: 15). In another embodiment, provided herein is an antibody or fragment thereof that specifically binds to GITR (e.g., human GITR) comprising a light chain variable region (VL) comprising VL CDR1, VL CDR2, VL CDR3 and framework regions derived from of a human immunoglobulin, wherein VL CDR1 contains, consists of, or predominantly consists of the amino acid sequence KSSQSLLNSGNQKNYLT (SEQ ID NO: 16), VL CDR2 contains, consists of, or predominantly consists of the amino acid sequence WASTRES (SEQ ID NO: 17), and VL CDR3 contains, consists of, or predominantly consists of the amino acid sequence QNDYSYPYT (SEQ ID NO: 18). In another embodiment, provided herein is an antibody or fragment thereof that specifically binds to GITR (e.g., human GITR) comprising a heavy chain variable region (VH) comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 201 , 203, 206 and 215-389. In another embodiment, provided herein is an antibody or fragment thereof that specifically binds to GITR (e.g., human GITR) comprising a light chain variable region (VL) comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 202 , 204, 205, 207, 208 and 400-518. In another embodiment, provided herein is an antibody or fragment thereof that specifically binds to GITR (e.g., human GITR) comprising a light chain variable region (VL) comprising the amino acid sequence of SEQ ID NO: 519. In some embodiments, the antibody or an antigen-binding fragment thereof partially inhibits the binding of GITRL (e.g., human GITRL) to GITR (e.g., human GITR) as assessed by a method known to one of skill in the art or described herein (see, for example, sections 6.2.5.2 and 6.2. 5.4 below). In certain embodiments, the antibody or antigen-binding fragment thereof at a concentration of 1000 ng/mL inhibits less than 80% of 0.5 nM GITRL (e.g., human GITRL) from binding to bead-bound GITR (e.g., human GITR bound to Luminex® beads) in 5 pg/mL/bead versus 0.5 nM GITRL binding to bead-bound GITR at 5 pg/mL/bead in the absence of anti-GITR antibody or antigen-binding fragment thereof in a suspension matrix assay. In specific embodiments, at least 20% of the amount of GITRL (e.g., human GITRL) that binds to GITR (e.g., human GITR) in the absence of antibody or antigen-binding fragment thereof binds to GITR (e.g., human GITR) in the presence of antibody or an antigen-binding fragment thereof in an assay comprising the following steps: (a) binding a GITR (e.g., human

- 9 040077

GITR) with granules at a concentration of 5 pg/ml/granule; (b) incubation associated with GITR (eg human GITR) beads at a concentration of 40 beads/µl with or without antibody in the well; (c) adding labeled GITRL (eg, labeled human GITRL) to the well to give a final concentration of 0.5 nM GITRL (eg, human GITRL) and 20 beads/µl GITR-bound beads; and (d) detecting labeled GITRL (eg, human GITRL) associated with GITR-related (eg, human GITR) beads by a method, eg, suspension matrix analysis. In some embodiments, 20 to 60%, 20 to 50%, 30 to 60%, or 30 to 50% of the amount of GITRL (e.g., human GITRL) that binds to GITR (e.g., human GITR) in the absence of antibody or an antigen-binding fragment thereof, binds to a GITR (eg, human GITR) in the presence of an antibody or antigen-binding fragment thereof. In a particular embodiment, this document provides an antibody or fragment thereof that specifically binds to GITR (e.g., human GITR) comprising a heavy chain variable region (VH) and a light chain variable region (VL), wherein VH and VL contain the amino acid sequence antibodies from Fig. 23 or any of FIG. 24A-24C. In a particular embodiment, this document provides an antibody or fragment thereof that specifically binds to GITR (e.g., human GITR) comprising a heavy chain variable region (VH) and a light chain variable region (VL), wherein VH and VL contain the amino acid sequence antibodies from the table. 17.

In certain embodiments, an antibody provided herein that specifically binds to GITR (eg, human GITR) contains heavy and/or light chain constant regions. In some embodiments, the heavy chain constant region is selected from the group of human immunoglobulins consisting of IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2. In certain embodiments, the light chain constant region is selected from the group of human immunoglobulins consisting of IgGK and IgGλ. In a particular embodiment, the IgG1 is non-fucosylated IgG1. In another specific embodiment, the antibody is an IgG1 that contains the N297A or N297Q mutation. In another specific embodiment, the antibody is an IgG4 that contains the S228P mutation. In another specific embodiment, the antibody is an IgG2 that contains the C127S mutation. In certain embodiments, an antibody provided herein that specifically binds to GITR (e.g., human GITR) comprises a heavy chain constant region comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 557-562. In certain embodiments, an antibody provided herein that specifically binds to GITR (e.g., human GITR) comprises a heavy chain constant region comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 583 and 584. In another specific embodiment, an antibody provided herein that specifically binds to GITR (e.g., human GITR) comprises a heavy chain constant region comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 557-560 with the amino acid substitution N to A or Q at amino acid position 180. In certain embodiments, an antibody provided herein that specifically binds to GITR (e.g., human GITR) comprises a light chain constant region comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 588-591. In certain embodiments, an antibody provided herein that specifically binds to GITR (e.g., human GITR) comprises a light chain constant region comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 563-566.

In a particular embodiment, an antibody provided herein that specifically binds to GITR (e.g., human GITR) comprises (a) a heavy chain comprising an amino acid sequence selected from the group consisting of SEQ ID NOS: 553, 554, and 567- 570; and (b) a light chain containing an amino acid sequence selected from the group consisting of SEQ ID NOs: 555, 556 and 571-576. In another specific embodiment, an antibody provided herein that specifically binds to GITR (eg, human GITR) comprises (a) a heavy chain comprising the amino acid sequence of SEQ ID NO: 553; and (b) a light chain comprising the amino acid sequence of SEQ ID NO: 556. In another specific embodiment, an antibody provided herein that specifically binds to GITR (e.g., human GITR) comprises (a) a heavy chain comprising the amino acid sequence SEQ ID NO: 554; and (b) a light chain comprising the amino acid sequence of SEQ ID NO: 556. In another specific embodiment, an antibody provided herein that specifically binds to GITR (e.g., human GITR) comprises (a) a heavy chain comprising the amino acid sequence SEQ ID NO: 581; and (b) a light chain containing the amino acid sequence of SEQ ID NO: 556. In another specific embodiment of the invention proposed in this document

- 10 040077 mente antibody that specifically binds to GITR (eg human GITR) contains (a) a heavy chain containing the amino acid sequence of SEQ ID NO: 582; and (b) a light chain comprising the amino acid sequence of SEQ ID NO: 556. In another specific embodiment, an antibody provided herein that specifically binds to GITR (e.g., human GITR) comprises (a) a heavy chain comprising the amino acid sequence SEQ ID NO: 553; and (b) a light chain comprising the amino acid sequence of SEQ ID NO: 555. In another specific embodiment, an antibody provided herein that specifically binds to GITR (e.g., human GITR) comprises (a) a heavy chain comprising the amino acid sequence SEQ ID NO: 554; and (b) a light chain comprising the amino acid sequence of SEQ ID NO: 555. In another specific embodiment, an antibody provided herein that specifically binds to GITR (e.g., human GITR) comprises (a) a heavy chain comprising the amino acid sequence SEQ ID NO: 567; and (b) a light chain comprising the amino acid sequence of SEQ ID NO: 573. In another specific embodiment, an antibody provided herein that specifically binds to GITR (e.g., human GITR) comprises (a) a heavy chain comprising the amino acid sequence SEQ ID NO: 567; and (b) a light chain comprising the amino acid sequence of SEQ ID NO: 576. In another specific embodiment, an antibody provided herein that specifically binds to GITR (e.g., human GITR) comprises (a) a heavy chain comprising the amino acid sequence SEQ ID NO: 554; and (b) a light chain comprising the amino acid sequence of SEQ ID NO: 576. In another specific embodiment, an antibody provided herein that specifically binds to GITR (e.g., human GITR) comprises (a) a heavy chain comprising the amino acid sequence SEQ ID NO: 581; and (b) a light chain comprising the amino acid sequence of SEQ ID NO: 576. In another specific embodiment, an antibody provided herein that specifically binds to GITR (e.g., human GITR) comprises (a) a heavy chain comprising the amino acid sequence SEQ ID NO: 582; and (b) a light chain containing the amino acid sequence of SEQ ID NO: 576.

In another specific embodiment, an antibody provided herein that specifically binds to GITR (e.g., human GITR) comprises (a) a heavy chain comprising the amino acid sequence of SEQ ID NO: 553 with the amino acid substitution of N for A or Q at the amino acid position 298; and (b) a light chain containing an amino acid sequence selected from the group consisting of SEQ ID NOs: 555, 556 and 571-576. In another specific embodiment, an antibody provided herein that specifically binds to GITR (e.g., human GITR) comprises (a) a heavy chain comprising the amino acid sequence of SEQ ID NO: 553 with the amino acid substitution of N for A or Q at the amino acid position 298; and (b) a light chain comprising the amino acid sequence of SEQ ID NO: 556. In another specific embodiment, an antibody provided herein that specifically binds to GITR (e.g., human GITR) comprises (a) a heavy chain comprising the amino acid sequence SEQ ID NO: 553 with amino acid substitution of N for A or Q at amino acid position 298; and (b) a light chain comprising the amino acid sequence of SEQ ID NO: 555. In another embodiment, this document provides an antibody or fragment thereof that binds to the same GITR epitope (e.g., human GITR) as described herein. antibody. In another embodiment, this document provides an isolated antibody that specifically binds to each of i) human GITR, wherein the human GITR comprises residues 26-241 of SEQ ID NO: 701, and ii) a cynomolgus monkey GITR variant comprising residues 26-234 SEQ ID NO: 699, wherein the antibody does not specifically bind to cynomolgus monkey GITR containing residues 26-234 of SEQ ID NO: 704. In another embodiment, this document provides an isolated antibody that specifically binds to each of i) human GITR, wherein the human GITR contains residues 26-241 of SEQ ID NO: 701, and ii) the cynomolgus monkey GITR variant containing residues 26-234 of SEQ ID NO: 699, wherein the antibody does not significantly bind to the cynomolgus monkey GITR containing residues 26-234 of SEQ ID NO: 704. In another embodiment, this document provides an isolated antibody that specifically binds to human GITR, wherein the human sheep GITR contains residues 26-241 of SEQ ID NO: 701, with the binding between the antibody and the variant GITR significantly reduced compared to the binding between the antibody and human GITR, and the variant GITR contains residues 26-241 of SEQ ID NO: 701 except amino acid substitution selected from the group consisting of D60A and G63A. In one embodiment of the invention, the replacement is D60A. In another embodiment of the invention, the replacement is G63A. In another embodiment, this document provides an isolated antibody that specifically binds to human GITR, wherein the human GITR contains residues 26-241 of SEQ ID NO: 701, and the antibody binds to an epitope containing residues 60-63

- 11 040077

SEQ ID NO: 701. In another embodiment, this document provides an isolated antibody that specifically binds to human GITR, wherein the human GITR contains residues 26-241 of SEQ ID NO: 701, and the antibody binds to at least one residue in the amino acid sequence formed by residues 60-63 of SEQ ID NO: 701. In one embodiment, the antibody binds to at least one residue selected from the group consisting of residues 60, 62, and 63 of SEQ ID NO: 701. In one embodiment, carrying out the invention, the antibody binds to at least one residue selected from the group consisting of residues 62 and 63 of SEQ ID NO: 701. In one embodiment of the invention, the antibody activates or increases the activity of human GITR. In another embodiment, this document provides an isolated antibody that specifically binds human GITR, wherein the human GITR comprises residues 26-241 of SEQ ID NO: 701, and wherein the antibody binds a human GITR epitope containing at least one of residues 60 or 63 SEQ ID NO: 701. In another embodiment, provided herein is an isolated antibody that specifically binds to human GITR, wherein the antibody exhibits, compared to binding to human GITR, reduced or no binding to a protein identical to human GITR, except for the presence of the amino acid substitution D60A or G63A. In one embodiment, the antibody induces, activates, or enhances human GITR activity. In another embodiment, provided herein is an antibody, or antigen-binding fragment thereof, that competes with the antibody or antigen-binding fragment thereof described herein for binding to GITR (eg, human GITR). In a specific embodiment, provided herein is an antibody, or antigen-binding fragment thereof, that competes with the antibody described herein, or antigen-binding fragment thereof, for binding to GITR (e.g., human GITR) to the same extent as the antibody described herein or its antigen-binding fragment competes with itself for binding to GITR (eg, human GITR). In another specific embodiment, provided herein is a first antibody, or antigen-binding fragment thereof, that competes with the antibody or antigen-binding fragment thereof described herein for binding to GITR (e.g., human GITR), wherein the first antibody, or antigen-binding fragment thereof, competes for binding in an assay comprising the following steps: (a) container incubation of the GITR-transfected cells with the first antibody or antigen-binding fragment thereof in unlabeled form; (b) adding to the cells in the container the antibody described herein or its antigen-binding fragment in labeled form and incubating the cells in the container; and (c) detecting binding of an antibody described herein, or an antigen-binding fragment thereof in labeled form, to cells. In another specific embodiment of the invention, provided herein is a first antibody, or antigen-binding fragment thereof, that competes with the antibody described herein, or an antigen-binding fragment thereof, for binding to GITR (e.g., human GITR), wherein the competition manifests itself as reduced binding of the first antibody, or its antigen-binding fragment with GITR (e.g., human GITR) by more than 80% (e.g., 85%, 90%, 95%, or 98%, or 80% to 85%, 80% to 90%, 85% to 90%, or 85% to 95% %).

In certain embodiments, an antibody or fragment thereof as provided herein that specifically binds to GITR (eg, human GITR), activates, induces, or increases the activity of GITR (eg, human GITR). In specific embodiments, an antibody provided herein that specifically binds to GITR (eg, human GITR) is a humanized antibody, a mouse antibody, or a chimeric antibody. In certain embodiments, an antibody provided herein that specifically binds to GITR (eg, human GITR) binds to GITR (eg, human GITR) with a Kd ranging from about 0.5 nM to 5 nM. In certain embodiments, an antibody provided herein that specifically binds to GITR (eg, human GITR) contains a detectable label. In specific embodiments, the antibody provided herein is isolated.

In certain embodiments, an antibody or fragment thereof described herein that immunospecifically binds to GITR (eg, human GITR) induces, activates, or enhances human GITR activity in a cell, regardless of RTK initiation. In specific embodiments of the invention, the cell is a T cell. In specific embodiments of the invention, the cell is not a T cell. In specific embodiments, the cell is selected from the group consisting of B cell, plasma cell, memory cell, natural killer cell, granulocyte, neutrophil, eosinophil, basophil, mast cell, monocyte, dendritic cell, plasmacytoid dendritic cell, NKT cell and macrophage. In specific embodiments, an antibody described herein that immunospecifically binds to GITR (eg, human GITR) induces, activates, or increases NF-kB activity, regardless of RTK initiation. In certain embodiments of

NF-κΒ activity can be assessed, for example, in an assay comprising the following steps: (a) incubation of T cells (eg Jurkat cells) expressing an NF-kB luciferase reporter construct (eg GloResponse NF-kB-1uc2P construct ) and GITR (e.g., human GITR), with an antibody described herein, or an isotype control antibody at an antibody concentration of, for example, 12.5, 10, 5, 2.5, 1.25, or 0.625 μg/mL, in lack of anti-CD3 antibodies; and (b) reading the luciferase signal, e.g., after 2, 5, 6, 8, or 18 hours of incubation with, e.g., an EnVision 2100 multilabel reader, wherein a positive luciferase signal compared to an isotype control antibody is indicative of NF-kB activity. In a specific embodiment of the invention, the luciferase signal is read after 5 hours of incubation.

In certain embodiments, an antibody or fragment thereof described herein that immunospecifically binds to GITR (eg, human GITR) increases the percentage of polyfunctional (IFNu+ TNFa+) T cells. In specific embodiments of the invention, the increase in the percentage of polyfunctional (IFNy + TNFa +) T cells can be assessed, for example, in an analysis that includes the following steps: (a) incubation, for example, of human PBMCs, for example, with anti-CD3 antibody at various suboptimal concentrations ( for example, 0.3-5 μg/ml); and, for example, an antibody described herein that immunospecifically binds to GITR (eg, human GITR), for example, at 5 μg/ml, or an isotype control antibody for, for example, 3-4 days at 37°C and 5% _CO2 ; (b) treating the cells with, for example, brefeldin A for, for example, 6 hours at 37° C. and 5% CO2; (c) staining the cell surface with, for example, an anti-CD3 antibody, an anti-CD4 antibody, and an anti-CD8α antibody; (d) intracellular staining with, for example, an anti-IFNy antibody and an anti-TNFa antibody; and (e) determining the percentage of polyfunctional (IFNy+ TNFa+) T cells compared to an isotype control antibody. In specific embodiments, polyfunctional T cells (IFNu+ TNFa+) are selected from the group consisting of polyfunctional (IFNu+ TNFa+) CD4+ T cells and polyfunctional (IFNu+ TNFa+) CD8+ T cells. In specific embodiments, an antibody or fragment thereof described herein that immunospecifically binds to GITR (e.g., human GITR) binds to activating Fc gamma receptors selected from the group consisting of CD16 when bound to activated regulatory T cells. , CD32A and CD64, to a greater extent (for example, greater in 1.2, 1.3, 1.4, 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5, 6 , 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90 times, or 100 times) than the antibody, when bound to activated effector T cells, binds to activating Fcgamma receptors selected from the group consisting of CD16, CD32A and CD64 as assessed by methods described herein or known to one of skill in the art (e.g. IIIA Fc gamma receptor (CD16) reporter assay or as described in the examples below). In specific embodiments of the invention, activating Fc-gamma receptors are expressed on a cell selected from the group consisting of myeloid effector cells and lymphocytic effector cells. In a specific embodiment, the activating Fc-gamma receptor is CD16.

In specific embodiments, an antibody or fragment thereof described herein that immunospecifically binds to GITR (e.g., human GITR) when bound to activated regulatory T cells results in enhanced activation of activating Fc-gamma receptors selected from the group consisting of CD16, CD32A and CD64 than the antibody, when bound to activated effector T cells, leads to the activation of activating Fcgamma receptors selected from the group consisting of CD16, CD32A and CD64. In specific embodiments, the activation of activating Fc-gamma receptors upon binding of an antibody described herein that immunospecifically binds to GITR (e.g., human GITR) to activated regulatory T cells is at least about 1.2, 1, 3, 1.4, 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 times more potent than activation of activating Fc-gamma receptors upon binding of an antibody described herein that immunospecifically binds to GITR (e.g., human GITR) to activated effector T cells, as assessed methods described herein or known to those skilled in the art (eg, Fc-gamma receptor IIIA (CD16) reporter assay or as described in the examples below). In specific embodiments of the invention, activating Fc-gamma receptors are expressed on a cell selected from the group consisting of myeloid effector cells and lymphocytic effector cells. In a specific embodiment, the activating Fc-gamma receptor is CD16.

In certain embodiments, an antibody or fragment described herein that immunospecifically binds to GITR (e.g., human GITR) increases surface expression of OX40 and/or PD-1 in activated T cells by at least 1,2, 1, 3, 1.4, 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900 or 1000 times as assessed by the methods described herein and/or known to a person skilled in the art, compared to surface expression of OX40 and/or PD-1 in activated T cells without the antibody described herein.

In another embodiment, provided herein are nucleic acid molecules encoding a heavy chain variable region and/or a light chain variable region, or a light chain and/or heavy chain of an antibody described herein. In a particular embodiment, the nucleic acid molecule encodes a heavy chain variable region comprising the nucleotide sequence of SEQ ID NO: 209. In another specific embodiment, the nucleic acid molecule encodes a light chain variable region comprising the nucleotide sequence of SEQ ID NO: 210 or SEQ ID NO : 211. In specific embodiments, the nucleic acid molecule is isolated. In certain embodiments, the vector (eg, an isolated vector) comprises a nucleic acid molecule encoding a heavy chain variable region and/or a light chain variable region, or a light chain and/or heavy chain of an antibody described herein. In certain embodiments of the invention, the host cell contains a nucleic acid molecule or a vector. Examples of host cells include E. coli, Pseudomonas, Bacillus, Streptomyces, yeast, CHO, YB/20, NS0, PER-C6, HEK-293T, NIH-3T3, HeLa, BHK, Hep G2, SP2/0, R1 .1, B-W, L-M, COS 1, COS 7, BSC1, BSC40, BMT10, plant cells, insect cells and human cells in tissue culture. In a particular embodiment, this document provides a method for producing an antibody or antigen-binding fragment thereof that specifically binds to GITR (e.g., human GITR), comprising culturing a host cell such that expression of the nucleic acid occurs and an antibody is produced.

In another embodiment, this document provides a method for enhancing costimulation of T cells, comprising ex vivo incubation of T cells that have been stimulated with a T cell receptor complex (RTC) stimulating agent (e.g., phytohemagglutinin (PHA) and/or phorbol myristacetate (PMA ), or an antibody that stimulates the PTK complex, such as an anti-CD3 antibody and an anti-CD28 antibody) with the antibody described herein or an antigen-binding fragment thereof. In another embodiment, provided herein is a method for activating T cells, comprising ex vivo incubation of T cells with an antibody or antigen-binding fragment thereof as described herein. In some embodiments, the method further comprises ex vivo incubating the T cells with an agent that stimulates the PTK complex (e.g., phytohemagglutinin (PHA) and/or phorbol myristacetate (PMA), or an antibody that stimulates the PTK complex, such as an anti-CD3 antibody). and anti-CD28 antibody), before, simultaneously with, or after incubation with an anti-GITR antibody or antigen-binding fragment thereof. In some embodiments of the invention, T cells have been isolated from the body of the subject. In certain embodiments of the invention, the subject is infused with stimulated and/or activated T cells. In some embodiments, the T cells that are infused into a subject are autologous or allogeneic. In a specific embodiment of the invention, the subject is a human. In another embodiment, provided herein is a method for preferentially expanding effector T cells over regulatory T cells in a subject, comprising administering to the subject an effective amount of an antibody described herein, or an antigen-binding fragment thereof. In a specific embodiment of the invention, the subject is a human. In another embodiment, provided herein is a method for increasing T cell expansion (e.g., CD4+ and/or CD8+ T cells) and/or T cell effector function, comprising ex vivo incubation of T cells with an antibody described herein, or its antigen-binding fragment. In some embodiments, the method further comprises incubating the T cells with an agent that stimulates the T cell receptor complex (RTC) (e.g., phytohemagglutinin (PHA) and/or phorbol myristacetate (PMA), or an antibody that stimulates the T cell receptor complex, such as anti-CD3 antibody and anti-CD28 antibody), before, simultaneously with, or after incubation of T cells with the antibody or antigen-binding fragment thereof. In certain embodiments of the invention, T cells have been isolated from the body of the subject. In some embodiments, the method further comprises infusing the subject with T cells after they have expanded and/or after their effector function has increased. In certain embodiments of the invention, the T cells that are infused into the subject are autologous or allogeneic. In a specific embodiment of the invention, the subject is a human. In another embodiment, provided herein is a method for increasing the expansion of CD8+ T cells, comprising ex vivo incubation of T cells with an antibody or antigen-binding fragment thereof as described herein. In some embodiments, the method further comprises incubating the T cells with an agent that stimulates the T cell receptor complex (RTC) (e.g., phytohemagglutinin (PHA) and/or phorbol myristacetate (PMA), or an antibody that stimulates the T cell receptor complex, such as antiCD3 antibody and anti-CD28 antibody), before, simultaneously with, or after incubation of T cells with the antibody or antigen-binding fragment thereof. In certain embodiments of the invention, T cells have been isolated from the body of the subject. In some embodiments, the method further comprises infusing the subject with T cells after they have expanded and/or after their effector function has increased. In certain embodiments of the invention, the T cells that are infused into the subject are autologous or allogeneic. In a specific embodiment of the invention, the subject is a human.

In another embodiment, provided herein is a method for increasing the expansion of CD4+ T cells, comprising ex vivo incubation of T cells with an antibody or antigen-binding fragment thereof as described herein. In some embodiments, the method further comprises incubating the T cells with a T cell receptor complex (RTC) stimulating agent (e.g., phytohemagglutinin (PHA) and/or phorbol myristacetate (PMA) or an antibody that stimulates the T cell receptor complex, such as anti -CD3 antibody and anti-CD28 antibody), before, simultaneously with or after incubation of T cells with the antibody or its antigen-binding fragment. In certain embodiments of the invention, T cells have been isolated from the body of the subject. In some embodiments, the method further comprises infusing the subject with T cells after they have expanded and/or after their effector function has increased. In certain embodiments of the invention, the T cells that are infused into the subject are autologous or allogeneic. In a specific embodiment of the invention, the subject is a human.

In another embodiment, provided herein is a method for activating GITR or activating NF-kB, comprising ex vivo incubation of T cells that have not been stimulated with a T cell receptor complex (RTC) stimulating agent (e.g., phytohemagglutinin (PHA) and/or phorbol myristacetate (PMA), or an antibody that stimulates the PTK complex, such as an anti-CD3 antibody and an anti-CD28 antibody) with the antibody described herein or an antigen-binding fragment thereof. In some embodiments of the invention, T cells have been isolated from the body of the subject. In certain embodiments of the invention, the subject is infused with activated T cells. In some embodiments, the T cells that are infused into a subject are autologous or allogeneic. In a specific embodiment of the invention, the subject is a human.

In another embodiment of the invention, this document provides a method of activating T cells, regardless of the initiation of RTK, including bringing T cells into contact with the antibody described herein or its antigen-binding fragment.

In another embodiment of the invention, provided herein is a method for inducing, activating, or increasing NF-kB activity, independent of RTK initiation, comprising contacting T cells with an antibody described herein, or an antigen-binding fragment thereof.

In another embodiment of the invention, this document provides a method for increasing the percentage of polyfunctional (IFNy + TNFa +) T cells, including bringing the T cells into contact with the antibody described herein or its antigen-binding fragment.

In another embodiment of the invention, this document provides a method of increasing the surface expression of OX40 and/or PD-1 in activated T cells, including bringing the T cells into contact with the antibody described herein or its antigen-binding fragment.

In another embodiment, provided herein are pharmaceutical compositions comprising an antibody or antigen-binding fragment thereof, nucleic acid molecule, vector, or host cell described herein, and a pharmaceutically acceptable carrier. The pharmaceutical composition can be used to modulate an immune response and/or treat and/or prevent a disorder such as cancer or an infectious disease. In a specific embodiment of the invention, provided herein is a method for modulating an immune response in a subject, comprising administering to the subject an effective amount of a pharmaceutical composition described herein. In a specific embodiment of the invention, an increase or induction of an immune response occurs. In another specific embodiment of the invention, provided herein is a method for increasing T cell expansion and/or T cell effector function in a subject, comprising administering to the subject an effective amount of a pharmaceutical composition described herein. In another specific embodiment of the invention, provided herein is a method for increasing the expansion of CD8+ T cells in a subject, comprising administering to the subject an effective amount of a pharmaceutical composition described herein. In some embodiments, the invention provides for the use of an antibody described herein in the manufacture of a medicament for the treatment of cancer. In certain embodiments, the invention provides an antibody described herein for use in the treatment of cancer. In certain embodiments, the invention provides for the use of a pharmaceutical composition described herein in the manufacture of a medicament for the treatment of cancer. In certain embodiments, the invention provides a pharmaceutical composition described herein for use in the treatment of cancer. In another specific embodiment of the invention, provided herein is a method of treating cancer in a subject, comprising administering to the subject an effective amount of a pharmaceutical composition described herein. In certain embodiments of the invention

- 15 040077 the method of treating cancer further comprises administering an anti-cancer agent to the subject. Examples of anticancer agents that can be administered to a subject in combination with a pharmaceutical composition described herein are described in section 5.4 below (eg, sections 5.4.1 and 5.4.1.1). In a particular embodiment, the anticancer agent is a vaccine. In a particular embodiment, the vaccine comprises a heat shock protein peptide complex (HSPPC), wherein the HSPPC contains a heat shock protein (eg, gp96 protein) complexed with one or more antigenic peptides (eg, tumor-associated antigenic peptides). In certain embodiments, the cancer being treated is squamous cell carcinoma, small cell lung cancer, non-small cell lung cancer, gastrointestinal cancer, Hodgkin's or non-Hodgkin's lymphoma, pancreatic cancer, glioblastoma, glioma, cervical cancer, ovarian cancer, liver cancer, bladder cancer, breast cancer, colon cancer, colorectal cancer, endometrial carcinoma, myeloma, salivary gland carcinoma, kidney cancer, basal cell carcinoma, melanoma, prostate cancer, vulvar cancer, thyroid cancer, testicular cancer, esophageal cancer or a type of head and neck cancer. In certain embodiments, the cancer being treated is desmoplastic melanoma, inflammatory breast cancer, thymoma, rectal cancer, anal cancer, or surgically resectable or non-surgical brainstem glioma. In a specific embodiment of the invention, the subject being treated is a human. In another embodiment of the invention, this document provides a method of activating T cells, regardless of the initiation of RTK in a subject, comprising administering to the subject an effective amount of a pharmaceutical composition described herein.

In another embodiment, provided herein is a method for inducing, activating, or increasing NF-kB activity, independent of the initiation of RTK in a subject, comprising administering to the subject an effective amount of a pharmaceutical composition described herein.

In another embodiment, provided herein is a method for increasing the percentage of polyfunctional (IFNy+ TNFa+) T cells in a subject, comprising administering to the subject an effective amount of a pharmaceutical composition described herein.

In another embodiment, provided herein is a method for increasing surface expression of OX40 and/or PD-1 in activated T cells in a subject, comprising administering to the subject an effective amount of a pharmaceutical composition described herein.

The antibody described herein can be used in combination with an IDO inhibitor for the treatment of cancer. In one embodiment, provided herein is a method of treating cancer in a subject, comprising administering to the subject an effective amount of a pharmaceutical composition described herein, the method further comprising administering to the subject an indolamine-2,3-dioxygenase (IDO) inhibitor. An IDO inhibitor for use in the treatment of cancer described herein is in a solid dosage form of a pharmaceutical composition such as a tablet, pill or capsule, wherein the pharmaceutical composition contains an IDO inhibitor and a pharmaceutically acceptable excipient. Therefore, the antibody described herein and the IDO inhibitor described herein may be administered separately, sequentially, or simultaneously as separate dosage forms. In one embodiment, the antibody is administered parenterally and the IDO inhibitor is administered orally. In specific embodiments, the inhibitor is selected from the group consisting of epacadostat (Incyte Corporation), F001287 (Flexus Biosciences), indoxymod (NewLink Genetics), and NLG919 (NewLink Genetics). Epacadostat has been described in PCT Publication No. WO 2010/005958, which is incorporated herein by reference in its entirety in all respects. In one embodiment, the inhibitor is epacadostat. In another embodiment, the inhibitor is F001287. In another embodiment, the inhibitor is indoxymod. In another embodiment, the inhibitor is NLG919.

The antibody described herein can be used in combination with a checkpoint-targeting agent for the treatment of cancer. In one embodiment, provided herein is a method of treating cancer in a subject, comprising administering to the subject an effective amount of a pharmaceutical composition described herein, the method further comprising administering to the subject a checkpoint targeting agent. In some embodiments, the checkpoint targeting agent is selected from the group consisting of a PD-1 antagonist (e.g., an anti-PD-1 antagonist antibody), a PD-L1 antagonist (e.g., an anti-PD-L1 antagonist antibody), a PD antagonist -L2 (eg, anti-PD-L2 antagonist antibody), CTLA-4 antagonist (eg, anti-CTLA-4 antagonist antibody), TIM-3 antagonist (eg, anti-TIM-3 antagonist antibody), LAG-3 antagonist (eg, an anti-LAG-3 antagonist antibody) and an OX40 agonist (eg, an anti-OX40 agonist antibody). In some embodiments, a checkpoint targeting agent, such as a PD-1 antagonist (on

- 16 040077 example, an anti-PD-1 antagonist antibody) or an OX40 agonist (eg, an anti-OX40 agonist antibody) is administered simultaneously with the anti-GITR antibody. In some embodiments, a checkpoint targeting agent, e.g., a PD-1 antagonist (e.g., an anti-PD-1 antagonist antibody) or an OX40 agonist (e.g., an anti-OX40 agonist antibody), is administered prior to administration of the anti-GITR antibody. In some embodiments, a checkpoint targeting agent, e.g., a PD-1 antagonist (e.g., an anti-PD-1 antagonist antibody) or an OX40 agonist (e.g., an anti-OX40 agonist antibody), is administered after administration of the anti-GITR antibody.

The antibody described herein can be used in combination with an anti-CD25 antibody. In some embodiments, the anti-CD25 antibody is administered concurrently with the anti-GITR antibody. In some embodiments, the anti-CD25 antibody is administered prior to the administration of the anti-GITR antibody. In some embodiments, the anti-CD25 antibody is administered following the administration of the anti-GITR antibody.

In another specific embodiment, provided herein is a method of treating cancer in a subject, comprising administering an anti-PD-1 antagonist antibody to a subject in need thereof who has received an anti-GITR antibody, wherein the anti-PD-1 antibody is administered at a time when the anti-PD-1 -GITR antibody increases the expression of PD-1 in the subject compared to the expression of PD-1 in the subject at the time of administration. In another specific embodiment, provided herein is a method of treating cancer in a subject, comprising administering an anti-OX40 agonist antibody to a subject in need thereof who has received an anti-GITR antibody, wherein the anti-OX40 antibody is administered at a time when the anti-GITR antibody increases expression of OX40 in the subject compared to expression of OX40 in the subject at the time of administration. In certain embodiments, the anti-GITR antibody induces, activates, or upregulates the expression of GITR.

In another specific embodiment, provided herein is a method of treating cancer in a subject, comprising administering an anti-GITR antibody to a subject in need thereof, wherein the anti-GITR antibody increases expression of PD-1 in the subject relative to expression of PD-1 in the subject during the time of administration; and the administration of the anti-PD-1 antagonist antibody to the subject when an increase in PD-1 expression occurs. In another specific embodiment, provided herein is a method of treating cancer in a subject, comprising administering an anti-GITR antibody to a subject in need thereof, wherein the anti-GITR antibody increases the subject's OX40 expression relative to the subject's OX40 expression at the time of administration, and administering an OX40 agonist antibody to a subject when there is an increase in OX40 expression. In certain embodiments, the anti-GITR antibody induces, activates, or upregulates the expression of GITR. In another specific embodiment of the invention, provided herein is a method for treating cancer or a viral infection in a subject, comprising the steps of: (a) incubating T cells ex vivo with the antibody described herein, or an antigen-binding fragment thereof; and (b) infusion of T cells into the subject. In a particular embodiment, the T cells that are infused into the subject are autologous or allogeneic. In certain embodiments of the invention, T cells have been isolated from the body of the subject. In some embodiments, the T cells are not incubated with an agent that stimulates the T cell receptor complex (RTC) (e.g., phytohemagglutinin (PHA) and/or phorbol myristacetate (PMA) or an antibody that stimulates the T cell receptor complex, such as anti-CD3 antibody and anti-CD28 antibody). In certain embodiments of the invention, the method further comprises, prior to step (a): (1) analyzing T cells for expression of GITR on the cell surface; and, (2) if step (1) does not result in detection of GITR above a threshold, induction of GITR expression on the surface of T cells by incubating the T cells with a T cell receptor complex (RTC) stimulating agent (e.g., phytohemagglutinin (PHA ) and/or phorbol myristacetate (PMA), or an antibody that stimulates the PTK complex, such as an anti-CD3 antibody and an anti-CD28 antibody). In some embodiments, the method further comprises incubating the T cells with a T cell receptor complex (RTC) stimulating agent (e.g., phytohemagglutinin (PHA) and/or phorbol myristacetate (PMA) or an antibody that stimulates the T cell receptor complex, such as anti -CD3 antibody and anti-CD28 antibody), before, simultaneously or after step (a). In a specific embodiment of the invention, the subject being treated is a human. In another embodiment of the invention, provided herein is a method for treating and/or preventing an infectious disease in a subject, comprising administering to the subject an effective amount of a pharmaceutical composition described herein. See section 5.4.1.2 below for examples of infectious diseases. In another specific embodiment of the invention, provided herein is a method of treating a viral infection, comprising administering to a subject an effective amount of a pharmaceutical composition described herein. In certain embodiments, the viral infection being treated is human papillomavirus (HPV), herpes simplex or other herpes virus, hepatitis B virus (HBV), hepatitis C virus (HCV) or other hepatitis virus, measles virus, HIV or Epstein-Barr virus (EBV). In certain embodiments, the method of treating a viral infection further comprises administering an antiviral agent to the subject. In a specific embodiment of the invention, the subject being treated is a human.

In another specific embodiment, provided herein is a method for detecting an anti-GITR antibody that is capable of inducing, activating, or increasing GITR activity in the absence of a PTK agonist, comprising contacting a cell expressing GITR with an anti-GITR antibody in the absence of a PTK agonist, and measurement of GITR activity, with increased GITR activity compared to GITR activity in the absence of an anti-GITR antibody, indicating that the anti-GITR antibody is capable of inducing, activating, or increasing GITR activity in the absence of a PTK agonist. In certain embodiments of the invention, GITR activity is assessed by measuring NF-kB activity. In certain embodiments of the invention, GITR activity is assessed by measuring the activation of TRAF adapter-mediated signaling pathways, wherein the TRAF adapter is selected from the group consisting of TRAF1, TRAF2, TRAF3, TRAF4, and TRAF5. In certain embodiments of the invention, GITR activity is assessed by measuring activation of the MAPK/ERK pathway. In certain embodiments of the invention, the anti-GITR antibody increases the activity of GITR by at least two times compared to the activity of GITR in the absence of anti-GITR antibody. In certain embodiments of the invention, the anti-GITR antibody increases the activity of GITR from two to twenty times compared to the activity of GITR in the absence of anti-GITR antibodies. In certain embodiments of the invention, the anti-GITR antibody increases the activity of GITR two to ten times compared to the activity of GITR in the absence of anti-GITR antibody. In certain embodiments of the invention, the cell is a T cell. In certain embodiments of the invention, the cell is not a T cell.

In another specific embodiment, provided herein is an anti-GITR antibody that specifically binds to human GITR, wherein said antibody is capable of inducing, activating, or increasing GITR activity in a cell in the absence of RTK initiation. In another specific embodiment, provided herein is an anti-GITR antibody that specifically binds to human GITR, wherein said antibody induces, activates, or increases NF-κB activity in a cell in the absence of PTK initiation. In another specific embodiment, provided herein is a method of treating cancer comprising administering to a subject in need an anti-GITR antibody that specifically binds to human GITR, said antibody being capable of inducing, activating, or increasing GITR and/or NF-κB activity. in the absence of RTK initiation.

3.1. Terminology

The terms about and approximately, used herein to modify a numerical value or numerical range, indicate that deviations of 5 to 10% up and 5 to 10% down from the value or range remain within the intended value of the given magnitude or range.

In the context of this document, the binding between the test antibody and the first antigen is significantly reduced compared to the binding between the test antibody and the second antigen, if the binding between the test antibody and the first antigen is reduced by at least 30%, 40%, 50%, 60%, 70%, or 80%. compared to the binding between the antibody under study and the second antigen, for example, in this experiment or in accordance with the average values of several experiments as assessed, for example, by an analysis method that includes the following steps: (a) expression on the surface of cells (for example, cells 1624- 5) the first antigen or the second antigen; (b) staining cells expressing the first antigen or second antigen using, for example, 2 μg/ml of the test antibody or polyclonal antibody in a flow cytometry assay and recording mean fluorescence intensity (MFI) values, for example, as an average of more than one experiment, and the polyclonal antibody recognizes both the first antigen and the second antigen; (c) dividing the CIF of the test antibody for cells expressing the second antigen by the CIF of the polyclonal antibody for cells expressing the second antigen (CIF ₂ ratio); (d) dividing the CIF of the test antibody for cells expressing the first antigen by the CIF of the polyclonal antibody for cells expressing the first antigen (CIF1 ratio); and (e) determining the percent reduction in binding by calculating 100%x(1-(CIF1 ratio/ _CIF2 ratio)).

For the purposes of this document, an antibody does not exhibit significant binding to an antigen if, as measured by flow cytometry, the mean fluorescence intensity (MFI) value of the antibody against the antigen does not substantially exceed the MIF value of the isotype control antibody against the antigen, or the MIF value in the absence of any antibody. As used herein, the terms antibody and antibodies are terms accepted in the art, can be used interchangeably herein, and refer to a molecule with an antigen-binding site that specifically binds an antigen.

Antibodies may include, for example, monoclonal antibodies, recombinantly produced antibodies, monospecific antibodies, multispecific antibodies (including bispecific antibodies), human antibodies, humanized antibodies, chimeric antibodies, immunoglobulins, synthetic antibodies, tetrameric antibodies containing two molecules of heavy antibody light chain monomer, antibody heavy chain monomer, antibody light chain dimer, antibody heavy chain dimer, antibody light chain-antibody heavy chain pair, intrabodies, antibody heteroconjugates, single domain antibodies, monovalent antibodies, single chain antibodies or single chain Fvs (scFvs), camelized antibodies, affibodies, Fab fragments, F(ab') ₂ fragments, disulfide-linked Fvs (sdFvs), anti-idiotypic (anti-Id) antibodies (including, for example, anti-anti-Id antibodies), and antigen-binding fragments of any of the above antibodies. In certain embodiments, the antibodies described herein refer to populations of polyclonal antibodies. Antibodies may be of any type (eg, IgG, IgE, IgM, IgD, IgA, or IgY), any class (eg, IgG1, IgG2, IgG3, IgG4, IgA1, or IgA2), or any subclass (eg, IgG2a or IgG2b) of an immunoglobulin molecule. . In certain embodiments, the antibodies described herein are IgG antibodies, or a class (eg, human IgG1 or IgG4) or subclass thereof. In a particular embodiment, the antibody is a humanized monoclonal antibody. In another specific embodiment, the antibody is a human monoclonal antibody, preferably an immunoglobulin. In certain embodiments, the antibody described herein is an IgG1 or IgG4 antibody.

As used herein, the terms antigen-binding domain, antigen-binding site, antigen-binding fragment, and similar terms refer to the portion of an antibody molecule that contains amino acid residues that confer antigen specificity on the antibody molecule (e.g., hypervariable regions (CDRs)). The antigen binding site can be obtained from any animal species such as rodents (eg mouse, rat or hamster) and humans.

In the context of this document, the terms variable region or variable domain are used interchangeably and are generally accepted in the art. Variable region generally refers to the part of an antibody, generally the light or heavy chain part, typically about 110 to 120 amino-terminal amino acids in the mature heavy chain and about 90 to 115 amino acids in the mature light chain, which are strongly differ in sequence among antibodies and provide the binding and specificity of a particular antibody for a particular antigen. Variability in sequences is concentrated in regions called hypervariable regions (CDRs), while more highly conserved regions in the variable domain are called framework regions (FRs). Without being limited by any particular mechanism or theory, it is believed that the CDRs of the light and heavy chains are primarily responsible for the interaction and specificity of the antibody and antigen. In certain embodiments of the invention, the variable region is a human variable region. In certain embodiments, the variable region comprises a rodent or mouse CDR and human framework regions (FRs). In specific embodiments, the variable region is a primate (eg, monkey) variable region. In certain embodiments, the variable region comprises a rodent or mouse CDR and a primate (eg, monkey) framework (FR).

The terms VL and VL domain are used interchangeably and refer to the variable region of the light chain of an antibody.

The terms VH and VH domain are used interchangeably and refer to the variable region of an antibody heavy chain.

The term Kabat numbering and similar terms are known in the art and refer to the numbering system for amino acid residues in the heavy and light chain variable regions of an antibody or antigen-binding portion thereof. In certain aspects, the CDR of an antibody can be determined according to the Kabat numbering system (see, for example, Kabat EA & Wu TT (1971) Ann NY Acad Sci 190: 382-391 and Kabat EA et al. (1991) Sequences of Proteins of Immunological Interest, Fifth Edition, U.S. Department of Health and Human Services, NIH Publication No. 91-3242). According to Kabat's numbering system, CDRs within a heavy chain molecule are typically found at amino acid positions 31 to 35, which may optionally include one or two additional amino acids after 35 (referred to according to Kabat's numbering scheme as 35A and 35B) ( CDR1), amino acid positions 50 to 65 (CDR2), and amino acid positions 95 to 102 (CDR3). According to the Kabat numbering system, CDRs within a light chain molecule are typically found at amino acid positions 24 to 34 (CDR1), amino acid positions 50 to 56 (CDR2), and amino acid positions 89 to 97 (CDR3). In a particular embodiment, the CDRs of the antibodies described herein were determined according to the Kabat numbering scheme. In the context of this document, the terms constant region or constant domain are used interchangeably and have the meanings generally accepted in the art. A constant region is a portion of an antibody, such as the carboxy-terminal portion of the light and/or heavy chain, that is not directly involved in antibody-antigen binding, but which may exhibit various effector functions such as interaction with the Fc receptor. The constant region of an immunoglobulin molecule generally has a more conserved amino acid sequence than the variable domain of an immunoglobulin.

In the context of this document, the term heavy chain, as used in relation to an antibody, may refer to any unique type, such as alpha (α), delta (δ), epsilon (ε), gamma (γ), and mu (μ), based on the amino acid sequence of the constant domain, which is the reason for the division of antibodies into classes IgA, IgD, IgE, IgG and IgM, respectively, including subclasses of IgG, for example, IgG1, IgG2, IgG3 and IgG4.

As used herein, the term light chain as used in relation to an antibody may refer to any unique type, such as kappa (k) or lambda (λ) based on the amino acid sequence of the constant domains. Light chain amino acid sequences are well known in the art. In specific embodiments of the invention, the light chain is a human light chain.

Binding affinity generally refers to the set of non-covalent interactions between one binding site of a molecule (eg, an antibody) and its binding partner (eg, an antigen). Unless otherwise indicated, in the context of this document, binding affinity refers to a characteristic binding affinity that represents a 1:1 interaction between members of a binding pair (eg, antibody and antigen). The affinity of a molecule X for its partner Y can generally be represented by the dissociation constant (Kd). Affinity can be determined and/or expressed using a wide variety of methods known in the art, including, but not limited to, equilibrium dissociation constant (Kd) and equilibrium association constant (K _A ). Kd is calculated by the coefficient k _duss /k _acc , while K _A is calculated by the coefficient k _acc /k _duss . k _acc refers to the association rate constant of eg an antibody against an antigen, and k _diss refers to the dissociation of eg an antibody against an antigen. k _acc and k _diss can be determined using methods known to the person skilled in the art, such as BIAcore® or KinExA.

As used herein, a conservative amino acid substitution is one in which an amino acid residue is replaced by an amino acid residue with a similar side chain. Families of amino acid residues having a certain type of side chains have been defined in the art. These families include amino acids with basic side chains (eg, lysine, arginine, histidine), acidic side chains (eg, aspartic acid, glutamic acid), uncharged polar side chains (eg, glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine, tryptophan), non-polar side chains (eg, alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine), beta-branched side chains (eg, threonine, valine, isoleucine), and aromatic side chains (eg, tyrosine, phenylalanine , tryptophan, histidine). In certain embodiments of the invention, one or more amino acid residues within the CDRs or within the framework regions of an antibody or antigen-binding fragment may be replaced with an amino acid residue with a similar side chain.

In the context of this document, an epitope is a term accepted in the art and refers to a localized region of an antigen to which an antibody can specifically bind. An epitope may be, for example, contiguous amino acids of a polypeptide (linear or continuous epitope), or an epitope may, for example, be formed from two or more non-contiguous regions of a polypeptide or polypeptides (conformational, non-linear or discontinuous epitope). In certain embodiments of the invention, the epitope to which the antibody binds can be determined by, for example, NMR spectroscopy, X-ray diffraction crystallography, ELISA analysis, hydrogen/deuterium exchange in conjunction with mass spectrometry (for example, electrospray liquid chromatography-mass spectrometry) , matrix scanning analysis of oligopeptides and/or mapping by mutagenesis (eg, mapping by site-directed mutagenesis). In the case of X-ray crystallography, crystallization can be carried out using any methods known in the art (for example, Giege R et al. (1994) Acta Crystallogr D Biol Crystallogr 50(Pt 4): 339-350; McPherson A (1990) Eur J Biochem 189: 1-23; Chayen NE (1997) Structure 5: 1269-1274; McPherson A (1976) J Biol Chem 251: 6300-6303). Antibody crystals: antigen can be examined using well-known X-ray diffraction techniques and fine-tuning can be done using software such as X-PLOR (Yale University, 1992, supplied by Molecular Simulations, Inc.; see, for example, Meth Enzymol ( 1985), volumes 114 and 115, eds Wyckoff HW et al.; U.S. 2004/0014194) and BUSTER (Bricogne G (1993) Acta Crystallogr D Biol Crystallogr 49(Pt 1): 37-60; Bricogne G (1997) Meth Enzymol 276A: 361-423, ed Carter CW Roversi P et al (2000) Acta Crystallogr D Biol Crystallogr 56(Pt 10): 1316-1323). Mutagenesis mapping studies can be carried out using any method known to a person skilled in the art. See, for example, Champe M et al. (1995) J Biol Chem 270: 1388-1394 and Cunningham VS & Wells JA (1989)

- 20 040077

Science 244: 1081-1085 for a description of mutagenesis methods, including alanine-scanning mutagenesis methods. In a particular embodiment, the epitope of an antibody or antigen-binding fragment thereof is determined using alanine-scanning mutagenesis assays as described in section 6 below. In the context of this document, the terms immunospecifically binds, immunospecifically recognizes, specifically binds, and specifically recognizes are analogous in the context of antibodies and refer to molecules that bind to an antigen (e.g., an epitope or immune complex) in the sense that binding is intended by those skilled in the art. the field of technology. For example, a molecule that specifically binds to an antigen may bind to other peptides or polypeptides with a generally lower affinity as determined by e.g. in the art methods of analysis. In a particular embodiment, molecules that immunospecifically bind to an antigen bind to the antigen with a K _A that is at least 2 log, 2.5 log, 3 log, 4 log or more greater than the K _A when the molecules bind to another antigen. .

In another specific embodiment, molecules that immunospecifically bind to an antigen do not cross-react with other proteins under similar binding conditions. In another specific embodiment, molecules that immunospecifically bind to an antigen do not cross-react with other non-GITR proteins. In a specific embodiment of the invention, this document provides an antibody or fragment thereof that binds to GITR with higher affinity than to another, unrelated antigen. In certain embodiments, provided herein is an antibody or fragment thereof that binds to GITR (e.g., human GITR) with an affinity of 20, 25, 30, 35, 4o, 45, 50, 55, 60, 65, 70, 75%, 80%, 85%, 90%, 95% or more greater than the affinity for another unrelated antigen as measured by a method such as radioimmunoassay, surface plasmon resonance, or kinetic exclusion assay. In a particular embodiment, the degree of binding of an anti-GITR antibody described herein, or an antigen-binding fragment thereof, to an unrelated, non-GITR protein is less than 10%, 15%, or 20% of the binding of the antibody to the GITR protein, as measured by a method such as radioimmunoassay.

In a specific embodiment of the invention, this document provides an antibody, or fragment thereof, that binds to human GITR with higher affinity than other types of GITR. In certain embodiments, provided herein is an antibody or fragment thereof that binds to human GITR with an affinity of 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70 % or more greater than the affinity for another species of GITR of another species as measured by a method such as radioimmunoassay, surface plasmon resonance, or kinetic exclusion assay. In a particular embodiment of the invention, the binding of an antibody or fragment thereof that binds to human GITR to another type of GITR protein is less than 10%, 15%, or 20% of the binding of the antibody or fragment thereof to human GITR protein, as measured by a method such as radioimmunoassay, surface plasmon resonance, or kinetic exclusion assay.

As used herein, the terms glucocorticoid-induced TNFR family receptor or GITR, or GITR polypeptide refer to GITR, including, but not limited to, native GITR, a GITR isoform, or a cross-species homologue of GITR. GITR is a 26 kDa type I transmembrane protein. GenBank™ accession numbers BC152381 and BC152386 represent exemplary nucleotide sequences for human GITR. Swiss-Prot accession number Q9Y5U5-1 (TNR18HUMAN; SEQ ID NO: 701) and GenBank™ accession number NP_004186 represent the representative human GITR amino acid sequences for isoform 1. This amino acid sequence is 241 amino acids long, with the first 25 amino acid residues encoding signal sequence. Isoform 1 is a type I membrane protein. The exemplary mature amino acid sequence of human GITR is shown as SEQ ID NO: 700. In contrast, isoform 2 is the secreted form of human GITR and is approximately 255 amino acids long.

Swiss-Prot accession number Q9Y5U5-2 and GenBank™ accession number NP683699 represent the representative human GITR amino acid sequences for isoform 2. Human GITR isoform 3 is approximately 234 amino acids long. Swiss-Prot accession number Q9Y5U5-3 and GenBank™ accession number NP_683700 (precursor of isoform 3) represent exemplary human GITR amino acid sequences for isoform 3. In a particular embodiment, GITR is human GITR. In another specific embodiment, the GITR is human GITR isoform 1 (SEQ ID NO: 701). In certain embodiments, the GITR is human isoform 2 (SEQ ID NO: 702) or human isoform 3 (SEQ ID NO: 703). GITR is also known as a member of the tumor necrosis factor receptor 18 (TNFRSF18) superfamily, an activation-inducible receptor of the family

TNFR (AITR), GITR-D and CD357. The human GITR is designated as GeneID: 8784 in the Entrez Gene.

The amino acid sequence of the immature form of the generic cynomolgus monkey GITR protein is shown in SEQ ID NO: 704. The mature form of this generic protein corresponds to amino acids 26234 in SEQ ID NO: 704.

As used herein, the terms GITR ligand and GITRL refer to a glucocorticoid-inducible TNFR-like protein ligand. GITRL is also known as activation-induced TNF-like ligand (AITRL) and a member of the tumor necrosis factor 18 ligand superfamily (TNF-SF18). GenBank™ accession number AF125303 represents the exemplary nucleotide sequence of human GITRL. GenBank™ accession number NP_005083 and Swiss-Prot accession number Q9UNG2 represent exemplary amino acid sequences for human GITRL. In a specific embodiment, the GITRL is a human GITRL with SEQ ID NO: 716.

As used herein, the term host cell can represent any type of cell, such as a primary cell, a cell in culture, or a cell from a cell line. In specific embodiments of the invention, the term host cell refers to a cell transfected with a nucleic acid molecule and the progeny or potential progeny of such a cell. The progeny of such a cell may not be identical to the parent cell transfected with the nucleic acid molecule, for example, due to mutations or environmental influences that may occur in subsequent generations, or integration of the nucleic acid molecule into the genome of the host cell.

As used herein, the term effective amount in the context of applying therapy to a subject refers to the amount of therapy that achieves the desired prophylactic or therapeutic effect. Examples of effective amounts are given in section 5.4.1.3 below.

In the context of this document, the terms subject and patient are used interchangeably. The subject may be an animal. In some embodiments, the subject is a mammal, such as a non-primate (eg, cow, pig, horse, cat, dog, rat, etc.) or primate (eg, monkey or human), most preferably a human. In certain embodiments, these terms refer to a non-human animal (eg, a non-human animal such as a pig, horse, cow, cat, or dog). In some embodiments of the invention, these terms refer to a domestic or farm animal. In specific embodiments of the invention, these terms refer to a person.

4. Brief description of graphic materials

In FIG. 1 is a Western blot under non-reducing conditions illustrating the specificity of the anti-GITR antibody 231-32-15 compared to an isotype control. Antibody blotting is performed against human recombinant GITR protein (recombinant Hu GITR protein), mouse recombinant GITR protein (recombinant Mu GITR protein), CMS5A cells expressing recombinant human GITR (CMS5A-huGITR), wild-type CMS5A cells (CMS5A-gt) , protein from activated CD4+ cells (activated CD4+) and protein from untreated CD4+ cells (untreated CD4+). 231-32-15 reactivity is observed against human GITR, recombinant human GITR in CMS5A cells, and native human GITR in activated CD4+ cells.

Fig. 2A and 2B illustrate a FACS analysis of competitive binding of anti-GITR antibodies against a commercial (R&D Systems) anti-GITR mAb. In FIG. 2A, blocking of the R&D Systems mAb is examined using the R&D mAb and test antibodies (antibody 1042-7, antibody 1039-45, antibody 1333-21 and antibody 32-15) as indicated in the figure. The no antibody condition illustrates the binding of a single R&D Systems mAb in the absence of test antibodies. Fig. 2B illustrates blocking of anti-GITR antibody 231-1039-45 without mAb using R&D Systems mAb and test antibodies (10427 antibody, 1039-45 antibody, 1333-21 antibody, and 32-14 antibody) as indicated in the figure. The no antibody condition illustrates the binding of a single 231-1039-45 antibody in the absence of test antibodies.

Fig. 3A, 3B and 3C. Fig. 3A illustrates staining of CMS5A-GITR with antibodies 1333-21 lot 1, 1333-21 lot 2, and antibody R&D at various antibody concentrations. In FIG. 3B shows ex vivo fluorescence intensity plots of PBMCs of CD3-CD19-GITR+ and CD4+CD25+GITR+ cells after staining with antibodies 1042-7, 32-15, 1039-45, 1333-21 and antibody R&D. In FIG. 3C shows FACS analysis for CD3-CD19-GITR+ and CD4+CD25+GITR+ cells with 1333-21 antibody and R&D Systems antibody.

Fig. 4 illustrates the evaluation of the co-stimulatory effect of an anti-GITR antibody on CD4+ T cells in combination with various concentrations of anti-CD3 (OKT3) antibody. The top panel plots the % cells with low CFSE for each antibody tested (PBS control, R&D, 1042-7, 32-15, 1039-45, and 1333-21) in combination with decreasing OKT3 antibody concentrations (5, 1, 0.2, 0.04 and 0 µg/mL). The lower panel plots the concentration of IFNy (pg/mL) for each test antibody (PBS control, R&D, 1042-7, 32-15, 1039-45, and 1333-21) in combination with decreasing concentrations of OKT3 antibody (5 µg/mL). ml, 1 µg/ml, 0.2 µg/ml, 0.04 µg/ml and 0 µg/ml).

- 22 040077

Fig. 5 illustrates the binding of GITRL-PE to GITR in the presence of anti-GITR antibodies - chimeric parent 231-32-15 and m6C8. An additional SK48E26 antibody that recognizes IL-1b was used as a negative control. Percent binding of GITRL-PE was determined using suspension matrix technology (Luminex® 200 system) in the presence of increasing concentrations of antibodies (12, 37, 111, 333, 1000, 3000 and 9000 ng/ml). Fig. 5 illustrates the results of four independent replicates of this assay run in duplicate, and the standard deviation was determined for n=8.

Fig. 6 is similar to that shown in FIG. 5 is a graph in which the percentage of GITRL-PE binding was determined using suspension matrix technology (Luminex® 200 system) in the presence of increasing concentrations of antibodies (12, 37, 111, 333, 1000, 3000 and 9000 ng/ml). The anti-GITR antibodies tested were the chimeric parent antibody 231-32-15 and two humanized variants Hum231#1 and Hum231#2. This figure illustrates the results of a single experiment conducted in duplicate. Fig. 7 illustrates GITR ligand binding to GITR in the presence of mAb as measured by surface plasmon resonance (BIAcore® T100/200). The anti-GITR antibodies tested were the chimeric parent antibody 231-32-15, humanized variants of Hum231#1 and Hum231#2, and m6C8. Anti-IL-1b antibody SK48E26 served as a negative control.

In FIG. 8A and 8B are FACS plots of suboptimal CD3 stimulation assays to assess the effect of anti-GITR antibody stimulation on enriched CD4+ T cells from two different buffy coats. Fig. 8A illustrates a FACS analysis of cell number and proliferation of CD4 T cells from a group with a strong response to stimulation (buffy coat 6), and FIG. 8B illustrates the FACS analysis for the low response group (buffy coat 8). Cell proliferation (CFSE; x-axis) is for 10 μg/ml anti-GITR antibody (chimeric parent antibody 231-32-15 and humanized variants Hum231#1 and Hum231#2). A single anti-CD3/anti-CD28 antibody or no stimulation served as controls. The analysis was carried out in triplicate.

Fig. 9A and 9B are bar graphs illustrating the effect of anti-GITR humanized Hum231#1 and Hum231#2 variant antibodies on enriched CD4 T cell proliferation (Figure 9A) and cell number (Figure 9B) compared to m6C8 antibody in a suboptimal stimulation assay. CD3. Antibodies were used at a concentration of 10 μg/ml. The last column (filled in black; FIGS. 9A and 9B) illustrates anti-CD3/anti-CD28 stimulation without the addition of any anti-GITR antibodies.

Fig. 10A, 10B, 10C, and 10D illustrate an analysis of cytokine production of IFNy, IL-6, IL-10, and TNFa, respectively, induced by administration of anti-GITR antibodies in a suboptimal CD3 stimulation assay. The anti-GITR antibodies tested were the chimeric parental 231-32-15 and humanized variants Hum231#1 and Hum231#2 at concentrations of 10 μg/ml and 5 μg/ml.

Fig. 11 is a bar graph illustrating additional titration of antiGITR antibodies and their effect on cell proliferation in a suboptimal CD3 stimulation assay. Chimeric parental antibody 231-32-15 and humanized variants Hum231#1 and Hum231#2 were used at concentrations of 10 μg/ml, 5 μg/ml and 2.5 μg/ml.

Fig. 12A and 12B illustrate additional titration of anti-GITR antibodies and their effect on IFN-y production in a CD3 suboptimal stimulation assay. Chimeric parental antibody 231-3215 and humanized variants Hum231#1 and Hum231#2 were used at concentrations of 10 μg/mL, 5 μg/mL, and 2.5 μg/mL as plate-bound antibodies (FIG. 12A) or 20 μg/mL. ml, 10 µg/ml and 5 µg/ml as soluble antibodies (FIG. 12B).

In FIG. 13 is a set of bar graphs illustrating the results of costimulation with 5 μg/mL plate-bound Hum231#2 on PBMC cytokine secretion in a suboptimal CD3 stimulation assay. The data shown in FIG. 13 obtained from two donors examined on day 2 and day 4 after stimulation. The maximum fold increase in induction compared to the isotype control was plotted for six different cytokines (IFNy, IL-2, TNFa, IL-10, IL-13, and IL-4). Whiskers represent the standard deviation of two replicates for each cytokine. Each donor was examined in at least three independent experiments.

In FIG. 14A, 14B and 14C are the results of an intracellular cytokine assay showing IFN-γ and TNFα production induced by plate-bound Hum231#2, Hum231#2w, or pab1989 (an IgG4 analogue of Hum231#2w) upon suboptimal CD3 stimulation. In FIG. 14A is a group of flow cytometry plots illustrating co-staining of IFNy and TNFa for CD4+ and CD8+ T cells. The percentage of IFNy+ monofunctional T cells, TNFa+ monofunctional T cells, or IFNy+ TNFa+ polyfunctional T cells were plotted for Hum231#2, Hum231#2w, pab1989, or isotype control in the range of suboptimal anti-CD3 antibody concentrations (Fig. 14B and 14C). Each point in Fig. 14B and 14C represent a double replica for the condition under study. The whiskers represent the standard deviation. Anti-GITR antibodies were used at a concentration of 5 μg/ml. Graphs are representative of experiments with

- 23 040077 PBMC from two (Fig. 14A and 14B) and four (Fig. 14C) different donors, respectively.

In FIG. 15A, 15B and 15C are groups of bar graphs illustrating the results of experiments comparing the anti-GITR antibody Hum231#2 under different crosslinking conditions. Fig. 15A is a bar graph illustrating the maximum fold increase in induction versus isotype control for the percentage of IFNy+ TNFa+ polyfunctional CD8+ T cells using PBMC co-stimulated with 5 µg/mL plate-bound (SP) or soluble Hum231#2 or isotype control. . The whiskers represent the standard deviation. * represents p<0.05 and ** represents p<0.005 (unpaired T-test). In FIG. 15B and 15C plotted the maximum fold increase in induction compared to isotype control for six different cytokines for plate-bound Hum231#2 (FIG. 15B) or anti-Fc cross-linked Hum231#2 (FIG. 15C).

The whiskers represent the standard deviation for the double cue for each cytokine.

Fig. 16A and 16B illustrate the results of anti-CD3/anti-CD28 and anti-GITR antibody stimulation on effector (T-eff) and regulatory T cells (Treg). In FIG. 16A shows that activated T effector and T regulatory cells express GITR on their surface after stimulation with anti-CD3/anti-CD28 alone or in combination with anti-GITR antibodies. Meanwhile, as shown in FIG. 16B, costimulation with anti-GITR antibodies results in preferential expansion of effector T cells over regulatory T cells. Cellular expansion/proliferation (CFSE; y-axis) is illustrated for 10 μg/ml anti-GITR antibodies (chimeric parent antibody 231-32-15 and humanized variants Hum231#1 and Hum231#2) on buffy coat 8. Anti-CD3/ alone served as controls. anti-CD28 antibody at 125 ng/mL or no stimulation.

Fig. 17A and 17B illustrate the results for T cell proliferation induced by the tested anti-GITR antibodies. Fig. 17A illustrates the proliferation of CD4 cells and FIG. 17B illustrates the proliferation of CD8 cells in total PBMC stimulated with 31.25 ng/ml of anti-CD3 antibody. The chimeric parent antibody 231-32-15 and the humanized variants Hum231#1 and Hum231#2 were tested at a concentration of 10 μg/ml.

In FIG. 18A, 18B and 18C are graphs illustrating the results of the NF-KB-luciferase GITR reporter assay in the absence or presence of 0.3 μg/ml plate-bound anti-CD3 antibody (clone SP34). In FIG. 18A is a graph showing the relative light units (RFU) of luciferase over a range of anti-GITR antibody concentrations 18 hours after stimulation in the presence of anti-CD3 antibody. In FIG. 18B is a graph showing luciferase OSE at various concentrations of anti-GITR antibody 5 hours post-stimulation in the absence of anti-CD3 antibody. In FIG. 18C is a graph showing peak luciferase expression (GITR Ab/isotype control) at 0, 2, 5, 6, 8, and 18 hours post-stimulation. The whiskers represent the standard deviation for two replicas. The anti-GITR antibodies tested were Hum231#2w and m6C8. Data shown are representative of four experiments with anti-CD3 antibody or two experiments without anti-CD3 antibody.

In FIG. 19A is a bar graph illustrating the normalized density of human GITR receptors on activated nTreg, CD4+ T cells, or CD8+ T cells as measured by flow cytometry.

The anti-GITR antibody used was a PE-conjugated mouse anti-human anti-GITR antibody (Biolegend: 621; 311604/B171072). The whiskers represent the standard deviation.

In FIG. 19B is a graph illustrating the assay of the anti-GITR antibody Hum231#2w using the Fc gamma receptor IIIA (CD16) reporter cell line. Jurkat NFAT-luciferase reporter cells overexpressing CD16A with a high affinity 158 V/V polymorphism were cultured together with activated primary nTreg and effector T cells for 20 h at 37°C in the presence of Hum231#2w or an isotype control. After 20 hours, relative light units (RFU) representing CD16A binding were recorded. Δ OCE represents the OCE of the antiGITR antibody minus the OCE of the isotype control. The whiskers represent the standard deviation (n=2). Data shown are representative of experiments with cells from three donors. In FIG. 19C is a group of histograms illustrating surface expression of GITR as determined by flow cytometry. Samples were obtained from the blood of healthy human donors (ac, n=3) or from tumor tissues of patients with non-small cell lung cancer (NSCLC) (d-f, n=3). Cell populations were defined as: Tconv (CD3+, CD4+, CD8a-, CD25low, FOXP3-) or Tregs (CD3+, CD4+, CD8a-, CD25high, FOXP3+).

Fig. 20A, 20B and 20C illustrate the results of experiments using African green monkey (AGM) PBMCs. In FIG. 20A is a group of plots of flow cytometry staining of activated African green monkey (AZM) CD4+ and CD8+ T cells using anti-GITR antibody Hum231#2 and anti-PD-1 antibody. PBMCs of healthy ASMs were activated with anti-CD3 antibody (clone SP34.2) or ConA plus IL-2 (20 U/ml) for 3 days. Flow cytometry plots are representative of experiments in which

- 24 040077 used PBMCs from three different ASMs. Fig. 20B and 20C represent the results of CD3 substimulation analysis using AZM PBMC. In FIG. 20B is a pair of flow cytometry plots illustrating CD8 and IFNy co-staining for cells co-stimulated with Hum231#2w or isotype control. In FIG. The 20C percentage of IFNu+ CD8+ ASM T cells was plotted for different concentrations of anti-GITR antibody. Each dot represents a two-well replica, and the whiskers represent the standard deviation. The data shown in FIG. 20B and 20C are representative of experiments with PBMCs from two AZMs.

Fig. 21A and 21B illustrate the results of surface OX40 and PD-1 staining on CD4+ and CD8+ T cells stimulated with 0.8 μg/ml plate-bound anti-CD3 antibody and 5 μg/ml anti-GITR antibody Hum231#2. In FIG. 21A is a group of flow cytometry plots and histograms illustrating co-staining of OX40 and PD-1. In FIG. 21B, each bar represents the CIF value for PD-1 and OX40 on CD4+ and CD8+ T cells stimulated with Hum231#2 (black bars), isotype control (gray bars), or medium alone (white bars). The whiskers represent the standard deviation. The flow cytometry plots are representative of single-donor PBMC experiments.

Fig. 22A and 22B illustrate the design of mutation libraries for generating antibody variants with germline modifications. The various positions of the framework and CDRs included in the library based on the human germline IGHV1-2*02 VH are shown in FIG. 22A (SEQ ID NOs: 37-53, respectively, in order of appearance), and for a library based on the human germline IGKV4-1*01 VL, in FIG. 22B (SEQ ID NO: 54-71, respectively, in order of appearance).

Fig. 23 is a table listing 17 antibody variants with germline modifications and specifying their heavy and light chain variable regions with their respective SEQ ID numbers. The table shows the number of additional germline amino acids and the average relative affinity of the variant antibodies compared to the chimeric parental antibody 231-32-15.

Fig. 24A-C are tables listing 107 antibody variants with germline modifications and specifying their heavy and light chain variable regions with their respective SEQ ID numbers.

Fig. 25A and 25B illustrate the binding of GITRL-PE and GITR in the presence of a set of anti-GITR antibody variants with germline modifications. Percent binding of GITRL-PE was determined using suspension matrix technology (Luminex® 200 system) in the presence of increasing concentrations of antibodies (12, 37, 111, 333, 1000, 3000 and 9000 ng/ml).

Fig. 26A and 26B illustrate the effect of antibody variants with germline modifications on cell proliferation (low % CFSE) compared to chimeric parent antibody 231-32-15 and humanized variants Hum231#1 and Hum231#2 for enriched CD4 T cells from two buffy coats, BC4 (FIG. 26A) and BC9 (FIG. 26B). A CD3 suboptimal stimulation assay was performed using plate-bound anti-CD3 antibody at 125 ng/mL with plate-bound or soluble isotype control. Anti-GITR antibodies were used at a concentration of 10 μg/ml.

Fig. 27A and 27B illustrate the effect of antibody variants with germline modifications on the release of the cytokines IFNy and IL-10, respectively, compared to the chimeric parent antibody 231-32-15 and the humanized Hum231#1 and Hum231#2 variants for enriched T cells. CD4 from BC4 buffy coat. A CD3 suboptimal stimulation assay was performed using plate-bound anti-CD3 antibody at 125 ng/mL with plate-bound or soluble isotype control. Anti-GITR antibodies were used at a concentration of 10 μg/ml and cytokine levels were measured in the culture supernatant.

Fig. 28A and 28B illustrate the effect of antibody variants with germline modifications on the release of the cytokines IFNy and IL-10, respectively, compared to the chimeric parent antibody 231-32-15 and the humanized Hum231#1 and Hum231#2 variants for enriched T cells. CD4 from BC9 buffy coat. A CD3 suboptimal stimulation assay was performed using plate-bound anti-CD3 antibody at 125 ng/mL with plate-bound or soluble isotype control. Anti-GITR antibodies were used at a concentration of 10 μg/ml and cytokine levels were measured in the culture supernatant.

Fig. 29A and 29B illustrate the percentage of IFNy-positive CD4+ T cells (determined by intracellular staining) of antibody variants with germline modifications compared to the chimeric parent antibody 231-32-15 and humanized variants Hum231#1 and Hum231#2 for enriched T CD4 cells from two buffy coats. Fig. 29A illustrates the results for buffy coat 13 (BC13), and FIG. 29B illustrates the results for buffy coat 18 (BC18).

In FIG. ZOA-C presents a group of graphs illustrating the results of reporter analysis

- 25 040077

GITR NF-kB-luciferase in the presence of 0.3 μg/ml aHTu-CD3 antibody. Anti-GITR antibodies tested in this assay were Hum231#2w and 20 germline variants: pab1964, pab1965, pab1966, pab1967, pab1968, pab1969, pab1970, pab1971, pab1972, pab1973, pab1975, pab1976, pab1978, pab1978 pab1983, pab2159, pab2160 and pab2161. In FIG. 30L-C is a plot of the luciferase OSE at 18 hours post-stimulation for different test concentrations of anti-GITR antibody. The whiskers represent the standard deviation. In FIG. 30D-F is a group of graphs illustrating the results of the NF-kB luciferase GITR reporter assay in the absence of anti-CD3 antibody. The anti-GITR antibodies tested in this assay were m6C8, Hum231#2w and 20 germline variants: pab1964, pab1965, pab1966, pab1967, pab1968, pab1969, pab1970, pab1971, pab1972, pab1973, pab1975, pab1978, pab1978, pab1976 pab1981, pab1983, pab2159, pab2160 and pab2161. In FIG. 30D-F is a plot of the luciferase OCE 6 hours post-stimulation for different test concentrations of anti-GITR antibodies. The whiskers represent the standard deviation. Graphs are representative of data from two experiments (FIGS. 30A-C) or one experiment (FIGS. 30DF).

Fig. 31 illustrates decreased binding of 1624-5 pre-B cells expressing chimeric parent antibody 231-32-15 to biotinylated GITR (GITR-bio) when GITR-bio was pre-incubated with chimeric parent antibody 231-32-15, Hum231# 1 or Hum231#2. The profile on the right in Fig. 31 illustrates binding of 1624-5 pre-B cells expressing the chimeric parent antibody 231-32-15 to GITR-bio. The profile on the right shows a decrease in binding of 1624-5 cells expressing the chimeric parent antibody 231-32-15 to GITR-bio after pre-incubation of GITR-bio with any of the chimeric parent antibody 231-32-15, Hum231#1 or Hum231 #2.

Fig. 32 illustrates the results of epitope competition analysis obtained by surface plasmon resonance (BIAcore® T100/200). The GITR antigen was immobilized on a CM5 sensor chip, and anti-GITR antibodies were used at a concentration of 300 nM. The chimeric parent antibody 231-32-15 was used first, followed by the mouse antibody 6C8.

Fig. 33L and 33B illustrate the results of an epitope mapping experiment using a cell library expressing GITR variants generated by error-corrected PCR. In FIG. 33L and 33B show sequence alignments of GITR variants that bind to the polyclonal anti-GITR antibody but do not bind to the anti-GITR chimeric parental antibody 231-32-15.

Fig. 34A and B illustrate the results of an epitope mapping experiment using alanine scanning. The following positions in human GITR (numbered according to SEQ ID NO: 701) were individually mutated to alanine: P28A, T29A, G30A, G31A, P32A, T54A, T55A, R56A, C57A, C58A, R59A, D60A, Y61A, P62A, G63A , E64A, E65A, C66A, C67A, S68A, E69A, W70A, D71A, C72A, M73A, C74A, V75A and Q76A. The antibodies tested in this experiment, shown in FIG. 34A included: the anti-GITR monoclonal antibody Hum231#2, three germline variants (pab1967, pab1975 and pab1979), and the m6C8 antibody; and a polyclonal anti-GITR antibody (AF689, R&D systems). In FIG. 34A is a table summarizing the binding results of Hum231#2, three germline variants (pab1967, pab1975, and pab1979), and the standard t6C8 antibody to 1624-5 cells expressing human GITR alanine mutants. In FIG. 34B is a group of flow cytometry plots illustrating the staining of 1624-5 cells expressing wild-type human GITR, D60A mutant, or G63A mutant with monoclonal antibodies 231-32-15, Hum231#2, or m6C8, or a polyclonal antibody. The percentage of GITR positive cells is indicated on each graph.

In FIG. 35A shows sequence alignments of human GITR, V1M cynomolgus GITR, and V1M/Q62P/S63G cynomolgus GITR, with positions 62 and 63 highlighted, in which two amino acids from cynomolgus GITR (GlnSer) have been replaced with the corresponding residues in human GITR (ProGly).

In FIG. 35B is a group of flow cytometric plots illustrating the staining of 1624-5 cells expressing human GITR, cynomolgus V1M GITR, or cynomolgus V1M/Q62P/S63G GITR using monoclonal antibodies 231-32-15, Hum231#2, or m6C8, or polyclonal antibodies. anti-GITR antibodies.

5. Detailed description of the invention

Provided herein are antibodies (eg, monoclonal antibodies) and antigen-binding fragments thereof that specifically bind to GITR (eg, human GITR) and modulate GITR activity. For example, in one aspect, provided herein is(s) an antibody(s) or fragment(s) thereof that specifically binds to GITR and enhances, induces, or enhances one or more GITR activities. In a specific embodiment of the invention, the antibody(s) or its(their) antigennegative(e) fragment(s) is isolated. Also provided are isolated nucleic acids (polynucleotides), such as complementary DNA (cDNA), encoding

- 26 040077 such antibodies and their antigen-binding fragments. Further provided are vectors (eg, expression vectors) and cells (eg, host cells) containing nucleic acids encoding such coding antibodies or antigen-binding fragments thereof. Methods for producing such antibodies are also provided. In other aspects, provided herein are methods and uses for inducing, increasing or enhancing GITR activity and treating certain pathological conditions such as cancer and infectious diseases. Related compositions (eg, pharmaceutical compositions), kits, and detection methods are also provided.

5.1. Antibodies

In a specific aspect, provided herein are antibodies (eg, monoclonal antibodies such as chimeric or humanized antibodies) and fragments thereof that specifically bind to GITR (eg, human GITR). In some embodiments, the antibody described herein, or an antigen-binding fragment thereof, partially inhibits the binding of GITRL (eg, human GITRL) to GITR (eg, human GITR). In certain embodiments, an antibody described herein, or an antigen-binding fragment thereof, inhibits the binding of GITRL (e.g., human GITRL) to GITR (e.g., human GITR) by less than 85, 80, 75, 70, 65, 60, 55, 50, 45%, 40%, 35%, 30%, 25%, 20%, or 10% as assessed by a method known to those skilled in the art or described herein. In a particular embodiment, the antibody described herein, or an antigen-binding fragment thereof, inhibits the binding of GITRL (e.g., human GITRL) to GITR (e.g., human GITR) by less than 85, 80, 75, 70, 65, 60, 55, 50, 45, 40, 35, 30, 25, 20 or 10% as assessed by the method described in Example 2 below (eg sections 6.2.5.2 or 6.2.5.4 below). In another specific embodiment of the invention, the antibody described herein or its antigen-binding fragment at a concentration of 1000, 950, 900, 850, 800, 750, 700, 650, 600, 550, 500, 450, 400, 350, 333, 300, 250 , 200, 100, 50 or 10 ng/ml inhibits binding 1.5, 1.4, 1.3, 1.2, 1.1, 1, 0.9, 0.8, 0.7, 0.6 , 0.5, 0.4, 0.3, 0.2, or 0.1 nM labeled GITRL (eg, GITRL-PE) with GITR associated with beads (eg, human GITR associated with Luminex® beads) at a concentration of 9 , 8, 7, 6, 5, 4 or 3 pg/ml per granule less than 85, 80, 75, 70, 65, 60, 55, 50, 45, 40, 35, 30, 25, 20 or 10% compared to binding 1.5, 1.4, 1.3, 1.2, 1.1, 1, 0.9, 0.8, 0.7, 0.6, 0.5, 0.4, 0.3, 0.2, or 0.1 nM labeled GiTRL with GITR bound to beads at 9, 8, 7, 6, 5, 4, or 3 pg/mL per bead, in the absence of anti-GITR antibody or antigen-binding fragment thereof in suspension matrix analysis (eg Luminex® 200 system). In another specific embodiment of the invention, the antibody described herein or its antigen-binding fragment at a concentration of from 1000 to 750 ng/ml, from 1000 to 500 ng/ml, from 850 to 500 ng/ml, from 750 to 500 ng/ml, from 600 to 500 ng/mL, 500 to 400 ng/mL, 400 to 300 ng/mL, or 300 to 200 ng/mL inhibits binding 1.5, 1.4, 1.3, 1.2, 1, 1, 1, 0.9, 0.8, 0.7, 0.6, 0.5, 0.4, 0.3, 0.2, 0.1 nM labeled GITRL (e.g. GITRL-PE) with GITR associated with granules (e.g., human GITR associated with Luminex® granules) at a concentration of 9, 8, 7, 6, 5, 4, or 3 pg/ml per granule less than 85, 80, 75, 70, 65, 60 , 55, 50, 45, 40, 35, 30, 25, 20%, or 10% compared to binding 1.5, 1.4, 1.3, 1.2, 1.1, 1, 0.9, 0.8, 0.7, 0.6, 0.5, 0.4, 0.3, 0.2, or 0.1 nM labeled GiTRL with GITR bound to beads at 9, 8, 7, 6, 5, 4, or 3 pg/mL per bead, in the absence of an anti-GITR antibody or antigen-binding fragment thereof in a suspension matrix assay (e.g., system Luminex® 200). In another specific embodiment, the antibody or antigen-binding fragment thereof at a concentration of 1000 ng/mL inhibits less than 80% (40 to 70%, 50 to 80%, or 40 to 80% in some embodiments) of binding 0.5 nM labeled GITRL (eg, human GITRL) with bead-bound GITR (eg, human GITR associated with Luminex® beads) at 5 pg/mL/bead versus binding of 0.5 nM labeled GITRL to bead-bound GITR at a concentration of 5 pg/ml/bead in the absence of anti-GITR antibody or its antigen-binding fragment in the suspension matrix analysis.

In another specific embodiment of the invention, the antibody described herein or its antigen-binding fragment at a concentration of 3500, 3400, 3300, 3200, 3100, 3000, 2900, 2800, 2700, 2600, 2500, 2400, 2300, 2200, 2100, 2000, 1900 . 8, 0.7, 0.6, 0.5, 0.4, 0.3, 0.2, or 0.1 nM labeled GITRL (eg, GITRL-PE) with bead-bound GITR (eg, human GITR, associated with Luminex® beads) at a concentration of 9, 8, 7, 6, 5, 4 or 3 pg/ml per bead less than 85, 80, 75, 70, 65, 60, 55, 50, 45, 40, 35 , 30, 25, 20, or 10% compared to binding 1.5, 1.4, 1.3, 1.2, 1.1, 1, 0.9, 0.8, 0.7, 0.6 , 0.5, 0.4, 0.3, 0.2, or 0.1 nM labeled GITRL with GITR bound to beads at 9, 8, 7, 6, 5, 4, or 3 pg/mL per bead, in the absence of an anti-GITR antibody or antigen-binding fragment thereof in a suspension matrix assay (e.g. Luminex® system 200). In another specific embodiment of the invention, the antibody described herein or its antigen-binding fragment at a concentration of from 3500 to 3200 ng/ml, from 3500 to 3000 ng/ml, from 3200 to 2500 ng/ml, from 3000 to 2200 ng/ml, from 2500 to 1800 ng/mL, 2000 to 1500 ng/mL, 1700 to 1200 ng/mL, or 1500 to 1000 ng/mL inhibits binding 1.5, 1.4, 1.3, 1.2, 1, 1, 1, 0.9, 0.8, 0.7, 0.6, 0.5, 0.4, 0.3, 0.2 or 0.1

- 27 040077 nM labeled GITRL (eg GITRL-PE) with bead-bound GITR (eg human GITR associated with Luminex® beads) at 9, 8, 7, 6, 5, 4 or 3 pg/mL per bead less than 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, or 10% compared to binding 1.5, 1.4, 1.3, 1 .2, 1.1, 1, 0.9, 0.8, 0.7, 0.6, 0.5, 0.4, 0.3, 0.2, or 0.1 nM labeled GITRL with GITR, bound to beads at 9, 8, 7, 6, 5, 4, or 3 pg/mL per bead, in the absence of anti-GITR antibody or antigen-binding fragment thereof in a suspension matrix assay (e.g. Luminex® 200 system). In a certain embodiment, the antibody described herein, or an antigen-binding fragment thereof at a concentration of 3000 ng/ml, inhibits the binding of 0.5 nM GITRL (e.g., human GITRL) to GITR (e.g., human GITR) by less than 85% or less than 80% (in some embodiments, 60 to 85, 60 to 80%, 70 to 85%, or 70 to 80%) when GITR (e.g., human GITR) is associated with beads (e.g., Luminex® beads) at a concentration of 5 pg/mL per bead compared to the binding of 0.5 nM labeled GITRL to bead-bound GITR at 5 pg/mL/bead in the absence of anti-GITR antibody or antigen-binding fragment thereof in a suspension matrix assay (e.g., Luminex® 200 system). In a certain embodiment, the antibody described herein, or an antigen-binding fragment thereof at a concentration of 1000 ng/ml, inhibits the binding of 0.5 nM GITRL (e.g., human GITRL) to GITR (e.g., human GITR) by less than 85%, less than 80% or less than 75% (in some embodiments, 60 to 85%, 60 to 80%, 70 to 85%, or 70 to 80%) when the GITR (e.g., human GITR) is bound to the beads (e.g., Luminex® Beads) at 5 pg/mL per bead compared to binding of 0.5 nM labeled GITRL to bead-bound GITR at 5 pg/mL/bead in the absence of anti-GITR antibody or antigen-binding fragment thereof in suspension matrix analysis (eg Luminex® 200 system). In a certain embodiment, the antibody described herein, or an antigen-binding fragment thereof at a concentration of 333 ng/ml, inhibits the binding of 0.5 nM GITRL (e.g., human GITRL) to GITR (e.g., human GITR) by less than 70% or less than 65% (in some embodiments, 50 to 70%, 55 to 70%, 50 to 65%, or 50 to 60%) when GITR (eg, human GITR) is bound to beads (eg, Luminex® beads ) at 5 pg/mL per bead compared to the binding of 0.5 nM labeled GITRL to bead-bound GITR at 5 pg/mL/bead in the absence of anti-GITR antibody or antigen-binding fragment thereof in a suspension matrix assay (e.g. , Luminex® 200 system). In a certain embodiment, the antibody described herein, or an antigen-binding fragment thereof at a concentration of 111 ng/ml, inhibits the binding of 0.5 nM GITRL (e.g., human GITRL) to GITR (e.g., human GITR) by less than 65%, less than 60% or less than 55% (in some embodiments, 40 to 65%, 40 to 60%, 40 to 55%, or 30 to 60%) when the GITR (e.g., human GITR) is bound to the beads (e.g., Luminex® Beads) at 5 pg/mL per bead compared to binding of 0.5 nM labeled GITRL to bead-bound GITR at 5 pg/mL/bead in the absence of anti-GITR antibody or antigen-binding fragment thereof in suspension matrix analysis (eg Luminex® 200 system). In a certain embodiment, the antibody described herein, or an antigen-binding fragment thereof at a concentration of 37 ng/ml, inhibits the binding of 0.5 nM GITRL (e.g., human GITRL) to GITR (e.g., human GITR) by less than 40% (in some embodiments implementation of the invention from 20 to 40%, from 20 to 30% or from 15 to 35%) when GITR (for example, human GITR) is associated with granules (for example, Luminex® granules) at a concentration of 5 pg/ml per granule, compared with binding of 0.5 nM labeled GITRL to bead-bound GITR at 5 pg/mL/bead in the absence of anti-GITR antibody or antigen-binding fragment thereof in a suspension matrix assay (eg, Luminex® 200 system). In a certain embodiment, the antibody described herein or an antigen-binding fragment thereof at a concentration of 12 ng/ml inhibits the binding of 0.5 nM GITRL (e.g., human GITRL) to GITR (e.g., human GITR) by less than 20% (in some embodiments implementation of the invention from 10 to 20%), when GITR (for example, human GITR) is associated with granules (for example, Luminex® granules) at a concentration of 5 pg / ml per granule, compared with the binding of 0.5 nM labeled GITRL to GITR associated with granules at a concentration of 5 pg/ml/granule in the absence of anti-GITR antibody or its antigen-binding fragment in the suspension matrix analysis (for example, the Luminex® 200 system).

In certain embodiments, at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, or 75% of GITRL (e.g., human GITRL) binds to GITR (e.g., human GITR) in the presence of an antibody described herein, or an antigen-binding fragment thereof, as assessed by a method known to one of skill in the art or described herein. In a particular embodiment, at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, or 75% of GITRL (e.g., human GITRL) binds to GITR (e.g., human GITR) in the presence of an antibody described herein or its antigen

- 28 040077 binding fragment according to the evaluation method described in example 2 below (for example, section 6.2.5.2 or 6.2.5.4 below). In another specific embodiment of the invention, at least 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70 or 75% 1.5, 1.4, 1.3, 1 .2, 1.1, 1, 0.9, 0.8, 0.7, 0.6, 0.5, 0.4, 0.3, 0.2, or 0.1 nM labeled GITRL (e.g., labeled human GITRL, such as hGITRL-PE) binds to bead-bound GITR (e.g., human GITR bound to Luminex® beads) at a concentration of 9, 8, 7, 6, 5, 4, or 3 pg/mL per bead, in the presence of 1000, 950, 900, 850, 800, 750, 7θ0, 650, 600, 550, 500, 450, 400, 350, 333, 300, 250, or 200 ng/mL of the antibody described herein or its antigen-binding fragment according to compared with binding 1.5 nM, 1.4, 1.3, 1.2, 1.1, 1, 0.9, 0.8, 0.7, 0.6, 0.5, 0.4, 0.3, 0.2, or 0.1 nM labeled GITRL with GITR bound to beads at 9, 8, 7, 6, 5, 4, or 3 pg/mL per bead, in the absence of anti-GITR antibody or antigen-binding antibody thereof fragment in a suspension matrix assay (eg Luminex® 200 system). In another specific embodiment of the invention, at least 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70 or 75% of 1.5 nM, 1.4, 1.3, 1.2, 1.1, 1, 0.9, 0.8, 0.7, 0.6, 0.5, 0.4, 0.3, 0.2, or 0.1 nM labeled GITRL (e.g. , labeled human GITRL, such as hGITRL-PE) binds to bead-bound GITR (e.g., human GITR bound to Luminex® beads) at 9, 8, 7, 6, 5, 4, or 3 pg/mL per bead , in the presence of 1000 to 900 ng/mL, 1000 to 850 ng/mL, 900 to 800 ng/mL, or 850 to 750 ng/mL, or 800 to 750 ng/mL compared to binding 1, 5, 1.4, 1.3, 1.2, 1.1, 1, 0.9, 0.8, 0.7, 0.6, 0.5, 0.4, 0.3, 0, 2 or 0.1 nM labeled GITRL with GITR bound to beads at 9, 8, 7, 6, 5, 4, or 3 pg/mL per bead, in the absence of anti-GITR antibody or antigen-binding fragment thereof in a suspension matrix assay ( e.g. Luminex® 200 system). In another specific embodiment, at least 20%, at least 25%, or at least 30% of 0.5 nM labeled GITRL (e.g. labeled human GITRL such as hGITRL-PE) binds to bead-bound GITR ( e.g. human GITR bound to Luminex® beads) at 5 pg/ml/bead in the presence of 1000 ng/ml antibody or antigen-binding fragment compared to binding of 0.5 nM labeled GITRL to GITR bound to beads at 5 pg/ml/bead bead, in the absence of anti-GITR antibody or antigen-binding fragment thereof in the suspension matrix assay.

In another specific embodiment of the invention, at least 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70 or 75% 1.5, 1.4, 1.3, 1 .2, 1.1, 1, 0.9, 0.8, 0.7, 0.6, 0.5, 0.4, 0.3, 0.2, 0.1 nM labeled GITRL (e.g., labeled human GITRL, such as hGITRL-PE) binds to bead-bound GITR (e.g., human GITR bound to Luminex® beads) at a concentration of 9, 8, 7, 6, 5, 4, or 3 pg/mL per bead, in the presence of 3500, 3400, 3300, 3200, 3100, 3000, 2900, 280θ, 2700, 2600, 2500, 2400, 2300, 2200, 2100, 2000, 1900, 1800, 1700, 1600, 100, 150 1100 or 1000 ng/mL of the antibody described herein or an antigen-binding fragment thereof compared to binding 1.5, 1.4, 1.3, 1.2, 1.1, 1, 0.9, 0.8, 0 .7, 0.6, 0.5, 0.4, 0.3, 0.2, or 0.1 nM labeled GITRL with GITR bound to beads at a concentration of 9, 8, 7, 6, 5, 4, or 3 pg/mL per bead, in the absence of antiGITR antibody or its antigen-binding fragment in the suspension matrix ana lyse (e.g. Luminex® 200 system). In another specific embodiment of the invention, at least 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70 or 75% 1.5, 1.4, 1.3, 1 .2, 1.1, 1, 0.9, 0.8, 0.7, 0.6, 0.5, 0.4, 0.3, 0.2, or 0.1 nM labeled GITRL (e.g., labeled human GITRL, such as hGITRL-PE) binds to bead-bound GITR (e.g., human GITR bound to Luminex® beads) at a concentration of 9, 8, 7, 6, 5, 4, or 3 pg/mL per bead, in the presence of 3500 to 3200 ng/ml, 3500 to 3000 ng/ml, 3200 to 2500 ng/ml, 3000 to 22θ0 ng/ml, 2500 to 1800 ng/ml, 2000 to 1500 ng/ml, 1700 to 1200 ng/mL or 1500 to 1000 ng/mL of the antibody described herein or an antigen-binding fragment thereof compared to binding 1.5, 1.4, 1.3, 1.2, 1.1, 1, 0.9, 0.8, 0.7, 0.6, 0.5, 0.4, 0.3, 0.2, or 0.1 nM labeled GITRL with GITR bound to beads at 9, 8, 7, 6, 5, 4, or 3 pg/mL per bead, in the absence of an anti-GITR antibody or antigen-binding fragment thereof in c dispersion matrix analysis (eg Luminex® 200 system).

In another specific embodiment, at least 20%, at least 25%, or at least 30% of 0.5 nM labeled GITRL (e.g. labeled human GITRL such as hGITRL-PE) binds to bead-bound GITR ( e.g. human GITR bound to Luminex® beads) at 5 pg/ml/bead in the presence of 3000 ng/ml antibody or antigen-binding fragment compared to 0.5 nM labeled GITRL binding to GITR bound to beads at 5 pg/ml/bead, in the absence of anti-GITR antibody or its antigen-binding fragment in the suspension matrix analysis. In another specific embodiment of the invention, at least 25%, at least 30%, at least 40%, or at least 50% (in some embodiments, from 25 to 60%, from 40 to 60%, from 40 to 70% or 25 to 50%) 0.5 nM labeled GITRL (eg labeled human GITRL such as hGITRLPE) binds to bead-bound GITR (eg human GITR associated with Luminex® beads) at a concentration of 5 pg/ ml/bead, in the presence of 1000 ng/ml of the antibody or antigen-binding fragment thereof, compared with the binding of 0.5 nM labeled GITRL to the bead-bound GITR

- 29 040077 lamy at a concentration of 5 pg/ml/bead, in the absence of anti-GITR antibody or its antigen-binding fragment in the suspension matrix analysis. In another specific embodiment of the invention, at least 30%, at least 40%, at least 50%, or at least 60% (in some embodiments, from 30 to 60%, from 40 to 60%, from 40 to 70% or 30 to 50%) 0.5 nM labeled GITRL (eg labeled human GITRL such as hGITRL-PE) binds to bead-bound GITR (eg human GITR associated with Luminex® beads) at a concentration of 5 pg/mL/bead, in the presence of 333 ng/mL antibody or antigen-binding fragment thereof, compared with binding of 0.5 nM labeled GITRL to GITR bound to beads at 5 pg/mL/bead, in the absence of anti-GITR antibody or its antigen-binding fragment in the suspension matrix analysis. In another specific embodiment of the invention, at least 40%, at least 50%, at least 60%, or at least 65% (in some embodiments, from 40 to 70%, from 40 to 60%, from 40 to 65% or 40 to 50%) 0.5 nM labeled GITRL (eg labeled human GITRL such as hGITRL-PE) binds to bead-bound GITR (eg human GITR bound to Luminex® beads) at a concentration of 5 pg/mL/bead, in the presence of 111 ng/mL antibody or antigen-binding fragment thereof, compared with binding of 0.5 nM labeled GITRL to GITR bound to beads at 5 pg/mL/bead, in the absence of anti-GITR antibody or its antigen-binding fragment in the suspension matrix analysis. In another particular embodiment, at least 60%, at least 70%, or at least 80% (in some embodiments, 60 to 80%, 70 to 80%, or 75 to 85%) 0.5 nM labeled GITRL (eg, labeled human GITRL, such as hGITRL-PE) binds to bead-bound GITR (eg, human GITR associated with Luminex® beads) at a concentration of 5 pg/mL/bead, in the presence of 37 ng/mL antibody or antigen-binding fragment thereof versus binding of 0.5 nM labeled GITRL to bead-bound GITR at 5 pg/mL/bead in the absence of anti-GITR antibody or antigen-binding fragment thereof in a suspension matrix assay. In another specific embodiment, at least 80%, at least 85%, or at least 90% (80 to 90% or 85 to 95% in some embodiments) of 0.5 nM labeled GITRL (e.g., labeled human GITRL, such as hGITRL-PE) binds to bead-bound GITR (e.g. human GITR bound to Luminex® beads) at a concentration of 5 pg/mL/bead in the presence of 12 ng/mL of the antibody or antigen-binding fragment thereof at compared to the binding of 0.5 nM labeled GITRL to GITR bound to beads at 5 pg/mL/bead in the absence of anti-GITR antibody or antigen-binding fragment thereof in the suspension matrix assay.

In a specific embodiment of the invention, the antibody described herein or its antigen-negative fragment at a concentration of 3000 ng/ml does not inhibit the binding of 0.5 nM GITRL (for example, human GITRL) to GITR (for example, human GITR) by more than 15% or more than by 20% when GITR (eg, human GITR) is bound to beads (eg, Luminex® beads) at 5 pg/mL per bead, compared with binding of 0.5 nM labeled GITRL to GITR bound to beads at 5 pg/ml/bead, in the absence of an anti-GITR antibody or antigen-binding fragment thereof in a suspension matrix assay (eg Luminex® 200 system). In a specific embodiment of the invention, the antibody described herein or its antigen-binding fragment at a concentration of 1000 ng/ml does not inhibit the binding of 0.5 nM GITRL (for example, human GITRL) to GITR (for example, human GITR) by more than 15%, more than by 20% or more than 25% when GITR (eg human GITR) is bound to beads (eg Luminex® beads) at 5 pg/mL per bead compared to binding of 0.5 nM labeled GITRL to GITR, bound to beads at a concentration of 5 pg/mL/bead, in the absence of an antiGITR antibody or antigen-binding fragment thereof in a suspension matrix assay (eg Luminex® 200 system). In a specific embodiment of the invention, the antibody described herein or its antigen-binding fragment at a concentration of 333 ng/ml does not inhibit the binding of 0.5 nM GITRL (for example, human GITRL) to GITR (for example, human GITR) by more than 30% or more by 35% when GITR (eg, human GITR) is bound to beads (eg, Luminex® beads) at 5 pg/mL per bead compared to binding of 0.5 nM labeled GITRL to GITR bound to beads at 5 pg/ml/bead, in the absence of anti-GITR antibody or antigen-binding fragment thereof in a suspension matrix assay (eg Luminex® 200 system). In a specific embodiment of the invention, the antibody described herein or its antigen-negative fragment at a concentration of 111 ng/ml does not inhibit the binding of 0.5 nM GITRL (for example, human GITRL) to GITR (for example, human GITR) by more than 35%, more than by 40% or more than 45% when GITR (eg human GITR) is bound to beads (eg Luminex® beads) at 5 pg/mL per bead compared to binding of 0.5 nM labeled GITRL to GITR, associated with granules at a concentration of 5 pg/ml/granule, in the absence of anti-GITR antibody or its antigen-binding fragment in the suspension matrix

- 30 040077 analysis (eg Luminex® 200 system). In a certain embodiment, the antibody described herein, or an antigen-binding fragment thereof at a concentration of 37 ng/ml, does not inhibit the binding of 0.5 nM GITRL (e.g., human GITRL) to GITR (e.g., human GITR) by more than 60% when the GITR (e.g., human GITR) bound to beads (e.g., Luminex® beads) at 5 pg/mL per bead compared to binding of 0.5 nM labeled GITRL to bead-bound GITR at 5 pg/ml/bead, in the absence of an antiGITR antibody or antigen-binding fragment thereof in a suspension matrix assay (eg, Luminex® 200 system). In a certain embodiment, the antibody described herein, or an antigen-binding fragment thereof, at a concentration of 12 ng/mL does not inhibit the binding of 0.5 nM GITRL (e.g., human GITRL) to GITR (e.g., human GITR) by more than 80% when the GITR (e.g., human GITR) bound to beads (e.g., Luminex® beads) at 5 pg/mL per bead compared to binding of 0.5 nM labeled GITRL to bead-bound GITR at 5 pg/ml/bead, in the absence of an anti-GITR antibody or antigen-binding fragment thereof in a suspension matrix assay (eg, Luminex® 200 system).

In another embodiment of the invention, a certain amount of labeled GITRL (for example, human GITRL-PE) binds to a GITR associated with beads (for example, human GITR associated with Luminex® beads) in the presence of an antibody described herein or an antigen-binding fragment thereof in a method comprising: (a) binding GITR (eg, human GITR) to the beads at a concentration of approximately 9, 8, 7, 6, 5, 4, or 3 pg/ml per bead; (b) incubation in the well of GITR bound to beads at a concentration of approximately 30, 40, or 50 beads/µl with 3000, 2500, 2000, 1500, 1000, 750, 500, 250, 100, 50, 25, or 10 ng/ml an antibody described herein, or an antigen-binding fragment thereof, for a first time period (eg, 30, 60 minutes, 1.5 hours, 2, 2.5, or 3 hours); (c) adding labeled GITRL (eg human GITRL-PE) to the well to give a final concentration of approximately 1.5, 1, 0.9, 0.8, 0.7, 0.6, 0.5, 0 ,4, 0.3, 0.2, or 0.1 nM labeled GITRL and approximately 15 beads/µl, 20 beads/µl, or 25 beads/µl, and incubation for a second time period (e.g., 30 min, 1 h, 1.5, 2, 2.5 or 3 hours); and (d) detecting labeled GITRL associated with bead-bound GITR, for example, in a suspension matrix assay such as the Luminex® 200 system. In particular embodiments, the amount of labeled GITRL associated with bead-bound GITR in the presence of anti-GITR The antibody or antigen-binding fragment thereof is defined relative to the amount of labeled GITRL bound to bead-bound GITR in the absence of an anti-GITR antibody or antigen-binding fragment thereof. In certain embodiments, the absence of an anti-GITR antibody or antigen-binding fragment means that no antibody or antigen-binding fragment thereof is present in the well. In other embodiments, the absence of an anti-GITR antibody or antigen-binding fragment thereof means that an isotype control antibody is present in the well that does not bind to GITR. According to these embodiments, the amount of labeled GITRL bound to bead-bound GITR in the presence of an anti-GITR antibody or antigen-binding fragment thereof is, in some embodiments, at least 15, 20, 25, 30, 35, 40, 45%, 50%, 55%, or 60%, or 15% to 60%, 20% to 60%, 30% to 70%, or 20% to 50% of the amount of labeled GITRL bound to bead-bound GITR in the absence of anti-GITR an antibody or antigen-binding fragment thereof. In another embodiment of the invention, a certain amount of labeled GITRL (for example, human GITRL-PE) binds to a GITR associated with beads (for example, human GITR associated with Luminex® beads) in the presence of an antibody described herein or an antigen-binding fragment thereof in a method comprising: (a) binding GITR (eg, human GITR) to the beads at a concentration of approximately 5 pg/ml per bead; (b) well incubation of GITR bound to beads at a concentration of approximately 40 beads/µl with 3θθθ ng/mL, 2500, 2000, 1500, 1000, 750, 50θ, 250, 100, 50 or 10 ng/mL as described herein document the antibody or antigen-binding fragment thereof for a first time period (eg, 30, 60 minutes, 1.5 hours, 2, 2.5, or 3 hours); (c) adding labeled GITRL (e.g., human GITRL-PE) to the well to obtain a final concentration of 0.5 nM labeled GITRL and approximately 20 beads/µl and incubating for a second time period (e.g., 30 min, 1 h , 1.5, 2, 2.5 or 3 hours); and (d) detecting labeled GITRL associated with bead-bound GITR, for example, in a suspension matrix assay such as the Luminex® 200 system. In particular embodiments, the amount of labeled GITRL associated with bead-bound GITR in the presence of anti-GITR The antibody or antigen-binding fragment thereof is defined relative to the amount of labeled GITRL bound to bead-bound GITR in the absence of an anti-GITR antibody or antigen-binding fragment thereof. In certain embodiments, the absence of an anti-GITR antibody or antigen-binding fragment means that no antibody or antigen-binding fragment thereof is present in the well. In other embodiments of the invention, the absence of an anti-GITR antibody or antigen-binding fragment means that in

- 31 040077 well contains an isotype control antibody that does not bind to GITR. According to these embodiments, the amount of labeled GITRL bound to bead-bound GITR in the presence of an anti-GITR antibody or antigen-binding fragment thereof is, in some embodiments, at least 20, 25, 30, 35, 40, 45, 50%, 55%, or 60%, or 20% to 70%, 20% to 60%, 30% to 70%, or 20% to 50% of the amount of labeled GITRL bound to bead-bound GITR in the absence of anti-GITR antibody, or its antigen-binding fragment.

In certain embodiments, an antibody described herein or an antigen-binding fragment thereof at a concentration of 150, 145, 140, 135, 130, 125, 120, 115, 110, 105, or 100 nM associated with a GITR (e.g., human GITR) immobilized on a chip (e.g., CM5 sensor chip), inhibits binding of 150, 145, 140, 135, 130, 125, 120, 115, 110, 105, or 100 nM GITRL (e.g., non-covalently bound human GITRL trimer) to GITR immobilized on the chip less than 60% less than 55% less than 50% less than 45% less than 40% less than 35% less than 30% less than 25% less than 20% or less than 15%. In certain embodiments, an antibody described herein, or an antigen-binding fragment thereof, at a concentration of 125 nM, bound to a GITR (e.g., human GITR) immobilized on a chip (e.g., a CM5 sensor chip) inhibits binding of 125 nM GITRL (e.g., non-covalently bound human GITRL trimer) with GITR immobilized on the chip less than 60%, less than 55%, less than 50%, less than 45%, less than 40%, less than 35%, less than 30%, less than 25%, less than 20% or less than 15%.

In certain embodiments, an antibody or fragment thereof described herein binds to a GITR (e.g., human GITR) with a dissociation rate constant (kdiss) of 8.5x10'3 s ^-1 or less, 3.5x10'3 s ^-1 or less, 5x10'3 s ^-1 or less, 2.5x10'3 s ^-1 or less, 1x10-3 s ^-1 or less, 8.5x10 ^-4 s ^-1 or less, 5x10 ^-4 s ^-1 or less less, 3.5x10 ^-4 s ^-1 or less, 2.5x10'4 s ^-1 or less, 1x10 ^-4 s ^-1 or less, 8.5x10'5 s ^-1 or less, 3.5x10'5 s ^-1 or less, 5x10'5 s ^-1 or less, 2.5x10'5 s ^-1 or less, 1x10'5 s ^-1 or less, 8.5x10'6 s ^-1 or less, 5x10'6 s ^{- 1} or less, 3.5x10'6 s ^-1 or less, 2.5x10'6 s ^-1 or less, 1x10'6 s ^-1 or less, 8.5x10'7 s ^-1 or less, 5x10'7 s ^-1 or less, 2.5x10'7 s ^-1 or less, 1x10'7 s ^-1 or less, 8.5x10'8 s ^-1 or less, 5x10'8 s ^-1 or less, 2.5x10'8 s ^-1 or less, 1x10'8 s ^-1 or less, 8.5x10'9 s ^-1 or less, 5x10'9 s ^-1 or less, 2.5x10'9 s ^-1 or less, or 1x10'9 s ^-1 or less. In some embodiments, an antibody described herein, or a fragment thereof, binds to a GITR (e.g., human GITR) with a kdiss of 9.5x10'5 s ^-1 to 1x10 ^-9 s ^-1 , from 8.5x10'5 s ^-1 to 1x10 ^-9 s ^-1 , 5x10'5 s ^-1 to 1x10 ^-9 s ^-1 , 9.5x10'5 s ^-1 to 1x10'8 s ^-1 , 5x10'5 s ^-1 to 1x10'8 s ^-1 , 9.5x10'5 s ^-1 to 1x10'7 s ^-1 , 5x10'5 s ^-1 to 1x10'7 s ^-1 , 9.5x10'5 s ^-1 to 5x10 '6 s ^-1 , 9.5x10'5 s ^-1 to 1x10'5 s ^-1 , 8.5x10'3 s ^-1 to 1x10-4 s ^-1 , 5x10'3 s ^-1 to 2, 5χ10 ^-4 s ^-1 , from 8.5x10'3 s ^-1 , from to 1x10'5 s ^-1 , from 8.5x10'5 s ^-1 to 5x10'5 s ^-1 . In certain embodiments of the invention, kdiss is determined using a monovalent antibody, such as a Fab fragment, and measurements are made, for example, using BIAcore® surface plasmon resonance technology. In other embodiments, k _diss is determined using a bivalent antibody and measurements are made, for example, using BIAcore® surface plasmon resonance technology. In a specific embodiment of the invention, k _diss is determined by the analysis method described in Section 6 below.

In certain embodiments, an antibody or fragment thereof described herein binds to a GITR (eg, human GITR) with an association rate constant (cass) of at least 105 M ^-1 s ^-1 , at least 2.5x105 M ^{- 1} s ^-1 , at least 3.5x105 M ^-1 s ^-1 , at least 5x105 M ^-1 s ^-1 , at least 106 M ^-1 s ^-1 , at least 2.5x106 M ^-1 s ^-1 , at least 3.5x106 M ^-1 s ^-1 , at least 5x106 M ^-1 s ^-1 , at least 107 M ^-1 s ^-1 , at least 5x107 M ^-1 s ^-1 , according to at least 10 ⁸ M ^-1 s ^-1 , at least 5x108 M ^-1 s ^-1 or at least 10 ⁹ M ¹ s ^-1 . In some embodiments, an antibody described herein or a fragment thereof binds to GITR (e.g., human GITR) with cass from 1x105 M ^-1 s ^-1 to 5x105 M ^-1 s ^-1 , from 1x105 M ^-1 s ^-1 to 1x106 M ^-1 s ^-1 , from 3.5x105 M ^-1 s ^-1 to 2.5x106 M ^-1 s ^-1 , from 3.5x105 M ^-1 s ^-1 to 3.5x106 M ^-1 s ^-1 , from 1x105 M ^-1 s ^-1 to 5x106 M ^-1 s ^-1 , from 1x105 M ^-1 s ^-1 to 1x107 M ^-1 s ^-1 , from 1x105 M ^-1 s ^-1 to 5x107 M ^-1 s ^-1 , from 1x105 M ^-1 s ^-1 to 10 ⁸ M ^-1 s ^-1 , from 1x105 M ^-1 s ^-1 to 1x10 ⁹ M ^-1 s ^-1 , from 1x106 M ^-1 s ^-1 to 1x107 M ^-1 s ^-1 , from 1x106 M ^-1 s ^-1 to 1x108 M ^-1 s ^-1 , from 1x106 M ^-1 s ^-1 to 1x10 ⁹ M ^-1 s ^-1 , from 1x107 M ^-1 s ^-1 to 1x108 M ^-1 s ^-1 , from 1x107 M ^-1 s ^-1 to 1x10 ⁹ M ^-1 s ^-1 , from 1x108 M ^-1 s ^-1 to 1x10 ⁹ M ^-1 s ^-1 . In certain embodiments, cass is determined using a monovalent antibody, such as a Fab fragment, and measurements are made, for example, using BIAcore® surface plasmon resonance technology. In other embodiments of the invention, the _acc is determined using a bivalent antibody, and the measurements are carried out, for example, using BIAcore® surface plasmon resonance technology. In a specific embodiment of the invention, k _ac is determined by the analysis method described in section 6 below.

In certain embodiments, an antibody described herein, or a fragment thereof, binds to a GITR (e.g., human GITR) with a Kd of less than 7, 6, 5, 4.5,

- 32 040077

4, 3.5, 3, 2.5, 2, 1.5, 1, 0.75, 0.5, 0.25 or 0.1 nM. In some embodiments, an antibody described herein, or a fragment thereof, binds to a GITR (e.g., human GITR) with a Kd of about 7, 6, 5, 4.5, 4, 3.5, 3, 2.5, 2 , 1.5, 1, 0.75, 0.5, 0.25, or 0.1 nM. In certain embodiments, an antibody or fragment thereof described herein binds to a GITR (e.g., from human GITR) with a Kd of 7 to 2 nM, 5 to 3 nM, 5 to 1 nM, 4 to 3 nM , 4 to 2 nM, 3 to 2 nM, 3 to 1 nM, 2 to 1 nM, 3 to 0.1 nM, 2 to 0.1 nM, 1 to 0.1 nM, or 0.5 to 0.1 nM. In certain embodiments, Kd is calculated as the ratio k _{d u} cc/k _acc , and k _acc and k _{d ss} are determined using a monovalent antibody, such as a Fab fragment, and measurements are made, for example, using BIAcore® surface plasmon resonance technology. In other embodiments, Kd is calculated as the ratio of k _{d u} cc/k _acc , and k _acc and k _{d ss} are determined using a bivalent antibody, such as a Fab fragment, and measurements are made, for example, using BIAcore® surface plasmon resonance technology. In a particular embodiment of the invention, Kd is calculated as shown in the examples in Section 6 below (eg Example 2). In a particular embodiment, an antibody or fragment thereof described herein that specifically binds to GITR (e.g., human GITR) comprises a light chain variable region (VL) comprising:

(a) a VL CDR1 comprising, consisting of, or predominantly consisting of the amino acid sequence KSSQSX ₁ X ₂ X ₃ X4X ₅ X ₆ X ₇ KX ₈ YLX ₉ (SEQ ID NO: 4), where

X1 is L, A, V, I, P, F or M;

X ₂ is L, A, V, I, P, F, M, or S;

X3 is N, G, Q, S, T, C, W, Y, or A;

X ₄ is S, G, N, Q, T, C, W, Y, or A;

X ₅ is G, N, Q, S, T, C, W, Y, or A;

X6 is N, G, Q, S, T, C, W, Y, or A;

X ₇ is Q, G, N, S, T, C, W, Y, or A;

X ₈ is N, G, Q, S, T, C, W, Y, or A;

X9 is T, G, N, Q, S, C, W, Y, V, I, or A; and/or (b) a VL CDR2 comprising, consisting of, or predominantly consisting of the amino acid sequence X1ASTRX2X3 (SEQ ID NO: 5), where

X1 is W, G, N, Q, S, T, C, Y, F, H, or A;

X ₂ represents E, D or A;

X3 is S, G, N, Q, T, C, W, Y, or A; and/or (c) a VL CDR3 comprising, consisting of, or predominantly consisting of the amino acid sequence QX1X2YX3X4PYT (SEQ ID NO: 6), where

X1 is N, G, Q, S, T, C, W or Y;

X2 is D, E or Y;

X ₃ represents S, G, N, Q, T, C, W, Y or A;

X4 is Y, G, N, Q, S, T, C, W, F, H, L, or A.

In specific embodiments, the antibody or antigen-binding fragment thereof contains one, two, or all three of the above VL CDRs. In certain embodiments of the invention, the antibody or antigennegative fragment contains VL CDR1 of one of the antibodies from table. 1. In some embodiments of the invention, the antibody or antigennegative fragment contains VL CDR2 of one of the antibodies from table. 1. In certain embodiments of the invention, the antibody or antigennegative fragment contains VL CDR3 of one of the antibodies from table. 1. In certain embodiments of the invention, the antibody or its antigen-binding fragment contains one, two or all three VL CDRs of one of the antibodies from table. 1 (eg VL CDRs from one row in Table 1, eg all VL CDRs of antibody 231-32-15). In some embodiments, the antibody or antigen-binding fragment thereof contains the VL framework regions described herein. In specific embodiments of the invention, the antibody or its antigen-binding fragment contains the VL framework (FR) of the antibody shown in table. 3 (for example, one, two, three, or four frame regions from one row in Table 3).

In another embodiment, an antibody described herein, or an antigen-binding fragment thereof, that specifically binds to GITR (e.g., human GITR) comprises a heavy chain variable region (VH) comprising:

(a) a VH CDR1 containing, consisting of, or predominantly consisting of the amino acid sequence X1YX2MX3 (SEQ ID NO: 1) wherein

X ₁ is D, E, G or A;

X2 is A, V, L, I, P, F, M, or Y;

X3 is Y, G, N, Q, S, T, C, W, F, or H; and/or (b) a VH CDR2 comprising, consisting of, or predominantly consisting of the amino acid sequence X1IX2X3X4SGX5X6X7YX8QKFX9X10 (SEQ ID NO: 2), wherein

- 33 040077

X ₁ is V, A, L, I, P, F, M or T;

X2 is R, K, H, Q or A;

X ₃ is T, G, N, Q, S, C, W, Y, V, I, or P;

X ₄ is Y, G, N, Q, S, T, C, W, F, H, or A;

X5 is D, E, G or A;

X6 is V, A, L, I, P, F, M or T;

X ₇ is T, G, N, Q, S, C, W, Y, V, I, P, or A;

X ₈ is N, G, Q, S, T, C, W, Y, or A;

X9 is K, R, H, Q or A;

X ₁₀ is D, E, G or A; and/or (c) a VH CDR3 comprising, consisting of, or predominantly consisting of the amino acid sequence SGTVRGX1X2X3 (SEQ ID NO: 3) wherein

X1 is F, A, V, L, I, P, M, Y, W, H, or S;

X ₂ is A or D;

X ₃ is Y, G, N, Q, S, T, C, W, F, H, or V.

In specific embodiments, the antibody or antigen-binding fragment thereof contains one, two, or all three of the above VH CDRs. In certain embodiments of the invention, the antibody or antigennegative fragment contains VH CDR1 of one of the antibodies from table. 2. In some embodiments of the invention, the antibody or antigennegative fragment contains VH CDR2 of one of the antibodies from table. 2. In certain embodiments of the invention, the antibody or antigennegative fragment contains VH CDR3 of one of the antibodies from table. 2. In some embodiments of the invention, the antibody or its antigen-binding fragment contains one, two or all three VH CDRs of one of the antibodies from table. 2 (eg VH CDRs from one row in Table 2, eg all VH CDRs of antibody 231-32-15). In some embodiments, the antibody, or antigen-binding fragment thereof, comprises the VH framework regions described herein. In specific embodiments of the invention, the antibody or its antigennegative fragment contains the VH frame regions of the antibody shown in table. 4 (for example, one, two, three, or four frame regions from one row in Table 4).

Table 1

Amino acid sequences of VL CDR ¹

Antibody VL CDR1 (SEQ ID NO:) VL CDR2 (SEQ ID NO:) VL CDR3 (SEQ ID NO:) 231-32-15 KSSQSLLNSGNQKNYLT (16) WASTERS (17) QNDYSYPYT (18) Hum231#1 KSSQSLLNSGNQKNYLT (16) WASTERS (17) QNDYSYPYT (18) Hum231#2 KSSQSLLNSGNQKNYLT (16) WASTERS (17) QNDYSYPYT (18) pub1964 KSSQSLLNSGNQKNYLS (101) WASTERS (105) QNEYSYPYT (106) pub1965 KSSQSLLNSGNQKNYLT (102) WASTERS (105) QNDYSYPYT (107) pub1966 KSSQSLLNSGNQKNYLT (102) WASTERS (105) QNDYSYPYT (107) pub1967 KSSQSLLNSSNQKNYLT (103) WASTERS (105) QNEYSFPYT (108) pub1968 KSSQSLLNSGNQKNYLS (101) WASTERS (105) QNDYSYPYT (107) pub1969 KSSQSLLNSSNQKNYLT (103) WASTERS (105) QNDYSFPYT (109) pub1970 KSSQSLLNSGNQKNYLS (101) WASTERS (105) QNDYSFPYT (109) pub1971 KSSQSLLNSSNQKNYLT (103) WASTERS (105) QNDYSYPYT (107) pub1972 KSSQSLLNSSNQKNYLS (104) WASTERS (105) QNDYSYPYT (107) pub1973 KSSQSLLNSSNQKNYLT (103) WASTERS (105) QNDYSYPYT (107) pub1975 KSSQSLLNSGNQKNYLT (102) WASTERS (105) QNDYSYPYT (107) pub1976 KSSQSLLNSGNQKNYLS (101) WASTERS (105) QNDYSYPYT (107) pub1977 KSSQSLLNSSNQKNYLT (103) WASTERS (105) QNDYSYPYT (107) pub1979 KSSQSLLNSGNQKNYLT (102) WASTERS (105) QNDYSYPYT (107) pub1980 KSSQSLLNSGNQKNYLS (101) WASTERS (105) QNDYSYPYT (107) pub1981 KSSQSLLNSSNQKNYLT (103) WASTERS (105) QNDYSYPYT (107) pub1983 KSSQSLLNSGNQKNYLT (102) WASTERS (105) QNDYSYPYT (107) pab2159 KSSQSLLNSGNQKNYLT (102) WASTERS (105) QNDYSFPYT (109) pab2160 KSSQSLLNSGNQKNYLT (102) WASTERS (105) QNDYSYPYT (107) pab2161 KSSQSLLNSSNQKNYLT (103) WASTERS (105) QNDYSFPYT (109) 1 KSSQSLLNSGNQKNYLT (102) WASTERS (105) QNDYSYPYT (107) 2 KSSQSLLNSGNQKNYLS (101) WASTERS (105) QNEYSFPYT (108) 3 KSSQSLLNSGNQKNYLS (101) WASTERS (105) QNDYSFPYT (109) 4 KSSQSLLNSSNQKNYLS (104) WASTERS (105) QNDYSYPYT (107) 5 KSSQSLLNSSNQKNYLT (103) WASTERS (105) QNEYSFPYT (108) 6 KSSQSLLNSGNQKNYLS (101) WASTERS (105) QNDYSYPYT (107)

- 34 040077

Ί KSSQSLLNSSNQKNYLS (104) WASTERS (105) QNEYSFPYT (108) 8 KSSQSLLNSGNQKNYLT (102) WASTERS (105) QNEYSYPYT (106) 9 KSSQSLLNSGNQKNYLT (102) WASTERS (105) QNDYSFPYT (109) 10 KSSQSLLNSSNQKNYLS (104) WASTERS (105) QNDYSYPYT (107) eleven KSSQSLLNSSNQKNYLS (104) WASTERS (105) QNDYSFPYT (109) 12 KSSQSLLNSGNQKNYLS (101) WASTERS (105) QNDYSFPYT (109) 13 KSSQSLLNSSNQKNYLT (103) WASTERS (105) QNDYSFPYT (109) 14 KSSQSLLNSGNQKNYLS (101) WASTERS (105) QNDYSYPYT (107) 15 KSSQSLLNSGNQKNYLS (101) WASTERS (105) QNDYSYPYT (107) 16 KSSQSLLNSGNQKNYLT (102) WASTERS (105) QNDYSYPYT (107) 17 KSSQSLLNSGNQKNYLS (101) WASTERS (105) QNEYSFPYT (108) 18 KSSQSLLNSSNQKNYLT (103) WASTERS (105) QNDYSYPYT (107) 19 KSSQSLLNSSNQKNYLS (104) WASTERS (105) QNDYSFPYT (109) 20 KSSQSLLNSGNQKNYLT (102) WASTERS (105) QNDYSYPYT (107) 21 KSSQSLLNSGNQKNYLT (102) WASTERS (105) QNDYSYPYT (107) 22 KSSQSLLNSGNQKNYLS (101) WASTERS (105) QNDHSFPYT(191) 23 KSSQSLLNSGNQKNYLS (101) WASTERS (105) QNDYSSPYT (192) 24 KSSQSLLNSSNQKNYLT (103) WASTERS (105) QNDYSFPYT (109) 25 KSSQSLLNSGNQKNYLT (102) WASTERS (105) QNDYSFPYT (109) 26 KSSQSLLNSGNQKNYLT (102) WASTERS (105) QNEYSFPYT (108) 27 KSSQSLLNSSNQKNYLS (104) WASTERS (105) QNDYSFPYT (109) 28 KSSQSLLNSGNQKNYLS (101) WASTERS (105) QNDYSFPYT (109) 29 KSSQSLLNSSNQKNYLS (104) WASTERS (105) QNDYSYPYT (107) thirty KSSQSLLNSGNQKNYLS (101) WASTERS (105) QNDYSYPYT (107) 31 KSSQSLLNSSNQKNYLT (103) WASTERS (105) QNDYSYPYT (107) 32 KSSQSLLNSGNQKNYLT (102) WASTERS (105) QNDYSYPYT (107) 33 KSSQSLLNSGNQKNYLS (101) WASTERS (105) QNEYSYPYT (106) 34 KSSQSLLNSSNQKNYLT (103) WASTERS (105) QNDYSYPYT (107) 35 KSSQSLLNSGNQKNYLT (102) WASTERS (105) QNDYSYPYT (107) 36 KSSQSLLNSSNQKNYLT (103) WASTERS (105) QNDYSFPYT (109) 37 KSSQSLLNSGNQKNYLT (102) WASTERS (105) QNEYSYPYT (106) 38 KSSQSLLNSGNQKNYLT (102) WASTERS (105) QNDYSYPYT (107) 39 KSSQSLLNSSNQKNYLT (103) WASTERS (105) QNEYSFPYT (108) 40 KSSQSLLNSGNQKNYLS (101) WASTERS (105) QNEYSYPYT (106) 41 KSSQSLLNSGNQKNYLT (102) WASTERS (105) QNDYSYPYT (107) 42 KSSQSLLNSGNQKNYLS (101) WASTERS (105) QNDYSYPYT (107) 43 KSSQSLLNSGNQKNYLT (102) WASTERS (105) QNDYSYPYT (107) 44 KSSQSLLNSGNQKNYLT (102) WASTERS (105) QNEYSFPYT (108) 45 KSSQSLLNSGNQKNYLS (101) WASTERS (105) QNDYSFPYT (109) 46 KSSQSLLNSGNQKNYLS (101) WASTERS (105) QNDYSYPYT (107) 47 KSSQSLLNSGNQKNYLS (101) WASTERS (105) QNDYSFPYT (109) 48 KSSQSLLNSGNQKNYLS (101) WASTERS (105) QNEYSFPYT (108) 49 KSSQSLLNSGNQKNYLT (102) WASTERS (105) QNDYSFPYT (109) 50 KSSQSLLNSSNQKNYLT (103) WASTERS (105) QNDYSYPYT (107) 51 KSSQSLLNSGNQKNYLT (102) WASTERS (105) QNDYSSPYT (192) 52 KSSQSLLNSGNQKNYLT (102) WASTERS (105) QNDYSFPYT (109) 53 KSSQSLLNSGNQKNYLS (101) WASTERS (105) QNDYSYPYT (107) 54 KSSQSLLNSSNQKNYLT (103) WASTERS (105) QNDYSFPYT (109)

- 35 040077

55 KSSQSLLNSGNQKNYLS (101) WASTERS (105) QNDYSFPYT (109) 56 KSSQSLLNSSNQKNYLS (104) WASTERS (105) QNDYSYPYT (107) 57 KSSQSLLNSSNQKNYLS (104) WASTERS (105) QNDYSYPYT (107) 58 KSSQSLLNSGNQKNYLS (101) WASTERS (105) QNDYSYPYT (107) 59 KSSQSLLNSSNQKNYLS (104) WASTERS (105) QNDYSYPYT (107) 60 KSSQSLLNSGNQKNYLT (102) WASTERS (105) QNEYSYPYT (106) 61 KSSQSLLNSGNQKNYLS (101) WASTERS (105) QNDYSFPYT (109) 62 KSSQSLLNSGNQKNYLT (102) WASTERS (105) QNEYSFPYT (108) 63 KSSQSLLNSGNQKNYLS (101) WASTERS (105) QNDYSFPYT (109) 64 KSSQSLLNSSNQKNYLS (104) WASTERS (105) QNEYSYPYT (106) 65 KSSQSLLNSSNQKNYLS (104) WASTERS (105) QNEYSFPYT (108) 66 KSSQSLLNSSNQKNYLS (104) WASTERS (105) QNDYSFPYT (109) 67 KSSQSLLNSGNQKNYLT (102) WASTERS (105) QNDYSFPYT (109) 68 KSSQSLLNSGNQKNYLT (102) WASTERS (105) QNDYSYPYT (107) 69 KSSQSLLNSSNQKNYLT (103) WASTERS (105) QNDYSFPYT (109) 70 KSSQSLLNSGNQKNYLS (101) WASTERS (105) QNDYSFPYT (109) 71 KSSQSLLNSSNQKNYLT (103) WASTERS (105) QNDYSYPYT (107) 72 KSSQSLLNSGNQKNYLT (102) WASTERS (105) QNEYSFPYT (108) 73 KSSQSLLNSGNQKNYLT (102) WASTERS (105) QNDYSFPYT (109) 74 KSSQSLLNSGNQKNYLS (101) WASTERS (105) QNDYSYPYT (107) 75 KSSQSLLNSGNQKNYLS (101) WASTERS (105) QNDYSYPYT (107) 76 KSSQSLLNSGNQKNYLS (101) WASTERS (105) QNDYSFPYT (109) 77 KSSQSLLNSSNQKNYLT (103) WASTERS (105) QNDYSFPYT (109) 78 KSSQSLLNSGNQKNYLT (102) WASTERS (105) QNDYSYPYT (107) 79 KSSQSLLNSGNQKNYLT (102) WASTERS (105) QNDYSYPYT (107) 80 KSSQSLLNSSNQKNYLT (103) WASTERS (105) QNDYSFPYT (109) 81 KSSQSLLNSSNQKNYLS (104) WASTERS (105) QNDYSYPYT (107) 82 KSSQSLLNSSNQKNYLS (104) WASTERS (105) QNDYSYPYT (107) 83 KSSQSLLNSSNQKNYLT (103) WASTERS (105) QNDYSFPYT (109) 84 KSSQSLLNSSNQKNYLT (103) WASTERS (105) QNDYSFPYT (109) 85 KSSQSLLNSSNQKNYLS (104) WASTERS (105) QNDYSYPYT (107) 86 KSSQSLLNSGNQKNYLT (102) WASTERS (105) QNDYSYPYT (107) 87 KSSQSLLNSGNQKNYLT (102) WASTERS (105) QNDYSYPYT (107) 88 KSSQSLLNSGNQKNYLT (102) WASTERS (105) QNDYSFPYT (109) 89 KSSQSLLNSGNQKNYLT (102) WASTERS (105) QNDYSFPYT (109) 90 KSSQSLLNSGNQKNYLS (101) WASTERS (105) QNEYSSPYT (193) 91 KSSQSLLNSGNQKNYLS (101) WASTERS (105) QNEYSFPYT (108) 92 KSSQSLLNSGNQKNYLT (102) WASTERS (105) QNDYSYPYT (107) 93 KSSQSLLNSSNQKNYLT (103) WASTERS (105) QNDYSYPYT (107) 94 KSSQSLLNSGNQKNYLT (102) WASTERS (105) QNDYSYPYT (107) 95 KSSQSLLNSGNQKNYLT (102) WASTERS (105) QNDYSFPYT (109) 96 KSSQSLLNSSNQKNYLS (104) WASTERS (105) QNDYSYPYT (107) 97 KSSQSLLNSGNQKNYLT (102) WASTERS (105) QNEYSFPYT (108) 98 KSSQSLLNSGNQKNYLS (101) WASTERS (105) QNDYSYPYT (107) 99 KSSQSLLNSGNQKNYLT (102) WASTERS (105) QNDYSFPYT (109) 100 KSSQSLLNSGNQKNYLS (101) WASTERS (105) QNDYSSPYT (192) 101 KSSQSLLNSSNQKNYLT (103) WASTERS (105) QNDYSFPYT (109) 102 KSSQSLLNSSNQKNYLS (104) WASTERS (105) QNDYSYPYT (107) 103 KSSQSLLNSSNQKNYLS (104) WASTERS (105) QNDYSSPYT (192) 104 KSSQSLLNSGNQKNYLS (101) WASTERS (105) QNEYSYPYT (106) 105 KSSQSLLNSGNQKNYLS (101) WASTERS (105) QNDYSYPYT (107) 106 KSSQSLLNSSNQKNYLT (103) WASTERS (105) QNDYSYPYT (107) 107 KSSQSLLNSGNQKNYLS (101) WASTERS (105) QNDYSYPYT (107)

¹ VL CDR in tab. 1 determined by Kabat.

-36040077

table 2

Amino acid sequences of VH CDR ²

Antibody VH CDR1 (SEQ ID NO:) VH CDR2 (SEQ ID NO:) VH CDR3 (SEQ ID NO:) 231-32-15 DYAMY (13) VIRTYSGDVTYNQKFKD (14) SGTVRGFAY (15) Hum231#1 DYAMY (13) VIRTYSGDVTYNQKFKD (14) SGTVRGFAY (15) Hum231#2 DYAMY (13) VIRTYSGDVTYNQKFKD (14) SGTVRGFAY (15) pub1964 GYAMY(19) LIRTYSGGVTYNQKFQG (24) SGTVRGFAY (34) pub1965 GYAMY(19) VIRTFSGDVTYNQKFRG (25) SGTVRGFAY (34) pub1966 GYAMY(19) VIKTYSGGVTYNQKFRG (26) SGTVRGFAY (34) pub1967 GYAMH (20) LIRTYSGGVSYNQKFRE (27) SGTVRGFAY (34) pub1968 DYAMY (21) VIRTFSGDLTYNQKFQD (28) SGTVRGFAY (34) pub1969 EYAMH (22) LIRTYSGGVSYNQKFQG(29) SGTVRGFAY (34) pub1970 DYAMY (21) LIRTYSGGVTYNQKFQG (24) SGTVRGFAY (34) pub1971 DYAMY (21) VIRTYSGDVSYNQKFRG (177) SGTVRGFAY (34) pub1972 EYAMY (23) LIRTYSGGVSYNQKFRD (31) SGTVRGFAY (34) pub1973 GYAMY(19) VIRTFSGGVTYNQKFRG (32) SGTVRGFAY (34) pub1975 EYAMH (22) LIRTYSGGVSYNQKFQG(29) SGTVRGFAY (34) pub1976 EYAMH (22) LIRTYSGGVSYNQKFQG(29) SGTVRGFAY (34) pub1977 EYAMH (22) LIRTYSGGVSYNQKFQG(29) SGTVRGFAY (34) pub1979 EYAMH (22) VIRTYSGGVSYNQKFQE (33) SGTVRGFAY (34) pub1980 EYAMH (22) VIRTYSGGVSYNQKFQE (33) SGTVRGFAY (34) pub1981 EYAMH (22) VIRTYSGGVSYNQKFQE (33) SGTVRGFAY (34) pub1983 GYAMY(19) LIRTYSGGVTYNQKFQG (24) SGTVRGFAY (34) pab2159 GYAMY (19) LIRTYSGEVSYNQKFRG (144) SGTVRGFAY (34) pab2160 GYVMH(119) VIRTFSGDVSYNQKFRE (162) SGTVRGFAY (34) pab2161 EYAMH (22) LIQTYSGDVSYNQKFRG (121) SGTVRGFAY (34) 1 EYAMY (23) VIRTYSGGVTYNQKFQG (187) SGTVRGFAY (34) 2 EYAMH (22) LIRTYSGGVSYNQKFRG (148) SGTVRGFAY (34) 3 GYVMH(119) VIRTYSGEVSYNQKFQE (181) SGTVRGFAY (34) 4 EYAMY (23) LIRTFSGDVSYNQKFQD (124) SGTVRGFAY (34) 5 EYAMH (22) LIRTYSGGVTYNQKFRG (151) SGTVRGFAY (34) 6 EYAMY (23) LIRTFSGGVSYNQKFKG (135) SGTVRGFAY (34) 7 GYAMH (20) LIRTFSGGLSYNQKFRE (132) SGTVRGFAY (34) 8 GYVMY(116) VIKTFSGGVSYNQKFQE (152) SGTVRGFAY (34) 9 GYAMY (19) LIRTYSGEVSYNQKFRG (144) SGTVRGFAY (34) 10 EYAMY (23) LIRTYSGGVSYNQKFRG (148) SGTVRGFAY (34) eleven DYAMH (117) LIRTYSGGVSYNQKFRG (148) SGTVRGFAY (34)

- 37 040077

12 GYAMY (19) VIRTFSGEVSYNQKFKG (164) SGTVRGFAY (34) 13 GYAMY(19) LIRTFSGDVTYNQKFRG (127) SGTVRGFAY (34) 14 GYVMH(119) LIRTYSGDVSYNQKFRD (146) SGTVRGFAY (34) 15 DYAMY (21) VIRTFSGDVSYNQKFRE (162) SGTVRGFAY (34) 16 GYAMY(19) LIRTFSGGVTYNQKFRE (140) SGTVRGFAY (34) 17 EYAMY (23) VIQTFSGGVTYNQKFRG (157) SGTVRGFAY (34) 18 GYAMY (19) LIRTFSGEVTYNQKFRG (130) SGTVRGFAY (34) 19 GYAMY (19) LIRTYSGGLSYNQKFQD (145) SGTVRGFAY (34) 20 DYAMY (21) VIRTFSGDLSYNQKFRG (114) SGTVRGFAY (34) 21 GYVMH(119) VIRTFSGDVSYNQKFRE (162) SGTVRGFAY (34) 22 GYAMY(19) VIRTFSGDVTYNQKFRG (25) SGTVRGFAY (34) 23 GYAMY(19) LIRTFSGDVTYNQKFRG (127) SGTVRGFAY (34) 24 DYAMH (117) LIRTYSGGVTYNQKFRG (151) SGTVRGFAY (34) 25 EYAMY (23) LIRTFSGGVSYNQKFRG (138) SGTVRGFAY (34) 26 EYAMH (22) LIRTFSGDVSYNQKFKG (123) SGTVRGFAY (34) 27 DYAMY (21) LIRTYSGGVSYNQKFRG (148) SGTVRGFAY (34) 28 DYAMY (21) VIRTFSGGVTYNQKFRG (32) SGTVRGFAY (34) 29 DYAMY (21) VIRTFSGGVTYNQKFKG (172) SGTVRGFAY (34) thirty DYVMY (35) VIRTFSGGLSYNQKFRG (165) SGTVRGFAY (34) 31 EYAMY (23) LIRTFSGGLTYNQKFKD (133) SGTVRGFAY (34) 32 DYAMY (21) VIRTFSGGVTYNQKFKD (171) SGTVRGFAY (34) 33 GYAMY(19) LIRTYSGGVTYNQKFQG (24) SGTVRGFAY (34) 34 DYAMY (21) VIRTFSGGVTYNQKFRG (32) SGTVRGFAY (34) 35 GYAMY(19) VIRTFSGDVTYNQKFRG (25) SGTVRGFAY (34) 36 DYAMY (21) VIRTFSGGVSYNQKFRD (168) SGTVRGFAY (34) 37 EYAMY (23) LIRTFSGEVTYNQKFKD (129) SGTVRGFAY (34) 38 GYAMY (19) VIKTYSGGVTYNQKFRG (26) SGTVRGFAY (34) 39 GYAMH (20) LIRTYSGGVSYNQKFRE (27) SGTVRGFAY (34) 40 EYAMY (23) VIRTYSGDLSYNQKFRG (174) SGTVRGFAY (34) 41 DYVMY (35) VIRTFSGGVSYNQKFRG (170) SGTVRGFAY (34) 42 DYAMY (21) VIRTFSGDLTYNQKFQD (28) SGTVRGFAY (34) 43 EYAMY (23) LIRTFSGDVSYNQKFKG (123) SGTVRGFAY (34) 44 EYAMH (22) LIRTYSGDVSYNQKFQG (142) SGTVRGFAY (34) 45 EYAMY (23) LIRTYSGGVSYNQKFQG (147) SGTVRGFAY (34) 46 EYAMY (23) LIRTFSGDLSYNQKFRG (122) SGTVRGFAY (34) 47 DYAMY (21) VIRTYSGGVTYNQKFRD (188) SGTVRGFAD (189) 48 DYAMY (21) LIRTYSGGVTYNQKFKE (149) SGTVRGFAY (34) 49 GYAMY (19) VIRTYSGDVTYNQKFRE (179) SGTVRGFAY (34) 50 DYAMY (21) LIRTFSGGVSYNQKFKE (134) SGTVRGFAY (34) 51 EYAMY (23) VIRTFSGGVTYNQKFKG (172) SGTVRGFAY (34) 52 DYAMY (21) LIRTYSGGVSYNQKFRE (27) SGTVRGFAY (34) 53 EYAMH (22) VIRTYSGGLSYNQKFRG (182) SGTVRGFAY (34) 54 EYAMH (22) LIRTYSGGVSYNQKFQG (147) SGTVRGFAY (34) 55 DYAMY (21) LIRTYSGGVTYNQKFQG (24) SGTVRGFAY (34)

- 38 040077

56 DYAMY (21) VIRTYSGDVSYNQKFRG (177) SGTVRGFAY (34) 57 GYAMY (19) LIRTYSGDVTYNQKFKD (143) SGTVRGFAY (34) 58 DYAMY (21) VIRTYSGGVTYNQKFKG (186) SGTVRGFAY (34) 59 EYAMY (23) LIRTYSGGVSYNQKFRD (31) SGTVRGFAY (34) 60 DYAMY (21) VIKTYSGGVSYNQKFRG (153) SGTVRGFAY (34) 61 EYAMH (22) LIRTYSGGVSYNQKFQE (115) SGTVRGFAY (34) 62 GYVMY(116) VIRTFSGGVSYNQKFQG (167) SGTVRGFAY (34) 63 EYAMY (23) VIRTFSGDVTYNQKFKG (163) SGTVRGFAY (34) 64 DYAMY (21) VIRTYSGDVTYNQKFRG (180) SGTVRGFAY (34) 65 EYAMY (23) VIKTYSGGVTYNQKFRG (26) SGTVRGFAY (34) 66 DYVMY (35) VIRTYSGEVSYNQKFRG (183) SGTVRGFAY (34) 67 EYAMY (23) VIQTFSGDVSYNQKFKG (156) SGTVRGFAY (34) 68 GYAMY (19) LIRTYSGGVTYNQKFRG (151) SGTVRGFAY (34) 69 EYVMH(118) VIRTFSGGVSYNQKFRE (169) SGTVRGFAY (34) 70 GYAMY (19) VIRTYSGDVTYNQKFKD (178) SGTVRGFAY (34) 71 GYAMY (19) VIRTFSGGVTYNQKFRG (32) SGTVRGFAY (34) 72 GYAMY(19) VIRTYSGDVSYNQKFQE (175) SGTVRGFAY (34) 73 GYVMH(119) IIKTYSGGVSYNQKFQG (120) SGTVRGFAY (34) 74 DYAMY (21) VIKTYSGGVTYNQKFKD (154) SGTVRGFAY (34) 75 GYAMY (19) VIRTYSGGVTYNQKFQG (187) SGTVRGFAY (34) 76 DYAMH (117) LIRTFSGDVSYNQKFRE (125) SGTVRGFAY (34) 77 EYAMH (22) LIQTYSGDVSYNQKFRG (121) SGTVRGFAY (34) 78 DYAMY (21) VIKTYSGGVTYNQKFRD (155) SGTVRGFAY (34) 79 EYAMH (22) LIRTYSGGVTYNQKFRE (150) SGTVRGFAY (34) 80 EYAMH (22) LIRTFSGDVSYNQKFRG (126) SGTVRGFAY (34) 81 DYAMY (21) LIRTFSGEVSYNQKFQD (128) SGTVRGFAY (34) 82 GYVMH(119) VIRTFSGGVSYNQKFRG (170) SGTVRGFAY (34) 83 GYAMY (19) VIRTFSGDVSYNQKFRD (161) SGTVRGFAY (34) 84 GYAMY (19) LIRTFSGDVTYNQKFRG (127) SGTVRGFAY (34) 85 EYAMY (23) VIRTYSGGVTYNQKFKD (185) SGTVRGFAY (34) 86 EYAMY (23) VIRTYSGGVTYNQKFRD (188) SGTVRGFAY (34) 87 GYAMY(19) VIRTFSGDLSYNQKFKG (159) SGTVRGFAY (34) 88 EYAMH (22) VIRTYSGDVSYNQKFRG (177) SGTVRGFAY (34) 89 GYAMY (19) VIRTFSGDVTYNQKFRG (25) SGTVRGFAY (34) 90 EYAMY (23) LIRTYSGDLSYNQKFKE (141) SGTVRGFAY (34) 91 EYAMH (22) LIRTYSGGVSYNQKFQE (115) SGTVRGFAY (34) 92 EYAMY (23) LIRTFSGGVTYNQKFQG (139) SGTVRGFAY (34) 93 DYAMH (117) VIQTYSGDVSYNQKFQG (158) SGTVRGFAY (34) 94 GYAMY (19) VIRTFSGGVTYNQKFRD (173) SGTVRGFAY (34) 95 DYAMY (21) LIRTYSGGVSYNQKFRG (148) SGTVRGFAY (34) 96 EYAMY (23) VIRTYSGGLTYNQKFRD (184) SGTVRGFAY (34) 97 EYAMH (22) LIRTFSGGLSYNQKFRD (131) SGTVRGFAY (34) 98 GYAMH (20) VIRTFSGGVSYNQKFQE (166) SGTVRGFAY (34) 99 DYAMH (117) LIRTFSGDLSYNQKFRG (122) SGTVRGFAY (34) 100 EYAMH (22) VIRTFSGGVSYNQKFQG (167) SGTVRGFAY (34) 101 DYAMH (117) LIRTFSGGVSYNQKFQD (136) SGTVRGFAY (34) 102 GYAMY(19) VIRTYSGGVSYNQKFRD (194) SGTVRGFAY (34) 103 GYAMY(19) VIRTYSGDVSYNQKFRG (177) SGTVRGFAY (34) 104 DYAMY (21) LIRTFSGGVSYNQKFRD (137) SGTVRGFAY (34) 105 EYAMY (23) LIRTFSGGVSYNQKFKG (135) SGTVRGFAY (34) 106 DYAMY (21) VIRTFSGDVSYNQKFQE (160) SGTVRGFAY (34) 107 GYAMY(19) VIRTYSGDVSYNQKFRD (176) SGTVRGFAY (34)

² VH CDR in the table. 1 determined by Kabat.

- 39 040077

Amino acid sequences of VL FR ³

Table 3

Antibody VL FR1 (SEQ ID NO:) VL FR2 (SEQ ID NO:) VLFR3 (SEQ ID NO:) VLFR4 (SEQ ID NO:) 231-32-15 DIVMTQSPSSLTVTA GEKVIMSC (616) WYQQKPGQP PKLLIY (623) GVPDRFTGSGSGTDFTTLTI SSVQAEDLAVYHC (637) FGGGTKLEIK (641) Hum231#1 DIVMTQSPPTLSLSP GERVTLSC (615) WYQQKPGQA PRLLIY (622) GIPARFSGSGSGTDFTLTIS SLQPEDFAVYHC (626) FGQGTKLEIK (643) Hum231#2 DIVMTQSPDSLAVSL GERATINC (611) WYQQKPGQP PKLLIY (623) GVPDRFSGSGSGTDFTTLTI SSLQAEDVAVYHC (630) FGQGTKLEIK (643) raY964 DIVMTQSPDSLAVSL GERATINC (611) WYHQKPGQP PKLLIY (618) GVPDRFSGSGSGTDFTTLTI SSVQAEDVAVYHC (632) FGQGTKLEIK (643) paly965 DIVMTQSPDSLAVSL GERATINC (611) WYHQKPGQP PKLLIY (618) GVPDRFTGSGSGTDFTTLTI SSVQAEDVAVYYC (639) FGQGTKLEIK (643) pub1966 DIVMTQSPDSLAVSL GERATINC (611) WYQQKPGQP PKLLIY (623) GVPDRFSGSGSGTDFTTLTI SSLQAEDVAVYYC (631) FGQGTKLEIK (643) pub1967 DIVMTQSPDSLAVSL GERATINC (611) WYQQKPGQP PKLLIY (623) GVPDRFTGSGSGTDFTTLTI SSVQAEDVAVYHC (638) FGQGTKLEIK (643) pub1968 DIVMTQSPDSLAVSL GERATINC (611) WYQQKPGQP PKLLIY (623) GVPDRFSGSGSGTDFTTLTI SSLQAEDVAVYYC (631) FGQGTKLEIK (643) pub1969 DIVMTQSPDSLAVSL GERATINC (611) WYQQKPGQP PKLLIY (623) GVPDRFTGSGSGTDFTTLTI SSVQAEDVAVYHC (638) FGQGTKLEIK (643) pub1970 DIVMTQSPDSLAVSL GERATINC (611) WYQQKPGQP PKLLIY (623) GVPDRFSGSGSGTDFTTLTI SSVQAEDVAVYHC (632) FGQGTKLEIK (643) pub1971 DIVMTQSPDSLAVSL GERATINC (611) WYQQKPGQP PKLLIY (623) GVPDRFTGSGSGTDFTTLTI SSLQAEDVAVYYC (642) FGQGTKLEIK (643) pub1972 DIVMTQSPDSLAVSL GERATINC (611) WYHQKPGQP PKLLIY (618) GVPDRFSGSGSGTDFTTLTI SSVQAEDVAVYHC (632) FGQGTKLEIK (643) pub1973 DIVMTQSPDSLAVSL GERATINC (611) WYQQKPGQP PKLLIY (623) GVPDRFTGSGSDTDFTLTI SSVQAEDVAVYHC (627) FGQGTKLEIK (643) pub1975 DIVMTQSPDSLAVSL GERATINC (611) WYQQKPGQP PKLLIY (623) GVPDRFSGSGSGTDFTTLTI SSLQAEDVAVYYC (631) FGQGTKLEIK (643) pub1976 DIVMTQSPDSLAVSL GERATINC (611) WYQQKPGQP PKLLIY (623) GVPDRFSGSGSGTDFTTLTI SSLQAEDVAVYYC (631) FGQGTKLEIK (643) pub1977 DIVMTQSPDSLAVSL GERATINC (611) WYQQKPGQP PKLLIY (623) GVPDRFTGSGSGTDFTTLTI SSLQAEDVAVYYC (642) FGQGTKLEIK (643)

- 40 040077

raY979 DIVMTQSPDSLAVSL GERATINC (611) WYQQKPGQP PKLLIY (623) GVPDRFSGSGSGTDFTTLTI SSLQAEDVAVYYC (631) FGQGTKLEIK (643) raY980 DIVMTQSPDSLAVSL GERATINC (611) WYQQKPGQP PKLLIY (623) GVPDRFSGSGSGTDFTTLTI SSLQAEDVAVYYC (631) FGQGTKLEIK (643) raY981 DIVMTQSPDSLAVSL GERATINC (611) WYQQKPGQP PKLLIY (623) GVPDRFTGSGSGTDFTTLTI SSLQAEDVAVYYC (642) FGQGTKLEIK (643) raY983 DIVMTQSPDSLAVSL GERATINC (611) WYQQKPGQP PKLLIY (623) GVPDRFSGSGSGTDFTTLTI SSLQAEDVAVYYC (631) FGQGTKLEIK (643) pab2159 DIVMTQSPDSLAVSL GERATINC (611) WYQQKPGQP PKMLIY (624) GVPDRFSGSGSGTDFTTLTI SSLQAEDVAVYHC (630) FGQGTKLEIK (643) pab2160 DIVMTQSPDSLAVSL GERATINC (611) WYHQKPGQP PKLLIY (618) GVPDRFSGSGSGTDFTTLTI SSVQAEDVAVYHC (632) FGQGTKLEIK (643) pab2161 DIVMTQSPDSLAVSL GERATINC (611) WYHQKPGQP PKLLIY (618) GVPDRFTGSGSGTDFTTLTI SSVQAEDVAVYYC (639) FGQGTKLEIK (643) 1 DIVMTQSPDSLAVSL GERATINC (611) WYHQKPGQP PKMLIY (619) GVPDRFSGSGSGTDFTTLTI SSVQAEDVAVYHC (632) FGQGTKLEIK (643) 2 DIVMTQSPDSLAVSL GERATINC (611) WYHQKPGQP PKLLIY (618) GVPDRFSGSGSGTDFTTLTI SSVQAEDVAVYYC (633) FGQGTKLEIK (643) 3 DIVMTQSPDSLAVSL GERATINC (611) WYHQKPGQP PKLLIY (618) GVPDRFTGSGSGTDFTTLTI SSVQAEDVAVYHC (638) FGQGTKLEIK (643) 4 DIVMTQSPDSLAVSL GERATINC (611) WYHQKPGQP PKLLIY (618) GVPDRFTGSGSGTDFTTLTI SSVQAEDVAVYYC (639) FGQGTKLEIK (643) 5 DIVMTQSPDSLAAPG ERATINC (610) WYHQKPGQP PKLLIY (618) GVPDRFTGSGSGTDFTTLTI SSVQAEDVAVYYC (639) FGQGTKLEIK (643) 6 DIVMTQSPDSLAVSL GERATINC (611) WYQQKPGQP PKMLIY (624) GVPDRFTGSGSGTDFTTLTI SSLQAEDVAVYHC (636) FGQGTKLEIK (643) 7 DIVMTQSPDSLAVSL GERATINC (611) WYHQKPGQP PKMLIY (619) GVPDRFSGSGSGTDFTTLTI SSLQAEDVAVYHC (630) FGQGTKLEIK (643) 8 DIVMTQSPDSLAVSL GERATINC (611) WYHQKPGQP PKLLIY (618) GVPDRFSGSGSGTDFTTLTI SSVQAEDVAVYHC (632) FGQGTKLEIK (643) 9 DIVMTQSPDSLAVSL GERATINC (611) WYQQKPGQP PKMLIY (624) GVPDRFSGSGSGTDFTTLTI SSLQAEDVAVYHC (630) FGQGTKLEIK (643) 10 DIVMTQSPDSLAVSL GERATINC (611) WYQQKPGQP PKLLIY (623) GVPDRFSGSGSGTDFTTLTI SSVQAEDVAVYHC (632) FGQGTKLEIK (643) eleven DIVMTQSPDSLAVSL GERATINC (611) WYQQKPGQP PKLLIY (623) GVPDRFSGSGSGTDFTTLTI SSVQAEDVAVYHC (632) FGQGTKLEIK (643) 12 DIVMTQSPDSLAVSL GERATINC (611) WYHQKPGQP PKMLIY (619) GVPDRFSGSGSGTDFTTLTI SSLQAEDVAVYHC (630) FGQGTKLEIK (643) 13 DIVMTQSPDSLAVSL GERATINC (611) WYQQKPGQP PKLLIY (623) GVPDRFSGSGSGTDFTTLTI SSVQAEDVAVYHC (632) FGQGTKLEIK (643) 14 DIVMTQSPDSLAVSL GERATINC (611) WYHQKPGQP PKMLIY (619) GVPDRFSGSGSGTDFTTLTI SSVQAEDVAVYYC (633) FGQGTKLEIK (643) 15 DIVMTQSPDSLAVSL GERATINC (611) WYQQKPGQP PKLLIY (623) GVPDRFTGSGSGTDFTTLTI SSLQAEDVAVYHC (636) FGQGTKLEIK (643) 16 DIVMTQSPDSLAVSL GERATINC (611) WYHQKPGQP PKLLIY (618) GVPDRFTGSGSGTDFTTLTI SSVQAEDVAVYHC (638) FGQGTKLEIK (643)

- 41 040077

17 DIVMTQSPDSLAVSL GERATINC (611) WYHQKPGQP PKMLIY (619) GVPDRFSGSGSGTDFTTLTI SSVQAEDVAVYHC (632) FGQGTKLEIK (643) 18 DIVMTQSPDSLAVSL GERATINC (611) WYHQKPGQP PKMLIY (619) GVPDRFTGSGSGTDFTTLTI SSVQAEDVAVYYC (639) FGQGTKLEIK (643) 19 DIVMTQSPDSLAVSL GERATINC (611) WYQQKPGQP PKLLIY (623) GVPDRFTGSGSGTDFTTLTI SSVQAEDVAVYHC (638) FGQGTKLEIK (643) 20 DIVMTQSPDSLAVSL GERATINC (611) WYQQKPGQP PKMLLY (624) GVPDRFTGSGSGTDFTTLTI SSVQAEDVAVYHC (620) FGQGTKLEIK (643) 21 DIVMTQSPDSLAVSL GERATINC (611) WYHQKPGQP PKLLIY (618) GVPDRFSGSGSGTDFTTLTI SSVQAEDVAVYHC (632) FGQGTKLEIK (643) 22 DIVMTQSPDSLAVSL GERATINC (611) WYHQKPGQP PKMLIY (619) GVPDRFSGSGSGTDFTTLTI SSVQAEDVAVYHC (632) FGQGTKLEIK (643) 23 DIVMTQSPDSLAVSL GERATINC (611) WYQQKPGQP PKMLIY (624) GVPDRFSGSGSGTDFTTLTI SSVQAEDVAVYHC (632) FGQGTKLEIK (643) 24 DIVMTQSPDSLAVSL GERATINC (611) WYQQKPGQP PKMLIY (624) GVPDRFSGSGSGTDFTTLTI SSVQAEDVAVYHC (632) FGQGTKLEIK (643) 25 DIVMTQSPDSLAVSL GERATINC (611) WYQQKPGQP PKMLIY (624) GVPDRFTGSGSGTDFTTLTI SSVQAEDVAVYYC (639) FGQGTKLEIK (643) 26 DIVMTQSPDSLAVSL GERATINC (611) WYQQKPGQP PKMLIY (624) GVPDRFSGSGSGTDFTTLTI SSVQAEDVAVYYC (633) FGQGTKLEIK (643) 27 DIVMTQSPDSLAVSL GERATINC (611) WYHQKPGQP PKLLIY (618) GVPDRFSGSGSGTDFTTLTI SSLQAEDVAVYHC (630) FGQGTKLEIK (643) 28 DIVMTQSPDSLAVSL GERATINC (611) WYHQKPGQP PKLLIY (618) GVPDRFSGSGSGTDFTTLTI SSLQAEDVAVYHC (630) FGQGTKLEIK (643) 29 DIVMTQSPDSLAVSL GERATINC (611) WYQQKPGQP PKLLIY (623) GVPDRFSGSGSGTDFTTLTI SSLQAEDVAVYHC (630) FGQGTKLEIK (643) thirty DIVMTQSPDSLAVSL GERATINC (611) WYHQKPGQP PKLLIY (618) GVPDRFSGSGSGTDFTTLTI SSLQAEDVAVYYC (631) FGQGTKLEIK (643) 31 DIVMTQSPDSLAVSL GERATINC (611) WYQQKPGQP PKLLIY (623) GVPDRFTGSGSGTDFTTLTI SSLQAEDVAVYHC (636) FGQGTKLEIK (643) 32 DIVMTQSPDSLAVSL GERATINC (611) WYQQKPGQP PKLLIY (623) GVPDRFTGSGSGTDFTTLTI SSLQAEDVAVYHC (636) FGQGTKLEIK (643) 33 DIVMTQSPDSLAVSL GERATINC (611) WYHQKPGQP PKLLIY (618) GVPDRFSGSGSGTDFTTLTI SSVQAEDVAVYHC (632) FGQGTKLEIK (643) 34 DIVMTQSTDSLAVSL GERATINC (617) WYQQKPGQP PKLLIY (623) GVPDRFTGSGSGTDFTTLTI SSLQAEDVAVYHC (636) FGQGTKLEIK (643) 35 DIVMTQSPDSLAVSL GERATINC (611) WYHQKPGQP PKLLIY (618) GVPDRFTGSGSGTDFTTLTI SSVQAEDVAVYYC (639) FGQGTKLEIK (643) 36 DIVMTQSPDSLAVSL GERATINC (611) WYHQKPGQP PKMLIY (619) GVPDRFSGSGSGTDFTTLTI SSVQEEDVAVYHC (634) FGQGTKLEIK (643) 37 DIVMTQSPDSLAVSL GERATINC (611) WYQQKPGQP PKLLIY (623) GVPDRFTGSGSGTDFTTLTI SSLQAEDVAVYHC (636) FGQGTKLEIK (643) 38 DIVMTQSPDSLAVSL GERATINC (611) WYQQKPGQP PKLLIY (623) GVPDRFSGSGSGTDFTTLTI SSLQAEDVAVYYC (631) FGQGTKLEIK (643) 39 DIVMTQSPDSLAVSL GERATINC (611) WYQQKPGQP PKLLIY (623) GVPDRFTGSGSGTDFTTLTI SSVQAEDVAVYHC (638) FGQGTKLEIK (643)

-42040077

40 DIVMTQSPDSLAVSL GERATINC (611) WYQQKPGQP PKLLIY (623) GVPDRFTGSGSGTDFTTLTI SSVQAEDVAVYHC (638) FGQGTKLEIK (643) 41 DIVMTQSPDSLAVSL GERATINC (611) WYHQKPGQP PKLLIY (618) GVPDRFSGSGSGTDFTTLTI SSLQAEDVAVYHC (630) FGQGTKLEIK (643) 42 DIVMTQSPDSLAVSL GERATINC (611) WYQQKPGQP PKLLIY (623) GVPDRFSGSGSGTDFTTLTI SSLQAEDVAVYYC (631) FGQGTKLEIK (643) 43 DIVMTQSPDSLAVSL GERATINC (611) WYQQKPGQP PKMLIY (624) GVPDRFTGSGSGTDFTTLTI SSVQAEDVAVYHC (638) FGQGTKLEIK (643) 44 DIVMTQSPDSLAVSL GERATINC (611) WYHQKPGQP PKMLIY (619) GVPDRFTGSGSGTDFTTLTI SSVQAEDVAVYYC (639) FGQGTKLEIK (643) 45 DIVMTQSPDSLAVSL GERATINC (611) WYHQKPGQP PKLLIY (618) GVPDRFTGSGSGTDFTTLTI SSVQAEDVAVYYC (639) FGQGTKLEIK (643) 46 DIVMTQSPDSLAVSL GERATINC (611) WYHQKPGQP PKLLIY (618) GVPDRFTGSGSGTDFTTLTI SSLQAEDVAVYHC (636) FGQGTKLEIK (643) 47 DIVMTQSPDSLAVSL GERATINC (611) WYQQKPGQP PKLLIY (623) GVPDRFTGSGSGTDFTTLTI SSVQAEDVAVYHC (638) FGQGTKLEIK (643) 48 DIVMTQSPDSLAVSL GERATINC (611) WYQQKPGQP PKLLIY (623) GVPDRFTGSGSGTDFTTLTI SSLQAEDVAVYHC (636) FGQGTKLEIK (643) 49 DIVMTQSPDSLAVSL GERATINC (611) WYHQKPGQP PKLLIY (618) GVPDRFSGSGSGTDFTTLTI SSVQAEDVAVYHC (632) FGQGTKLEIK (643) 50 DIVMTQSPDSLAVSL GERATINC (611) WYQQKPGQP PKMLIY (624) GVPDRFSGSGSGTDFTTLTI SSLQAEDVAVYYC (631) FGQGTKLEIK (643) 51 DIVMTQSPDSLAVSL GERATINC (611) WYHQKPGQP PKLLIY (618) GVPDRFSGSGSGTDFTTLTI SSVQAEDVAVYHC (632) FGQGTKLEIK (643) 52 DIVMTQSPDSLAVSL GERATINC (611) WYQQKPGQP PKLLIY (623) GVPDRFSGSGSGTDFTTLTI SSLQAEDVAVYHC (630) FGQGTKLEIK (643) 53 DIVMTQSPDSLAVSL GERATINC (611) WYQQKPGQP PKLLIY (623) GVPDRFTGSGSGTDFTTLTI SSVQAEDVAVYHC (638) FGQGTKLEIK (643) 54 DIVMTQSPDSLAVSL GERATINC (611) WYQQKPGQP PKLLIY (623) GVPDRFTGSGSGTDFTTLTI SSVQAEDVAVYHC (638) FGQGTKLEIK (643) 55 DIVMTQSPDSLAVSL GERATINC (611) WYQQKPGQP PKLLIY (623) GVPDRFSGSGSGTDFTTLTI SSVQAEDVAVYHC (632) FGQGTKLEIK (643) 56 DIVMTQSPDSLAVSL GERATINC (611) WYQQKPGQP PKLLIY (623) GVPDRFTGSGSGTDFTTLTI SSLQAEDVAVYHC (636) FGQGTKLEIK (643) 57 DIVMTQSPDSLAVSL GERATINC (611) WYHQKPGQP PKMLIY (619) GVPDRFSGSGSGTDFTTLTI SSLQAEDVAVYHC (630) FGQGTKLEIK (643) 58 DIVMTQSPDSLAVSL GERATINC (611) WYHQKPGQP PKLLIY (618) GVPDRFSGSGSGTDFTTLTI SSVQAEDVAVYHC (632) FGQGTKLEIK (643) 59 DIVMTQSPDSLAVSL GERATINC (611) WYHQKPGQP PKLLIY (618) GVPDRFSGSGSGTDFTTLTI SSVQAEDVAVYHC (632) FGQGTKLEIK (643) 60 DIVMTQSPDSLAVSL GERATINC (611) WYHQKPGQP PKLLIY (618) GVPDRFSGSGSGTDFTTLTI SSVQAEDVAVYYC (633) FGQGTKLEIK (643) 61 DIVMTQSPDSLAVSL GERATINC (611) WYQQKPGQP PKLLIY (623) GVPDRFSGSGSGTDFTTLTI SSVQAEDVAVYYC (633) FGQGTKLEIK (643) 62 DIVMTQSPDSLAVSL GERATINC (611) WYQQKPGQP PKLLIY (623) GVPDRFTGSGSGTDFTTLTI SSLQAEDVAVYHC (636) FGQGTKLEIK (643)

- 43 040077

63 DIVMTQSPDSLAVSL GERATINC (611) WYHQKPGQP PKMLIY (619) GVPDRFTGSGSGTDFTTLTI SSVQAEDVAVYHC (638) FGQGTKLEIK (643) 64 DIVMTQSPDSLAVSL GERATINC (611) WYHQKPGQP PKLLIY (618) GVPDRFSGSGSGTDFTTLTI SSVQAEDVAVYHC (632) FGQGTKLEIK (643) 65 DIVMTQSPDSLPVSL GERATINC (612) WYHQKPGQP PKMLIY (619) GVPDRFSGSGSGTDFTTLTI SFVQAEDVAVYYC (628) FGQGTKLEIK (643) 66 DIVMTQSPDSLAVSL GERATINC (611) WYHQKPGQP PKLLIY (618) GVPDRFSGSGSGTDFTTLTI SSVQAEDVAVYHC (632) FGQGTKLEIK (643) 67 DIVMTQSPDSLAVSL GERATINC (611) WYHQKPGQP PKLLIY (618) GVPDRFTGSGSGTDFTTLTI SSVQAEDVAVYYC (639) FGQGTKLEIK (643) 68 DIVMTQSPDSLAVSL GERATINC (611) WYQQKPGQP PKMLIY (624) GVPDRFTGSGSGTDFTTLTI SSLQAEDVAVYYC (642) FGQGTKLEIK (643) 69 DIVMTQSPDSLAVSL GERATINC (611) WYHQKPGQP PKMLIY (619) GVPDRFSGSGSGTDFTTLTI SSVQAEDVAVYYC (633) FGQGTKLEIK (643) 70 DIVMTQSPDSLAVSL GERATINC (611) WYQQKPGQP PKLLIY (623) GVPDRFSGSGSGTDFTTLTI SSLQAEDVAVYHC (630) FGQGTKLEIK (643) 71 DIVMTQSPDSLAVSL GERATINC (611) WYQQKPGQP PKLLIY (623) GVPDRFTGSGSGTDFTTLTI SSVQAEDVAVYHC (638) FGQGTKLEIK (643) 72 DIVMTQSPDSLAVSL GERATINC (611) WYHQKPGQP PKLLIY (618) GVPDRFSGSGSGTDFTTLTI SSLQAEDVAVYHC (630) FGQGTKLEIK (643) 73 DIVMTQSPDSLAVSL GERATINC (611) WYHQKPGQP PKLLIY (618) GVPDRFSGSGSGTDFTTLTI SSLQAEDVAVYHC (630) FGQGTKLEIK (643) 74 DIVMTQSPDSLAVSL GERATINC (611) WYHQKPGQP PKMLIY (619) GVPDRFSGSGSGTDFTTLTI SSVQAEDVAVYHC (632) FGQGTKLEIK (643) 75 DIVMTQSPDSLAVSL GERATINC (611) WYHQKPGQP PKLLIY (618) GVPDRFTGSGSGTDFTTLTI SSLQAEDVAVYYC (642) FGQGTKLEIK (643) 76 DIVMTQSPDSLAVSL GERATINC (611) WYQQKPGQP PKMLIY (624) GVPDRFSGSGSGTDFTTLTI SSVQAEDVAVYHC (632) FGQGTKLEIK (643) 77 DIVMTQSPDSLAVSL GERATINC (611) WYHQKPGQP PKLLIY (618) GVPDRFTGSGSGTDFTTLTI SSVQAEDVAVYYC (639) FGQGTKLEIK (643) 78 DIVMTQSPDSLAVSL GERATINC (611) WYHQKPGQP PKMLIY (619) GVPDRFTGSGSGTDFTTLTI SSVQAEDVAVYHC (638) FGQGTKLEIK (643) 79 DIVMTQSPDSLAVSL GERATINC (611) WYHQKPGQP PKMLIY (619) GVPDRFSGSGSGTDFTTLTI SSLQAEDVAVYYC (631) FGQGTKLEIK (643) 80 DIVMTQSPDSLAVSL GERATINC (611) WYQQKPGQP PKLLIY (623) GVPDRFTGSGSGTDFTTLTI SSLQAEDVAVYYC (642) FGQGTKLEIK (643) 81 DIVMTQSPDSLSVSL GERATINC(613) WYQQKPGQP PKLLIY (623) GVPDRFSGSGSGTDFTTLTI SSVQAEDVAVYHC (632) FGQGTKLEIK (643) 82 DIVMTQSPDSLAVSL GERATINC (611) WYHQKPGQP PKMLIY (619) GVPDRFSGSGSGTDFTTLTI SSLQAEDVAVYYC (631) FGQGTKLEIK (643) 83 DIVMTQSPDSLAVSL GERATINC (611) WYHQKPGQP PKLLIY (618) GVPDRFSGSGSGTDFTTLTI SSVQAEDVAVYYC (633) FGQGTKLEIK (643) 84 DIVMTQSPDSLAVSL GERATINC (611) WYQQKPGQP PKLLIY (623) GVPDRFTGSGSGTDFTTLTI SSLQAEDVAVYHC (636) FGQGTKLEIK (643) 85 DIVMTQSPDSLAVSL GERATINC (611) WYHQKPGQP PKLLIY (618) GVPDRFSGSGSGTDFTTLTI SSVQAEDVAVYYC (633) FGQGTKLEIK (643)

- 44 040077

86 DIVMTQSPDSLAVSL GERATINC (611) WYHQKPGQP PKLLIY (618) GVPDRFSGSGSGTDFTTLTI SSVQAEDVAVYYC (633) FGQGTKLEIK (643) 87 DIVMTQSPDSLAVSL GERATINC (611) WYQQKPGQP PKLLIY (623) GVPDRFSGSGSGTDFTTLTI SSVQAEDVAVYHC (632) FGQGTKLEIK (643) 88 DIVMTQSPDSLAVSL GERATINC (611) WYQQKPGQP PKLLIY (623) GVPDRFSGSGSGTDFTTLTI SSVQAEDVAVYYC (633) FGQGTKLEIK (643) 89 DIVMTQSPDSLAVSL GERATINC (611) WYQQKPGQP PKLLIY (623) GVPDRFTGSGSGTDFTTLTI SSLQAEDVAVYHC (636) FGQGTKLEIK (643) 90 DIVMTQSPDSLAVSL GERATINC (611) WYHQKPGQP PKLLIY (618) GVPDRFTGSGSGTDFTTLTI SSLQAEDVAVYHC (636) FGQGTKLEIK (643) 91 DIVMTQSPDSLAVSL GERATINC (611) WYQQKPGQP PKLLIY (623) GVPDRFSGSGSGTDFTTLTI SSVQAEDVAVYHC (632) FGQGTKLEIK (643) 92 DIVMTQSPDSLAVSL GERATINC (611) WYHQKPGQP PKMLIY (619) GVPDRFSGSGSG0HOTLTI SSVQAEDVAVYHC (635) FGQGTKLEIK (643) 93 DIVMTQSPDSLAVSL GERATINC (611) WYHQKPGQP PKMLIY (619) GVPDRFTGSGSGTDFTTLTI SSLQAEDVAVYHC (636) FGQGTKLEIK (643) 94 DIVMTQSPDSLAVSL GERATINC (611) WYQQKPGQP PKLLIY (623) GVPDRFTGSGSGTDFTTLTI SSVQAEDVAVYHC (638) FGQGTKLEIK (643) 95 DIVMTQSPDSLAVSL GERATINC (611) WYQQKPGQP PKMLIY (624) GVPDRFSGSGSGTDFTTLTI SSVQAEDVAVYHC (632) FGQGTKLEIK (643) 96 DIVMTQSPDSLAVSL GERATINC (611) WYHQKPGQP PKLLIY (618) GVPDRFSGSGSGTDFTTLTI SSLQAEDVAVYHC (630) FGQGTKLEIK (643) 97 DIVMTQSPDSLAVSL GERATINC (611) WYHQKPGQP PKLLIY (618) GVPDRFTGSGSGTDFTTLTI SSVQAEDVAVYHC (638) FGQGTKLEIK (643) 98 DIVMTQSPDSLAVSL GERATINC (611) WYHQKPGQP PKLLIY (618) GVPDRFTGSGSGTDFTTLTI SSVQAEDVAVYHC (638) FGQGTKLEIK (643) 99 DIVMTQSPDSLAVSL GERATINC (611) WYQQKPGQP PKMLIY (624) GVPDRFSGSGSGTDFTTLTI SSVQAEDVAVYYC (633) FGQGTKLEIK (643) 100 DIVMTQSPDSLAVSL GERATINC (611) WYHQKPGQP PKMLIY (619) GVPDRFSGSGSGTDFTTLTI SSVQAEDVAVYHC (632) FGQGTKLEIK (643) 101 DIVMTQSPDSLAVSL GERATINC (611) WYHQKPGQP PKLLIY (618) GVPDRFSGSGSGTDFTTLTI SSVQAEDVAVYHC (632) FGQGTKLEIK (643) 102 DIVMTQSPDSLAVSL GERATINC (611) WYQQKPGQP PKLLIY (623) GVPDRFTGSGSGTDFTTLTI SSVQAEDVAVYYC (639) FGQGTKLEIK (643) 103 DIVMTQSPDSLAVSL GERATINC (611) WYQQKPGQP PKLLIY (623) GVPDRFSGSGSGTDFTTLTI SSLQAEDVAVYHC (630) FGQGTKLEIK (643) 104 DIVMTQSPDSLAVSL GERATINC (611) WYHQKPGQP PKLLIY (618) GVPDRFSGSGSGTDFTTLTI SSFQAEDVAVYHC (629) FGQGTKLEIK (643) 105 DIVMTQSPDSLAVSL GERATINC (611) WYQQKPGQP PKLLIY (623) GVPDRFSGSGSGTDFTTLTI SSVQAEDVAVYYC (633) FGQGTKLEIK (643) 106 DIVMTQSPDSLAVSL GERATINC (611) WYQQKPGQP PKSLIY (625) GVPDRFSGSGSGTDFTTLTI SSVQAEDVAVYHC (632) FGQGTKLEIK (643) 107 DIVMTQSPDSLAVSL GERATINC (611) WYHQKPGQP PKLLIY (618) GVPDRFTGSGSGTDFTTLTI SSVQAEDVAVYYC (639) FGQGTKLEIK (643)

³ Described in Table. 3 VL frame regions are defined based on the boundaries for the CDRs according to the Kabat numbering system. In other words, VL CDRs are defined by Kabat and framework regions represent the amino acid residues surrounding the CDRs in the variable region, in the format FR1, CDR1, FR2, CDR2, FR3, CDR3 and FR4.

- 45 040077

Amino acid sequences of VH FR ⁴

Table 4

Antibody VH FR1 (SEQ ID NO:) VH FR2 (SEQ ID NO:) VHFR3 (SEQ ID NO:) VHFR4 (SEQ ID NO:) 231-32-15 QVQLLQSGTELVRPGVSV KISCKGSGYTFT (645) WVKQSHAKSLE WIG (652) KATMTVDKSSSIAYMELAR LSSEDSAIYYCAK (658) WGQGTLVTVSS (668) Hum231#1 QVQLVQSGAEVKKPGAS VKVSCKGSGYTFT (649) WVRQAPGQGLE WIG (653) RATMTVDKSISTAYMELSR LRSDDTAVYYCAK (659) WGQGTLVTVSS (668) Hum231#2 QVQLVQSGAEVKKPGAS VKVSCKGSGYTFT (649) WVRQAPGQGLE WIG (653) RATMTVDKSISTAYMELSR LRSDDTAVYYCAK (659) WGQGTLVTVSS (668) raY964 QVQLVQSGAEVKKPGAS VKVSCKASGYTFT (648) WVRQAPGQGME WIG (655) RVTMTVDTSISTAYMELSR LRSDDTAVYYCAK (663) WGQGTLVTVSS (668) paly965 QVQLVQSGAEAKKPGAS VKVSCKGSGYTFT (646) WVRQAPGQGME WIG (655) RVTMTVDTSISTAYMELSR LRSDDTAVYYCAK (663) WGQGTLVTVSS (668) raYEbb QVQLVQSGTEVKKPGAS VKVSCKGSGYTFT (651) WVRQAPGQGLE WIG (653) RVTMTVDKSISTAYMELSR LRSDDTAVYYCAK (662) WGQGTLVTVSS (668) paly967 QVQLVQSGAEVKKPGAS VKVSCKGSGYTFT (649) WVRQAPGQGLE Wmg (654) RATMTVDTSISTAYMELSR LRSDDTAVYYCAK (670) WGQGTLITVSS (667) pub1968 QVQLVQSGTEVKKPGAS VKVSCKASGYTFT (650) WVRQAPGQGLE WIG (653) RVTMTVDTSISTAYMELSR LRSDDTAVYYCAK (663) WGQGTLVTVSS (668) pub1969 QVQLVQSGAEVKKPGAS VKVSCKASGYTFT (648) WVRQAPGQGLE Wmg (654) RATMTVDTSISTAYMELSR LRSDDTAVYYCAK (670) WGQGTLVTVSS (668) pub1970 QVQLVQSGTEVKKPGAS VKVSCKASGYTFT (650) WVRQAPGQGLE WIG (653) RVTMTVDTSISTAYMELSR LRSDDTAVYYCAK (663) WGQGTLVTVSS (668) pub1971 QVQLVQSGTEVKKPGAS VKVSCKGSGYTFT (651) WVRQAPGQGME Wmg (656) RVTMTVDTSISTAYMELSR LRSDDTAVYYCAK (663) WGQGTLVTVSS (668) pub1972 QVQLVQSGAEVKKPGAS VKVSCKASGYTFT (648) WVRQAPGQGLE Wmg (654) RVTMTVDKSISTAYMELSR LRSDDTAVYYCAK (662) WGQGTLVTVSS (668) pub1973 QVQLVQSGAEVKKPGAS VKVSCKASGYTFT (648) WVRQAPGQGME Wmg (656) RATMTVDTSISTAYMELSR LRSDDTAVYYCAK (670) WGQGTLVTVSS (668) pub1975 QVQLVQSGAEVKKPGAS VKVSCKASGYTFT (648) WVRQAPGQGLE Wmg (654) RATMTVDTSISTAYMELSR LRSDDTAVYYCAK (670) WGQGTLVTVSS (668) pub1976 QVQLVQSGAEVKKPGAS VKVSCKASGYTFT (648) WVRQAPGQGLE Wmg (654) RATMTVDTSISTAYMELSR LRSDDTAVYYCAK (670) WGQGTLVTVSS (668) pub1977 QVQLVQSGAEVKKPGAS VKVSCKASGYTFT (648) WVRQAPGQGLE Wmg (654) RATMTVDTSISTAYMELSR LRSDDTAVYYCAK (670) WGQGTLVTVSS (668) pub1979 QVQLVQSGAEVKKPGAS VKVSCKASGYTFT (648) WVRQAPGQGLE Wmg (654) RVTMTVDTSISTAYMELSR LRSDDTAVYYCAK (663) WGQGTLVTVSS (668) pub1980 QVQLVQSGAEVKKPGAS VKVSCKASGYTFT (648) WVRQAPGQGLE Wmg (654) RVTMTVDTSISTAYMELSR LRSDDTAVYYCAK (663) WGQGTLVTVSS (668) pub1981 QVQLVQSGAEVKKPGAS VKVSCKASGYTFT (648) WVRQAPGQGLE Wmg (654) RVTMTVDTSISTAYMELSR LRSDDTAVYYCAK (663) WGQGTLVTVSS (668) pub1983 QVQLVQSGAEVKKPGAS WVRQAPGQGME RVTMTVDTSISTAYMELSR WGQGTLVTVSS

- 46 040077

VKVSCKASGYTFT (648) WIG (655) LRSDDTAVYYCAK (663) (668) pab2159 QVQLVQSGAEVKKPGAS VKVSCKASGYTFT (648) WVRQAPGQGLE Wmg (654) RATMTVDKSISTAYMELSR LRSDDTAVYYCAK (659) WGQGTLVTVSS (668) pab2160 QVQLVQSGTEVKKPGAS VKVSCKGSGYTFT (651) WVRQAPGQGME WIG (655) RVTMTVDTSISTAYMELSR LRSDDTAVYYCAK (663) WGQGTLVTVSS (668) pab2161 QVQLVQSGAEVKKPGAS VKVSCKGSGYTFT (649) WVRQAPGQGLE WIG (653) RATMTVDTSISTAYMELSR LRSDDTAVYYCAK (670) WGQGTLVTVSS (668) 1 QVQLVQSGTEVKKPGAS VKVSCKGSGYTFT (651) WVRQAPGQGLE WIG (653) RATMTVDTSISTAYMELSR LRSDDTAVYYCAK (670) WGQGTLVTVSS (668) 2 QVQLVQSGAEVKKPGAS VKVSCKASGYTFT (648) WVRQAPGQGME WIG (655) RATMTVDKSISTAYMELSR LRSDDTAVYYCAK (659) WGQGTLVTVSS (668) 3 QVQLVQSGAEVKKPGAS VKVSCKGSGYTFT (649) WVRQAPGQGME Wmg (656) RVTMTVDKSISTAYMELSR LRSDDTAVYYCAK (662) WGQGTLVTVSS (668) 4 QVQLVQSGAEVKKPGAS VKVSCKASGYTFT (648) WVRQAPGQSLE Wmg (657) RVTMTVDKSISTAYMELSR LRSDDTAVYYCAK (662) WGQGTLVTVSS (668) 5 QVQLVQSGAEVKKPGAS VKVSCKGSGYTFT (649) WVRQAPGQGLE Wmg (654) RVTMTVDTSISTAYMELSR LRSDDTAVYYCAK (663) WGQGTLVTVSS (668) 6 QVQLVQSGAEVKKPGAS VKVSCKGSGYTFT (649) WVRQAPGQGLE Wmg (654) RATMTVDTSISTAYMELSR LRSDDTAVYYCAK (670) WGQGTLVTVSS (668) 7 QVQLVQSGAEVKKPGAS VKVSCKASGYTFT (648) WVRQAPGQGME Wmg (656) RVTMTVDTSISTAYMELSR LRSDDTAVYYCAK (663) WGQGTLVTVSS (668) 8 QVQLVQSGAEVKKPGAS VKVSCKGSGYTFT (649) WVRQAPGQGLE Wmg (654) RVTMTVDKSISTAYMELSR LRSDDTAVYYCAK (662) WGQGTLVTVSS (668) 9 QVQLVQSGAEVKKPGAS VKVSCKASGYTFT (648) WVRQAPGQGLE Wmg (654) RATMTVDKSISTAYMELSR LRSDDTAVYYCAK (659) WGQGTLVTVSS (668) 10 QVQLVQSGAEVKKPGAS VKVSCKASGYTFT (648) WVRQAPGQGLE Wmg (654) RVTMTVDKSISTAYMELSR LRSDDTAVYYCAK (662) WGQGTLVTVSS (668) eleven QVQLVQSGAEVKKPGAS VKVSCKGSGYTFT (649) WVRQAPGQGLE Wmg (654) RVTMTVDTSISTAYMELSR LRSDDTAVYYCAK (663) WGQGTLVTVSS (668) 12 QVQLVQSGAEVKKPGAS VKVSCKGSGYTFT (649) WVRQAPGQGLE WIG (653) RVTMTVDTSISTAYMELSR LRSDDTAVYYCAK (663) WGQGTLVTVSS (668) 13 QVQLVQSGAEVKKPGAS VKVSCKASGYTFT (648) WVRQAPGQGLE Wmg (654) RATMTVDKSISTAYMELSR LRSDDTAVYYCAK (659) WGQGTLVTVSS (668) 14 QVQLVQSGTEVKKPGAS VKVSCKGSGYTFT (651) WVRQAPGQGLE Wmg (654) RATMTVDTSISTAYMELSR LRSDDTAVYYCAK (670) WGQGTLVTVSS (668) 15 QVQLVQSGAEVKKPGAS VKVSCKGSGYTFT (649) WVRQAPGQGLE WIG (653) RATMTVDKSISTAYMELSR LRSDDTAVYYCAK (659) WGQGTLVTVSS (668) 16 QVQLVQSGTEVKKPGAS VKVSCKASGYTFT (650) WVRQAPGQGLE WIG (653) RVTMTVDKSISTAYMELSR LRSDDTAVYYCAK (662) WGQGTLVTVSS (668) 17 QVQLVQSGAEVKKPGAS VKVSCKASGYTFT (648) WVRQAPGQGLE Wmg (654) RATMTVDKSISTAYMELSR LRSDDTAVYYCAK (659) WGQGTLVTVSS (668) 18 QVQLVQSGTEVKKPGAS VKVSCKASGYTFT (650) WVRQAPGQGME WIG (655) RVTMTVDTSISTAYMELSR LRSDDTAVYYCAK (663) WGQGTLVTVSS (668)

- 47 040077

19 QVQLVQSGAEVKKPGAS VKVSCKGSGYTFT (649) WVRQAPGQGLE Wmg (654) RATMTVDTSISTAYMELSR LRSDDTAVYYCAK (670) WGQGTLVTVSS (668) 20 QVQLVQSGTEVKKPGAS VKVSCKASGYTFT (650) VWRQAPGQGLE WIG (653) RVTMTVDTSISTAYMELSR LRSDDTAVYYCAK (663) WGQGTLVTVSS (668) 21 QVQLVQSGTEVKKPGAS VKVSCKGSGYTFT (651) WVRQAPGQGME WIG (655) RVTMTVDTSISTAYMELSR LRSDDTAVYYCAK (663) WGQGTLVTVSS (668) 22 QVQLVQSGAEVKKPGAS VKVSCKASGYTFT (648) WVRQAPGQGME WIG (655) RATMTVDTSISTAYMELSR LRSDDTAVYYCAK (670) WGQGTLVTVSS (668) 23 QVQLVQSGTEVKKPGAS VKVSCKGSGYTFT (651) WVRQAPGQGME WIG (655) RATMTVDKSISTAYMELSR LRSDDTAVYYCAK (659) WGQGTLVTVSS (668) 24 QVQLVQSGAEVKKPGAS VKASCKGSGYTFT (647) WVRQAPGQGME WIG (655) RVTMTVDKSISTAYMELSR LRSDDTAVYYCAK (662) WGQGTLVTVSS (668) 25 QVQLVQSGAEVKKPGAS VKVSCKASGYTFT (648) VWRQAPGQGLE Wmg (654) RATMTVDTSISTAYMELSR LRSDDTAVYYCAK (670) WGQGTLVTVSS (668) 26 QVQLVQSGTEVKKPGAS VKVSCKGSGYTFT (651) WVRQAPGQGME Wmg (656) RVTMTVDKSISTAYMELSR LRSDDTAVYYCAK (662) WGQGTLVTVSS (668) 27 QVQLVQSGTEVKKPGAS VKVSCKGSGYTFT (651) WVRQAPGQGME Wmg (656) RVTMTVDTSISTAYMELSR LRSDDTAVYYCAK (663) WGQGTLVTVSS (668) 28 QVQLVQSGTEVKKPGAS VKVSCKGSGYTFT (651) VWRQAPGQGLE WIG (653) RATMTVDKSISTAYMELSR LRSDDTAVYYCAK (659) WGQGTLVTVSS (668) 29 QVQLVQSGAEVKKPGAS VKVSCKGSGYTFT (649) VWRQAPGQGLE WIG (653) RATMTVDTSISTAYMELSR LRSDDTAVYYCAK (670) WGQGTLVTVSS (668) thirty QVQLVQSGAEVKKPGAS VKVSCKGSGYTFT (649) VWRQAPGQGLE Wmg (654) RVTMTVDTSISTAYMELSR LRSDDTAVYYCAK (663) WGQGTLVTVSS (668) 31 QVQLVQSGTEVKKPGAS VKVSCKGSGYTFT (651) VWRQAPGQGLE Wmg (654) RVTMTVDKSISTAYMELSR LRSDDTAVYYCAK (662) WGQGIPVTVSS (664) 32 QVQLVQSGAEVKKPGAS VKVSCKASGYTFT (648) WVRQAPGQGME Wmg (656) RATMTVDKSISTAYMELSR LRSDDTAVYYCAK (659) WGQGTLVTVSS (668) 33 QVQLVQSGAEVKKPGAS VKVSCKASGYTFT (648) WVRQAPGQGME WIG (655) RVTMTVDTSISTAYMELSR LRSDDTAVYYCAK (663) WGQGTLVTVSS (668) 34 QVQLVQSGAEVKKPGAS VKVSCKASGYTFT (648) WVRQAPGQGME WIG (655) RVTMTVDTSISTAYMELSR LRSDDTAVYYCAK (663) WGQGTLVTVSS (668) 35 QVQLVQSGAEAKKPGAS VKVSCKGSGYTFT (646) WVRQAPGQGME WIG (655) RVTMTVDTSISTAYMELSR LRSDDTAVYYCAK (663) WGQGTLVTVSS (668) 36 QVQLVQSGAEVKKPGAS VKVSCKGSGYTFT (649) WVRQAPGQGME WIG (655) RVTMTVDKSISTAYMELSR LRSDDTAVYYCAK (662) WGQGTLVTVSS (668) 37 QVQLVQSGTEVKKPGAS VKVSCKGSGYTFT (651) WVRQAPGQGME WIG (655) RVTMTVDTSISTAYMELSR LRSDDTAVYYCAK (663) WGQGTLVTVSS (668) 38 QVQLVQSGTEVKKPGAS VKVSCKGSGYTFT (651) VWRQAPGQGLE WIG (653) RVTMTVDKSISTAYMELSR LRSDDTAVYYCAK (662) WGQGTLVTVSS (668) 39 QVQLVQSGAEVKKPGAS VKVSCKGSGYTFT (649) VWRQAPGQGLE Wmg (654) RATMTVDTSISTAYMELSR LRSDDTAVYYCAK (670) WGQGTLITVSS (667) 40 QVQLVQSGAEVKKPGAS VWRQAPGQGLE RVTMTVDKSISTAYMELSR WGQGTLVTVSS

- 48 040077

VKVSCKASGYTFT (648) WIG (653) LRSDDTAVYYCAK (662) (668) 41 QVQLVQSGAEVKKPGAS VKVSCKGSGYTFT (649) WVRQAPGQGLE Wmg (654) RATMTVDKSISTAYMELSR LRSDDTAVYYCAK (659) WGQGTLVTVSS (668) 42 QVQLVQSGTEVKKPGAS VKVSCKASGYTFT (650) WVRQAPGQGLE WIG (653) RVTMTVDTSISTAYMELSR LRSDDTAVYYCAK (663) WGQGTLVTVSS (668) 43 QVQLVQSGAEVKKPGAS VKVSCKGSGYTFT (649) WVRQAPGQGME WIG (655) RATMTVDKSISTAYMELSR LRSDDTAVYYCAK (659) WGQGTLVTVSS (668) 44 QVQLVQSGTEVKKPGAS VKVSCKGSGYTFT (651) WVRQAPGQGLE Wmg (654) RATMTVDTSISTAYMELSR LRSDDTAVYYCAK (670) WGQGTLVTVSS (668) 45 QVQLVQSGAEVKKPGAS VKVSCKGSGYTFT (649) WVRQAPGQGLE WIG (653) RVTMTVDTSISTAYMELSR LRSDDTAVYYCAK (663) WGQGTFVTVSS (665) 46 QVQLVQSGAEVKKPGAS VKVSCKASGYTFT (648) WVRQAPGQGLE Wmg (654) RVTMTVDTSISTAYMELSR LRSDDTAVYYCAK (663) WGQGTLVTVSS (668) 47 QVQLVQSGAEVKKPGAS VKVSCKASGYTFT (648) WVRQAPGQGME Wmg (656) RVTMTVDKSISTAYMELSR LRSDDTAVYYCAK (662) WGQGTLVTVSS (668) 48 QVQLVQSGAEVKKPGAS VKVSCKASGYTFT (648) WVRQAPGQGLE Wmg (654) RATMTVDKSISTAYMELSR LRSDDTAVYYCAK (659) WGQGTLVTVSS (668) 49 QVQLVQSGTEVKKPGAS VKVSCKGSGYTFT (651) WVRQAPGQGLE Wmg (654) RATMTVDTSISTAYMELSR LRSDDTAVYYCAK (670) WGQGTLVTVSS (668) 50 QVQLVQSGTEVKKPGAS VKVSCKASGYTFT (650) WVRQAPGQGLE WIG (653) RVTMTVDKSISTAYMELSR LRSDDTAVYYCAK (662) WGQGTLVTVSS (668) 51 QVQLVQSGTEVKKPGAS VKVSCKASGYTFT (650) WVRQAPGQGLE Wmg (654) RATMTVDTSISTAYMELSR LRSDDTAVYYCAK (670) WGQGTLVTVSS (668) 52 QVQLVQSGTEVKKPGAS VKVSCKGSGYTFT (651) WVRQAPGQGLE Wmg (654) RVTMTVDKSISTAYMELSR LRSDDTAVYYCAK (662) WGQGTLVTVSS (668) 53 QVQLVQSGTEVKKPGAS VKVSCKASGYTFT (650) WVRQAPGQGME Wmg (656) RATMTVDKSISTAYMELSR LRSDDTAVYYCAK (659) WGQGTLVTVSS (668) 54 QVQLVQSGAEVKKPGAS VKVSCKASGYTFT (648) WVRQAPGQGLE Wmg (654) RATMTVDTSISTAYMELSR LRSDDTAVYYCAK (670) WGQGTLVTVSS (668) 55 QVQLVQSGTEVKKPGAS VKVSCKASGYTFT (650) WVRQAPGQGLE WIG (653) RVTMTVDTSISTAYMELSR LRSDDTAVYYCAK (663) WGQGTLVTVSS (668) 56 QVQLVQSGTEVKKPGAS VKVSCKGSGYTFT (651) WVRQAPGQGME Wmg (656) RVTMTVDTSISTAYMELSR LRSDDTAVYYCAK (663) WGQGTLVTVSS (668) 57 QVQLVQSGTEVKKPGAS VKVSCKGSGYTFT (651) WVRQAPGQGME WIG (655) RVTMTVDTSISTAYMELSR LRSDDTAVYYCAK (663) WGQGTLVTVSS (668) 58 QVQLVQSGAEVKKPGAS VKVSCKGSGYTFT (649) WVRQAPGQGLE Wmg (654) RATMTVDKSISTAYMELSR LRSDDTAVYYCAK (659) WGQGTLVTVSS (668) 59 QVQLVQSGAEVKKPGAS VKVSCKASGYTFT (648) WVRQAPGQGLE Wmg (654) RVTMTVDKSISTAYMELSR LRSDDTAVYYCAK (662) WGQGTLVTVSS (668) 60 QVQLVQSGAEVKKPGAS VKVSCKGSGYTFT (649) WVRQAPGQGLE Wmg (654) RATMTVDKSISTAYMELSR LRSDDTAVYYCAK (659) WGQGTLVTVSS (668) 61 QVQLVQSGTEVKKPGAS VKVSCKASGYTFT (650) WVRQAPGQGLE Wmg (654) RVTMTVDKSISTAYMELSR LRSDDTAVYYCAK (662) WGQGTLVTVSS (668)

- 49 040077

62 QVQLVQSGAEVKKPGAS VKVSCKGSGYTFT (649) VWRQAPGQGME Wmg (656) RATMTVDKSISTAYMELSR LRSDDTAVYYCAK (659) WGQGTLVTVSS (668) 63 QVQLVQSGAEVKKPGAS VKVSCKASGYTFT (648) VWRQAPGQGLE WIG (653) RVTMTVDKSISTAYMELSR LRSDDTAVYYCAK (662) WGQGTLVTVSS (668) 64 QVQLVQSGAEVKKPGAS VKVSCKASGYTFT (648) VWRQAPGQGLE Wmg (654) RATMTVDTSISTAYMELSR LRSDDTAVYYCAK (670) WGQGTLVTVSS (668) 65 QVQLVQSGAEVKKPGAS VKVSCKGSGYTFT (649) VWRQAPGQGLE Wmg (654) RVTMTVDKSISTAYMELSR LRSDDTAVYYCAK (662) WGQGTLVTVSS (668) 66 QVQLVQSGTEVKKPGAS VKVSCKGSGYTFT (651) VWRQAPGQGLE Wmg (654) RVTMTVDTSISTAYMELSR LRSDDTAVYYCAK (663) WGQGTLVTVSS (668) 67 QVQLVQSGAEVKKPGAS VKVSCKGSGYTFT (649) VWRQAPGQGLE Wmg (654) RVTMTVDKSISTAYMELSR LRSDDTAVYYCAK (662) WGQGTLVTVSS (668) 68 QVQLVQSGTEVKKPGAS VKVSCKGSGYTFT (651) VWRQAPGQGLE WIG (653) RVTMTVDTSISTAYMELSR LRSDDTAVYYCAK (663) WGQGTLVTVSS (668) 69 QVQLVQSGTEVKKPGAS VKVSCKGSGYTFT (651) VWRQAPGQGME Wmg (656) RATMTVDTSISTAYMELSR LRSDDTAVYYCAK (670) WGQGTLVTVSS (668) 70 QVQLVQSGTEVKKPGAS VKVSCKASGYTFT (650) VWRQAPGQGME WIG (655) RATMTVDTSISTAYMELSR LRSDDTAVYYCAK (670) WGQGTLVTVSS (668) 71 QVQLVQSGAEVKKPGAS VKVSCKASGYTFT (648) VWRQAPGQGME Wmg (656) RATMTVDTSISTAYMELSR LRSDDTAVYYCAK (670) WGQGTLVTVSS (668) 72 QVQLVQSGAEVKKPGAS VKVSCKGSGYTFT (649) VWRQAPGQGLE Wmg (654) RATMTVDTSISTAYMELSR LRSDDTAVYYCAK (670) WGQGTLVTVSS (668) 73 QVQLVQSGAEVKKPGAS VKVSCKGSGYTFT (649) VWRQAPGQGME WIG (655) RVTMTVDKSISTAYMELSR LRSDDTAVYYCAK (662) WGQGTLVTVSS (668) 74 QVQLVQSGTEVKKPGAS VKVSCKGSGYTFT (651) VWRQAPGQGME WIG (655) RATMTVDTSISTAYMELSR LRSDDTAVYYCAK (670) WGQGTLVTVSS (668) 75 QVQLVQSGTEVKKPGAS VKVSCKGSGYTFT (651) VWRQAPGQGLE WIG (653) RVTMTVDKSISTAYMELSR LRSDDTAVYYCAK (662) WGQGTLVTVSS (668) 76 QVQLVQSGAGVKKPGAS VKVSCKGSGYTFT (644) VWRQAPGQGLE Wmg (654) RATMTVDKSISTAYMELSR LRSDDTAVYYCAK (659) WGQGTLVTVSS (668) 77 QVQLVQSGAEVKKPGAS VKVSCKGSGYTFT (649) VWRQAPGQGLE WIG (653) RATMTVDTSISTAYMELSR LRSDDTAVYYCAK (670) WGQGTLVTVSS (668) 78 QVQLVQSGAEVKKPGAS VKVSCKGSGYTFT (649) VWRQAPGQGLE WIG (653) RATMTVDTSISTAYMELSR LRGDDTAVYYCAK (661) WGRGTLVTVSS (669) 79 QVQLVQSGTEVKKPGAS VKVSCKGSGYTFT (651) VWRQAPGQGME Wmg (656) RVTMTVDKSISTAYMELSR LRSDDTAVYYCAK (662) WGQGTLVTVSS (668) 80 QVQLVQSGTEVKKPGAS VKVSCKASGYTFT (650) VWRQAPGQGME Wmg (656) RVTMTVDTSISTAYMELSR LRSDDTAVYYCAK (663) WGQGTLVTVSS (668) 81 QVQLVQSGTEVKKPGAS VKVSCKASGYTFT (650) VWRQAPGQGLE Wmg (654) RATMTVDTSISTAYMELSR LRSDDTAVYYCAK (670) WGQGTLVTVSS (668) 82 QVQLVQSGAEVKKPGAS VKVSCKGSGYTFT (649) VWRQAPGQGME Wmg (656) RVTMTVDKSISTAYMELSR LRSDDTAVYYCAK (662) WGQGTLVTVSS (668) 83 QVQLVQSGAEVKKPGAS VWRQAPGQGME RVTMTVDTSISTAYMELSR WGQGTLVTVSS

- 50 040077

VKVSCKGSGYTFT (649) Wmg (656) LRSDDTAVYYCAK (663) (668) 84 QVQLVQSGTEVKKPGAS VKVSCKGSGYTFT (651) WVRQAPGQGME Wmg (656) RATMTVDTSISTAYMELSR LRSDDTAVYYCAK (670) WGQGTLVTVSS (668) 85 QVQLVQSGAEVKKPGAS VKVSCKASGYTFT (648) WVRQAPGQGLE Wmg (654) RATMTVDTSISTAYMELSR LRSDDTAVYYCAK (670) WGQGTLVTVSS (668) 86 QVQLVQSGAEVKKPGAS VKVSCKGSGYTFT (649) WVRQAPGQGME Wmg (656) RATMTVDTSISTAYMELSR LRSDDTAVYYCAK (670) WGQGTLVTVSS (668) 87 QVQLVQSGAEVKKPGAS VKVSCKGSGYTFT (649) WVRQAPGQGME WIG (655) RATMTVDTSISTAYMELSR LRSDDTAVYYCAK (670) WGQGTLVTVSS (668) 88 QVQLVQSGAEVKKPGAS VKVSCKGSGYTFT (649) WVRQAPGQGLE Wmg (654) RATMTVDKSISTAYMELSR LRSDDTAVYYCAK (659) WGQGTLVTVSS (668) 89 QVQLVQSGTEVKKPGAS VKVSCKASGYTFT (650) WVRQAPGQGME Wmg (656) RVTMTVDKSISTAYMELSR LRSDDTAVYYCAK (662) WGQGTLVTVSS (668) 90 QVQLVQSGAEVKKPGAS VKVSCKASGYTFT (648) WVRQAPGQGLE WIG (653) RATMTVDTSISTAYMELSR LRSDDTAVYYCAK (670) WGQGTLVTVSS (668) 91 QVQLVQSGTEVKKPGAS VKVSCKGSGYTFT (651) WVRQAPGQGME Wmg (656) RATMTVDTSISTAYMELSR LRSDDTAVYYCAK (670) WGQGTLVTVSS (668) 92 QVQLVQSGAEVKKPGAS VKVSCKGSGYTFT (649) WVRQAPGQGLE Wmg (654) RATMTVDTSISTAYMELSR LQSDDTAVYYCAK (660) WGQGTLVTVSS (668) 93 QVQLVQSGTEVKKPGAS VKVSCKASGYTFT (650) WVRQAPGQGME Wmg (656) RVTMTVDKSISTAYMELSR LRSDDTAVYYCAK (662) WGQGTLVTVSS (668) 94 QVQLVQSGTEVKKPGAS VKVSCKGSGYTFT (651) WVRQAPGQGLE WIG (653) RVTMTVDKSISTAYMELSR LRSDDTAVYYCAK (662) WGQGTFVTVSS (666) 95 QVQLVQSGAEVKKPGAS VKVSCKGSGYTFT (649) WVRQAPGQGLE Wmg (654) RVTMTVDTSISTAYMELSR LRSDDTAVYYCAK (663) WGQGTFVTVSS (666) 96 QVQLVQSGAEVKKPGAS VKVSCKGSGYTFT (649) WVRQAPGQGME Wmg (656) RVTMTVDTSISTAYMELSR LRSDDTAVYYCAK (663) WGQGTLVTVSS (668) 97 QVQLVQSGTEVKKPGAS VKVSCKGSGYTFT (651) WVRQAPGQGME WIG (655) RVTMTVDKSISTAYMELSR LRSDDTAVYYCAK (662) WGQGTLVTVSS (668) 98 QVQLVQSGAEVKKPGAS VKVSCKGSGYTFT (649) WVRQAPGQGME Wmg (656) RATMTVDTSISTAYMELSR LRSDDTAVYYCAK (670) WGQGTLVTVSS (668) 99 QVQLVQSGAEVKKPGAS VKVSCKASGYTFT (648) WVRQAPGQGME Wmg (656) RVTMTVDKSISTAYMELSR LRSDDTAVYYCAK (662) WGQGTLVTVSS (668) 100 QVQLVQSGTEVKKPGAS VKVSCKASGYTFT (650) WVRQAPGQGME Wmg (656) RATMTVDTSISTAYMELSR LRSDDTAVYYCAK (670) WGQGTLVTVSS (668) 101 QVQLVQSGAEVKKPGAS VKVSCKASGYTFT (648) WVRQAPGQGLE Wmg (654) RVTMTVDKSISTAYMELSR LRSDDTAVYYCAK (662) WGQGTLVTVSS (668) 102 QVQLVQSGTEVKKPGAS VKVSCKASGYTFT (650) WVRQAPGQGLE WIG (653) RVTMTVDTSISTAYMELSR LRSDDTAVYYCAK (663) WGQGTLVTVSS (668) 103 QVQLVQSGAEVKKPGAS VKVSCKASGYTFT (648) WVRQAPGQGME Wmg (656) RVTMTVDTSISTAYMELSR LRSDDTAVYYCAK (663) WGQGTLVTVSS (668) 104 QVQLVQSGTEVKKPGAS VKVSCKGSGYTFT (651) WVRQAPGQGME Wmg (656) RVTMTVDTSISTAYMELSR LRSDDTAVYYCAK (663) WGQGTLVTVSS (668) 105 QVQLVQSGAEVKKPGAS VKVSCKGSGYTFT (649) WVRQAPGQGLE Wmg (654) RVTMTVDTSISTAYMELSR LRSDDTAVYYCAK (663) WGQGTLVTVSS (668) 106 QVQLVQSGTEVKKPGAS VKVSCKGSGYTFT (651) WVRQAPGQGLE WIG (653) RATMTVDKSISTAYMELSR LRSDDTAVYYCAK (659) WGQGTLVTVSS (668) 107 QVQLVQSGAEVKKPGAS VKVSCKGSGYTFT (649) WVRQAPGQGLE Wmg (654) RVTMTVDTSISTAYMELSR LRSDDTAVYYCAK (663) WGQGTLVTVSS (668)

⁴ Described in Table. The 4 VH wireframes are defined based on the bounds for

CDR according to the Kabat numbering system. In other words, VH CDRs are defined by Kabat and framework regions represent the amino acid residues surrounding the CDRs in the variable region, in the format FR1, CDR1, FR2, CDR2, FR3, CDR3 and FR4.

In a particular embodiment, an antibody or fragment thereof described herein that specifically binds to GITR (e.g., human GITR) comprises a light chain variable region (VL) comprising:

(a) a VL CDR1 comprising, consisting of, or predominantly consisting of the amino acid sequence KSSQSX1X2X3X4X5X6X7KX8YLX9 (SEQ ID NO: 4), where

X ₁ is L, A, V, I, P, F or M;

- 51 040077

X2 is L, A, V, I, P, F, M, or S;

X ₃ is N, G, Q, S, T, C, W, Y, or A;

X ₄ is S, G, N, Q, T, C, W, Y, or A;

X ₅ is G, N, Q, S, T, C, W, Y, or A;

X ₆ is N, G, Q, S, T, C, W, Y, or A;

X ₇ is Q, G, N, S, T, C, W, Y, or A;

X ₈ is N, G, Q, S, T, C, W, Y, or A;

X ₉ is T, G, N, Q, S, C, W, Y, V, I, or A; and/or (b) a VL CDR2 comprising, consisting of, or predominantly consisting of the amino acid sequence X1ASTRX2X3 (SEQ ID NO: 5), where

X ₁ is W, G, N, Q, S, T, C, Y, F, H, or A;

X ₂ represents E, D or A;

X ₃ represents S, G, N, Q, T, C, W, Y or A; and/or (c) a VL CDR3 comprising, consisting of, or predominantly consisting of the amino acid sequence QX1X ₂ YX ₃ X ₄ PYT (SEQ ID NO: 6), where

X ₁ represents N, G, Q, S, T, C, W or Y;

X ₂ is D, E or Y;

X ₃ represents S, G, N, Q, T, C, W, Y or A;

X ₄ is Y, G, N, Q, S, T, C, W, F, H, L, or A.

In specific embodiments, the antibody or antigen-binding fragment thereof contains one, two, or all three of the above VL CDRs. In certain embodiments of the invention, the antibody or antigennegative fragment contains VL CDR1 of one of the antibodies from table. 5. In some embodiments of the invention, the antibody or antigennegative fragment contains VL CDR2 of one of the antibodies from table. 5. In certain embodiments of the invention, the antibody or antigennegative fragment contains VL CDR3 of one of the antibodies from table. 5. In certain embodiments of the invention, the antibody or its antigen-binding fragment contains one, two or all three VL CDRs of one of the antibodies from table. 5 (eg VL CDRs from one row in Table 5, eg all VL CDRs of antibody 231-32-15). In some embodiments, the antibody or antigen-binding fragment thereof contains the VL framework regions described herein. In specific embodiments of the invention, the antibody or its antigen-binding fragment contains the framework region of the VL (FR) of the antibody shown in table. 7 (for example, one, two, three, or four frame regions from one row in Table 7).

In another embodiment, an antibody described herein, or an antigen-binding fragment thereof, that specifically binds to GITR (e.g., human GITR) comprises a heavy chain variable region (VH) comprising:

(a) a VH CDR1 containing, consisting of, or predominantly consisting of the amino acid sequence X1YX2MX3 (SEQ ID NO: 1) wherein

X ₁ is D, E, G or A;

X ₂ is A, V, L, I, P, F, M, or Y;

X ₃ represents Y, G, N, Q, S, T, C, W, F or H; and/or (b) a VH CDR2 comprising, consisting of, or predominantly consisting of the amino acid sequence X1IX ₂ X ₃ X ₄ SGX ₅ X ₆ X ₇ YX ₈ QKFX ₉ X ₁₀ (SEQ ID NO: 2), wherein

X1 is V, A, L, I, P, F, M or T;

X2 is R, K, H, Q or A;

X ₃ is T, G, N, Q, S, C, W, Y, V, I, or P;

X4 is Y, G, N, Q, S, T, C, W, F, H, or A;

X5 is D, E, G or A;

X6 is V, A, L, I, P, F, M or T;

X ₇ is T, G, N, Q, S, C, W, Y, V, I, P, or A;

X ₈ is N, G, Q, S, T, C, W, Y, or A;

X ₉ is K, R, H, Q or A;

X ₁₀ is D, E, G or A; and/or (c) a VH CDR3 comprising, consisting of, or predominantly consisting of the amino acid sequence SGTVRGX1X2X3 (SEQ ID NO: 3) wherein

X1 is F, A, V, L, I, P, M, Y, W, H, or S;

X2 is A or D;

X3 is Y, G, N, Q, S, T, C, W, F, H, or V.

In specific embodiments of the invention, the antibody or its antigennegative fragment contains one, two or all three of the above VH CDR. In certain embodiments of the invention, the antibody or antigennegative fragment contains VH CDR1 of one of the antibodies from table. 6. In some embodiments of the invention, the antibody or antigennegative fragment contains VH CDR2 of one of the antibodies from table. 6. In certain embodiments, the antibody, or antigen-binding fragment thereof, contains the VH CDR3 of one of the antibodies in Table. 6. In some embodiments of the invention, the antibody or its antigen-binding fragment contains one, two or all three VH CDRs of one of the antibodies from table. 6 (eg VH CDRs from one row in Table 6, eg all VH CDRs of antibodies 231-32-15). In some embodiments, the antibody, or antigen-binding fragment thereof, comprises the VH framework regions described herein. In specific embodiments of the invention, the antibody or its antigennegative fragment contains the VH frame regions of the antibody shown in table. 8 (for example, one, two, three, or four frame regions from one row in Table 8).

Table 5

Amino acid sequences of VL CDR ¹

Antibody VL CDR1 (SEQ ID NO:) VL CDR2 (SEQ ID NO:) VL CDR3 (SEQ ID NO:) 231-32-15 KSSQSLLNSGNQKNYLT (16) WASTERS (17) QNDYSYPYT (18) Hum231#l KSSQSLLNSGNQKNYLT (16) WASTERS (17) QNDYSYPYT (18) Hum231#2 KSSQSLLNSGNQKNYLT (16) WASTERS (17) QNDYSYPYT (18) pabl964 KSSQSLLNSGNQKNYLS (101) WASTERS (105) QNEYSYPYT (106) pabl965 KSSQSLLNSGNQKNYLT (102) WASTERS (105) QNDYSYPYT (107) pabl966 KSSQSLLNSGNQKNYLT (102) WASTERS (105) QNDYSYPYT (107) pab1967 KSSQSLLNSSNQKNYLT (103) WASTERS (105) QNEYSFPYT (108) pab1968 KSSQSLLNSGNQKNYLS (101) WASTERS (105) QNDYSYPYT (107) pab1969 KSSQSLLNSSNQKNYLT (103) WASTERS (105) QNDYSFPYT (109) pab1970 KSSQSLLNSGNQKNYLS (101) WASTERS (105) QNDYSFPYT (109) paly971 KSSQSLLNSSNQKNYLT (103) WASTERS (105) QNDYSYPYT (107) paly972 KSSQSLLNSSNQKNYLS (104) WASTERS (105) QNDYSYPYT (107) raY973 KSSQSLLNSSNQKNYLT (103) WASTERS (105) QNDYSYPYT (107) paly975 KSSQSLLNSGNQKNYLT (102) WASTERS (105) QNDYSYPYT (107) raY976 KSSQSLLNSGNQKNYLS (101) WASTERS (105) QNDYSYPYT (107) paly977 KSSQSLLNSSNQKNYLT (103) WASTERS (105) QNDYSYPYT (107) raY979 KSSQSLLNSGNQKNYLT (102) WASTERS (105) QNDYSYPYT (107) raY980 KSSQSLLNSGNQKNYLS (101) WASTERS (105) QNDYSYPYT (107) raY981 KSSQSLLNSSNQKNYLT (103) WASTERS (105) QNDYSYPYT (107) raY983 KSSQSLLNSGNQKNYLT (102) WASTERS (105) QNDYSYPYT (107) pab2159 KSSQSLLNSGNQKNYLT (102) WASTERS (105) QNDYSFPYT (109) pab2160 KSSQSLLNSGNQKNYLT (102) WASTERS (105) QNDYSYPYT (107) pab2161 KSSQSLLNSSNQKNYLT (103) WASTERS (105) QNDYSFPYT (109) 1 KSSQSLLNSGNQKNYLT (102) WASTERS (105) QNDYSYPYT (107) 2 KSSQSLLNSGNQKNYLS (101) WASTERS (105) QNEYSFPYT (108) 4 KSSQSLLNSSNQKNYLS (104) WASTERS (105) QNDYSYPYT (107) 5 KSSQSLLNSSNQKNYLT (103) WASTERS (105) QNEYSFPYT (108) 6 KSSQSLLNSGNQKNYLS (101) WASTERS (105) QNDYSYPYT (107) 9 KSSQSLLNSGNQKNYLT (102) WASTERS (105) QNDYSFPYT (109) 10 KSSQSLLNSSNQKNYLS (104) WASTERS (105) QNDYSYPYT (107) eleven KSSQSLLNSSNQKNYLS (104) WASTERS (105) QNDYSFPYT (109) 15 KSSQSLLNSGNQKNYLS (101) WASTERS (105) QNDYSYPYT (107) 16 KSSQSLLNSGNQKNYLT (102) WASTERS (105) QNDYSYPYT (107) 18 KSSQSLLNSSNQKNYLT (103) WASTERS (105) QNDYSYPYT (107) 20 KSSQSLLNSGNQKNYLT (102) WASTERS (105) QNDYSYPYT (107) 21 KSSQSLLNSGNQKNYLT (102) WASTERS (105) QNDYSYPYT (107) 25 KSSQSLLNSGNQKNYLT (102) WASTERS (105) QNDYSFPYT (109) 29 KSSQSLLNSSNQKNYLS (104) WASTERS (105) QNDYSYPYT (107) 31 KSSQSLLNSSNQKNYLT (103) WASTERS (105) QNDYSYPYT (107) 33 KSSQSLLNSGNQKNYLS (101) WASTERS (105) QNEYSYPYT (106) 34 KSSQSLLNSSNQKNYLT (103) WASTERS (105) QNDYSYPYT (107) 35 KSSQSLLNSGNQKNYLT (102) WASTERS (105) QNDYSYPYT (107) 36 KSSQSLLNSSNQKNYLT (103) WASTERS (105) QNDYSFPYT (109) 37 KSSQSLLNSGNQKNYLT (102) WASTERS (105) QNEYSYPYT (106) 38 KSSQSLLNSGNQKNYLT (102) WASTERS (105) QNDYSYPYT (107) 39 KSSQSLLNSSNQKNYLT (103) WASTERS (105) QNEYSFPYT (108) 42 KSSQSLLNSGNQKNYLS (101) WASTERS (105) QNDYSYPYT (107) 43 KSSQSLLNSGNQKNYLT (102) WASTERS (105) QNDYSYPYT (107) 45 KSSQSLLNSGNQKNYLS (101) WASTERS (105) QNDYSFPYT (109) 46 KSSQSLLNSGNQKNYLS (101) WASTERS (105) QNDYSYPYT (107) 47 KSSQSLLNSGNQKNYLS (101) WASTERS (105) QNDYSFPYT (109) 49 KSSQSLLNSGNQKNYLT (102) WASTERS (105) QNDYSFPYT (109) 50 KSSQSLLNSSNQKNYLT (103) WASTERS (105) QNDYSYPYT (107) 52 KSSQSLLNSGNQKNYLT (102) WASTERS (105) QNDYSFPYT (109) 54 KSSQSLLNSSNQKNYLT (103) WASTERS (105) QNDYSFPYT (109) 55 KSSQSLLNSGNQKNYLS (101) WASTERS (105) QNDYSFPYT (109) 58 KSSQSLLNSGNQKNYLS (101) WASTERS (105) QNDYSYPYT (107) 59 KSSQSLLNSSNQKNYLS (104) WASTERS (105) QNDYSYPYT (107)

- 53 040077

61 KSSQSLLNSGNQKNYLS (101) WASTERS (105) QNDYSFPYT (109) 68 KSSQSLLNSGNQKNYLT (102) WASTERS (105) QNDYSYPYT (107) 70 KSSQSLLNSGNQKNYLS (101) WASTERS (105) QNDYSFPYT (109) 71 KSSQSLLNSSNQKNYLT (103) WASTERS (105) QNDYSYPYT (107) 75 KSSQSLLNSGNQKNYLS (101) WASTERS (105) QNDYSYPYT (107) 76 KSSQSLLNSGNQKNYLS (101) WASTERS (105) QNDYSFPYT (109) 78 KSSQSLLNSGNQKNYLT (102) WASTERS (105) QNDYSYPYT (107) 79 KSSQSLLNSGNQKNYLT (102) WASTERS (105) QNDYSYPYT (107) 80 KSSQSLLNSSNQKNYLT (103) WASTERS (105) QNDYSFPYT (109) 85 KSSQSLLNSSNQKNYLS (104) WASTERS (105) QNDYSYPYT (107) 86 KSSQSLLNSGNQKNYLT (102) WASTERS (105) QNDYSYPYT (107) 91 KSSQSLLNSGNQKNYLS (101) WASTERS (105) QNEYSFPYT (108) 92 KSSQSLLNSGNQKNYLT (102) WASTERS (105) QNDYSYPYT (107) 94 KSSQSLLNSGNQKNYLT (102) WASTERS (105) QNDYSYPYT (107) 95 KSSQSLLNSGNQKNYLT (102) WASTERS (105) QNDYSFPYT (109) 96 KSSQSLLNSSNQKNYLS (104) WASTERS (105) QNDYSYPYT (107) 97 KSSQSLLNSGNQKNYLT (102) WASTERS (105) QNEYSFPYT (108) 101 KSSQSLLNSSNQKNYLT (103) WASTERS (105) QNDYSFPYT (109) 102 KSSQSLLNSSNQKNYLS (104) WASTERS (105) QNDYSYPYT (107) 105 KSSQSLLNSGNQKNYLS (101) WASTERS (105) QNDYSYPYT (107) 107 KSSQSLLNSGNQKNYLS (101) WASTERS (105) QNDYSYPYT (107)

¹ VL CDR in tab. 5 are determined by Cabal.

Table 6

Amino acid sequences of VH CDR ²

Antibody VH CDR1 (SEQ ID NO:) VH CDR2 (SEQ ID NO:) VH CDR3 (SEQ ID NO:) 231-32-15 DYAMY (13) VIRTYSGDVTYNQKFKD (14) SGTVRGFAY (15) Hum231#l DYAMY (13) VIRTYSGDVTYNQKFKD (14) SGTVRGFAY (15) Hum231#2 DYAMY (13) VIRTYSGDVTYNQKFKD (14) SGTVRGFAY (15) pabl964 GYAMY(19) LIRTYSGGVTYNQKFQG (24) SGTVRGFAY (34) pabl965 GYAMY(19) VIRTFSGDVTYNQKFRG (25) SGTVRGFAY (34) pabl966 GYAMY(19) VIKTYSGGVTYNQKFRG (26) SGTVRGFAY (34) pabl967 GYAMH (2 0) LIRTYSGGVSYNQKFRE (27) SGTVRGFAY (34) pabl968 DYAMY (21) VIRTFSGDLTYNQKFQD (28) SGTVRGFAY (34) pabl969 EYAMH (22) LIRTYSGGVSYNQKFQG(29) SGTVRGFAY (34) pabl970 DYAMY (21) LIRTYSGGVTYNQKFQG (24) SGTVRGFAY (34) pabl971 DYAMY (21) VIRTYSGDVSYNQKFRG (177) SGTVRGFAY (34) pabl972 EYAMY (23) LIRTYSGGVSYNQKFRD (31) SGTVRGFAY (34) pabl973 GYAMY(19) VIRTFSGGVTYNQKFRG (32) SGTVRGFAY (34) pabl975 EYAMH (22) LIRTYSGGVSYNQKFQG(29) SGTVRGFAY (34) pabl976 EYAMH (22) LIRTYSGGVSYNQKFQG(29) SGTVRGFAY (34) pabl977 EYAMH (22) LIRTYSGGVSYNQKFQG(29) SGTVRGFAY (34) pabl979 EYAMH (22) VIRTYSGGVSYNQKFQE (33) SGTVRGFAY (34) pabl980 EYAMH (22) VIRTYSGGVSYNQKFQE (33) SGTVRGFAY (34) pabl981 EYAMH (22) VIRTYSGGVSYNQKFQE (33) SGTVRGFAY (34) pabl983 GYAMY(19) LIRTYSGGVTYNQKFQG (24) SGTVRGFAY (34) pab2159 GYAMY(19) LIRTYSGEVSYNQKFRG (144) SGTVRGFAY (34) pab2160 GYVMH(119) VIRTFSGDVSYNQKFRE (162) SGTVRGFAY (34) pab2161 EYAMH (22) LIQTYSGDVSYNQKFRG (121) SGTVRGFAY (34) 1 EYAMY (23) VIRTYSGGVTYNQKFQG (187) SGTVRGFAY (34)

-54040077

2 EYAMH (22) LIRTYSGGVSYNQKFRG (148) SGTVRGFAY (34) 4 EYAMY (23) LIRTFSGDVSYNQKFQD (124) SGTVRGFAY (34) 5 EYAMH (22) LIRTYSGGVTYNQKFRG (151) SGTVRGFAY (34) 6 EYAMY (23) LIRTFSGGVSYNQKFKG (135) SGTVRGFAY (34) 9 GYAMY (19) LIRTYSGEVSYNQKFRG (144) SGTVRGFAY (34) 10 EYAMY (23) LIRTYSGGVSYNQKFRG (148) SGTVRGFAY (34) eleven DYAMH (117) LIRTYSGGVSYNQKFRG (148) SGTVRGFAY (34) 15 DYAMY (21) VIRTFSGDVSYNQKFRE (162) SGTVRGFAY (34) 16 GYAMY (19) LIRTFSGGVTYNQKFRE (140) SGTVRGFAY (34) 18 GYAMY (19) LIRTFSGEVTYNQKFRG (130) SGTVRGFAY (34) 20 DYAMY (21) VIRTFSGDLSYNQKFRG (114) SGTVRGFAY (34) 21 GYVMH (119) VIRTFSGDVSYNQKFRE (162) SGTVRGFAY (34) 25 EYAMY (23) LIRTFSGGVSYNQKFRG (138) SGTVRGFAY (34) 29 DYAMY (21) VIRTFSGGVTYNQKFKG (172) SGTVRGFAY (34) 31 EYAMY (23) LIRTFSGGLTYNQKFKD (133) SGTVRGFAY (34) 33 GYAMY (19) LIRTYSGGVTYNQKFQG (24) SGTVRGFAY (34) 34 DYAMY (21) VIRTFSGGVTYNQKFRG (32) SGTVRGFAY (34) 35 GYAMY (19) VIRTFSGDVTYNQKFRG (25) SGTVRGFAY (34) 36 DYAMY (21) VIRTFSGGVSYNQKFRD (168) SGTVRGFAY (34) 37 EYAMY (23) LIRTFSGEVTYNQKFKD (129) SGTVRGFAY (34) 38 GYAMY (19) VIKTYSGGVTYNQKFRG (26) SGTVRGFAY (34) 39 GYAMH (20) LIRTYSGGVSYNQKFRE (27) SGTVRGFAY (34) 42 DYAMY (21) VIRTFSGDLTYNQKFQD (28) SGTVRGFAY (34) 43 EYAMY (23) LIRTFSGDVSYNQKFKG (123) SGTVRGFAY (34) 45 EYAMY (23) LIRTYSGGVSYNQKFQG (147) SGTVRGFAY (34) 46 EYAMY (23) LIRTFSGDLSYNQKFRG (122) SGTVRGFAY (34) 47 DYAMY (21) VIRTYSGGVTYNQKFRD (188) SGTVRGFAD (189) 49 GYAMY (19) VIRTYSGDVTYNQKFRE (179) SGTVRGFAY (34) 50 DYAMY (21) LIRTFSGGVSYNQKFKE (134) SGTVRGFAY (34) 52 DYAMY (21) LIRTYSGGVSYNQKFRE (27) SGTVRGFAY (34) 54 EYAMH (22) LIRTYSGGVSYNQKFQG (147) SGTVRGFAY (34) 55 DYAMY (21) LIRTYSGGVTYNQKFQG (24) SGTVRGFAY (34) 58 DYAMY (21) VIRTYSGGVTYNQKFKG (186) SGTVRGFAY (34) 59 EYAMY (23) LIRTYSGGVSYNQKFRD (31) SGTVRGFAY (34) 61 EYAMH (22) LIRTYSGGVSYNQKFQE (115) SGTVRGFAY (34) 68 GYAMY (19) LIRTYSGGVTYNQKFRG (151) SGTVRGFAY (34) 70 GYAMY (19) VIRTYSGDVTYNQKFKD (178) SGTVRGFAY (34) 71 GYAMY (19) VIRTFSGGVTYNQKFRG (32) SGTVRGFAY (34) 75 GYAMY (19) VIRTYSGGVTYNQKFQG (187) SGTVRGFAY (34) 76 DYAMH (117) LIRTFSGDVSYNQKFRE (125) SGTVRGFAY (34) 78 DYAMY (21) VIRTYSGGVTYNQKFRD (155) SGTVRGFAY (34) 79 EYAMH (22) LIRTYSGGVTYNQKFRE (150) SGTVRGFAY (34) 80 EYAMH (22) LIRTFSGDVSYNQKFRG (126) SGTVRGFAY (34) 85 EYAMY (23) VIRTYSGGVTYNQKFRD (185) SGTVRGFAY (34) 86 EYAMY (23) VIRTYSGGVTYNQRFRD (188) SGTVRGFAY (34) 91 EYAMH (22) LIRTYSGGVSYNQRFQE (115) SGTVRGFAY (34) 92 EYAMY (23) LIRTFSGGVTYNQRFQG (139) SGTVRGFAY (34) 94 GYAMY (19) VIRTFSGGVTYNQRFRD (173) SGTVRGFAY (34) 95 DYAMY (21) LIRTYSGGVSYNQRFRG (148) SGTVRGFAY (34) 96 EYAMY (23) VIRTYSGGLTYNQRFRD (184) SGTVRGFAY (34) 97 EYAMH (22) LIRTFSGGLSYNQRFRD (131) SGTVRGFAY (34) 101 DYAMH (117) LIRTFSGGVSYNQRFQD (136) SGTVRGFAY (34) 102 GYAMY (19) VIRTYSGGVSYNQRFRD (194) SGTVRGFAY (34) 105 EYAMY (23) LIRTFSGGVSYNQRFRG (135) SGTVRGFAY (34) 107 GYAMY (19) VIRTYSGDVSYNQRFRD (176) SGTVRGFAY (34)

² VH CDR in the table. 6 determined by Kabat.

- 55 040077

Table 7

Amino acid sequences of VL FR ³

Antibody VLFR1 (SEQ ID NO:) VL FR2 (SEQ ID NO:) VLFR3 (SEQ ID NO:) VLFR4 (SEQ ID NO:) 231-32- 15 DIVMTQSPSSLTVTAG EKVIMSC (616) WYQQKPGQPPK LLIY (623) GVPDRFTGSGSGTDFTLTISS VQAEDLAVYHC (637) FGGGTKLEIK (641) Hum2 31 #1 DIVMTQSPPTLSLSPG ERVTLSC (615) WYQQKPGQAPR LLIY (622) GIPARFSGSGSGTDFTLTISS LQPEDFAVYHC (626) FGQGTKLEIK (643) Hum2 31 #2 DIVMTQSPDSLAVSLG ERATINC (611) WYQQKPGQPPK LLIY (623) GVPDRFSGSGSGTDFTLTISS LQAEDVAVYHC (6 3 0) FGQGTKLEIK (643) raY964 DIVMTQSPDSLAVSLG ERATINC (611) WYHQKPGQPPK LLIY (618) GVPDRFSGSGSGTDFTLTISS VQAE DVAVYH C (6 3 2) FGQGTKLEIK (643) paly965 DIVMTQSPDSLAVSLG ERATINC (611) WYHQKPGQPPK LLIY (618) GVPDRFTGSGSGTDFTLTISS VQAEDVAVYYC (6 3 9) FGQGTKLEIK (643) raY966 DIVMTQSPDSLAVSLG ERATINC (611) WYQQKPGQPPK LLIY (623) GVPDRFSGSGSGTDFTLTISS LQAEDVAVYYC (6 31) FGQGTKLEIK (643) paly967 DIVMTQSPDSLAVSLG ERATINC (611) WYQQKPGQPPK LLIY (623) GVPDRFTGSGSGTDFTLTISS VQAE DVAVYH C (6 3 8) FGQGTKLEIK (643) raY968 DIVMTQSPDSLAVSLG ERATINC (611) WYQQKPGQPPK LLIY (623) GVPDRFSGSGSGTDFTLTISS LQAEDVAVYYC (6 31) FGQGTKLEIK (643) raY969 DIVMTQSPDSLAVSLG ERATINC (611) WYQQKPGQPPK LLIY (623) GVPDRFTGSGSGTDFTLTISS VQAE DVAVYH C (6 3 8) FGQGTKLEIK (643) paly970 DIVMTQSPDSLAVSLG ERATINC (611) WYQQKPGQPPK LLIY (623) GVPDRFSGSGSGTDFTLTISS VQAE DVAVYH C (6 3 2) FGQGTKLEIK (643) paly971 DIVMTQSPDSLAVSLG ERATINC (611) WYQQKPGQPPK LLIY (623) GVPDRFTGSGSGTDFTLTISS LQAEDVAVYYC (6 4 2) FGQGTKLEIK (643) paly972 DIVMTQSPDSLAVSLG ERATINC (611) WYHQKPGQPPK LLIY (618) GVPDRFSGSGSGTDFTLTISS VQAEDVAVYHC (632) FGQGTKLEIK (643) raY973 DIVMTQSPDSLAVSLG ERATINC (611) WYQQKPGQPPK LLIY (623) GVPDRFTGSSGSDTDFTLTISS VQAE DVAVYH C (6 2 7) FGQGTKLEIK (643) paly975 DIVMTQSPDSLAVSLG ERATINC (611) WYQQKPGQPPK LLIY (623) GVPDRFSGSGSGTDFTLTISS LQAEDVAVYYC (6 31) FGQGTKLEIK (643) raY976 DIVMTQSPDSLAVSLG ERATINC (611) WYQQKPGQPPK LLIY (623) GVPDRFSGSGSGTDFTLTISS LQAEDVAVYYC (6 31) FGQGTKLEIK (643) paly977 DIVMTQSPDSLAVSLG ERATINC (611) WYQQKPGQPPK LLIY (623) GVPDRFTGSGSGTDFTLTISS LQAEDVAVYYC (6 4 2) FGQGTKLEIK (643) raY979 DIVMTQSPDSLAVSLG ERATINC (611) WYQQKPGQPPK LLIY (623) GVPDRFSGSGSGTDFTLTISS LQAEDVAVYYC (6 31) FGQGTKLEIK (643) raY980 DIVMTQSPDSLAVSLG ERATINC (611) WYQQKPGQPPK LLIY (623) GVPDRFSGSGSGTDFTLTISS LQAEDVAVYYC (631) FGQGTKLEIK (643) raY981 DIVMTQSPDSLAVSLG ERATINC (611) WYQQKPGQPPK LLIY (623) GVPDRFTGSGSGTDFTLTISS LQAEDVAVYYC (6 4 2) FGQGTKLEIK (643) raY983 DIVMTQSPDSLAVSLG ERATINC (611) WYQQKPGQPPK LLIY (623) GVPDRFSGSGSGTDFTLTISS LQAEDVAVYYC (6 31) FGQGTKLEIK (643) pab2159 DIVMTQSPDSLAVSLG ERATINC (611) WYQQKPGQPPK MLIY (624) GVPDRFSGSGSGTDFTLTISS LQAEDVAVYHC (630) FGQGTKLEIK (643)

- 56 040077

pab2160 DIVMTQSPDSLAVSLG ERATINC (611) WYHQKPGQPPK LLIY (618) GVPDRFSGSGSGTDFTLTISS VQAE DVAVYH C (6 3 2) FGQGTKLEIK (643) pab2161 DIVMTQSPDSLAVSLG ERATINC (611) WYHQKPGQPPK LLIY (618) GVPDRFTGSGSGTDFTLTISS VQAEDVAVYYC (6 3 9) FGQGTKLEIK (643) 1 DIVMTQSPDSLAVSLG ERATINC (611) WYHQKPGQPPK MLIY (619) GVPDRFSGSGSGTDFTLTISS VQAE DVAVYH C (6 3 2) FGQGTKLEIK (643) 2 DIVMTQSPDSLAVSLG ERATINC (611) WYHQKPGQPPK LLIY (618) GVPDRFSGSGSGTDFTLTISS VQAEDVAVYYC (6 3 3) FGQGTKLEIK (643) 4 DIVMTQSPDSLAVSLG ERATINC (611) WYHQKPGQPPK LLIY (618) GVPDRFTGSGSGTDFTLTISS VQAEDVAVYYC (6 3 9) FGQGTKLEIK (643) 5 DIVMTQSPDSLAAPGE RATING (610) WYHQKPGQPPK LLIY (618) GVPDRFTGSGSGTDFTLTISS VQAEDVAVYYC (639) FGQGTKLEIK (643) 6 DIVMTQSPDSLAVSLG ERATINC (611) WYQQKPGQPPK MLIY (624) GVPDRFTGSGSGTDFTLTISS LQAEDVAVYHC (6 3 6) FGQGTKLEIK (643) 9 DIVMTQSPDSLAVSLG ERATINC (611) WYQQKPGQPPK MLIY (624) GVPDRFSGSGSGTDFTLTISS LQAEDVAVYHC (6 3 0) FGQGTKLEIK (643) 10 DIVMTQSPDSLAVSLG ERATINC (611) WYQQKPGQPPK LLIY (623) GVPDRFSGSGSGTDFTLTISS VQAEDVAVYHC (632) FGQGTKLEIK (643) eleven DIVMTQSPDSLAVSLG ERATINC (611) WYQQKPGQPPK LLIY (623) GVPDRFSGSGSGTDFTLTISS VQAE DVAVYH C (6 3 2) FGQGTKLEIK (643) 15 DIVMTQSPDSLAVSLG ERATINC (611) WYQQKPGQPPK LLIY (623) GVPDRFTGSGSGTDFTLTISS LQAEDVAVYHC (6 3 6) FGQGTKLEIK (643) 16 DIVMTQSPDSLAVSLG ERATINC (611) WYHQKPGQPPK LLIY (618) GVPDRFTGSGSGTDFTLTISS VQAE DVAVYH C (6 3 8) FGQGTKLEIK (643) 18 DIVMTQSPDSLAVSLG ERATINC (611) WYHQKPGQPPK MLIY (619) GVPDRFTGSGSGTDFTLTISS VQAEDVAVYYC (6 3 9) FGQGTKLEIK (643) 20 DIVMTQSPDSLAVSLG ERATINC (611) WYQQKPGQPPK MLLY (624) GVPDRFTGSGSGTDFTLTISS VQAE DVAVYH C (6 2 0) FGQGTKLEIK (643) 21 DIVMTQSPDSLAVSLG ERATINC (611) WYHQKPGQPPK LLIY (618) GVPDRFSGSGSGTDFTLTISS VQAEDVAVYHC (632) FGQGTKLEIK (643) 25 DIVMTQSPDSLAVSLG ERATINC (611) WYQQKPGQPPK MLIY (624) GVPDRFTGSGSGTDFTLTISS VQAEDVAVYYC (6 3 9) FGQGTKLEIK (643) 29 DIVMTQSPDSLAVSLG ERATINC (611) WYQQKPGQPPK LLIY (623) GVPDRFSGSGSGTDFTLTISS LQAEDVAVYHC (6 3 0) FGQGTKLEIK (643) 31 DIVMTQSPDSLAVSLG ERATINC (611) WYQQKPGQPPK LLIY (623) GVPDRFTGSGSGTDFTLTISS LQAEDVAVYHC (6 3 6) FGQGTKLEIK (643) 33 DIVMTQSPDSLAVSLG ERATINC (611) WYHQKPGQPPK LLIY (618) GVPDRFSGSGSGTDFTLTISS VQAE DVAVYH C (6 3 2) FGQGTKLEIK (643) 34 DIVMTQSTDSLAVSLG ERATINC (617) WYQQKPGQPPK LLIY (623) GVPDRFTGSGSGTDFTLTISS LQAEDVAVYHC (6 3 6) FGQGTKLEIK (643) 35 DIVMTQSPDSLAVSLG ERATINC (611) WYHQKPGQPPK LLIY (618) GVPDRFTGSGSGTDFTLTISS VQAEDVAVYYC (6 3 9) FGQGTKLEIK (643) 36 DIVMTQSPDSLAVSLG ERATINC (611) WYHQKPGQPPK MLIY (619) GVPDRFSGSGSGTDFTLTISS VQEEDVAVYHC (634) FGQGTKLEIK (643) 37 DIVMTQSPDSLAVSLG ERATINC (611) WYQQKPGQPPK LLIY (623) GVPDRFTGSGSGTDFTLTISS LQAEDVAVYHC (6 3 6) FGQGTKLEIK (643)

- 57 040077

38 DIVMTQSPDSLAVSLG ERATINC (611) WYQQKPGQPPK LLIY (623) GVPDRFSGSGSGTDFTLTISS LQAEDVAVYYC (6 31) FGQGTKLEIK (643) 39 DIVMTQSPDSLAVSLG ERATINC (611) WYQQKPGQPPK LLIY (623) GVPDRFTGSGSGTDFTLTISS VQAE DVAVYH C (6 3 8) FGQGTKLEIK (643) 42 DIVMTQSPDSLAVSLG ERATINC (611) WYQQKPGQPPK LLIY (623) GVPDRFSGSGSGTDFTLTISS LQAEDVAVYYC (6 31) FGQGTKLEIK (643) 43 DIVMTQSPDSLAVSLG ERATINC (611) WYQQKPGQPPK MLIY (624) GVPDRFTGSGSGTDFTLTISS VQAE DVAVYH C (6 3 8) FGQGTKLEIK (643) 45 DIVMTQSPDSLAVSLG ERATINC (611) WYHQKPGQPPK LLIY (618) GVPDRFTGSGSGTDFTLTISS VQAEDVAVYYC (6 3 9) FGQGTKLEIK (643) 46 DIVMTQSPDSLAVSLG ERATINC (611) WYHQKPGQPPK LLIY (618) GVPDRFTGSGSGTDFTLTISS LQAEDVAVYHC (636) FGQGTKLEIK (643) 47 DIVMTQSPDSLAVSLG ERATINC (611) WYQQKPGQPPK LLIY (623) GVPDRFTGSGSGTDFTLTISS VQAE DVAVYH C (6 3 8) FGQGTKLEIK (643) 49 DIVMTQSPDSLAVSLG ERATINC (611) WYHQKPGQPPK LLIY (618) GVPDRFSGSGSGTDFTLTISS VQAE DVAVYH C (6 3 2) FGQGTKLEIK (643) 50 DIVMTQSPDSLAVSLG ERATINC (611) WYQQKPGQPPK MLIY (624) GVPDRFSGSGSGTDFTLTISS LQAEDVAVYYC (631) FGQGTKLEIK (643) 52 DIVMTQSPDSLAVSLG ERATINC (611) WYQQKPGQPPK LLIY (623) GVPDRFSGSGSGTDFTLTISS LQAEDVAVYHC (6 3 0) FGQGTKLEIK (643) 54 DIVMTQSPDSLAVSLG ERATINC (611) WYQQKPGQPPK LLIY (623) GVPDRFTGSGSGTDFTLTISS VQAE DVAVYH C (6 3 8) FGQGTKLEIK (643) 55 DIVMTQSPDSLAVSLG ERATINC (611) WYQQKPGQPPK LLIY (623) GVPDRFSGSGSGTDFTLTISS VQAE DVAVYH C (6 3 2) FGQGTKLEIK (643) 58 DIVMTQSPDSLAVSLG ERATINC (611) WYHQKPGQPPK LLIY (618) GVPDRFSGSGSGTDFTLTISS VQAE DVAVYH C (6 3 2) FGQGTKLEIK (643) 59 DIVMTQSPDSLAVSLG ERATINC (611) WYHQKPGQPPK LLIY (618) GVPDRFSGSGSGTDFTLTISS VQAE DVAVYH C (6 3 2) FGQGTKLEIK (643) 61 DIVMTQSPDSLAVSLG ERATINC (611) WYQQKPGQPPK LLIY (623) GVPDRFSGSGSGTDFTLTISS VQAEDVAVYYC (633) FGQGTKLEIK (643) 68 DIVMTQSPDSLAVSLG ERATINC (611) WYQQKPGQPPK MLIY (624) GVPDRFTGSGSGTDFTLTISS LQAEDVAVYYC (6 4 2) FGQGTKLEIK (643) 70 DIVMTQSPDSLAVSLG ERATINC (611) WYQQKPGQPPK LLIY (623) GVPDRFSGSGSGTDFTLTISS LQAEDVAVYHC (6 3 0) FGQGTKLEIK (643) 71 DIVMTQSPDSLAVSLG ERATINC (611) WYQQKPGQPPK LLIY (623) GVPDRFTGSGSGTDFTLTISS VQAE DVAVYH C (6 3 8) FGQGTKLEIK (643) 75 DIVMTQSPDSLAVSLG ERATINC (611) WYHQKPGQPPK LLIY (618) GVPDRFTGSGSGTDFTLTISS LQAEDVAVYYC (6 4 2) FGQGTKLEIK (643) 76 DIVMTQSPDSLAVSLG ERATINC (611) WYQQKPGQPPK MLIY (624) GVPDRFSGSGSGTDFTLTISS VQAE DVAVYH C (6 3 2) FGQGTKLEIK (643) 78 DIVMTQSPDSLAVSLG ERATINC (611) WYHQKPGQPPK MLIY (619) GVPDRFTGSGSGTDFTLTISS VQAE DVAVYH C (6 3 8) FGQGTKLEIK (643) 79 DIVMTQSPDSLAVSLG ERATINC (611) WYHQKPGQPPK MLIY (619) GVPDRFSGSGSGTDFTLTISS LQAEDVAVYYC (631) FGQGTKLEIK (643) 80 DIVMTQSPDSLAVSLG ERATINC (611) WYQQKPGQPPK LLIY (623) GVPDRFTGSGSGTDFTLTISS LQAEDVAVYYC (6 4 2) FGQGTKLEIK (643)

- 58 040077

85 DIVMTQSPDSLAVSLG ERATINC (611) WYHQKPGQPPK LLIY (618) GVPDRFSGSGSGTDFTLTISS VQAEDVAVYYC (633) FGQGTKLEIK (643) 86 DIVMTQSPDSLAVSLG ERATINC (611) WYHQKPGQPPK LLIY (618) GVPDRFSGSGSGTDFTLTISS VQAEDVAVYYC (6 3 3) FGQGTKLEIK (643) 91 DIVMTQSPDSLAVSLG ERATINC (611) WYQQKPGQPPK LLIY (623) GVPDRFSGSGSGTDFTLTISS VQAE DVAVYH C (6 3 2) FGQGTKLEIK (643) 92 DIVMTQSPDSLAVSLG ERATINC (611) WYHQKPGQPPK MLIY (619) GVPDRFSGSGSG®HOTLTISS VQAE DVAVYH C (6 3 5) FGQGTKLEIK (643) 94 DIVMTQSPDSLAVSLG ERATINC (611) WYQQKPGQPPK LLIY (623) GVPDRFTGSGSGTDFTLTISS VQAEDVAVYHC (638) FGQGTKLEIK (643) 95 DIVMTQSPDSLAVSLG ERATINC (611) WYQQKPGQPPK MLIY (624) GVPDRFSGSGSGTDFTLTISS VQAE DVAVYH C (6 3 2) FGQGTKLEIK (643) 96 DIVMTQSPDSLAVSLG ERATINC (611) WYHQKPGQPPK LLIY (618) GVPDRFSGSGSGTDFTLTISS LQAEDVAVYHC (6 3 0) FGQGTKLEIK (643) 97 DIVMTQSPDSLAVSLG ERATINC (611) WYHQKPGQPPK LLIY (618) GVPDRFTGSGSGTDFTLTISS VQAE DVAVYH C (6 3 8) FGQGTKLEIK (643) 101 DIVMTQSPDSLAVSLG ERATINC (611) WYHQKPGQPPK LLIY (618) GVPDRFSGSGSGTDFTLTISS VQAE DVAVYH C (6 3 2) FGQGTKLEIK (643) 102 DIVMTQSPDSLAVSLG ERATINC (611) WYQQKPGQPPK LLIY (623) GVPDRFTGSGSGTDFTLTISS VQAEDVAVYYC (6 3 9) FGQGTKLEIK (643) 105 DIVMTQSPDSLAVSLG ERATINC (611) WYQQKPGQPPK LLIY (623) GVPDRFSGSGSGTDFTLTISS VQAEDVAVYYC (6 3 3) FGQGTKLEIK (643) 107 DIVMTQSPDSLAVSLG ERATINC (611) WYHQKPGQPPK LLIY (618) GVPDRFTGSGSGTDFTLTISS VQAEDVAVYYC (6 3 9) FGQGTKLEIK (643)

³ Described in Table. 7, the VL framework regions are defined based on the boundaries for the CDRs according to the Kabat numbering system. In other words, VL CDRs are defined by Kabat and framework regions represent the amino acid residues surrounding the CDRs in the variable region, in the format FR1, CDR1, FR2, CDR2, FR3, CDR3 and FR4.

Table 8

Amino acid sequences of VH FR ⁴

Antibody VHFR1 (SEQ ID NO:) VH FR2 (SEQ ID NO:) VHFR3 (SEQ ID NO:) VHFR4 (SEQ ID NO:) 231-32-15 QVQLLQSGTELVRPGVSVKI SCKGSGYTFT (645) WVKQSHAKSLEWI G(652) KATMTVDKS S SIAYMELARLS SEDSAIYYCAK (658) WGQGTLVTVSS (668) Hum231#l QVQ LVQ S GAEVKK P GASVKV SCKGSGYTFT (649) WVRQAPGQGLEWI G(653) RATMTVDKSISTAYMELSRLR SDDTAVYYCAK (659) WGQGTLVTVSS (668) Hum231#2 QVQ LVQ S GAEVKK P GASVKV SCKGSGYTFT (649) WVRQAPGQGLEWI G(653) RATMTVDKSISTAYMELSRLR SDDTAVYYCAK (659) WGQGTLVTVSS (668) pabl964 QVQ LVQ S GAEVKK P GASVKV SCKASGYTFT (648) WVRQAPGQGMEWI G(655) RVTMTVDTSISTAYMELSLR SDDTAVYYCAK (663) WGQGTLVTVSS (668) pabl965 QVQ LVQ S GAEAKK P GASVKV SCKGSGYTFT (646) WVRQAPGQGMEWI G(655) RVTMTVDTSISTAYMELSLR SDDTAVYYCAK (663) WGQGTLVTVSS (668) pabl966 QVQ LVQ S GT EVKK P GASVKV SCKGSGYTFT (651) WVRQAPGQGLEWI G(653) RVTMTVDKSISTAYMELSRLR SDDTAVYYCAK (662) WGQGTLVTVSS (668)

- 59 040077

paly967 QVQ LVQ S GAEVKK P GASVKV SCKGSGYTFT (649) WVRQAPGQGLEWM G(654) RATMTVDTSISTAYMELSLR SDDTAVYYCAK (670) WGQGTLITVSS (667) raY968 QVQ LVQ S GT EVKK R GASVKV SCKASGYTFT (650) WVRQAPGQGLEWI G(653) RVTMTVDTSISTAYMELSLR SDDTAVYYCAK (663) WGQGTLVTVSS (668) pabl969 QVQ LVQ S GAEVKK P GASVKV SCKASGYTFT (648) WVRQAPGQGLEWM G(654) RATMTVDTSISTAYMELSLR SDDTAVYYCAK (670) WGQGTLVTVSS (668) pabl970 QVQ LVQ S GT EVKK P GASVKV SCKASGYTFT (650) WVRQAPGQGLEWI G(653) RVTMTVDTSISTAYMELSLR SDDTAVYYCAK (663) WGQGTLVTVSS (668) pab1971 QVQ LVQ S GT EVKK P GASVKV SCKGSGYTFT (651) WVRQAPGQGMEWM G(656) RVTMTVDTSISTAYMELSLR SDDTAVYYCAK (663) WGQGTLVTVSS (668) pab1972 QVQ LVQ S GAEVKK P GASVKV SCKASGYTFT (648) WVRQAPGQGLEWM G(654) RVTMTVDKSISTAYMELSRLR SDDTAVYYCAK (662) WGQGTLVTVSS (668) pab1973 QVQ LVQ S GAEVKK P GASVKV SCKASGYTFT (648) WVRQAPGQGMEWM G(656) RATMTVDTSISTAYMELSLR SDDTAVYYCAK (670) WGQGTLVTVSS (668) paly975 QVQ LVQ S GAEVKK P GASVKV SCKASGYTFT (648) WVRQAPGQGLEWM G(654) RATMTVDTSISTAYMELSLR SDDTAVYYCAK (670) WGQGTLVTVSS (668) pab1976 QVQ LVQ S GAEVKK P GASVKV SCKASGYTFT (648) WVRQAPGQGLEWM G(654) RATMTVDTSISTAYMELSLR SDDTAVYYCAK (670) WGQGTLVTVSS (668) pab1977 QVQ LVQ S GAEVKK P GASVKV SCKASGYTFT (648) WVRQAPGQGLEWM G(654) RATMTVDTSISTAYMELSLR SDDTAVYYCAK (670) WGQGTLVTVSS (668) pab1979 QVQ LVQ S GAEVKK P GASVKV SCKASGYTFT (648) WVRQAPGQGLEWM G(654) RVTMTVDTSISTAYMELSLR SDDTAVYYCAK (663) WGQGTLVTVSS (668) pab1980 QVQ LVQ S GAEVKK P GASVKV SCKASGYTFT (648) WVRQAPGQGLEWM G(654) RVTMTVDTSISTAYMELSLR SDDTAVYYCAK (663) WGQGTLVTVSS (668) pab1981 QVQ LVQ S GAEVKK P GASVKV SCKASGYTFT (648) WVRQAPGQGLEWM G(654) RVTMTVDTSISTAYMELSLR SDDTAVYYCAK (663) WGQGTLVTVSS (668) pab1983 QVQ LVQ S GAEVKK P GASVKV SCKASGYTFT (648) WVRQAPGQGMEWI G(655) RVTMTVDTSISTAYMELSLR SDDTAVYYCAK (663) WGQGTLVTVSS (668) pab2159 QVQ LVQ S GAEVKK P GASVKV SCKASGYTFT (648) WVRQAPGQGLEWM G(654) RATMTVDKSISTAYMELSRLR SDDTAVYYCAK (659) WGQGTLVTVSS (668) pab2160 QVQ LVQ S GT EVKK P GASVKV SCKGSGYTFT (651) WVRQAPGQGMEWI G(655) RVTMTVDTSISTAYMELSLR SDDTAVYYCAK (663) WGQGTLVTVSS (668) pab2161 QVQ LVQ S GAEVKK P GASVKV SCKGSGYTFT (649) WVRQAPGQGLEWI G(653) RATMTVDTSISTAYMELSLR SDDTAVYYCAK (670) WGQGTLVTVSS (668) 1 QVQ LVQ S GT EVKK P GASVKV SCKGSGYTFT (651) WVRQAPGQGLEWI G(653) RATMTVDTSISTAYMELSLR SDDTAVYYCAK (670) WGQGTLVTVSS (668) 2 QVQ LVQ S GAEVKK P GASVKV SCKASGYTFT (648) WVRQAPGQGMEWI G(655) RATMTVDKSISTAYMELSRLR SDDTAVYYCAK (659) WGQGTLVTVSS (668) 4 QVQ LVQ S GAEVKK P GASVKV SCKASGYTFT (648) WVRQAPGQSLEWM G(657) RVTMTVDKSISTAYMELSRLR SDDTAVYYCAK (662) WGQGTLVTVSS (668) 5 QVQLVQS GAEVKKPGASVKV SCKGSGYTFT (649) WVRQAPGQGLEWM G(654) RVTMTVDTSISTAYMELSLR SDDTAVYYCAK (663) WGQGTLVTVSS (668) 6 QVQ LVQ S GAEVKK P GASVKV SCKGSGYTFT (649) WVRQAPGQGLEWM G(654) RATMTVDTSISTAYMELSLR SDDTAVYYCAK (670) WGQGTLVTVSS (668)

- 60 040077

9 QVQ LVQ S GAEVKK P GASVKV SCKASGYTFT (648) WVRQAPGQGLEWM G(654) RATMTVDKSISTAYMELSRLR SDDTAVYYCAK (659) WGQGTLVTVSS (668) 10 QVQ LVQ S GAEVKK P GASVKV SCKASGYTFT (648) WVRQAPGQGLEWM G(654) RVTMTVDKSISTAYMELSRLR SDDTAVYYCAK (662) WGQGTLVTVSS (668) eleven QVQ LVQ S GAEVKK P GASVKV SCKGSGYTFT (649) WVRQAPGQGLEWM G(654) RVTMTVDTSISTAYMELSLR SDDTAVYYCAK (663) WGQGTLVTVSS (668) 15 QVQ LVQ S GAEVKK P GASVKV SCKGSGYTFT (649) WVRQAPGQGLEWI G(653) RATMTVDKSISTAYMELSRLR SDDTAVYYCAK (659) WGQGTLVTVSS (668) 16 QVQ LVQ S GT EVKK P GASVKV SCKASGYTFT (650) WVRQAPGQGLEWI G(653) RVTMTVDKSISTAYMELSRLR SDDTAVYYCAK (662) WGQGTLVTVSS (668) 18 QVQ LVQ S GT EVKK P GASVKV SCKASGYTFT (650) WVRQAPGQGMEWI G(655) RVTMTVDTSISTAYMELSLR SDDTAVYYCAK (663) WGQGTLVTVSS (668) 20 QVQ LVQ S GT EVKK P GASVKV SCKASGYTFT (650) WVRQAPGQGLEWI G(653) RVTMTVDTSISTAYMELSLR SDDTAVYYCAK (663) WGQGTLVTVSS (668) 21 QVQ LVQ S GT EVKK P GASVKV SCKGSGYTFT (651) WVRQAPGQGMEWI G(655) RVTMTVDTSISTAYMELSLR SDDTAVYYCAK (663) WGQGTLVTVSS (668) 25 QVQ LVQ S GAEVKK P GASVKV SCKASGYTFT (648) WVRQAPGQGLEWM G(654) RATMTVDTSISTAYMELSLR SDDTAVYYCAK (670) WGQGTLVTVSS (668) 29 QVQ LVQ S GAEVKK P GASVKV SCKGSGYTFT (649) WVRQAPGQGLEWI G(653) RATMTVDTSISTAYMELSLR SDDTAVYYCAK (670) WGQGTLVTVSS (668) 31 QVQ LVQ S GT EVKK P GASVKV SCKGSGYTFT (651) WVRQAPGQGLEWM G(654) RVTMTVDKSISTAYMELSRLR SDDTAVYYCAK (662) WGQGIPVTVSS (664) 33 QVQ LVQ S GAEVKK P GASVKV SCKASGYTFT (648) WVRQAPGQGMEWI G(655) RVTMTVDTSISTAYMELSLR SDDTAVYYCAK (663) WGQGTLVTVSS (668) 34 QVQ LVQ S GAEVKK P GASVKV SCKASGYTFT (648) WVRQAPGQGMEWI G(655) RVTMTVDTSISTAYMELSLR SDDTAVYYCAK (663) WGQGTLVTVSS (668) 35 QVQ LVQ S GAEAKK P GASVKV SCKGSGYTFT (646) WVRQAPGQGMEWI G(655) RVTMTVDTSISTAYMELSLR SDDTAVYYCAK (663) WGQGTLVTVSS (668) 36 QVQ LVQ S GAEVKK P GASVKV SCKGSGYTFT (649) WVRQAPGQGMEWI G(655) RVTMTVDKSISTAYMELSRLR SDDTAVYYCAK (662) WGQGTLVTVSS (668) 37 QVQ LVQ S GT EVKK P GASVKV SCKGSGYTFT (651) WVRQAPGQGMEWI G(655) RVTMTVDTSISTAYMELSLR SDDTAVYYCAK (663) WGQGTLVTVSS (668) 38 QVQ LVQ S GT EVKK P GASVKV SCKGSGYTFT (651) WVRQAPGQGLEWI G(653) RVTMTVDKSISTAYMELSRLR SDDTAVYYCAK (662) WGQGTLVTVSS (668) 39 QVQ LVQ S GAEVKK P GASVKV SCKGSGYTFT (649) WVRQAPGQGLEWM G(654) RATMTVDTSISTAYMELSLR SDDTAVYYCAK (670) WGQGTLITVSS (667) 42 QVQ LVQ S GT EVKK P GASVKV SCKASGYTFT (650) WVRQAPGQGLEWI G(653) RVTMTVDTSISTAYMELSLR SDDTAVYYCAK (663) WGQGTLVTVSS (668) 43 QVQ LVQ S GAEVKK P GASVKV SCKGSGYTFT (649) WVRQAPGQGMEWI G(655) RATMTVDKSISTAYMELSRLR SDDTAVYYCAK (659) WGQGTLVTVSS (668) 45 QVQLVQS GAEVKKPGASVKV SCKGSGYTFT (649) WVRQAPGQGLEWI G(653) RVTMTVDTSISTAYMELSLR SDDTAVYYCAK (663) WGQGTFVTVSS (665) 46 QVQ LVQ S GAEVKK P GASVKV SCKASGYTFT (648) WVRQAPGQGLEWM G(654) RVTMTVDTSISTAYMELSLR SDDTAVYYCAK (663) WGQGTLVTVSS (668)

- 61 040077

47 QVQ LVQ S GAEVKK P GASVKV SCKASGYTFT (648) WVRQAPGQGMEWM G(656) RVTMTVDKSISTAYMELSRLR SDDTAVYYCAK (662) WGQGTLVTVSS (668) 49 QVQ LVQ S GT EVKK P GASVKV SCKGSGYTFT (651) WVRQAPGQGLEWM G(654) RATMTVDTSISTAYMELSLR SDDTAVYYCAK (670) WGQGTLVTVSS (668) 50 QVQ LVQ S GT EVKK P GASVKV SCKASGYTFT (650) WVRQAPGQGLEWI G(653) RVTMTVDKSISTAYMELSRLR SDDTAVYYCAK (662) WGQGTLVTVSS (668) 52 QVQ LVQ S GT EVKK P GASVKV SCKGSGYTFT (651) WVRQAPGQGLEWM G(654) RVTMTVDKSISTAYMELSRLR SDDTAVYYCAK (662) WGQGTLVTVSS (668) 54 QVQ LVQ S GAEVKK P GASVKV SCKASGYTFT (648) WVRQAPGQGLEWM G(654) RATMTVDTSISTAYMELSLR SDDTAVYYCAK (670) WGQGTLVTVSS (668) 55 QVQ LVQ S GT EVKK P GASVKV SCKASGYTFT (650) WVRQAPGQGLEWI G(653) RVTMTVDTSISTAYMELSLR SDDTAVYYCAK (663) WGQGTLVTVSS (668) 58 QVQ LVQ S GAEVKK P GASVKV SCKGSGYTFT (649) WVRQAPGQGLEWM G(654) RATMTVDKSISTAYMELSRLR SDDTAVYYCAK (659) WGQGTLVTVSS (668) 59 QVQ LVQ S GAEVKK P GASVKV SCKASGYTFT (648) WVRQAPGQGLEWM G(654) RVTMTVDKSISTAYMELSRLR SDDTAVYYCAK (662) WGQGTLVTVSS (668) 61 QVQ LVQ S GT EVKK P GASVKV SCKASGYTFT (650) WVRQAPGQGLEWM G(654) RVTMTVDKSISTAYMELSRLR SDDTAVYYCAK (662) WGQGTLVTVSS (668) 68 QVQ LVQ S GT EVKK P GASVKV SCKGSGYTFT (651) WVRQAPGQGLEWI G(653) RVTMTVDTSISTAYMELSLR SDDTAVYYCAK (663) WGQGTLVTVSS (668) 70 QVQLVQ S GT EVKK P GASVKV SCKASGYTFT (650) WVRQAPGQGMEWI G(655) RATMTVDTSISTAYMELSLR SDDTAVYYCAK (670) WGQGTLVTVSS (668) 71 QVQ LVQ S GAEVKK P GASVKV SCKASGYTFT (648) WVRQAPGQGMEWM G(656) RATMTVDTSISTAYMELSLR SDDTAVYYCAK (670) WGQGTLVTVSS (668) 75 QVQ LVQ S GT EVKK P GASVKV SCKGSGYTFT (651) WVRQAPGQGLEWI G(653) RVTMTVDKSISTAYMELSRLR SDDTAVYYCAK (662) WGQGTLVTVSS (668) 76 QVQ LVQ S GAGVKK P GASVKV SCKGSGYTFT (644) WVRQAPGQGLEWM G(654) RATMTVDKSISTAYMELSRLR SDDTAVYYCAK (659) WGQGTLVTVSS (668) 78 QVQ LVQ S GAEVKK P GASVKV SCKGSGYTFT (649) WVRQAPGQGLEWI G(653) RATMTVDTSISTAYMELSLR GDDTAVYYCAK (661) WGRGTLVTVSS (669) 79 QVQ LVQ S GT EVKK P GASVKV SCKGSGYTFT (651) WVRQAPGQGMEWM G(656) RVTMTVDKSISTAYMELSRLR SDDTAVYYCAK (662) WGQGTLVTVSS (668) 80 QVQ LVQ S GT EVKK P GASVKV SCKASGYTFT (650) WVRQAPGQGMEWM G(656) RVTMTVDTSISTAYMELSLR SDDTAVYYCAK (663) WGQGTLVTVSS (668) 85 QVQ LVQ S GAEVKK P GASVKV SCKASGYTFT (648) WVRQAPGQGLEWM G(654) RATMTVDTSISTAYMELSLR SDDTAVYYCAK (670) WGQGTLVTVSS (668) 86 QVQ LVQ S GAEVKK P GASVKV SCKGSGYTFT (649) WVRQAPGQGMEWM G(656) RATMTVDTSISTAYMELSLR SDDTAVYYCAK (670) WGQGTLVTVSS (668) 91 QVQ LVQ S GT EVKK P GASVKV SCKGSGYTFT (651) WVRQAPGQGMEWM G(656) RATMTVDTSISTAYMELSLR SDDTAVYYCAK (670) WGQGTLVTVSS (668) 92 QVQLVQS GAEVKKPGASVKV SCKGSGYTFT (649) WVRQAPGQGLEWM G(654) RATMTVDTSISTAYMELSRLQ SDDTAVYYCAK (660) WGQGTLVTVSS (668) 94 QVQ LVQ S GT EVKK P GASVKV SCKGSGYTFT (651) WVRQAPGQGLEWI G(653) RVTMTVDKSISTAYMELSRLR SDDTAVYYCAK (662) WGQGTFVTVSS (666)

- 62 040077

95 QVQ LVQ S GAEVKK P GASVKV SCKGSGYTFT (649) WVRQAPGQGLEWM G(654) RVTMTVDTSISTAYMELSLR SDDTAVYYCAK (663) WGQGTFVTVSS (666) 96 QVQ LVQ S GAEVKK P GASVKV SCKGSGYTFT (649) WVRQAPGQGMEWM G(656) RVTMTVDTSISTAYMELSLR SDDTAVYYCAK (663) WGQGTLVTVSS (668) 97 QVQ LVQ S GT EVKK P GASVKV SCKGSGYTFT (651) WVRQAPGQGMEWI G(655) RVTMTVDKSISTAYMELSRLR SDDTAVYYCAK (662) WGQGTLVTVSS (668) 101 QVQ LVQ S GAEVKK P GASVKV SCKASGYTFT (648) WVRQAPGQGLEWM G(654) RVTMTVDKSISTAYMELSRLR SDDTAVYYCAK (662) WGQGTLVTVSS (668) 102 QVQ LVQ S GT EVKK P GASVKV SCKASGYTFT (650) WVRQAPGQGLEWI G(653) RVTMTVDTSISTAYMELSLR SDDTAVYYCAK (663) WGQGTLVTVSS (668) 105 QVQ LVQ S GAEVKK P GASVKV SCKGSGYTFT (649) WVRQAPGQGLEWM G(654) RVTMTVDTSISTAYMELSLR SDDTAVYYCAK (663) WGQGTLVTVSS (668) 107 QVQ LVQ S GAEVKK P GASVKV SCKGSGYTFT (649) WVRQAPGQGLEWM G(654) RVTMTVDTSISTAYMELSLR SDDTAVYYCAK (663) WGQGTLVTVSS (668)

⁴ Described in Table. 8, the VH framework regions are defined based on the boundaries for the CDRs according to the Kabat numbering system. In other words, VH CDRs are defined by Kabat and framework regions represent the amino acid residues surrounding the CDRs in the variable region, in the format FR1, CDR1, FR2, CDR2, FR3, CDR3 and FR4.

In another embodiment, an antibody described herein, or an antigen-binding fragment thereof, that specifically binds to GITR (eg, human GITR) comprises:

(a) a VL CDR1 comprising, consisting of, or predominantly consisting of the amino acid sequence KSSQSX1X ₂ X ₃ X ₄ X ₅ X ₆ X ₇ KX ₈ YLX9 (SEQ ID NO: 4), where

X1 is L, A, V, I, P, F or M;

X ₂ is L, A, V, I, P, F, M, or S;

X ₃ is N, G, Q, S, T, C, W, Y, or A;

X ₄ is S, G, N, Q, T, C, W, Y, or A;

X ₅ is G, N, Q, S, T, C, W, Y, or A;

X ₆ is N, G, Q, S, T, C, W, Y, or A;

X ₇ is Q, G, N, S, T, C, W, Y, or A;

X ₈ is N, G, Q, S, T, C, W, Y, or A;

X9 is T, G, N, Q, S, C, W, Y, V, I, or A; and/or (b) a VL CDR2 containing, consisting of, or predominantly consisting of the amino acid sequence X1ASTRX ₂ X ₃ (SEQ ID NO: 5), where

X1 is W, G, N, Q, S, T, C, Y, F, H, or A;

X ₂ represents E, D or A;

X ₃ represents S, G, N, Q, T, C, W, Y or A; and/or (c) a VL CDR3 comprising, consisting of, or predominantly consisting of the amino acid sequence QX1X ₂ YX ₃ X ₄ PYT (SEQ ID NO: 6), where

X1 is N, G, Q, S, T, C, W or Y;

X ₂ represents D, E or Y;

X ₃ represents S, G, N, Q, T, C, W, Y or A;

X ₄ is Y, G, N, Q, S, T, C, W, F, H, L, or A; and/or (d) a VH CDR1 comprising, consisting of, or predominantly consisting of the amino acid sequence X1YX ₂ MX ₃ (SEQ ID NO: 1) wherein

X1 is D, E, G or A;

X ₂ is A, V, L, I, P, F, M, or Y;

X ₃ represents Y, G, N, Q, S, T, C, W, F or H; and/or (e) a VH CDR2 comprising, consisting of, or predominantly consisting of the amino acid sequence X1IX2X3X4SGX5X6X7YX8QKFX9X10 (SEQ ID NO: 2), wherein

X1 is V, A, L, I, P, F, M or T;

X2 is R, K, H, Q or A;

X ₃ is T, G, N, Q, S, C, W, Y, V, I, or P;

X ₄ is Y, G, N, Q, S, T, C, W, F, H, or A;

X ₅ is D, E, G or A;

X ₆ is V, A, L, I, P, F, M or T;

X7 is T, G, N, Q, S, C, W, Y, V, I, P, or A;

X ₈ is N, G, Q, S, T, C, W, Y, or A;

X ₉ is K, R, H, Q or A;

X10 is D, E, G or A; and/or

- 63 040077 (f) VH CDR3 containing, consisting or predominantly consisting of the amino acid sequence SGTVRGX1X2X3 (SEQ ID NO: 3), in which

X1 is F, A, V, L, I, P, M, Y, W, H, or S;

X2 is A or D;

X ₃ is Y, G, N, Q, S, T, C, W, F, H, or V.

In specific embodiments, the antibody or antigen-binding fragment thereof contains one, two, three, four, five, or all six of the above CDRs. In certain embodiments of the invention, the antibody or antigennegative fragment contains VL CDR1 of one of the antibodies from table. 1. In some embodiments of the invention, the antibody or antigennegative fragment contains VL CDR2 of one of the antibodies from table. 1. In certain embodiments of the invention, the antibody or antigennegative fragment contains VL CDR3 of one of the antibodies from table. 1. In some embodiments of the invention, the antibody or antigennegative fragment contains VH CDR1 of one of the antibodies from table. 2. In some embodiments of the invention, the antibody or antigennegative fragment contains VH CDR2 of one of the antibodies from table. 2. In certain embodiments of the invention, the antibody or antigennegative fragment contains VH CDR3 of one of the antibodies from table. 2. In some embodiments of the invention, the antibody or its antigen-binding fragment contains one, two or all three VH CDRs of one of the antibodies from table. 2 (eg VH CDRs from one row in Table 2, eg all VH CDRs of antibody 231-32-15). In certain embodiments of the invention, the antibody or its antigen-binding fragment contains one, two or all three VL CDRs of one of the antibodies from table. 1 (eg VL CDRs from one row in Table 1, eg all VL CDRs of antibody 231-32-15).

In another embodiment, an antibody described herein, or an antigen-binding fragment thereof, that specifically binds to GITR (e.g., human GITR) comprises a light chain variable region (VL) and a heavy chain variable region (VH), wherein (i) VL contains:

(a) a VL CDR1 comprising, consisting of, or predominantly consisting of the amino acid sequence KSSQSX1X ₂ X ₃ X ₄ X ₅ X ₆ X ₇ KX ₈ YLX ₉ (SEQ ID NO: 4), where

X1 is L, A, V, I, P, F or M;

X ₂ is L, A, V, I, P, F, M, or S;

X ₃ is N, G, Q, S, T, C, W, Y, or A;

X ₄ is S, G, N, Q, T, C, W, Y, or A;

X ₅ is G, N, Q, S, T, C, W, Y, or A;

X6 is N, G, Q, S, T, C, W, Y, or A;

X7 is Q, G, N, S, T, C, W, Y, or A;

X ₈ is N, G, Q, S, T, C, W, Y, or A;

X9 is T, G, N, Q, S, C, W, Y, V, I, or A; and/or (b) a VL CDR2 comprising, consisting of, or predominantly consisting of the amino acid sequence X1ASTRX2X3 (SEQ ID NO: 5), where

X ₁ is W, G, N, Q, S, T, C, Y, F, H, or A;

X ₂ represents E, D or A;

X ₃ represents S, G, N, Q, T, C, W, Y or A; and/or (c) a VL CDR3 comprising, consisting of, or predominantly consisting of the amino acid sequence QX1X2YX3X4PYT (SEQ ID NO: 6), where X1 is N, G, Q, S, T, C, W, or Y;

X2 is D, E or Y;

X3 is S, G, N, Q, T, C, W, Y, or A;

X4 is Y, G, N, Q, S, T, C, W, F, H, L, or A; and (ii) VH contains:

(a) a VH CDR1 containing, consisting of, or predominantly consisting of the amino acid sequence X1YX2MX3 (SEQ ID NO: 1) wherein

X ₁ is D, E, G or A;

X ₂ is A, V, L, I, P, F, M, or Y;

X ₃ represents Y, G, N, Q, S, T, C, W, F or H; and/or (b) a VH CDR2 comprising, consisting of, or predominantly consisting of the amino acid sequence X1IX2X3X4SGX5X6X7YX8QKFX9X10 (SEQ ID NO: 2), wherein

X1 is V, A, L, I, P, F, M or T;

X2 is R, K, H, Q or A;

X ₃ is T, G, N, Q, S, C, W, Y, V, I, or P;

X4 is Y, G, N, Q, S, T, C, W, F, H, or A;

X ₅ is D, E, G or A;

X ₆ is V, A, L, I, P, F, M or T;

X ₇ is T, G, N, Q, S, C, W, Y, V, I, P, or A;

- 64 040077

X ₈ is N, G, Q, S, T, C, W, Y, or A;

X9 is K, R, H, Q or A;

X ₁₀ is D, E, G or A; and/or (c) a VH CDR3 comprising, consisting of, or predominantly consisting of the amino acid sequence SGTVRGX1X2X3 (SEQ ID NO: 3) wherein

X1 is F, A, V, L, I, P, M, Y, W, H, or S;

X ₂ is A or D;

X ₃ is Y, G, N, Q, S, T, C, W, F, H, or V.

In particular embodiments, the VL contains one, two, or all three of the above VL CDRs and/or the VH contains one, two, or all three of the above VH CDRs. In certain embodiments of the invention, the antibody or antigennegative fragment contains VL CDR1 of one of the antibodies from table. 1. In some embodiments of the invention, the antibody or antigennegative fragment contains VL CDR2 of one of the antibodies from table. 1. In certain embodiments of the invention, the antibody or antigennegative fragment contains VL CDR3 of one of the antibodies from table. 1. In some embodiments of the invention, the antibody or antigennegative fragment contains VH CDR1 of one of the antibodies from table. 2. In some embodiments of the invention, the antibody or antigennegative fragment contains VH CDR2 of one of the antibodies from table. 2. In certain embodiments of the invention, the antibody or antigennegative fragment contains VH CDR3 of one of the antibodies from table. 2. In some embodiments of the invention, the antibody or its antigen-binding fragment contains one, two or all three VH CDRs of one of the antibodies from table. 2 (eg VH CDR from one row in Table 2). In certain embodiments of the invention, the antibody or its antigen-binding fragment contains one, two or all three VL CDRs of one of the antibodies from table. 1 (for example, VL CDR from one row in Table 1). In another embodiment, an antibody or fragment thereof described herein that specifically binds to GITR (e.g., human GITR) comprises a light chain variable region (VL) comprising:

(a) a VL CDR1 comprising, consisting of, or predominantly consisting of the amino acid sequence KSSQSLLNSX1NQKNYLX2 (SEQ ID NO: 10) wherein

X ₁ is G or S;

X ₂ represents T or S; and/or (b) a VL CDR2 comprising, consisting of, or predominantly consisting of the amino acid sequence WASTRES (SEQ ID NO: 11); and/or (c) a VL CDR3 comprising, consisting of, or predominantly consisting of the amino acid sequence QNX1YSX2PYT (SEQ ID NO: 12) wherein

X1 is D or E;

X2 is Y, F or S.

In specific embodiments, the antibody or antigen-binding fragment thereof contains one, two, or all three of the above VL CDRs. In certain embodiments of the invention, the antibody or antigennegative fragment contains VL CDR1 of one of the antibodies from table. 1. In some embodiments of the invention, the antibody or antigennegative fragment contains VL CDR2 of one of the antibodies from table. 1. In certain embodiments of the invention, the antibody or antigennegative fragment contains VL CDR3 of one of the antibodies from table. 1. In certain embodiments of the invention, the antibody or its antigen-binding fragment contains one, two or all three VL CDRs of one of the antibodies from table. 1 (for example, VL CDR from one row in Table 1). In some embodiments, the antibody or antigen-binding fragment thereof contains the VL framework regions described herein. In specific embodiments of the invention, the antibody or its antigen-binding fragment contains the VL framework (FR) of the antibody shown in table. 3 (for example, one, two, three, or four frame regions from one row in Table 3).

In another embodiment, an antibody or fragment thereof described herein that specifically binds to GITR (e.g., human GITR) comprises a heavy chain variable region (VH) comprising:

(a) a VH CDR1 containing, consisting of, or predominantly consisting of the amino acid sequence X1YX2MX3 (SEQ ID NO: 7) wherein

X1 is D, E or G;

X2 is A or V;

X3 is Y or H; and/or (b) a VH CDR2 comprising, consisting of, or predominantly consisting of the amino acid sequence X ₁ IX ₂ TX ₃ SGX ₄ X ₅ X ₆ YNQKFX ₇ X ₈ (SEQ ID NO: 8), wherein

X1 is V or L;

X ₂ represents R, K or Q;

X ₃ is Y or F;

- 65 040077

X ₄ is D, E or G;

X ₅ is V or L;

X ₆ is T or S;

X ₇ is K, R or Q;

X ₈ is D, E or G; and/or (c) a VH CDR3 containing, consisting of, or predominantly consisting of the amino acid sequence SGTVRGFAY (SEQ ID NO: 9).

In specific embodiments, the antibody or antigen-binding fragment thereof contains one, two, or all three of the above VH CDRs. In certain embodiments of the invention, the antibody or antigennegative fragment contains VH CDR1 of one of the antibodies from table. 2. In some embodiments of the invention, the antibody or antigennegative fragment contains VH CDR2 of one of the antibodies from table. 2. In certain embodiments of the invention, the antibody or antigennegative fragment contains VH CDR3 of one of the antibodies from table. 2. In some embodiments of the invention, the antibody or its antigen-binding fragment contains one, two or all three VH CDRs of one of the antibodies from table. 2 (eg VH CDR from one row in Table 2). In some embodiments of the invention, the antibody or its antigen-binding fragment contains one, two or all three VH CDRs of one of the antibodies from table. 2. In some embodiments, the antibody or antigen-binding fragment thereof comprises the VH framework regions described herein. In specific embodiments of the invention, the antibody or its antigennegative fragment contains the VH frame regions of the antibody shown in table. 4 (for example, one, two, three, or four frame regions from one row in Table 4).

In a particular embodiment, an antibody described herein, or an antigen-binding fragment thereof, that specifically binds to GITR (eg, human GITR) contains:

(a) a VL CDR1 comprising, consisting of, or predominantly consisting of the amino acid sequence KSSQSLLNSX1NQKNYLX2 (SEQ ID NO: 10) wherein

X1 is G or S;

X ₂ is T or S; and/or (b) a VL CDR2 comprising, consisting of, or predominantly consisting of the amino acid sequence WASTRES (SEQ ID NO: 11); and/or (c) a VL CDR3 comprising, consisting of, or predominantly consisting of the amino acid sequence QNX1YSX2PYT (SEQ ID NO: 12) wherein

X ₁ is D or E;

X2 is Y, F or S.

(d) a VH CDR1 comprising, consisting of, or predominantly consisting of the amino acid sequence X1YX2MX3 (SEQ ID NO: 7) wherein

X1 is D, E or G;

X ₂ is A or V;

X ₃ represents Y or H; and/or (e) a VH CDR2 comprising, consisting of, or predominantly consisting of the amino acid sequence X1IX ₂ TX ₃ SGX ₄ X ₅ X ₆ YNQKFX ₇ X ₈ (SEQ ID NO: 8), wherein

X1 is V or L;

X2 is R, K or Q;

X3 is Y or F;

X4 is D, E or G;

X ₅ is V or L;

X6 is T or S;

X7 is K, R or Q;

X ₈ is D, E or G; and/or (f) a VH CDR3 comprising, consisting of, or predominantly consisting of the amino acid sequence SGTVRGFAY (SEQ ID NO: 9).

In specific embodiments, the antibody or antigen-binding fragment thereof contains one, two, three, four, five, or all six of the above CDRs. In certain embodiments of the invention, the antibody or antigennegative fragment contains VL CDR1 of one of the antibodies from table. 1. In some embodiments of the invention, the antibody or antigennegative fragment contains VL CDR2 of one of the antibodies from table. 1. In certain embodiments of the invention, the antibody or its antigen-binding fragment contains VL CDR3 of one of the antibodies from table. 1. In some embodiments of the invention, the antibody or antigennegative fragment contains VH CDR1 of one of the antibodies from table. 2.

In some embodiments of the invention, the antibody or antigennegative fragment contains VH CDR2 of one of the antibodies from table. 2. In certain embodiments of the invention, the antibody or antigennegative fragment contains VH CDR3 of one of the antibodies from table. 2. In

- 66 040077 some embodiments of the invention, the antibody or antigennegative fragment contains one, two or all three VH CDR of one of the antibodies from the table. 2 (eg VH CDR from one row in Table 2). In certain embodiments of the invention, the antibody or its antigen-binding fragment contains one, two or all three VL CDRs of one of the antibodies from table. 1 (for example, VL CDR from one row in Table 1).

In a particular embodiment, an antibody or fragment thereof described herein that specifically binds to GITR (e.g., human GITR) comprises a light chain variable region (VL) and a heavy chain variable region (VH), wherein (i) VL comprises :

(a) a VL CDR1 comprising, consisting of, or predominantly consisting of the amino acid sequence KSSQSLLNSX1NQKNYLX ₂ (SEQ ID NO: 10) wherein

X ₁ is G or S;

X ₂ represents T or S; and/or (b) a VL CDR2 comprising, consisting of, or predominantly consisting of the amino acid sequence WASTRES (SEQ ID NO: 11); and/or (c) a VL CDR3 comprising, consisting of, or predominantly consisting of the amino acid sequence QNX ₁ YSX ₂ PYT (SEQ ID NO: 12), wherein

X ₁ is D or E;

X ₂ represents Y, F or S; and (ii) VH contains:

(a) a VH CDR1 comprising, consisting of, or predominantly consisting of the amino acid sequence X ₁ YX ₂ MX ₃ (SEQ ID NO: 7) wherein

X1 is D, E or G;

X ₂ is A or V;

X ₃ represents Y or H; and/or (b) a VH CDR2 comprising, consisting of, or predominantly consisting of the amino acid sequence X ₁ IX ₂ TX ₃ SGX ₄ X ₅ X ₆ YNQKFX ₇ X ₈ (SEQ ID NO: 8), wherein

X ₁ is V or L;

X ₂ represents R, K or Q;

X ₃ is Y or F;

X ₄ is D, E or G;

X ₅ is V or L;

X6 is T or S;

X ₇ is K, R or Q;

X8 is D, E or G; and/or (c) a VH CDR3 comprising, consisting of, or predominantly consisting of the amino acid sequence SGTVRGFAY (SEQ ID NO: 9).

In particular embodiments, the VL contains one, two, or all three of the above VL CDRs and/or the VH contains one, two, or all three of the above VH CDRs. In certain embodiments of the invention, the antibody or antigennegative fragment contains VL CDR1 of one of the antibodies from table. 1. In some embodiments of the invention, the antibody or antigennegative fragment contains VL CDR2 of one of the antibodies from table. 1. In certain embodiments of the invention, the antibody or antigennegative fragment contains VL CDR3 of one of the antibodies from table. 1. In some embodiments of the invention, the antibody or antigennegative fragment contains VH CDR1 of one of the antibodies from table. 2. In some embodiments of the invention, the antibody or antigennegative fragment contains VH CDR2 of one of the antibodies from table. 2. In certain embodiments of the invention, the antibody or antigennegative fragment contains VH CDR3 of one of the antibodies from table. 2. In some embodiments of the invention, the antibody or its antigen-binding fragment contains one, two or all three VH CDRs of one of the antibodies from table. 2 (eg VH CDR from one row in Table 2). In certain embodiments of the invention, the antibody or its antigen-binding fragment contains one, two or all three VL CDRs of one of the antibodies from table. 1 (for example, VL CDR from one row in Table 1). In a particular embodiment, an antibody or fragment thereof described herein that specifically binds to GITR (e.g., human GITR) comprises a light chain variable region (VL) and a heavy chain variable region (VH), wherein (i) VL comprises :

(a) a VL CDR1 comprising, consisting of, or predominantly consisting of the amino acid sequence KSSQSLLNSX ₁ NQKNYLX2 (SEQ ID NO: 10) wherein

X1 is G or S;

X2 is T or S; and/or (b) a VL CDR2 comprising, consisting of, or predominantly consisting of the amino acid sequence WASTRES (SEQ ID NO: 11); and/or

- 67 040077 (c) VL CDR3, containing, consisting or predominantly consisting of the amino acid sequence QNX1YSX2PYT (SEQ ID NO: 12), in which

X ₁ is D or E;

X ₂ represents Y, F or S; and (ii) VH contains:

(a) a VH CDR1 comprising, consisting of, or predominantly consisting of the amino acid sequence X1YX ₂ MX ₃ (SEQ ID NO: 7) wherein

X ₁ is D, E or G;

X ₂ is A or V;

X ₃ represents Y or H; and/or (b) a VH CDR2 comprising, consisting of, or predominantly consisting of the amino acid sequence X ₁ IX ₂ TX ₃ SGX ₄ X ₅ X ₆ YNQKFX ₇ X ₈ (SEQ ID NO: 8), wherein

X1 is V or L;

X2 is R, K or Q;

X ₃ is Y or F;

X ₄ is D, E or G;

X5 is V or L;

X ₆ is T or S;

X ₇ is K, R or Q;

X ₈ is D, E or G; and/or (c) a VH CDR3 comprising, consisting of, or predominantly consisting of the amino acid sequence SGTVRGX1X ₂ X ₃ (SEQ ID NO: 3), wherein X ₁ is F, A, V, L, I, P, M, Y, W, H or S;

X2 is A or D;

X ₃ is Y, G, N, Q, S, T, C, W, F, H, or V.

In certain embodiments, provided herein is an antibody, or fragment thereof, that specifically binds to GITR (e.g., human GITR) and contains one, two, or three of the antibody light chain variable region (VL) hypervariable regions (CDRs) of Table 1. 1 (for example, VL CDR from one row in Table 1). In some embodiments, provided herein is an antibody or fragment thereof that specifically binds to GITR (e.g., human GITR) and contains one, two, or three heavy chain variable region (VH) CDRs of any of the antibodies in Table. 2 (eg VH CDR from one row in Table 2).

In certain embodiments of the invention, provided herein is an antibody or fragment thereof that specifically binds to GITR (e.g., human GITR) and contains a light chain variable region (VL) containing one, two, or all three VL CDRs of the antibody from Table. 1 (for example, VL CDR from one row in Table 1). In some embodiments, the antibody or antigen-binding fragment thereof contains one, two, three, or all four VL framework regions described herein. In specific embodiments of the invention, the antibody or its antigen-binding fragment contains one, two, three or all four VL framework regions (FR) shown in table. 3 (for example, one, two, three, or four frame regions from one row in Table 3).

In certain embodiments of the invention, provided herein is an antibody or fragment thereof that specifically binds to GITR (e.g., human GITR) and contains a light chain variable region (VH) containing one, two, or all three VH CDRs of the antibody from Table. 2 (eg VH CDR from one row in Table 2). In some embodiments, the antibody or antigen-binding fragment thereof contains one, two, three, or all four VH framework regions described herein. In specific embodiments of the invention, the antibody or its antigen-binding fragment contains one, two, three or all four VH frame regions (FR) shown in table. 4 (for example, one, two, three, or four frame regions from one row in Table 4).

In certain embodiments, provided herein is an antibody or fragment thereof that specifically binds to GITR (e.g., human GITR) and contains a light chain variable region (VL) CDR, a heavy chain variable region (VH) CDR of any of the Hum231#2 antibodies, pab1964, pab1965, pab1966, pab1967, pab1968, pab1969, pab1970, pab1971, pab1972, pab1973, pab1975, pab1976, pab1977, pab1979, pab1980, pab1981, pab1983, Hum231-1, or antibodies antibodies pab2159, pab2160 or pab2161, for example, are given in table. 1 and 2 (for example, VH CDR and VL CDR from the same row belong to the same antibody, whose name is indicated in the first column of Tables 1 and 2, for example, VL CDR and VH CDR in the first row of Tables 1 and 2, respectively, belong to antibody 231 -32-15). In some embodiments, the antibody or antigen-binding fragment thereof comprises the VL framework regions and the VH framework regions described herein. In specific embodiments of the invention, the antibody or its antigennegative fragment contains the frame region (FR) VL and frame region VH, shown in table. 3 and 4 (for example, VL FR and VH FR belong to the same antibody).

In a particular embodiment, the antibody described herein, or

- 68 040077 antigennegative fragment that specifically binds to GITR (for example, human GITR), contains a light chain variable region (VL) containing VL CDR1, VL CDR2 and VL CDR3 shown in table. 1, for example VL CDR1, VL CDR2 and VL CDR3 of any of the antibodies Hum231#2, pab1964, pab1965, pab1966, pab1967, pab1968, pab1969, pab1970, pab1971, pab1972, pab1973, pab1975, pab1976, pab1978, pab1978, pab1978 pab1983, Hum231#1, 231-32-15 or antibody 1-107 or antibody pab2159, pab2160 or pab2161 (e.g. VL CDR from one row of Table 1). In some embodiments of the invention, the antibody or its antigen-binding fragment contains the framework region of the VL antibodies shown in table. 3 (for example, one, two, three, or four frame regions from one row in Table 3). In certain embodiments, the antibody or antigen-binding fragment thereof comprises a light chain variable region sequence comprising one, two, three, or four framework regions of the light chain variable region sequence of SEQ ID NO: 204 or SEQ ID NO: 205. In some embodiments, the antibody or an antigen-binding fragment thereof contains one, two, three, or four framework regions of a light chain variable region sequence that are at least 75%, 80, 85, 90, 95, or 100% identical to one, two, three, or four framework regions of the variable region sequence light chain selected from the group consisting of SEQ ID NO: 202, SEQ ID NO: 207, SEQ ID NO: 208 and SEQ ID NO: 400-518. In some embodiments, the antibody, or antigen-binding fragment thereof, comprises one, two, three, or four light chain variable region sequence framework regions that are at least 75%, 80%, 85%, 90%, 95%, or 100% identical to one, two, three, or four framework regions of the light chain variable region sequence of SEQ ID NO: 519. In certain embodiments, the antibody or antigen-binding fragment thereof comprises a light chain variable region framework that is or derived from an amino acid sequence encoded by the human gene, wherein the amino acid sequence is selected from the group consisting of IGKV4-1*01 (SEQ ID NO: 607) and IGKV3-7*02 (SEQ ID NO: 608). In particular embodiments, a light chain variable region framework that is derived from said amino acid sequence consists of said amino acid sequence minus up to 10 amino acid substitutions, deletions and/or insertions, preferably up to 10 amino acid substitutions. In a specific embodiment, the light chain variable region framework that is derived from the specified amino acid sequence consists of the specified amino acid sequence with 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acid residues replaced by an amino acid, located in a similar position in the corresponding non-human framework region of the variable region of the light chain. In some embodiments, the antibody or antigen-binding fragment thereof comprises a light chain variable region framework that is derived from the amino acid sequence of SEQ ID NO: 607 or SEQ ID NO: 608, with at least one amino acid in the amino acid sequence of SEQ ID NO: 607 or SEQ ID NO: 608 is substituted with an amino acid at the same position in the corresponding non-human light chain variable region framework. In a specific embodiment of the invention, the amino acid substitution is at amino acid position 87, with the amino acid position indicated according to Kabat numbering. In specific embodiments of the invention, the amino acid substitution is 87H, with the amino acid position indicated according to Kabat numbering.

In a particular embodiment, an antibody or fragment thereof described herein that specifically binds to GITR (e.g., human GITR) comprises VL CDR1, VL CDR2, and VL CDR3 from Hum231#1, e.g., VL CDR1, VL CDR2, and VL CDR3 from Hum231#1, given in table. 1 (SEQ ID NOs: 16, 17 and 18, respectively). In certain embodiments, the antibody or antigen-binding fragment thereof further comprises one, two, three, or all four VL framework regions derived from a human or primate VL antibody. In particular embodiments, the antibody, or antigen-binding fragment thereof, further comprises one, two, three, or all four VL framework regions derived from the human kappa light chain variable region subfamily. In some embodiments of the invention, the antibody or its antigennegative fragment contains the framework region of the VL antibodies shown in table. 3 (for example, Hum231#1 wireframes).

In a particular embodiment, an antibody or fragment thereof described herein that specifically binds to GITR (e.g., human GITR) comprises VL CDR1, VL CDR2, and VL CDR3 from Hum231#2, e.g., VL CDR1, VL CDR2, and VL CDR3 from Hum231#2, given in table. 1 (SEQ ID NOs: 16, 17 and 18, respectively). In certain embodiments, the antibody or antigen-binding fragment thereof further comprises one, two, three, or all four VL framework regions derived from a human or primate VL antibody. In particular embodiments, the antibody, or antigen-binding fragment thereof, further comprises one, two, three, or all four VL framework regions derived from the human kappa light chain variable region subfamily. In some embodiments of the invention, the antibody or its antigennegative fragment contains the framework region of the VL antibodies shown in table. 3

- 69 040077 (eg Hum231#2 wireframes).

In a particular embodiment, an antibody or fragment thereof described herein that specifically binds to GITR (e.g., human GITR) comprises VL CDR1, VL CDR2, and VL CDR3 from pab1964, e.g., VL CDR1, VL CDR2, and VL CDR3 from pab1964, given in table. 1 (SEQ ID NOs: 101, 105 and 106, respectively). In certain embodiments, the antibody or antigen-binding fragment thereof further comprises one, two, three, or all four VL framework regions derived from a human or primate VL antibody. In particular embodiments, the antibody, or antigen-binding fragment thereof, further comprises one, two, three, or all four VL framework regions derived from the human kappa light chain variable region subfamily. In some embodiments of the invention, the antibody or its antigennegative fragment contains the framework region of the VL antibodies shown in table. 3 (e.g. pab1964 frame regions).

In a particular embodiment, an antibody or fragment thereof described herein that specifically binds to GITR (e.g., human GITR) comprises VL CDR1, VL CDR2, and VL CDR3 from pab1965 A, e.g., VL CDR1, VL CDR2, and VL CDR3 from pab1965 given in Table. 1 (SEQ ID NOs: 102, 105 and 107, respectively). In certain embodiments, the antibody or antigen-binding fragment thereof further comprises one, two, three, or all four VL framework regions derived from a human or primate VL antibody. In particular embodiments, the antibody, or antigen-binding fragment thereof, further comprises one, two, three, or all four VL framework regions derived from the human kappa light chain variable region subfamily. In some embodiments of the invention, the antibody or its antigennegative fragment contains the framework region of the VL antibodies shown in table. 3 (e.g. pab1965 frame regions).

In a particular embodiment, an antibody or fragment thereof described herein that specifically binds to GITR (e.g., human GITR) comprises VL CDR1, VL CDR2, and VL CDR3 from pab1966, e.g., VL CDR1, VL CDR2, and VL CDR3 from pab1966, given in table. 1 (SEQ ID NOs: 102, 105 and 107, respectively). In certain embodiments, the antibody or antigen-binding fragment thereof further comprises one, two, three, or all four VL framework regions derived from a human or primate VL antibody. In specific embodiments, the antibody or antigen-binding fragment thereof further comprises one, two, three, or all four VL framework regions derived from the human kappa light chain variable region subfamily. In some embodiments of the invention, the antibody or its antigen-binding fragment contains the framework region of the VL antibodies shown in table. 3 (e.g. pab1966 frame regions). In a particular embodiment, an antibody or fragment thereof described herein that specifically binds to GITR (e.g., human GITR) comprises VL CDR1, VL CDR2, and VL CDR3 from pab1967, e.g., VL CDR1, VL CDR2, and VL CDR3 from pab1967, given in table. 1 (SEQ ID NOs: 103, 105 and 108, respectively). In certain embodiments, the antibody or antigen-binding fragment thereof further comprises one, two, three, or all four VL framework regions derived from a human or primate VL antibody. In specific embodiments, the antibody or antigen-binding fragment thereof further comprises one, two, three, or all four VL framework regions derived from the human kappa light chain variable region subfamily. In some embodiments of the invention, the antibody or its antigen-binding fragment contains the framework region of the VL antibodies shown in table. 3 (e.g. pab1967 frame regions).

In a particular embodiment, an antibody or fragment thereof described herein that specifically binds to GITR (e.g., human GITR) comprises VL CDR1, VL CDR2, and VL CDR3 from pab1968, e.g., VL CDR1, VL CDR2, and VL CDR3 from pab1968, given in table. 1 (SEQ ID NOs: 101, 105 and 107, respectively). In certain embodiments, the antibody or antigen-binding fragment thereof further comprises one, two, three, or all four VL framework regions derived from a human or primate VL antibody. In specific embodiments, the antibody or antigen-binding fragment thereof further comprises one, two, three, or all four VL framework regions derived from the human kappa light chain variable region subfamily. In some embodiments of the invention, the antibody or its antigen-binding fragment contains the framework region of the VL antibodies shown in table. 3 (e.g. pab1968 frame regions).

In a particular embodiment, an antibody or fragment thereof described herein that specifically binds to GITR (e.g., human GITR) comprises VL CDR1, VL CDR2, and VL CDR3 from pab1969, e.g., VL CDR1, VL CDR2, and VL CDR3 from pab1969, given in table. 1 (SEQ ID NOs: 103, 105 and 109, respectively). In certain embodiments, the antibody or antigen-binding fragment thereof further comprises one, two, three, or all four VL framework regions derived from a human or primate VL antibody. In specific embodiments, the antibody or antigen-binding fragment thereof further comprises one, two, three, or all four VL framework regions derived from the human kappa light chain variable region subfamily. In some embodiments of the invention, the antibody or its antigennegative fragment contains the framework region of the VL antibodies shown in table. 3 (e.g. pab1969 frame regions).

In a specific embodiment, an antibody or fragment thereof described herein that specifically binds to GITR (e.g., human GITR) comprises VL CDR1, VL CDR2, and VL CDR3 from pab1970, e.g., VL CDR1, VL CDR2, and VL CDR3 from pab1970, given in table. 1 (SEQ ID NOs: 101, 105 and 109, respectively). In certain embodiments, the antibody or antigen-binding fragment thereof further comprises one, two, three, or all four VL framework regions derived from a human or primate VL antibody. In specific embodiments, the antibody or antigen-binding fragment thereof further comprises one, two, three, or all four VL framework regions derived from the human kappa light chain variable region subfamily. In some embodiments of the invention, the antibody or its antigen-binding fragment contains the framework region of the VL antibodies shown in table. 3 (e.g. pab1970 frame regions).

In a particular embodiment, an antibody or fragment thereof described herein that specifically binds to GITR (e.g., human GITR) comprises VL CDR1, VL CDR2, and VL CDR3 from pab1971, e.g., VL CDR1, VL CDR2, and VL CDR3 from pab1971, given in table. 1 (SEQ ID NOs: 103, 105 and 107, respectively). In certain embodiments, the antibody or antigen-binding fragment thereof further comprises one, two, three, or all four VL framework regions derived from a human or primate VL antibody. In specific embodiments, the antibody or antigen-binding fragment thereof further comprises one, two, three, or all four VL framework regions derived from the human kappa light chain variable region subfamily. In some embodiments of the invention, the antibody or its antigen-binding fragment contains the framework region of the VL antibodies shown in table. 3 (e.g. pab1971 frame regions).

In a particular embodiment, an antibody or fragment thereof described herein that specifically binds to GITR (e.g., human GITR) comprises VL CDR1, VL CDR2, and VL CDR3 from pab1972, e.g., VL CDR1, VL CDR2, and VL CDR3 from pab1972, given in table. 1 (SEQ ID NOs: 104, 105 and 107, respectively). In certain embodiments, the antibody or antigen-binding fragment thereof further comprises one, two, three, or all four VL framework regions derived from a human or primate VL antibody. In particular embodiments, the antibody, or antigen-binding fragment thereof, further comprises one, two, three, or all four VL framework regions derived from the human kappa light chain variable region subfamily. In some embodiments of the invention, the antibody or its antigennegative fragment contains the framework region of the VL antibodies shown in table. 3 (e.g. pab1972 frame regions).

In a particular embodiment, an antibody or fragment thereof described herein that specifically binds to GITR (e.g., human GITR) comprises VL CDR1, VL CDR2, and VL CDR3 from pab1973, e.g., VL CDR1, VL CDR2, and VL CDR3 from pab1973, given in table. 1 (SEQ ID NOs: 103, 105 and 107, respectively). In certain embodiments, the antibody or antigen-binding fragment thereof further comprises one, two, three, or all four VL framework regions derived from a human or primate VL antibody. In specific embodiments, the antibody or antigen-binding fragment thereof further comprises one, two, three, or all four VL framework regions derived from the human kappa light chain variable region subfamily. In some embodiments of the invention, the antibody or its antigen-binding fragment contains the framework region of the VL antibodies shown in table. 3 (e.g. pab1973 frame regions).

In a particular embodiment, an antibody or fragment thereof described herein that specifically binds to GITR (e.g., human GITR) comprises VL CDR1, VL CDR2, and VL CDR3 from pab1975, e.g., VL CDR1, VL CDR2, and VL CDR3 from pab1975, given in table. 1 (SEQ ID NOs: 102, 105 and 107, respectively). In certain embodiments, the antibody or antigen-binding fragment thereof further comprises one, two, three, or all four VL framework regions derived from a human or primate VL antibody. In specific embodiments, the antibody or antigen-binding fragment thereof further comprises one, two, three, or all four VL framework regions derived from the human kappa light chain variable region subfamily. In some embodiments of the invention, the antibody or its antigen-binding fragment contains the framework region of the VL antibodies shown in table. 3 (e.g. pab1975 frame regions).

In a particular embodiment, an antibody or fragment thereof described herein that specifically binds to GITR (e.g., human GITR) comprises VL CDR1, VL CDR2, and VL CDR3 from pab1976, e.g., VL CDR1, VL CDR2, and VL CDR3 from pab1976, given in Table 71 040077 1 (SEQ ID NOs: 101, 105 and 107, respectively). In certain embodiments, the antibody or antigen-binding fragment thereof further comprises one, two, three, or all four VL framework regions derived from a human or primate VL antibody. In particular embodiments, the antibody, or antigen-binding fragment thereof, further comprises one, two, three, or all four VL framework regions derived from the human kappa light chain variable region subfamily. In some embodiments of the invention, the antibody or its antigennegative fragment contains the framework region of the VL antibodies shown in table. 3 (e.g. pab1976 frame regions).

In a particular embodiment, an antibody or fragment thereof described herein that specifically binds to GITR (e.g., human GITR) comprises VL CDR1, VL CDR2, and VL CDR3 from pab1977, e.g., VL CDR1, VL CDR2, and VL CDR3 from pab1977, given in table. 1 (SEQ ID NOs: 103, 105 and 107, respectively). In certain embodiments, the antibody or antigen-binding fragment thereof further comprises one, two, three, or all four VL framework regions derived from a human or primate VL antibody. In specific embodiments, the antibody or antigen-binding fragment thereof further comprises one, two, three, or all four VL framework regions derived from the human kappa light chain variable region subfamily. In some embodiments of the invention, the antibody or its antigen-binding fragment contains the framework region of the VL antibodies shown in table. 3 (e.g. pab1977 wireframes).

In a particular embodiment, an antibody or fragment thereof described herein that specifically binds to GITR (e.g., human GITR) comprises VL CDR1, VL CDR2, and VL CDR3 from pab1979, e.g., VL CDR1, VL CDR2, and VL CDR3 from pab1979, given in table. 1 (SEQ ID NOs: 102, 105 and 107, respectively). In certain embodiments, the antibody or antigen-binding fragment thereof further comprises one, two, three, or all four VL framework regions derived from a human or primate VL antibody. In particular embodiments, the antibody, or antigen-binding fragment thereof, further comprises one, two, three, or all four VL framework regions derived from the human kappa light chain variable region subfamily. In some embodiments of the invention, the antibody or its antigennegative fragment contains the framework region of the VL antibodies shown in table. 3 (e.g. pab1979 frame regions).

In a specific embodiment, an antibody or fragment thereof described herein that specifically binds to GITR (e.g., human GITR) comprises VL CDR1, VL CDR2, and VL CDR3 from pab1980, e.g., VL CDR1, VL CDR2, and VL CDR3 from pab1980, given in table. 1 (SEQ ID NOs: 101, 105 and 107, respectively). In certain embodiments, the antibody or antigen-binding fragment thereof further comprises one, two, three, or all four VL framework regions derived from a human or primate VL antibody. In specific embodiments, the antibody or antigen-binding fragment thereof further comprises one, two, three, or all four VL framework regions derived from the human kappa light chain variable region subfamily. In some embodiments of the invention, the antibody or its antigen-binding fragment contains the framework region of the VL antibodies shown in table. 3 (e.g. pab1980 wireframes).

In a particular embodiment, an antibody or fragment thereof described herein that specifically binds to GITR (e.g., human GITR) comprises VL CDR1, VL CDR2, and VL CDR3 from pab1981, e.g., VL CDR1, VL CDR2, and VL CDR3 from pab1981, given in table. 1 (SEQ ID NOs: 103, 105 and 107, respectively). In certain embodiments, the antibody or antigen-binding fragment thereof further comprises one, two, three, or all four VL framework regions derived from a human or primate VL antibody. In particular embodiments, the antibody, or antigen-binding fragment thereof, further comprises one, two, three, or all four VL framework regions derived from the human kappa light chain variable region subfamily. In some embodiments of the invention, the antibody or its antigennegative fragment contains the framework region of the VL antibodies shown in table. 3 (e.g. pab1981 frame regions).

In a particular embodiment, an antibody or fragment thereof described herein that specifically binds to GITR (e.g., human GITR) comprises VL CDR1, VL CDR2, and VL CDR3 from pab1983, e.g., VL CDR1, VL CDR2, and VL CDR3 from pab1983, given in table. 1 (SEQ ID NOs: 102, 105 and 107, respectively). In certain embodiments, the antibody or antigen-binding fragment thereof further comprises one, two, three, or all four VL framework regions derived from a human or primate VL antibody. In specific embodiments, the antibody or antigen-binding fragment thereof further comprises one, two, three, or all four VL framework regions derived from the human kappa light chain variable region subfamily. In some embodiments of the invention, the antibody or its antigen-binding fragment contains the framework region of the VL antibodies shown in table. 3

- 72 040077 (for example pab1983 wireframes).

In a particular embodiment, an antibody or fragment thereof described herein that specifically binds to GITR (e.g., human GITR) comprises VL CDR1, VL CDR2, and VL CDR3 from pab2159, e.g., VL CDR1, VL CDR2, and VL CDR3 from pab2159, given in table. 1 (SEQ ID NOs: 102, 105 and 109, respectively). In certain embodiments, the antibody or antigen-binding fragment thereof further comprises one, two, three, or all four VL framework regions derived from a human or primate VL antibody. In specific embodiments, the antibody or antigen-binding fragment thereof further comprises one, two, three, or all four VL framework regions derived from the human kappa light chain variable region subfamily. In some embodiments of the invention, the antibody or its antigen-binding fragment contains the framework region of the VL antibodies shown in table. 3 (e.g. pab2159 wireframes). In a particular embodiment, an antibody or fragment thereof described herein that specifically binds to GITR (e.g., human GITR) comprises VL CDR1, VL CDR2, and VL CDR3 from pab2160, e.g., VL CDR1, VL CDR2, and VL CDR3 from pab2160, given in table. 1 (SEQ ID NOs: 102, 105 and 107, respectively). In certain embodiments, the antibody or antigen-binding fragment thereof further comprises one, two, three, or all four VL framework regions derived from a human or primate VL antibody. In specific embodiments, the antibody or antigen-binding fragment thereof further comprises one, two, three, or all four VL framework regions derived from the human kappa light chain variable region subfamily. In some embodiments of the invention, the antibody or its antigen-binding fragment contains the framework region of the VL antibodies shown in table. 3 (eg pab2160 wireframes).

In a particular embodiment, an antibody or fragment thereof described herein that specifically binds to GITR (e.g., human GITR) comprises VL CDR1, VL CDR2, and VL CDR3 from pab2161, e.g., VL CDR1, VL CDR2, and VL CDR3 from pab2161, given in table. 1 (SEQ ID NOs: 103, 105 and 109, respectively). In certain embodiments, the antibody or antigen-binding fragment thereof further comprises one, two, three, or all four VL framework regions derived from a human or primate VL antibody. In particular embodiments, the antibody, or antigen-binding fragment thereof, further comprises one, two, three, or all four VL framework regions derived from the human kappa light chain variable region subfamily. In some embodiments of the invention, the antibody or its antigennegative fragment contains the framework region of the VL antibodies shown in table. 3 (eg pab2161 wireframes).

In a particular embodiment, an antibody described herein, or an antigen-binding fragment thereof, that specifically binds to GITR (e.g., human GITR) comprises a heavy chain variable region (VH) comprising the VH CDR1, VH CDR2, and VH CDR3 shown in Table 1. 2, e.g. VH CDR1, VH CDR2 and VH CDR3 of any of the antibodies Hum231#1, Hum231#2, pab1964, pab1965, pab1966, pab1967, pab1968, pab1969, pab1970, pab1971, pab1972, pab1973, pab1975, pab1977, pab1977, pab1976 , pab1980, pab1981, pab1983, 231-32-15, or antibodies 1-107, or antibodies pab2159, pab2160, or pab2161 (e.g., VH CDR from one row of Table 2). In some embodiments of the invention, the antibody or its antigennegative fragment contains the framework region of the VH antibodies shown in table. 4 (for example, one, two, three, or four frame regions from one row in Table 4). In certain embodiments, the antibody or antigen-binding fragment thereof comprises one, two, three, or all four framework regions of the heavy chain variable region sequence of SEQ ID NO: 203. In some embodiments, the antibody or antigen-binding fragment thereof contains one, two, three, or four framework regions of a heavy chain variable region sequence that are at least 75%, 80%, 85%, 90%, 95%, or 100% identical to one, two, three, or four framework regions of a heavy chain variable region sequence selected from the group consisting of SEQ ID NO : 201, SEQ ID NO: 206 and SEQ ID NO: 215-389. In certain embodiments, the antibody or antigen-binding fragment thereof comprises a heavy chain variable region framework that is or is derived from an amino acid sequence encoded by the human gene, the amino acid sequence being selected from the group consisting of IGHV1-2*02 (SEQ ID NO: 601), IGHV1-3*01 (SEQ ID NO: 602), IGHV1-46*01 (SEQ ID NO: 603), IGHV1-18*01 (SEQ ID NO: 604), IGHV1-69*01 (SEQ ID NO: 605) and IGHV7-4-1*02 (SEQ ID NO: 606). In specific embodiments, a heavy chain variable region framework that is derived from said amino acid sequence consists of said amino acid sequence minus up to 10 amino acid substitutions, deletions and/or insertions, preferably up to 10 amino acid substitutions. In a particular embodiment, the heavy chain variable region framework that is derived from the specified amino acid sequence consists of the specified amino acid sequence with 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acid residues replaced by an amino acid, located in a similar position in the corresponding non-human wireframe

- 73 040077 variable region of the heavy chain. In specific embodiments, the antibody, or antigen-binding fragment thereof, comprises a heavy chain variable region framework that is derived from the amino acid sequence of SEQ ID NO: 601, wherein at least one amino acid in the amino acid sequence of SEQ ID NO: 601 is replaced with an amino acid found in the same positions in the corresponding non-human heavy chain variable region framework. In certain embodiments of the invention, the amino acid substitution is at an amino acid position selected from the group consisting of 24, 48, 67, 71, 73, and 94, with the amino acid position of each member of the group indicated according to Kabat numbering. In specific embodiments, the amino acid substitution is selected from the group consisting of 24G, 48I, 67A, 71V, 73K, and 94K, with the amino acid position of each member of the group indicated according to Kabat numbering. In a specific embodiment, an antibody or fragment thereof described herein that specifically binds to GITR (e.g., human GITR) contains VH CDR1, VH CDR2, and VH CDR3 from Hum231#1, e.g., VH CDR1, VH CDR2, and VH CDR3 from Hum231#1, given in table. 2 (SEQ ID NOs: 13, 14 and 15, respectively). In certain embodiments, the antibody or antigen-binding fragment thereof further comprises one, two, three, or all four VH framework regions derived from a human or primate VH antibody. In specific embodiments, the antibody or antigen-binding fragment thereof further comprises one, two, three, or all four VH framework regions derived from a subfamily of human heavy chain variable regions (eg, one of subfamilies 1-7). In some embodiments of the invention, the antibody or its antigennegative fragment contains the framework region of the VH antibodies shown in table. 4 (for example, Hum2 31#1 wireframe regions).

In a particular embodiment, an antibody or fragment thereof described herein that specifically binds to GITR (e.g., human GITR) contains VH CDR1, VH CDR2, and VH CDR3 from Hum231#2, e.g., VH CDR1, VH CDR2, and VH CDR3 from Hum231#2, given in table. 2 (SEQ ID NOs: 13, 14 and 15, respectively). In certain embodiments, the antibody or antigen-binding fragment thereof further comprises one, two, three, or all four VH framework regions derived from a human or primate VH antibody. In specific embodiments, the antibody or antigen-binding fragment thereof further comprises one, two, three, or all four VH framework regions derived from a subfamily of human heavy chain variable regions (eg, one of subfamilies 1-7). In some embodiments of the invention, the antibody or its antigennegative fragment contains the framework region of the VH antibodies shown in table. 4 (for example, Hum231#2 wireframe regions). In a particular embodiment, an antibody or fragment thereof described herein that specifically binds to GITR (e.g., human GITR) contains VH CDR1, VH CDR2, and VH CDR3 from pab1964, e.g., VH CdR1, VH CDR2, and VH CDR3 from pab1964 given in Table. 2 (SEQ ID NOs: 19, 24 and 34, respectively). In certain embodiments, the antibody or antigen-binding fragment thereof further comprises one, two, three, or all four VH framework regions derived from a human or primate VH antibody. In specific embodiments, the antibody or antigen-binding fragment thereof further comprises one, two, three, or all four VH framework regions derived from a subfamily of human heavy chain variable regions (eg, one of subfamilies 1-7). In some embodiments of the invention, the antibody or its antigennegative fragment contains the framework region of the VH antibodies shown in table. 4 (e.g. pab1964 frame regions).

In a particular embodiment, an antibody or fragment thereof described herein that specifically binds to GITR (e.g., human GITR) contains VH CDR1, VH CDR2, and VH CDR3 from pab1965, e.g., VH CDR1, VH CDR2, and VH CDR3 from pab1965 given in Table. 2 (SEQ ID NOs: 19, 25 and 34, respectively). In certain embodiments, the antibody or antigen-binding fragment thereof further comprises one, two, three, or all four VH framework regions derived from a human or primate VH antibody. In specific embodiments, the antibody or antigen-binding fragment thereof further comprises one, two, three, or all four VH framework regions derived from a subfamily of human heavy chain variable regions (eg, one of subfamilies 1-7). In some embodiments of the invention, the antibody or its antigennegative fragment contains the framework region of the VH antibodies shown in table. 4 (e.g. pab1965 frame regions). In a particular embodiment, an antibody or fragment thereof described herein that specifically binds to GITR (e.g., human GITR) contains VH CDR1, VH CDR2, and VH CDR3 from pab1966, e.g., VH CDR1, VH CDR2, and VH CDR3 from pab1966 given in Table. 2 (SEQ ID NOs: 19, 26 and 34, respectively). In certain embodiments, the antibody or antigen-binding fragment thereof further comprises one, two, three, or all four VH framework regions derived from a human or primate VH antibody. In specific embodiments of the invention, the antibody or antigen-binding fragment further comprises one, two, three, or all four

- 74 040077 VH framework regions derived from a subfamily of human heavy chain variable regions (eg one of subfamilies 1-7). In some embodiments of the invention, the antibody or antigennegative fragment contains the VH framework region of the antibody shown in table. 4 (e.g. pab1966 frame regions).

In a particular embodiment, an antibody or fragment thereof described herein that specifically binds to GITR (e.g., human GITR) contains VH CDR1, VH CDR2, and VH CDR3 from pab1967, e.g., VH CDR1, VH CDR2, and VH CDR3 from pab1967 given in Table. 2 (SEQ ID NOs: 20, 27 and 34, respectively). In certain embodiments, the antibody or antigen-binding fragment thereof further comprises one, two, three, or all four VH framework regions derived from a human or primate VH antibody. In specific embodiments, the antibody or antigen-binding fragment thereof further comprises one, two, three, or all four VH framework regions derived from a subfamily of human heavy chain variable regions (eg, one of subfamilies 1-7). In some embodiments of the invention, the antibody or its antigennegative fragment contains the framework region of the VH antibodies shown in table. 4 (e.g. pab1967 frame regions).

In a particular embodiment, an antibody or fragment thereof described herein that specifically binds to GITR (e.g., human GITR) contains VH CDR1, VH CDR2, and VH CDR3 from pab1968, e.g., VH CDR1, VH CDR2, and VH CDR3 from pab1968 given in Table. 2 (SEQ ID NOs: 21, 28 and 34, respectively). In certain embodiments, the antibody or antigen-binding fragment thereof further comprises one, two, three, or all four VH framework regions derived from a human or primate VH antibody. In specific embodiments, the antibody or antigen-binding fragment thereof further comprises one, two, three, or all four VH framework regions derived from a subfamily of human heavy chain variable regions (eg, one of subfamilies 1-7). In some embodiments of the invention, the antibody or its antigennegative fragment contains the framework region of the VH antibodies shown in table. 4 (e.g. pab1968 frame regions). In a particular embodiment, an antibody or fragment thereof described herein that specifically binds to GITR (e.g., human GITR) contains VH CDR1, VH CDR2, and VH CDR3 from pab1969, e.g., VH CDR1, VH CDR2, and VH CDR3 from pab1969 given in Table. 2 (SEQ ID NOs: 22, 29 and 34, respectively). In certain embodiments, the antibody or antigen-binding fragment thereof further comprises one, two, three, or all four VH framework regions derived from a human or primate VH antibody. In specific embodiments, the antibody or antigen-binding fragment thereof further comprises one, two, three, or all four VH framework regions derived from a subfamily of human heavy chain variable regions (eg, one of subfamilies 1-7). In some embodiments of the invention, the antibody or its antigennegative fragment contains the framework region of the VH antibodies shown in table. 4 (e.g. pab1969 frame regions). In a particular embodiment, an antibody or fragment thereof described herein that specifically binds to GITR (e.g., human GITR) contains VH CDR1, VH CDR2, and VH CDR3 from pab1970, e.g., VH CDR1, VH CDR2, and VH CDR3 from pab1970 given in Table. 2 (SEQ ID NOs: 21, 24 and 34, respectively). In certain embodiments, the antibody or antigen-binding fragment thereof further comprises one, two, three, or all four VH framework regions derived from a human or primate VH antibody. In specific embodiments, the antibody or antigen-binding fragment thereof further comprises one, two, three, or all four VH framework regions derived from a subfamily of human heavy chain variable regions (eg, one of subfamilies 1-7). In some embodiments of the invention, the antibody or its antigennegative fragment contains the framework region of the VH antibodies shown in table. 4 (e.g. pab1970 frame regions). In a particular embodiment, an antibody or fragment thereof described herein that specifically binds to GITR (e.g., human GITR) comprises VH CDR1, VH CDR2, and VH CDR3 from pab1971, e.g., VH CDR1, VH CDR2, and VH CDR3 from pab1971 given in Table. 2 (SEQ ID NOs: 21, 177 and 34, respectively). In certain embodiments, the antibody or antigen-binding fragment thereof further comprises one, two, three, or all four VH framework regions derived from a human or primate VH antibody. In specific embodiments, the antibody or antigen-binding fragment thereof further comprises one, two, three, or all four VH framework regions derived from a subfamily of human heavy chain variable regions (eg, one of subfamilies 1-7). In some embodiments of the invention, the antibody or its antigennegative fragment contains the framework region of the VH antibodies shown in table. 4 (e.g. pab1971 frame regions). In a specific embodiment, an antibody or fragment thereof described herein that specifically binds to GITR (e.g., human GITR) contains VH CDR1, VH CDR2, and VH CDR3 from pab1972, e.g., VH CdR1, VH CDR2, and VH CDR3 from pab1972 given in Table. 2 (SEQ ID NOs: 23, 31 and 34, respectively). In certain embodiments, the antibody or antigen binding fragment thereof further comprises one, two, three, or all four VH framework regions derived from a human or primate VH antibody. In specific embodiments, the antibody or antigen-binding fragment thereof further comprises one, two, three, or all four VH framework regions derived from a subfamily of human heavy chain variable regions (eg, one of subfamilies 1-7). In some embodiments of the invention, the antibody or antigennegative fragment contains the VH framework region of the antibody shown in table. 4 (e.g. pab1972 frame regions).

In a specific embodiment, an antibody or fragment thereof described herein that specifically binds to GITR (e.g., human GITR) contains VH CDR1, VH CDR2, and VH CDR3 from pab1973, e.g., VH CDR1, VH CDR2, and VH CDR3 from pab1973 given in Table. 2 (SEQ ID NOs: 19, 32 and 34, respectively). In certain embodiments, the antibody or antigen-binding fragment thereof further comprises one, two, three, or all four VH framework regions derived from a human or primate VH antibody. In specific embodiments, the antibody or antigen-binding fragment thereof further comprises one, two, three, or all four VH framework regions derived from a subfamily of human heavy chain variable regions (eg, one of subfamilies 1-7). In some embodiments of the invention, the antibody or its antigennegative fragment contains the framework region of the VH antibodies shown in table. 4 (e.g. pab1973 frame regions). In a particular embodiment, an antibody or fragment thereof described herein that specifically binds to GITR (e.g., human GITR) contains VH CDR1, VH CDR2, and VH CDR3 from pab1975, e.g., VH CdR1, VH CDR2, and VH CDR3 from pab1975 given in Table. 2 (SEQ ID NOs: 22, 29 and 34, respectively). In certain embodiments, the antibody or antigen-binding fragment thereof further comprises one, two, three, or all four VH framework regions derived from a human or primate VH antibody. In specific embodiments, the antibody or antigen-binding fragment thereof further comprises one, two, three, or all four VH framework regions derived from a subfamily of human heavy chain variable regions (eg, one of subfamilies 1-7). In some embodiments of the invention, the antibody or its antigennegative fragment contains the framework region of the VH antibodies shown in table. 4 (e.g. pab1975 frame regions). In a specific embodiment, an antibody or fragment thereof described herein that specifically binds to GITR (e.g., human GITR) contains VH CDR1, VH CDR2, and VH CDR3 from pab1976, e.g., VH CDR1, VH CDR2, and VH CDR3 from pab1976 given in Table. 2 (SEQ ID NOs: 22, 29 and 34, respectively). In certain embodiments, the antibody or antigen-binding fragment thereof further comprises one, two, three, or all four VH framework regions derived from a human or primate VH antibody. In specific embodiments, the antibody or antigen-binding fragment thereof further comprises one, two, three, or all four VH framework regions derived from a subfamily of human heavy chain variable regions (eg, one of subfamilies 1-7). In some embodiments of the invention, the antibody or its antigennegative fragment contains the framework region of the VH antibodies shown in table. 4 (e.g. pab1976 frame regions). In a particular embodiment, an antibody or fragment thereof described herein that specifically binds to GITR (e.g., human GITR) contains VH CDR1, VH CDR2, and VH CDR3 from pab1977, e.g., VH CDR1, VH CDR2, and VH CDR3 from pab1977 given in Table. 2 (SEQ ID NOs: 22, 29 and 34, respectively). In certain embodiments, the antibody or antigen-binding fragment thereof further comprises one, two, three, or all four VH framework regions derived from a human or primate VH antibody. In specific embodiments, the antibody or antigen-binding fragment thereof further comprises one, two, three, or all four VH framework regions derived from a subfamily of human heavy chain variable regions (eg, one of subfamilies 1-7). In some embodiments of the invention, the antibody or its antigennegative fragment contains the framework region of the VH antibodies shown in table. 4 (e.g. pab1977 frame regions). In a specific embodiment, an antibody or fragment thereof described herein that specifically binds to GITR (e.g., human GITR) contains VH CDR1, VH CDR2, and VH CDR3 from pab1979, e.g., VH CdR1, VH CDR2, and VH CDR3 from pab1979 given in Table. 2 (SEQ ID NOs: 22, 33 and 34, respectively). In certain embodiments, the antibody or antigen-binding fragment thereof further comprises one, two, three, or all four VH framework regions derived from a human or primate VH antibody. In specific embodiments, the antibody or antigen-binding fragment thereof further comprises one, two, three, or all four VH framework regions derived from a subfamily of human heavy chain variable regions (eg, one of subfamilies 1-7). In some embodiments of the invention, the antibody or antigennegative fragment contains the VH framework region of the antibody shown in table. 4 (e.g. pab1979 frame regions). In a particular embodiment, an antibody described herein, or a fragment thereof, that specifically binds to GITR (e.g.,

- 76 040077 human GITR), contains VH CDR1, VH CDR2 and VH CDR3 from pab1980, for example, VH CDR1, VH CDR2 and VH CDR3 from pab1980, shown in table. 2 (SEQ ID NOs: 22, 33 and 34, respectively). In certain embodiments, the antibody or antigen-binding fragment thereof further comprises one, two, three, or all four VH framework regions derived from a human or primate VH antibody. In specific embodiments, the antibody or antigen-binding fragment thereof further comprises one, two, three, or all four VH framework regions derived from a subfamily of human heavy chain variable regions (eg, one of subfamilies 1-7). In some embodiments of the invention, the antibody or its antigennegative fragment contains the framework region of the VH antibodies shown in table. 4 (eg pab1980 wireframes). In a particular embodiment, an antibody or fragment thereof described herein that specifically binds to GITR (e.g., human GITR) contains VH CDR1, VH CDR2, and VH CDR3 from pab1981, e.g., VH CDR1, VH CDR2, and VH CDR3 from pab1981 given in Table. 2 (SEQ ID NOs: 22, 33 and 34, respectively). In certain embodiments, the antibody or antigen-binding fragment thereof further comprises one, two, three, or all four VH framework regions derived from a human or primate VH antibody. In specific embodiments, the antibody or antigen-binding fragment thereof further comprises one, two, three, or all four VH framework regions derived from a subfamily of human heavy chain variable regions (eg, one of subfamilies 1-7). In some embodiments of the invention, the antibody or its antigennegative fragment contains the framework region of the VH antibodies shown in table. 4 (e.g. pab1981 frame regions). In a particular embodiment, an antibody or fragment thereof described herein that specifically binds to GITR (e.g., human GITR) contains VH CDR1, VH CDR2, and VH CDR3 from pab1983, e.g., VH CdR1, VH CDR2, and VH CDR3 from pab1983 given in Table. 2 (SEQ ID NOs: 19, 24 and 34, respectively). In certain embodiments, the antibody or antigen-binding fragment thereof further comprises one, two, three, or all four VH framework regions derived from a human or primate VH antibody. In specific embodiments, the antibody or antigen-binding fragment thereof further comprises one, two, three, or all four VH framework regions derived from a subfamily of human heavy chain variable regions (eg, one of subfamilies 1-7). In some embodiments of the invention, the antibody or its antigennegative fragment contains the framework region of the VH antibodies shown in table. 4 (eg pab1983 wireframes). In a particular embodiment, an antibody or fragment thereof described herein that specifically binds to GITR (e.g., human GITR) contains VH CDR1, VH CDR2, and VH CDR3 from pab2159, e.g., VH CDR1, VH CDR2, and VH CDR3 from pab2159 given in Table. 2 (SEQ ID NOs: 19, 144 and 34, respectively). In certain embodiments, the antibody or antigen-binding fragment thereof further comprises one, two, three, or all four VH framework regions derived from a human or primate VH antibody. In specific embodiments, the antibody or antigen-binding fragment thereof further comprises one, two, three, or all four VH framework regions derived from a subfamily of human heavy chain variable regions (eg, one of subfamilies 1-7). In some embodiments of the invention, the antibody or its antigennegative fragment contains the framework region of the VH antibodies shown in table. 4 (eg pab2159 wireframes). In a particular embodiment, an antibody or fragment thereof described herein that specifically binds to GITR (e.g., human GITR) contains VH CDR1, VH CDR2, and VH CDR3 from pab2160, e.g., VH CDR1, VH CDR2, and VH CDR3 from pab2160 given in Table. 2 (SEQ ID NOs: 119, 162 and 34, respectively). In certain embodiments, the antibody or antigen-binding fragment thereof further comprises one, two, three, or all four VH framework regions derived from a human or primate VH antibody. In specific embodiments, the antibody or antigen-binding fragment thereof further comprises one, two, three, or all four VH framework regions derived from a subfamily of human heavy chain variable regions (eg, one of subfamilies 1-7). In some embodiments of the invention, the antibody or its antigennegative fragment contains the framework region of the VH antibodies shown in table. 4 (eg pab2160 wireframes). In a specific embodiment, an antibody or fragment thereof described herein that specifically binds to GITR (e.g., human GITR) comprises VH CDR1, VH CDR2, and VH CDR3 from pab2161, e.g., VH CDR1, VH CDR2, and VH CDR3 from pab2161 given in Table. 2 (SEQ ID NOs: 22, 121 and 34, respectively). In certain embodiments, the antibody or antigen-binding fragment thereof further comprises one, two, three, or all four VH framework regions derived from a human or primate VH antibody. In specific embodiments, the antibody or antigen-binding fragment thereof further comprises one, two, three, or all four VH framework regions derived from a subfamily of human heavy chain variable regions (eg, one of subfamilies 1-7). In some embodiments, the antibody, or antigen-binding fragment thereof, contains antibody VH framework regions conferring

- 77 040077 given in the table. 4 (eg pab2161 wireframes). In a particular embodiment, an antibody described herein, or an antigen-binding fragment thereof, that specifically binds to GITR (e.g., human GITR) comprises (i) a heavy chain variable region (VH) comprising VH CDR1, VH CDR2, and VH CDR3 as shown in table. 2, e.g. VH CDR1, VH CDR2 and VH CDR3 of any of the antibodies Hum231#1, Hum231#2, pab1964, pab1965, pab1966, pab1967, pab1968, pab1969, pab1970, pab1971, pab1972, pab1973, pab1975, pab1977, pab1977, pab1976 , pab1980, pab1981, pab1983, 231-32-15 or antibodies 1-107, or antibodies pab2159, pab2160 or pab2161, (e.g. VH CDR from one row of Table 2), and (ii) the light chain variable region (VL) containing VL CDR1, VL CDR2 and VL CDR3 shown in table. 1, for example VL CDR1, VL CDR2 and VL CDR3 of any of the antibodies Hum231#1, Hum231#2, pab1964, pab1965, pab1966, pab1967, pab1968, pab1969, pab1970, pab1971, pab1972, pab1973, pab1975, pab1977, pab1977, pab1977 pab1980, pab1981, pab1983, 231-32-15 or antibody 1-107 or antibody pab2159, pab2160 or pab2161 (e.g. VL CDR from one row of Table 1). In some embodiments, the antibody or antigen-binding fragment thereof contains the VL framework regions and the VH framework regions of the antibody shown in Table 1. 3 and 4, respectively (eg, framework regions of a single antibody whose name is indicated, eg, all FRs belong to Hum231#1 or Hum231#2). In some embodiments, an antibody described herein, or an antigen-binding fragment thereof, contains one, two, three, or four framework regions of a heavy chain variable region sequence that are at least 75%, 80%, 85%, 90%, 95%, or 100% identical to one, two, three or four framework regions of the heavy chain variable region sequence selected from the group consisting of SEQ ID NO: 201, SEQ ID NO: 206, and SEQ ID NO: 215-389. In certain embodiments, an antibody described herein, or an antigen-binding fragment thereof, comprises a heavy chain variable region framework that is or is derived from an amino acid sequence encoded by the human gene, the amino acid sequence being selected from the group consisting of IGHV1-2*02 ( SEQ ID NO: 601), IGHV1-3*01 (SEQ ID NO: 602), IGHV1-46*01 (SEQ ID NO: 603), IGHV1-18*01 (SEQ ID NO: 604), IGHV1-69* 01 (SEQ ID NO: 605) and IGHV7-4-1*02 (SEQ ID NO: 606). In specific embodiments, a heavy chain variable region framework that is derived from said amino acid sequence consists of said amino acid sequence minus up to 10 amino acid substitutions, deletions and/or insertions, preferably up to 10 amino acid substitutions. In a particular embodiment, the heavy chain variable region framework that is derived from the specified amino acid sequence consists of the specified amino acid sequence with 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acid residues replaced by an amino acid, located in a similar position in the corresponding non-human framework region of the variable region of the heavy chain. In specific embodiments, an antibody described herein, or an antigen-binding fragment thereof, comprises a heavy chain variable region framework that is derived from the amino acid sequence of SEQ ID NO: 601, wherein at least one amino acid in the amino acid sequence of SEQ ID NO: 601 is replaced with an amino acid located in a similar position in the corresponding non-human framework region of the variable region of the heavy chain. In certain embodiments of the invention, the amino acid substitution is at an amino acid position selected from the group consisting of 24, 48, 67, 71, 73, and 94, with the amino acid position of each member of the group indicated according to Kabat numbering. In specific embodiments, the amino acid substitution is selected from the group consisting of 24G, 48I, 67A, 71V, 73K, and 94K, with the amino acid position of each member of the group indicated according to Kabat numbering. In some embodiments, the antibody described herein, or an antigen-binding fragment thereof, contains the VL framework regions of the antibody shown in Table 1. 3. In certain embodiments, an antibody described herein, or an antigen-binding fragment thereof, comprises a light chain variable region sequence comprising one, two, three, or four framework regions of a light chain variable region sequence of SEQ ID NO: 204 or SEQ ID NO: 205. In some embodiments, an antibody described herein, or an antigen-binding fragment thereof, comprises one, two, three, or four light chain variable region sequence framework regions that are at least 75%, 80%, 85%, 90%, 95%, or 100% identical to one, two, three or four framework regions of a light chain variable region sequence selected from the group consisting of SEQ ID NO: 202, SEQ ID NO: 207, SEQ ID NO: 208, and SEQ ID NO: 400-518. In some embodiments, an antibody described herein, or an antigen-binding fragment thereof, comprises one, two, three, or four light chain variable region sequence framework regions that are at least 75%, 80%, 85%, 90%, 95%, or 100% identical to one, two, three, or four framework regions of the light chain variable region sequence of SEQ ID NO: 519. In certain embodiments, an antibody described herein, or an antigen-binding fragment thereof, comprises a light chain variable region framework that is or is derived from an amino acid sequence encoded by a human genome, while am

- 78 040077 no acid sequence selected from the group consisting of IGKV4-1*01 (SEQ ID NO: 607) and IGKV3-7*02 (SEQ ID NO: 608). In particular embodiments, a light chain variable region framework that is derived from said amino acid sequence consists of said amino acid sequence minus up to 10 amino acid substitutions, deletions and/or insertions, preferably up to 10 amino acid substitutions. In a specific embodiment, the light chain variable region framework that is derived from the specified amino acid sequence consists of the specified amino acid sequence with 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acid residues replaced by an amino acid, located in a similar position in the corresponding non-human framework region of the variable region of the light chain. In some embodiments, an antibody described herein, or an antigen-binding fragment thereof, comprises a light chain variable region framework that is derived from the amino acid sequence of SEQ ID NO: 607 or SEQ ID NO: 608, with at least one amino acid in the amino acid sequence of SEQ ID NO: 607 or SEQ ID NO: 608 is substituted with an amino acid at the same position in the corresponding non-human light chain variable region framework. In a specific embodiment of the invention, the amino acid substitution is at amino acid position 87, with the amino acid position indicated according to Kabat numbering. In specific embodiments of the invention, the amino acid substitution is 87H, with the amino acid position indicated according to Kabat numbering. In a particular embodiment, an antibody or fragment thereof described herein that specifically binds to GITR (e.g., human GITR) comprises VL CDR1, VL CDR2, VL CDR3, VH CDR1, VH CDR2, and VH CDR3 from Hum231#1, e.g. VL CDR1, VL CDR2, VL CDR3, VH CDR1, VH CDR2 and VH CDR3 from Hum231#1, shown in table. 1 and 2 (SEQ ID NOs: 16, 17, 18, 13, 14 and 15, respectively). In certain embodiments, the antibody or antigen-binding fragment further comprises one, two, three, or all four VL framework regions derived from the VL of a human or primate antibody and one, two, three, or all four VH framework regions derived from the VH of a human or primate antibody. primacy. In some embodiments, the antibody or antigen-binding fragment thereof contains the VL framework regions and the VH framework regions of the antibody shown in Table 1. 3 and 4, respectively (eg Hum231#1 frame regions). In a particular embodiment, an antibody or fragment thereof described herein that specifically binds to GITR (e.g., human GITR) comprises VL CDR1, VL CDR2, VL CDR3, VH CDR1, VH CDR2, and VH CDR3 from Hum231#2, e.g. VL CDR1, VL CDR2, VL CDR3, VH CDR1, VH CDR2 and VH CDR3 from Hum231#2, shown in table. 1 and 2 (SEQ ID NOs: 16, 17, 18, 13, 14 and 15, respectively). In certain embodiments, the antibody or antigen-binding fragment thereof further comprises one, two, three, or all four VL framework regions derived from the VL of a human or primate antibody and one, two, three, or all four VH framework regions derived from the VH of a human or primate antibody. primacy. In some embodiments, the antibody or antigen-binding fragment thereof contains the VL framework regions and the VH framework regions of the antibody shown in Table 1. 3 and 4, respectively (for example, the framework regions of one antibody, the name of which is indicated, for example, the framework regions of Hum231#1 or Hum231#2).

In a particular embodiment, an antibody or fragment thereof described herein that specifically binds to GITR (e.g., human GITR) comprises VL CDR1, VL CDR2, VL CDR3, VH CDR1, VH CDR2, and VH CDR3 from pab1964, e.g., VL CDR1 , VL CDR2, VL CDR3, VH CDR1, VH CDR2, and VH CDR3 from pab1964 are shown in Table 1. 1 and 2 (SEQ ID NOs: 101, 105, 106, 19, 24 and 34, respectively). In certain embodiments, the antibody or antigen-binding fragment thereof further comprises one, two, three, or all four VL framework regions derived from the VL of a human or primate antibody and one, two, three, or all four VH framework regions derived from the VH of a human or primate antibody. primacy. In some embodiments, the antibody or antigen-binding fragment thereof contains the VL framework regions and the VH framework regions of the antibody shown in Table 1. 3 and 4, respectively (eg pab1964 framework regions). In a particular embodiment, an antibody or fragment thereof described herein that specifically binds to GITR (e.g., human GITR) comprises VL CDR1, VL CDR2, VL CDR3, VH CDR1, VH CDR2, and VH CDR3 from pab1965, e.g., VL CDR1 , VL CDR2, VL CDR3, VH CDR1, VH CDR2 and VH CDR3 from pab1965, are shown in table. 1 and 2 (SEQ ID NOs: 102, 105, 107, 19, 25 and 34, respectively). In certain embodiments, the antibody or antigen-binding fragment thereof further comprises one, two, three, or all four VL framework regions derived from the VL of a human or primate antibody and one, two, three, or all four VH framework regions derived from the VH of a human or primate antibody. primacy. In some embodiments, the antibody or antigen-binding fragment thereof contains the VL framework regions and the VH framework regions of the antibody shown in Table 1. 3 and 4 respectively (eg pab1965 framework regions).

In a specific embodiment of the invention, the antibody described herein or its

- 79 040077 fragment that specifically binds to GITR (eg human GITR) contains VL CDR1, VL CDR2, VL CDR3, VH CDR1, VH CDR2 and VH CDR3 from pab1966, eg VL CDR1, VL CDR2, VL CDR3, VH CDR1 , VH CDR2 and VH CDR3 from pab1966, are shown in table. 1 and 2 (SEQ ID NOs: 102, 105, 107, 19, 26 and 34, respectively). In certain embodiments, the antibody or antigen-binding fragment thereof further comprises one, two, three, or all four VL framework regions derived from the VL of a human or primate antibody and one, two, three, or all four VH framework regions derived from the VH of a human or primate antibody. primacy. In some embodiments, the antibody or antigen-binding fragment thereof contains the VL framework regions and the VH framework regions of the antibody shown in Table 1. 3 and 4 respectively (eg pab1966 framework regions). In a particular embodiment, an antibody or fragment thereof described herein that specifically binds to GITR (e.g., human GITR) comprises VL CDR1, VL CDR2, VL CDR3, VH CDR1, VH CDR2, and VH CDR3 from pab1967, e.g., VL CDR1 , VL CDR2, VL CDR3, VH CDR1, VH CDR2 and VH CDR3 from pab1967 are shown in Table. 1 and 2 (SEQ ID NOs: 103, 105, 108, 20, 27 and 34, respectively). In certain embodiments, the antibody or antigen-binding fragment thereof further comprises one, two, three, or all four VL framework regions derived from the VL of a human or primate antibody and one, two, three, or all four VH framework regions derived from the VH of a human or primate antibody. primacy. In some embodiments, the antibody or antigen-binding fragment thereof contains the VL framework regions and the VH framework regions of the antibody shown in Table 1. 3 and 4 respectively (eg pab1967 framework regions). In a particular embodiment, an antibody or fragment thereof described herein that specifically binds to GITR (e.g., human GITR) comprises VL CDR1, VL CDR2, VL CDR3, VH CDR1, VH CDR2, and VH CDR3 from pab1968, e.g., VL CDR1 , VL CDR2, VL CDR3, VH CDR1, VH CDR2 and VH CDR3 from pab1968, are shown in table. 1 and 2 (SEQ ID NOs: 101, 105, 107, 21, 28 and 34, respectively). In certain embodiments, the antibody or antigen-binding fragment thereof further comprises one, two, three, or all four VL framework regions derived from the VL of a human or primate antibody and one, two, three, or all four VH framework regions derived from the VH of a human or primate antibody. primacy. In some embodiments, the antibody or antigen-binding fragment thereof contains the VL framework regions and the VH framework regions of the antibody shown in Table 1. 3 and 4, respectively (eg pab1968 framework regions). In a particular embodiment, an antibody or fragment thereof described herein that specifically binds to GITR (e.g., human GITR) comprises VL CDR1, VL CDR2, VL CDR3, VH CDR1, VH CDR2, and VH CDR3 from pab1969, e.g., VL CDR1 , VL CDR2, VL CDR3, VH CDR1, VH CDR2, and VH CDR3 from pab1969 are shown in Table 1. 1 and 2 (SEQ ID NOs: 103, 105, 109, 22, 29 and 34, respectively). In certain embodiments, the antibody or antigen-binding fragment thereof further comprises one, two, three, or all four VL framework regions derived from the VL of a human or primate antibody and one, two, three, or all four VH framework regions derived from the VH of a human or primate antibody. primacy. In some embodiments, the antibody or antigen-binding fragment thereof contains the VL framework regions and the VH framework regions of the antibody shown in Table 1. 3 and 4 respectively (eg pab1969 framework regions). In a particular embodiment, an antibody or fragment thereof described herein that specifically binds to GITR (e.g., human GITR) comprises VL CDR1, VL CDR2, VL CDR3, VH CDR1, VH CDR2, and VH CDR3 from pab1970, e.g., VL CDR1 , VL CDR2, VL CDR3, VH CDR1, VH CDR2, and VH CDR3 from pab1970 are shown in Table 1. 1 and 2 (SEQ ID NOs: 101, 105, 109, 21, 24 and 34, respectively). In certain embodiments, the antibody or antigen-binding fragment thereof further comprises one, two, three, or all four VL framework regions derived from the VL of a human or primate antibody and one, two, three, or all four VH framework regions derived from the VH of a human or primate antibody. primacy. In some embodiments, the antibody or antigen-binding fragment thereof contains the VL framework regions and the VH framework regions of the antibody shown in Table 1. 3 and 4 respectively (eg pab1970 framework regions). In a particular embodiment, an antibody or fragment thereof described herein that specifically binds to GITR (e.g., human GITR) comprises VL CDR1, VL CDR2, VL CDR3, VH CDR1, VH CDR2, and VH CDR3 from pab1971, e.g., VL CDR1 , VL CDR2, VL CDR3, VH CDR1, VH CDR2, and VH CDR3 from pab1971 are shown in Table 1. 1 and 2 (SEQ ID NOs: 103, 105, 107, 21, 177 and 34, respectively). In certain embodiments, the antibody or antigen-binding fragment thereof further comprises one, two, three, or all four VL framework regions derived from the VL of a human or primate antibody and one, two, three, or all four VH framework regions derived from the VH of a human or primate antibody. primacy. In some embodiments, the antibody or antigen-binding fragment thereof contains the VL framework regions and the VH framework regions of the antibody shown in Table 1. 3 and 4, respectively (eg pab1971 framework regions). In a particular embodiment, an antibody or fragment thereof described herein that specifically binds to GITR (e.g., human GITR) comprises VL CDR1, VL CDR2, VL CDR3, VH CDR1, VH CDR2, and VH CDR3 from pab1972, e.g., VL CDR1 , VL

- 80 040077

CDR2, VL CDR3, VH CDR1, VH CDR2 and VH CDR3 from pab1972, shown in table. 1 and 2 (SEQ ID NOs: 104, 105, 107, 23, 31 and 34, respectively). In certain embodiments, the antibody or antigen-binding fragment thereof further comprises one, two, three, or all four VL framework regions derived from the VL of a human or primate antibody and one, two, three, or all four VH framework regions derived from the VH of a human or primate antibody. primacy. In some embodiments, the antibody or antigen-binding fragment thereof contains the VL framework regions and the VH framework regions of the antibody shown in Table 1. 3 and 4, respectively (eg pab1972 frame regions). In a particular embodiment, an antibody or fragment thereof described herein that specifically binds to GITR (e.g., human GITR) comprises VL CDR1, VL CDR2, VL CDR3, VH CDR1, VH CDR2, and VH CDR3 from pab1973, e.g., VL CDR1 , VL CDR2, VL CDR3, VH CDR1, VH CDR2, and VH CDR3 from pab1973 are shown in Table 1. 1 and 2 (SEQ ID NOs: 103, 105, 107, 19, 32 and 34, respectively). In certain embodiments, the antibody or antigen-binding fragment thereof further comprises one, two, three, or all four VL framework regions derived from the VL of a human or primate antibody and one, two, three, or all four VH framework regions derived from the VH of a human or primate antibody. primacy. In some embodiments, the antibody or antigen-binding fragment thereof contains the VL framework regions and the VH framework regions of the antibody shown in Table 1. 3 and 4, respectively (eg pab1973 framework regions). In a particular embodiment, an antibody or fragment thereof described herein that specifically binds to GITR (e.g., human GITR) comprises VL CDR1, VL CDR2, VL CDR3, VH CDR1, VH CDR2, and VH CDR3 from pab1975, e.g., VL CDR1 , VL CDR2, VL CDR3, VH CDR1, VH CDR2, and VH CDR3 from pab1975 are shown in Table 1. 1 and 2 (SEQ ID NOs: 102, 105, 107, 22, 29 and 34, respectively). In certain embodiments, the antibody or antigen-binding fragment thereof further comprises one, two, three, or all four VL framework regions derived from the VL of a human or primate antibody and one, two, three, or all four VH framework regions derived from the VH of a human or primate antibody. primacy.

In some embodiments, the antibody or antigen-binding fragment thereof contains the VL framework regions and the VH framework regions of the antibody shown in Table 1. 3 and 4, respectively (eg pab1975 framework regions). In a particular embodiment, an antibody or fragment thereof described herein that specifically binds to GITR (e.g., human GITR) comprises VL CDR1, VL CDR2, VL CDR3, VH CDR1, VH CDR2, and VH CDR3 from pab1976, e.g., VL CDR1 , VL CDR2, VL CDR3, VH CDR1, VH CDR2, and VH CDR3 from pab1976 are shown in Table 1. 1 and 2 (SEQ ID NOs: 101, 105, 107, 22, 29 and 34, respectively). In certain embodiments, the antibody or antigen-binding fragment thereof further comprises one, two, three, or all four VL framework regions derived from the VL of a human or primate antibody and one, two, three, or all four VH framework regions derived from the VH of a human or primate antibody. primacy. In some embodiments, the antibody or antigen-binding fragment thereof contains the VL framework regions and the VH framework regions of the antibody shown in Table 1. 3 and 4, respectively (eg pab1976 framework regions). In a particular embodiment, an antibody or fragment thereof described herein that specifically binds to GITR (e.g., human GITR) comprises VL CDR1, VL CDR2, VL CDR3, VH CDR1, VH CDR2, and VH CDR3 from pab1977, e.g., VL CDR1 , VL CDR2, VL CDR3, VH CDR1, VH CDR2, and VH CDR3 from pab1977 are shown in Table 1. 1 and 2 (SEQ ID NOs: 103, 105, 107, 22, 29 and 34, respectively). In certain embodiments, the antibody or antigen-binding fragment thereof further comprises one, two, three, or all four VL framework regions derived from the VL of a human or primate antibody and one, two, three, or all four VH framework regions derived from the VH of a human or primate antibody. primacy. In some embodiments, the antibody or antigen-binding fragment thereof contains the VL framework regions and the VH framework regions of the antibody shown in Table 1. 3 and 4, respectively (eg pab1977 frame regions). In a particular embodiment, an antibody or fragment thereof described herein that specifically binds to GITR (e.g., human GITR) comprises VL CDR1, VL CDR2, VL CDR3, VH CDR1, VH CDR2, and VH CDR3 from pab1979, e.g., VL CDR1 , VL CDR2, VL CDR3, VH CDR1, VH CDR2, and VH CDR3 from pab1979 are shown in Table 1. 1 and 2 (SEQ ID NOs: 102, 105, 107, 22, 33 and 34, respectively). In certain embodiments, the antibody or antigen-binding fragment thereof further comprises one, two, three, or all four VL framework regions derived from the VL of a human or primate antibody and one, two, three, or all four VH framework regions derived from the VH of a human or primate antibody. primacy. In some embodiments, the antibody or antigen-binding fragment thereof contains the VL framework regions and the VH framework regions of the antibody shown in Table 1. 3 and 4, respectively (eg pab1979 frame regions). In a particular embodiment, an antibody or fragment thereof described herein that specifically binds to GITR (e.g., human GITR) comprises VL CDR1, VL CDR2, VL CDR3, VH CDR1, VH CDR2, and VH CDR3 from pab1980, e.g., VL CDR1 , VL CDR2, VL CDR3, VH CDR1, VH CDR2, and VH CDR3 from pab1980 are shown in Table. 1 and 2 (SEQ ID NOs: 101, 105, 107, 22, 33 and 34, respectively). In certain variants

The antibody or antigen-binding fragment thereof further comprises one, two, three, or all four VL framework regions derived from a human or primate VL antibody and one, two, three, or all four VH framework regions derived from a human or VH antibody. primacy. In some embodiments, the antibody or antigen-binding fragment thereof contains the VL framework regions and the VH framework regions of the antibody shown in Table 1. 3 and 4, respectively (eg pab1980 framework regions). In a particular embodiment, an antibody or fragment thereof described herein that specifically binds to GITR (e.g., human GITR) comprises VL CDR1, VL CDR2, VL CDR3, VH CDR1, VH CDR2, and VH CDR3 from pab1981, e.g., VL CDR1 , VL CDR2, VL CDR3, VH CDR1, VH CDR2 and VH CDR3 from pab1981, are shown in Table. 1 and 2 (SEQ ID NOs: 103, 105, 107, 22, 33 and 34, respectively). In certain embodiments, the antibody or antigen-binding fragment thereof further comprises one, two, three, or all four VL framework regions derived from the VL of a human or primate antibody and one, two, three, or all four VH framework regions derived from the VH of a human or primate antibody. primacy. In some embodiments, the antibody or antigen-binding fragment thereof contains the VL framework regions and the VH framework regions of the antibody shown in Table 1. 3 and 4, respectively (eg pab1981 frame regions). In a particular embodiment, an antibody or fragment thereof described herein that specifically binds to GITR (e.g., human GITR) comprises VL CDR1, VL CDR2, VL CDR3, VH CDR1, VH CDR2, and VH CDR3 from pab1983, e.g., VL CDR1 , VL CDR2, VL CDR3, VH CDR1, VH CDR2 and VH CDR3 from pab1983, shown in Table. 1 and 2 (SEQ ID NOs: 102, 105, 107, 19, 24 and 34, respectively). In certain embodiments, the antibody or antigen-binding fragment thereof further comprises one, two, three, or all four VL framework regions derived from the VL of a human or primate antibody and one, two, three, or all four VH framework regions derived from the VH of a human or primate antibody. primacy. In some embodiments, the antibody or antigen-binding fragment thereof contains the VL framework regions and the VH framework regions of the antibody shown in Table 1. 3 and 4, respectively (eg pab1983 framework regions). In a particular embodiment, an antibody or fragment thereof described herein that specifically binds to GITR (e.g., human GITR) comprises VL CDR1, VL CDR2, VL CDR3, VH CDR1, VH CDR2, and VH CDR3 from pab2159, e.g., VL CDR1 , VL CDR2, VL CDR3, VH CDR1, VH CDR2, and VH CDR3 from pab2159 are shown in Table 1 and 2 (SEQ ID NOs: 102, 105, 109, 19, 144 and 34, respectively). In certain embodiments, the antibody or antigen-binding fragment thereof further comprises one, two, three, or all four VL framework regions derived from the VL of a human or primate antibody and one, two, three, or all four VH framework regions derived from the VH of a human or primate antibody. primacy. In some embodiments, the antibody or antigen-binding fragment thereof contains the VL framework regions and the VH framework regions of the antibody shown in Table 1. 3 and 4 respectively (eg pab2159 framework regions). In a particular embodiment, an antibody or fragment thereof described herein that specifically binds to GITR (e.g., human GITR) comprises VL CDR1, VL CDR2, VL CDR3, VH CDR1, VH CDR2, and VH CDR3 from pab2160, e.g., VL CDR1 , VL CDR2, VL CDR3, VH CDR1, VH CDR2, and VH CDR3 from pab2160 shown in Table 1 and 2 (SEQ ID NOs: 102, 105, 107, 119, 162 and 34, respectively). In certain embodiments, the antibody or antigen-binding fragment thereof further comprises one, two, three, or all four VL framework regions derived from the VL of a human or primate antibody and one, two, three, or all four VH framework regions derived from the VH of a human or primate antibody. primacy. In some embodiments, the antibody or antigen-binding fragment thereof contains the VL framework regions and the VH framework regions of the antibody shown in Table 1. 3 and 4, respectively (eg pab2160 framework regions). In a particular embodiment, an antibody or fragment thereof described herein that specifically binds to GITR (e.g., human GITR) comprises VL CDR1, VL CDR2, VL CDR3, VH CDR1, VH CDR2, and VH CDR3 from pab2161, e.g., VL CDR1 , VL CDR2, VL CDR3, VH CDR1, VH CDR2, and VH CDR3 from pab2161 shown in Table 1 and 2 (SEQ ID NOs: 103, 105, 109, 22, 121 and 34, respectively). In certain embodiments, the antibody or antigen-binding fragment thereof further comprises one, two, three, or all four VL framework regions derived from the VL of a human or primate antibody and one, two, three, or all four VH framework regions derived from the VH of a human or primate antibody. primacy. In some embodiments, the antibody or antigen-binding fragment thereof contains the VL framework regions and the VH framework regions of the antibody shown in Table 1. 3 and 4, respectively (eg pab2161 frame regions). In certain embodiments, an antibody or fragment thereof that specifically binds to GITR (eg, human GITR) contains a VL domain containing the amino acid sequence of the antibody VL domain shown in FIG. 23 or any of FIG. 24A-24C (eg, the VL domain from one row of FIG. 23 or any of FIGS. 24A-24C). In certain embodiments of the invention, an antibody or fragment thereof that specifically binds to GITR (eg, human GITR) contains a VL domain containing the amino acid sequence of the VL domain of the antibody shown in Table. 17 (for example, a VL domain from one row

- 82 040077 tab. 17). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (eg, human GITR) contains a VL domain containing SEQ ID NO: 207 (eg, Hum231#1 antibody). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (eg, human GITR) contains a VL domain containing SEQ ID NO: 208 (eg, Hum231#2 antibody). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (eg, human GITR) contains a VL domain containing SEQ ID NO: 435 (eg, pab1964 antibody). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (eg, human GITR) contains a VL domain containing SEQ ID NO: 437 (eg, pab1965 antibody). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (eg, human GITR) contains a VL domain containing SEQ ID NO: 440 (eg, pab1966 antibody). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (eg, human GITR) contains a VL domain containing SEQ ID NO: 441 (eg, pab1967 antibody). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (eg, human GITR) contains a VL domain containing SEQ ID NO: 444 (eg, pab1968 antibody). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (eg, human GITR) contains a VL domain containing SEQ ID NO: 458 (eg, pab1969 antibody). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (eg, human GITR) contains a VL domain containing SEQ ID NO: 459 (eg, pab1970 antibody). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (eg, human GITR) contains a VL domain containing SEQ ID NO: 453 (eg, pab1971 antibody). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (eg, human GITR) contains a VL domain containing SEQ ID NO: 463 (eg, pab1972 antibody). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (eg, human GITR) contains a VL domain containing SEQ ID NO: 519 (eg, pab1973 antibody). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (eg, human GITR) contains a VL domain containing SEQ ID NO: 440 (eg, pab1975 antibody). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (eg, human GITR) contains a VL domain containing SEQ ID NO: 444 (eg, pab1976 antibody). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (eg, human GITR) contains a VL domain containing SEQ ID NO: 453 (eg, pab1977 antibody). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (eg, human GITR) contains a VL domain containing SEQ ID NO: 440 (eg, pab1979 antibody). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (eg, human GITR) contains a VL domain containing SEQ ID NO: 444 (eg, pab1980 antibody). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (eg, human GITR) contains a VL domain containing SEQ ID NO: 453 (eg, pab1981 antibody). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (eg, human GITR) contains a VL domain containing SEQ ID NO: 440 (eg, pab1983 antibody). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (eg, human GITR) contains a VL domain containing SEQ ID NO: 408 (eg, pab2159 antibody). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (eg, human GITR) contains a VL domain containing SEQ ID NO: 423 (eg, pab2160 antibody). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (eg, human GITR) contains a VL domain containing SEQ ID NO: 486 (eg, pab2161 antibody).

In some embodiments, an antibody or fragment thereof that specifically binds to GITR (eg, human GITR) contains a VL domain consisting or predominantly consisting of the antibody VL domain amino acid sequence shown in FIG. 23 or any of FIG. 24A-24C (eg, the VL domain from one row of FIG. 23 or any of FIGS. 24A-24C). In some embodiments, an antibody or fragment thereof that specifically binds to GITR (eg, human GITR) contains a VL domain consisting or predominantly consisting of the amino acid sequence of the antibody VL domain shown in Table 1. 17 (for example, VL domain from one row of Table 17). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (eg, human GITR) contains a VL domain consisting or predominantly consisting of SEQ ID NO: 207 (eg, Hum231#1 antibody). In a particular embodiment, an antibody or fragment thereof that specifically binds

- 83 040077 is named with GITR (eg human GITR), contains a VL domain consisting or predominantly consisting of SEQ ID NO: 208 (eg Hum231#2 antibody). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (eg, human GITR) contains a VL domain consisting or predominantly consisting of SEQ ID NO: 435 (eg, pab1964 antibody). In a specific embodiment, an antibody or fragment thereof that specifically binds to GITR (eg, human GITR) contains a VL domain consisting or predominantly consisting of SEQ ID NO: 437 (eg, pab1965 antibody). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (eg, human GITR) contains a VL domain consisting or predominantly consisting of SEQ ID NO: 440 (eg, pab1966 antibody). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (eg, human GITR) contains a VL domain consisting or predominantly consisting of SEQ ID NO: 441 (eg, pab1967 antibody). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (eg, human GITR) contains a VL domain consisting or predominantly consisting of SEQ ID NO: 444 (eg, pab1968 antibody). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (eg, human GITR) contains a VL domain containing SEQ ID NO: 458 (eg, pab1969 antibody). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (eg, human GITR) contains a VL domain consisting or predominantly consisting of SEQ ID NO: 459 (eg, pab1970 antibody). In a specific embodiment, an antibody or fragment thereof that specifically binds to GITR (eg, human GITR) contains a VL domain consisting or predominantly consisting of SEQ ID NO: 453 (eg, pab1971 antibody). In a specific embodiment, an antibody or fragment thereof that specifically binds to GITR (eg, human GITR) contains a VL domain consisting or predominantly consisting of SEQ ID NO: 463 (eg, pab1972 antibody). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (eg, human GITR) contains a VL domain consisting or predominantly consisting of SEQ ID NO: 519 (eg, pab1973 antibody). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (eg, human GITR) contains a VL domain consisting or predominantly consisting of SEQ ID NO: 440 (eg, pab1975 antibody). In a specific embodiment, an antibody or fragment thereof that specifically binds to GITR (eg, human GITR) contains a VL domain consisting or predominantly consisting of SEQ ID NO: 444 (eg, pab1976 antibody). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (eg, human GITR) contains a VL domain consisting or predominantly consisting of SEQ ID NO: 453 (eg, pab1977 antibody). In a specific embodiment, an antibody or fragment thereof that specifically binds to GITR (eg, human GITR) contains a VL domain consisting or predominantly consisting of SEQ ID NO: 440 (eg, pab1979 antibody). In a specific embodiment, an antibody or fragment thereof that specifically binds to GITR (eg, human GITR) contains a VL domain consisting or predominantly consisting of SEQ ID NO: 444 (eg, pab1980 antibody). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (eg, human GITR) contains a VL domain consisting or predominantly consisting of SEQ ID NO: 453 (eg, pab1981 antibody). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (eg, human GITR) contains a VL domain consisting or predominantly consisting of SEQ ID NO: 440 (eg, pab1983 antibody). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (eg, human GITR) contains a VL domain consisting or predominantly consisting of SEQ ID NO: 408 (eg, pab2159 antibody). In a specific embodiment, an antibody or fragment thereof that specifically binds to GITR (eg, human GITR) contains a VL domain consisting or predominantly consisting of SEQ ID NO: 423 (eg, pab2160 antibody). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (eg, human GITR) contains a VL domain consisting or predominantly consisting of SEQ ID NO: 486 (eg, pab2161 antibody). In certain embodiments, an antibody or fragment thereof that specifically binds to GITR (eg, human GITR) contains a VH domain containing the amino acid sequence of the antibody VH domain shown in FIG. 23 or any of FIG. 24A-24C (eg, the VH domain from one row of FIG. 23 or any of FIGS. 24A-24C). In certain embodiments of the invention, an antibody or fragment thereof that specifically binds to GITR (eg, human GITR) contains a VH domain containing the amino acid sequence of the VH domain of the antibody shown in Table. 17 (eg, VH domain from one row of Table 17). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (e.g., human GITR) contains a VH domain containing SEQ ID

- 84 040077

NO: 206 (eg Hum231#1 antibody). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (eg, human GITR) contains a VH domain containing SEQ ID NO: 206 (eg, Hum231#2 antibody). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (eg, human GITR) contains a VH domain containing SEQ ID NO: 249 (eg, pab1964 antibody). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (eg, human GITR) contains a VH domain containing SEQ ID NO: 251 (eg, pab1965 antibody). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (eg, human GITR) contains a VH domain containing SEQ ID NO: 254 (eg, pab1966 antibody). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (eg, human GITR) contains a VH domain containing SEQ ID NO: 255 (eg, pab1967 antibody). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (eg, human GITR) contains a VH domain containing SEQ ID NO: 259 (eg, pab1968 antibody). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (eg, human GITR) contains a VH domain containing SEQ ID NO: 276 (eg, pab1969 antibody). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (eg, human GITR) contains a VH domain containing SEQ ID NO: 277 (eg, pab1970 antibody). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (eg, human GITR) contains a VH domain containing SEQ ID NO: 280 (eg, pab1971 antibody). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (eg, human GITR) contains a VH domain containing SEQ ID NO: 284 (eg, pab1972 antibody). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (eg, human GITR) contains a VH domain containing SEQ ID NO: 304 (eg, pab1973 antibody). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (eg, human GITR) contains a VH domain containing SEQ ID NO: 276 (eg, pab1975 antibody). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (eg, human GITR) contains a VH domain containing SEQ ID NO: 276 (eg, pab1976 antibody). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (eg, human GITR) contains a VH domain containing SEQ ID NO: 276 (eg, pab1977 antibody). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (eg, human GITR) contains a VH domain containing SEQ ID NO: 345 (eg, pab1979 antibody). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (eg, human GITR) contains a VH domain containing SEQ ID NO: 345 (eg, pab1980 antibody). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (eg, human GITR) contains a VH domain containing SEQ ID NO: 345 (eg, pab1981 antibody). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (eg, human GITR) contains a VH domain containing SEQ ID NO: 249 (eg, pab1983 antibody). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (eg, human GITR) contains a VH domain containing SEQ ID NO: 224 (eg, pab2159 antibody). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (eg, human GITR) contains a VH domain containing SEQ ID NO: 237 (eg, pab2160 antibody). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (eg, human GITR) contains a VH domain containing SEQ ID NO: 315 (eg, pab2161 antibody).

In some embodiments, an antibody or fragment thereof that specifically binds to GITR (eg, human GITR) contains a VH domain consisting or predominantly consisting of the antibody VH domain amino acid sequence shown in FIG. 23 or any of FIG. 24A-24C (eg, the VH domain from one row of FIG. 23 or any of FIGS. 24A-24C). In some embodiments, an antibody or fragment thereof that specifically binds to GITR (eg, human GITR) contains a VH domain consisting or predominantly consisting of the antibody VH domain amino acid sequence shown in Table 1. 17 (eg, VH domain from one row of Table 17). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (eg, human GITR) contains a VH domain consisting or predominantly consisting of SEQ ID NO: 206 (eg, Hum231#1 antibody). In a specific embodiment, an antibody or fragment thereof that specifically binds to GITR (eg, human GITR) contains a VH domain consisting or predominantly consisting of SEQ ID NO: 206 (eg, Hum231#2 antibody). In a specific implementation of

An antibody or fragment thereof that specifically binds to GITR (eg human GITR) contains a VH domain consisting or predominantly consisting of SEQ ID NO: 249 (eg pab1964 antibody). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (eg, human GITR) contains a VH domain consisting or predominantly consisting of SEQ ID NO: 251 (eg, pab1965 antibody). In a specific embodiment, an antibody or fragment thereof that specifically binds to GITR (eg, human GITR) contains a VH domain consisting or predominantly consisting of SEQ ID NO: 254 (eg, pab1966 antibody). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (eg, human GITR) contains a VH domain consisting or predominantly consisting of SEQ ID NO: 255 (eg, pab1967 antibody). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (eg, human GITR) contains a VH domain consisting or predominantly consisting of SEQ ID NO: 259 (eg, pab1968 antibody). In a specific embodiment, an antibody or fragment thereof that specifically binds to GITR (eg, human GITR) contains a VH domain consisting or predominantly consisting of SEQ ID NO: 276 (eg, pab1969 antibody). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (eg, human GITR) contains a VH domain consisting or predominantly consisting of SEQ ID NO: 277 (eg, pab1970 antibody). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (eg, human GITR) contains a VH domain consisting or predominantly consisting of SEQ ID NO: 280 (eg, pab1971 antibody). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (eg, human GITR) contains a VH domain consisting or predominantly consisting of SEQ ID NO: 284 (eg, pab1972 antibody). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (eg, human GITR) contains a VH domain consisting or predominantly consisting of SEQ ID NO: 304 (eg, pab1973 antibody). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (eg, human GITR) contains a VH domain consisting or predominantly consisting of SEQ ID NO: 276 (eg, pab1975 antibody). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (eg, human GITR) contains a VH domain consisting or predominantly consisting of SEQ ID NO: 276 (eg, pab1976 antibody). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (eg, human GITR) contains a VH domain consisting or predominantly consisting of SEQ ID NO: 276 (eg, pab1977 antibody). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (eg, human GITR) contains a VH domain consisting or predominantly consisting of SEQ ID NO: 345 (eg, pab1979 antibody). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (eg, human GITR) contains a VH domain consisting or predominantly consisting of SEQ ID NO: 345 (eg, pab1980 antibody). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (eg, human GITR) contains a VH domain consisting or predominantly consisting of SEQ ID NO: 345 (eg, pab1981 antibody). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (eg, human GITR) contains a VH domain consisting or predominantly consisting of SEQ ID NO: 249 (eg, pab1983 antibody). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (eg, human GITR) contains a VH domain consisting or predominantly consisting of SEQ ID NO: 224 (eg, pab2159 antibody). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (eg, human GITR) contains a VH domain consisting or predominantly consisting of SEQ ID NO: 237 (eg, pab2160 antibody). In a specific embodiment, an antibody or fragment thereof that specifically binds to GITR (eg, human GITR) contains a VH domain consisting or predominantly consisting of SEQ ID NO: 315 (eg, pab2161 antibody).

In certain embodiments of the invention, an antibody or fragment thereof that specifically binds to GITR (for example, human GITR) contains a VH domain and a VL domain, while the VH domain and the VL domain contain the amino acid sequence of the VH domain and the VL domain the antibody shown in Fig. 23 or any of FIG. 24A-24C (eg, VH domain and VL domain from the same row of FIG. 23 or either of FIGS. 24A-24C). In certain embodiments of the invention, an antibody or fragment thereof that specifically binds to GITR (for example, human GITR) contains a VH domain and a VL domain, while the VH domain and the VL domain contain the amino acid sequence of the VH domain and the VL domain antibodies given in table. 17 (for example, VH domain and VL domain from the same row of Table 17). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (e.g., human GITR) contains a VL domain containing SEQ

- 86 040077

ID NO: 207, and a VH domain containing SEQ ID NO: 206 (eg, Hum231#1 antibody). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (e.g., human GITR) contains a VL domain containing SEQ ID NO: 208 and a VH domain containing SEQ ID NO: 206 (e.g., the Hum231 antibody #2). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (e.g., human GITR) contains a VL domain containing SEQ ID NO: 435 and a VH domain containing SeQ ID NO: 249 (e.g., pab1964 antibody ). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (e.g., human GITR) contains a VL domain containing SEQ ID NO: 437 and a VH domain containing SEQ ID NO: 251 (e.g., pab1965 antibody ). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (e.g., human GITR) contains a VL domain containing SEQ ID NO: 440 and a VH domain containing SEQ ID NO: 254 (e.g., pab1966 antibody ). In a specific embodiment, an antibody or fragment thereof that specifically binds to GITR (e.g., human GITR) contains a VL domain containing SEQ ID NO: 441 and a VH domain containing SEQ ID NO: 255 (e.g., pab1967 antibody ). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (e.g., human GITR) contains a VL domain containing SEQ ID NO: 444 and a VH domain containing SEQ ID NO: 259 (e.g., pab1968 antibody). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (e.g., human GITR) contains a VL domain containing SEQ ID NO: 458 and a VH domain containing SEQ ID NO: 276 (e.g., pab1969 antibody ). In a specific embodiment, an antibody or fragment thereof that specifically binds to GITR (e.g., human GITR) contains a VL domain containing SEQ ID NO: 459 and a VH domain containing SEQ ID NO: 277 (e.g., pab1970 antibody ). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (e.g., human GITR) contains a VL domain containing SEQ ID NO: 453 and a VH domain containing SEQ ID NO: 280 (e.g., pab1971 antibody ). In a specific embodiment, an antibody or fragment thereof that specifically binds to GITR (e.g., human GITR) contains a VL domain containing SEQ ID NO: 463 and a VH domain containing SEQ ID NO: 284 (e.g., pab1972 antibody ). In a specific embodiment, an antibody or fragment thereof that specifically binds to GITR (e.g., human GITR) contains a VL domain containing SEQ ID NO: 519 and a VH domain containing SEQ ID NO: 304 (e.g., pab1973 antibody ). In a specific embodiment, an antibody or fragment thereof that specifically binds to GITR (e.g., human GITR) contains a VL domain containing SEQ ID NO: 440 and a VH domain containing SEQ ID NO: 276 (e.g., pab1975 antibody ). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (e.g., human GITR) contains a VL domain containing SEQ ID NO: 444 and a VH domain containing SEQ ID NO: 276 (e.g., pab1976 antibody ). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (e.g., human GITR) contains a VL domain containing SEQ ID NO: 453 and a VH domain containing SEQ ID NO: 276 (e.g., pab1977 antibody ). In a specific embodiment, an antibody or fragment thereof that specifically binds to GITR (e.g., human GITR) contains a VL domain containing SEQ ID NO: 440 and a VH domain containing SEQ ID NO: 345 (e.g., pab1979 antibody ). In a specific embodiment, an antibody or fragment thereof that specifically binds to GITR (e.g., human GITR) contains a VL domain containing SEQ ID NO: 444 and a VH domain containing SEQ ID NO: 345 (e.g., pab1980 antibody ). In a specific embodiment, an antibody or fragment thereof that specifically binds to GITR (e.g., human GITR) contains a VL domain containing SEQ ID NO: 453 and a VH domain containing SEQ ID NO: 345 (e.g., pab1981 antibody ). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (e.g., human GITR) contains a VL domain containing SEQ ID NO: 440 and a VH domain containing SEQ ID NO: 249 (e.g., pab1983 antibody ). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (e.g., human GITR) contains a VL domain containing SEQ ID NO: 408 and a VH domain containing SEQ ID NO: 224 (e.g., pab2159 antibody ). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (e.g., human GITR) contains a VL domain containing SEQ ID NO: 423 and a VH domain containing SEQ ID NO: 237 (e.g., pab2160 antibody ). In a specific embodiment, an antibody or fragment thereof that specifically binds to GITR (e.g., human GITR) contains a VL domain containing SEQ ID NO: 486 and a VH domain containing SEQ ID NO: 315 (e.g., pab2161 antibody ).

In certain embodiments, an antibody or fragment thereof that specifically binds to GITR (e.g., human GITR) comprises a VH domain and a VL domain, wherein the VH domain and VL domain consist or predominantly consist of the amino acid sequence of the VH domain and the VL domain of the antibody shown in FIG. 23 or any of FIG. 24A-24C (for example, VH

- 87 040077 domain and VL domain from the same row of FIG. 23 or any of FIG. 24A-24C). In certain embodiments, an antibody or fragment thereof that specifically binds to GITR (e.g., human GITR) comprises a VH domain and a VL domain, wherein the VH domain and VL domain consist or predominantly consist of the amino acid sequence of the VH domain and the VL domain of the antibody shown in table. 17 (for example, VH domain and VL domain from the same row of Table 17). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (e.g., human GITR) comprises a VL domain and a VH domain, wherein the VL domain consists or predominantly consists of SEQ ID NO: 207 and the VH- the domain consists or predominantly consists of SEQ ID NO: 206 (eg, antibody Hum231#1). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (e.g., human GITR) comprises a VL domain and a VH domain, wherein the VL domain consists or predominantly consists of SEQ ID NO: 208 and the VH domain consists or predominantly consists of SEQ ID NO: 206 (eg Hum231#2 antibody). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (e.g., human GITR) comprises a VL domain and a VH domain, wherein the VL domain consists or predominantly consists of SEQ ID NO: 435 and the VH is the domain consists or predominantly consists of SEQ ID NO: 249 (eg, antibody pab1964). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (e.g., human GITR) comprises a VL domain and a VH domain, wherein the VL domain consists or predominantly consists of SEQ ID NO: 437 and the VH- the domain consists or predominantly consists of SEQ ID NO: 251 (eg, antibody pab1965). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (e.g., human GITR) contains a VL domain and a VH domain, with the VL domain consisting or predominantly consisting of SEQ ID NO: 440 and the VH- the domain consists or predominantly consists of SEQ ID NO: 254 (eg pab1966 antibody). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (e.g., human GITR) contains a VL domain and a VH domain, with the VL domain consisting or predominantly consisting of SEQ ID NO: 441 and the VH- the domain consists or predominantly consists of SEQ ID NO: 255 (eg, antibody pab1967). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (e.g., human GITR) comprises a VL domain and a VH domain, wherein the VL domain consists or predominantly consists of SEQ ID NO: 444 and the VH- the domain consists or predominantly consists of SEQ ID NO: 259 (eg pab1968 antibody). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (e.g., human GITR) comprises a VL domain and a VH domain, with the VL domain consisting or predominantly consisting of SEQ ID NO: 458 and the VH- the domain consists or predominantly consists of SEQ ID NO: 276 (eg, antibody pab1969). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (e.g., human GITR) comprises a VL domain and a VH domain, wherein the VL domain consists or predominantly consists of SEQ ID NO: 459 and the VH domain consists or predominantly consists of SEQ ID NO: 277 (eg pab1970 antibody). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (e.g., human GITR) comprises a VL domain and a VH domain, with the VL domain consisting or predominantly consisting of SEQ ID NO: 453 and the VH- the domain consists or predominantly consists of SEQ ID NO: 280 (eg pab1971 antibody). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (e.g., human GITR) contains a VL domain and a VH domain, with the VL domain consisting or predominantly consisting of SEQ ID NO: 463 and the VH- the domain consists or predominantly consists of SEQ ID NO: 284 (eg, antibody pab1972). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (e.g., human GITR) contains a VL domain and a VH domain, wherein the VL domain consists or predominantly consists of SEQ ID NO: 519 and the VH- the domain consists or predominantly consists of SEQ ID NO: 304 (eg, antibody pab1973). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (e.g., human GITR) contains a VL domain and a VH domain, with the VL domain consisting or predominantly consisting of SEQ ID NO: 440 and the VH- the domain consists or predominantly consists of SEQ ID NO: 276 (eg, antibody pab1975). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (e.g., human GITR) comprises a VL domain and a VH domain, wherein the VL domain consists or predominantly consists of SEQ ID NO: 444 and the VH- the domain consists or predominantly consists of SEQ ID NO: 276 (eg pab1976 antibody). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (e.g., human GITR) comprises a VL domain and a VH domain, wherein the VL domain consists or predominantly consists of SEQ ID NO: 453 and the VH- the domain consists or predominantly consists of SEQ ID NO: 276 (eg pab1977 antibody). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (e.g., human GITR) comprises a VL domain and a VH domain, wherein the VL domain consists or predominantly consists of SEQ ID NO: 440 and the VH- the domain consists or predominantly consists of SEQ ID NO: 345 (eg pab1979 antibody). In particular

- 88 040077 embodiment of the invention, an antibody or fragment thereof that specifically binds to GITR (for example, human GITR) contains a VL domain and a VH domain, while the VL domain consists or predominantly consists of SEQ ID NO: 444, and VH the α-domain consists or predominantly consists of SEQ ID NO: 345 (eg pab1980 antibody). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (e.g., human GITR) comprises a VL domain and a VH domain, wherein the VL domain consists or predominantly consists of SEQ ID NO: 453 and the VH domain consists or predominantly consists of SEQ ID NO: 345 (eg pab1981 antibody). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (e.g., human GITR) comprises a VL domain and a VH domain, wherein the VL domain consists or predominantly consists of SEQ ID NO: 440 and the VH- the domain consists or predominantly consists of SEQ ID NO: 249 (eg pab1983 antibody). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (e.g., human GITR) comprises a VL domain and a VH domain, wherein the VL domain consists or predominantly consists of SEQ ID NO: 408 and the VH- the domain consists or predominantly consists of SEQ ID NO: 224 (eg, antibody pab2159). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (e.g., human GITR) comprises a VL domain and a VH domain, with the VL domain consisting or predominantly consisting of SEQ ID NO: 423 and the VH- the domain consists or predominantly consists of SEQ ID NO: 237 (eg pab2160 antibody). In a particular embodiment, an antibody or fragment thereof that specifically binds to GITR (e.g., human GITR) contains a VL domain and a VH domain, with the VL domain consisting or predominantly consisting of SEQ ID NO: 486 and the VH- the domain consists or predominantly consists of SEQ ID NO: 315 (eg, antibody pab2161).

In certain aspects, an antibody described herein can be described only in relation to its VL domain, or only its VH domain, or only its 3 VL CDRs, or only its 3 VH CDRs. See, for example, Rader C et al. (1998) PNAS 95: 8910-8915, which is incorporated herein by reference in its entirety, describing the humanization of a mouse anti-a _{¥ 3} antibody by detection of a complementary light chain or heavy chain, respectively, from a library of human light chains or heavy chains , resulting in humanized antibody variants with the same or greater affinity as compared to the affinity of the parent antibody. See also Clackson T et al. (1991) Nature 352: 624-628, which is incorporated herein by reference in its entirety, describing methods for making antibodies that bind a specific antigen by using a particular VL domain (or VH domain) and screening the library for complementary variable domains. The screening resulted in 14 new partners for a specific VH domain and 13 new partners for a specific VL domain, which showed strong binding when analyzed by ELISA. See also Kim SJ & Hong HJ, (2007) J Microbiol 45: 572-577, which is incorporated herein by reference in its entirety, describing methods for generating antibodies that bind a specific antigen by applying a specific VH domain and screening libraries (eg, human VL libraries) for complementary VL domains; the selected VL domains can in turn be used to select additional complementary (eg, human) VH domains.

In certain aspects, the CDRs of antibodies can be defined according to the Chothia numbering scheme, which is based on the location of the structural loops of the immunoglobulin (see, for example, Chothia C & Lesk AM, (1987), J Mol Biol 196: 901-917; Al-Lazikani B et al (1997) J Mol Biol 273: 927-948 Chothia C et al (1992) J Mol Biol 227: 799-817 Tramontano A et al (1990) J Mol Biol 215(1): 175 -82 and US Pat. No. 7,709,226). Typically, in the Kabat numbering system, the Hotia CDR-H1 loop occupies heavy chain amino acids 26 to 32, 33, or 34, the Hotia CDR-H2 loop occupies heavy chain amino acids from 52 to 56, and the Hotia CDR-H3 loop occupies amino acids heavy chain from 95 to 102, while the Hotia CDR-L1 loop occupies light chain amino acids 24 to 34, the Hotia CDR-L2 loop occupies light chain amino acids 50 to 56, and the Hotia CDR-L3 loop occupies amino acids light chain from 89 to 97. The end of the CDR-H1 loop according to Hotia, when numbered according to the Kabat numbering system, may fall on H32 and H34, depending on the length of the loop (this is because in the Kaban numbering scheme, there are inserts in place of H35A and H35B; if neither 35A nor 35B is present, the loop ends at 32; if only 35A is present, the loop ends at 33; if 35A and 35B are present, the loop ends at 34). In certain aspects, provided herein are antibodies or fragments thereof that specifically bind to GITR (e.g., human GITR) and contain one or more Hotia VL CDRs of any of the antibodies described herein (e.g., any of Hum231#1, Hum231 #2, pab1964, pab1965, pab1966, pab1967, pab1968, pab1969, pab1970, pab1971, pab1972, pab1973, pab1975, pab1976, pab1977, pab1979, pab1980, pab1981, pab1983, 23132-15 или антител 1-107, или антител pab2159, pab2160 or pab2161) and/or one or more Hotia VH CDRs of any of the antibodies described herein (e.g., any of Hum231#1, Hum231#2, pab1964, pab1965, pab1966, pab1967, pab1968, pab1969, pab1970, pab1971, pab1972, pab1973, pab1975, pab1976, pab1977, pab1979, pab1980, pab1981, pab1983, 231-32-15 or antibodies 1-107, or anti

- 89 040077 pab2159, pab2160 or pab2161). In certain embodiments, antibodies or fragments thereof that specifically bind to GITR (eg, human GITR) contain one or more CDRs in which the Kabat and Hotia CDRs have the same amino acid sequence. In certain embodiments of the invention, provided herein are antibodies or fragments thereof that specifically bind to GITR (eg, human GITR) and contain combinations of the Kabat CDR and Hotia CDR. In a particular embodiment, provided herein are antibodies or fragments thereof that specifically bind to GITR (e.g., human GITR) and contain the Hotia CDR of any of the antibodies described herein (e.g., Hum231#1, Hum231#2, pab1964, pab1965, pab1966, pab1967, pab1968, pab1969, pab1970, pab1971, pab1972, pab1973, pab1975, pab1976, pab1977, pab1979, pab1980, pab1981, pab1983, 23132-15 или антител 1-107, или антител pab2159, pab2160 или pab2161).

In certain aspects, CDRs of antibodies can be defined according to the IMGT numbering system described in Lefranc M-P, (1999) The Immunologist 7: 132-136 and Lefranc M-P et al. (1999) Nucleic Acids Res 27: 209-212. According to the IMGT numbering scheme, VH-CDR1 corresponds to positions 26 to 35, VH-CDR2 corresponds to positions 51 to 57, VH-CDR3 corresponds to positions 93 to 102, VL-CDR1 corresponds to positions 27 to 32, VL-CDR2 corresponds to positions 50 to 52, and VL-CDR3 corresponds to positions 89 to 97. In a particular embodiment, this document provides antibodies or fragments thereof that specifically bind to GITR (e.g., human GITR) and contain a CDR of any of those described herein. antibody document (for example, any of the antibodies Hum231#1, Hum231#2, pab1964, pab1965, pab1966, pab1967, pab1968, pab1969, pab1970, pab1971, pab1972, pab1973, pab1975, pab1976, pab1977, pab1970, pab1988, pab1988, 23132-15 or antibodies 1-107, or antibodies pab2159, pab2160 or pab2161), which are defined by the IMGT numbering system, for example, as described in Lefranc M-P (1999), supra, and Lefranc M-P et al. (1999), supra).

In certain aspects, CDRs of antibodies can be defined according to MacCallum RM et al. (1996) J Mol Biol 262: 732-745. See also, for example, Martin A. Protein Sequence and Structure Analysis of Antibody Variable Domains in Antibody Engineering, Kontermann and Dubel, eds., Chapter 31, pp. 422-439, Springer-Verlag, Berlin (2001). In a specific embodiment, provided herein are antibodies or fragments thereof that specifically bind to GITR (e.g., human GITR) and contain the CDRs of any of the antibodies described herein (e.g., any of the antibodies Hum231#1, Hum231#2, pab1964 , pab1965, pab1966, pab1967, pab1968, pab1969, pab1970, pab1971, pab1972, pab1973, pab1975, pab1976, pab1977, pab1979, pab1980, pab1981, pab1983, 231-32-15 или антител 1-107, или антител pab2159, pab2160 или pab2161), which are determined by the method of MacCallum RM et al. In certain aspects, antibody CDRs can be determined according to the AbM numbering scheme, which is based on AbM hypervariable regions, a compromise between Kabat CDRs and Hotia structural loops, and is used in Oxford Molecular's AbM antibody modeling software (Oxford Molecular Group, Inc.). In a specific embodiment, provided herein are antibodies or fragments thereof that specifically bind to GITR (e.g., human GITR) and contain the CDRs of any of the antibodies described herein (e.g., any of the antibodies Hum231#1, Hum231#2, pab1964 , pab1965, pab1966, pab1967, pab1968, pab1969, pab1970, pab1971, pab1972, pab1973, pab1975, pab1976, pab1977, pab1979, pab1980, pab1981, pab1983, 231-32-15 или антител 1-107, или антител pab2159, pab2160 или pab2161), which are defined by the AbM numbering scheme.

In a particular embodiment, the positions of one or more CDRs in the VH (eg, CDR1, CDR2, or CDR3) and/or VL (eg, CDR1, CDR2, or CDR3) region of an antibody described herein may differ by one, two, three, four , five or six amino acid positions as long as immunospecific binding to GITR (e.g., human GITR) is retained (e.g., largely retained, e.g., at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%). For example, in one embodiment, positions defining the CDR of any antibody described herein (e.g., Hum231#1, Hum231#2, pab1964, pab1965, pab1966, pab1967, pab1968, pab1969, pab1970, pab1971, pab1972, pab1973, pab1975, pab1976, pab1977, pab1979, pab1980, pab1981, pab1983, 231-32-15 or antibodies 1-107, or antibodies pab2159, pab2160 or pab2161) may differ due to a shift of the N-terminal and/or C-terminal boundary of the CDR by one, two, three, four, five, or six amino acids compared to the CDR positions of any of the antibodies described herein (e.g., Hum231#1, Hum231#2, pab1964, pab1965, pab1966, pab1967, pab1968, pab1969, pab1970, pab1971, pab1972 , pab1973, pab1975, pab1976, pab1977, pab1979, pab1980, pab1981, pab1983, 231-32-15, or antibodies 1-107, or antibodies pab2159, pab2160 or pab2161, as defined e.g. in Table 1) until retains immunospecific binding to GITR (e.g., human GITR) (e.g., to a large extent e.g., at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% is retained. In another embodiment, the length of one or more CDRs in the VH (eg, CDR1, CDR2, or CDR3) and/or VL (eg, CDR1, CDR2, or CDR3) region of an antibody described herein may

- 90 040077 vary (e.g. be one, two, three, four, five or more amino acids more or less as long as immunospecific binding to GITR (e.g. human

GITR) (eg, largely retained, eg, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%).

In one embodiment, the VL CDR1, VL CDR2, VL CDR3, VH CDR1, VH CDR2, and/or VH CDR3 described herein may be one, two, three, four, five, or more amino acids shorter than one or more of the described herein CDRs (e.g., SEQ ID NOs: 1-34, 101-109, or 114-189, or SEQ ID NOs: 35 or 191-194), as long as immunospecific binding to GITR (e.g., human GITR ) (eg, largely retained, eg, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%). In another embodiment, the VL CDR1, VL CDR2, VL CDR3, VH CDR1, VH CDR2 and/or VH CDR3 described herein may be one, two, three, four, five or more amino acids longer than one or more of the described in this CDR document (e.g., SEQ ID NOs: 1-34, 101-109, or 114-189, or SEQ ID NOs: 35 or 191-194) as long as immunospecific binding to GITR (e.g., human GITR) is maintained (eg, largely retained, eg, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%). In another embodiment, the amino terminus of the VL CDR1, VL CDR2, VL CDR3, VH CDR1, VH CDR2 and/or VH CDR3 described herein may be extended by one, two, three, four, five or more amino acids compared to one or more of the CDRs described herein (e.g., SEQ ID NOS: 1-34, 101-109, or 114-189, or SEQ ID NOS: 35 or 191-194) as long as immunospecific binding to GITR is maintained (e.g., , human GITR) (e.g., largely preserved, e.g., at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%) . In another embodiment of the invention, the carboxy-terminus of the VL CDR1, VL CDR2, VL CDR3, VH CDR1, VH CDR2 and/or VH CDR3 described herein may be extended by one, two, three, four, five or more amino acids compared to one or more of the CDRs described herein (e.g., SEQ ID NOs: 1-34, 101109, or 114-189, or SEQ ID NOs: 35 or 191-194) as long as immunospecific binding to GITR (e.g., human GITR) (eg, largely retained, eg, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%). In another embodiment, the amino terminus of the VL CDR1, VL CDR2, VL CDR3, VH CDR1, VH CDR2 and/or VH CDR3 described herein may be shortened by one, two, three, four, five or more amino acids compared to one or more of the CDRs described herein (e.g., SEQ ID NOS: 1-34, 101-109, or 114-189, or SEQ ID NOS: 35 or 191-194) as long as immunospecific binding to GITR is maintained (e.g., , human GITR) (e.g., largely preserved, e.g., at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%) . In one embodiment of the invention, the carboxy-terminus of the VL CDR1, VL CDR2, VL CDR3, VH CDR1, VH CDR2 and/or VH CDR3 described herein may be shortened by one, two, three, four, five or more amino acids compared to one or more of the CDRs described herein (e.g., SEQ ID NOS: 1-34, 101-109, or 114-189, or SEQ ID NOS: 35 or 191194) as long as immunospecific binding to GITR (e.g., human GITR) (eg, largely retained, eg, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%). Any method known in the art can be used to determine if immunospecific binding to GITR (eg, human GITR) is maintained, such as the assay and binding conditions described in the examples section (section 6) herein.

In a specific aspect, provided herein is an antibody comprising a light chain and a heavy chain of an antibody, eg, a separate light and heavy chain. With respect to the light chain, in a particular embodiment, the light chain of an antibody described herein is a kappa light chain. In another specific embodiment, the light chain of an antibody described herein is a lambda light chain. In another specific embodiment, the light chain of an antibody described herein is a human kappa light chain or a human lambda light chain. In a specific embodiment, an antibody described herein that immunospecifically binds to a GITR polypeptide (e.g., human GITR) comprises a light chain, wherein the amino acid sequence of the VL domain contains any amino acid sequence described herein (e.g., SEQ ID NO: 202 , 204, 205, 207, 208, or 400-518), and the light chain constant region contains the amino acid sequence of the human kappa light chain constant region. In a particular embodiment, an antibody described herein that immunospecifically binds to a GITR polypeptide (e.g., human GITR) comprises a light chain, wherein the amino acid sequence of the VL domain contains any amino acid sequence described herein (e.g., SEQ ID NO: 519), and the light chain constant region contains the amino acid sequence of the human kappa light chain constant region. In another specific embodiment, an antibody described herein that immunospecifically binds to GITR (e.g., human GITR) comprises a light chain, wherein the amino acid sequence of the VL domain may comprise any amino acid sequence described herein (e.g., SEQ ID NO: 202, 204, 205, 207, 208 or 400-518), and the light chain constant region contains the amino acid sequence of the human lambda light chain constant region. In another specific embodiment, an antibody described herein that immunospecifically binds to GITR (e.g., human GITR) comprises a light chain, wherein the amino acid sequence of the VL domain may comprise any amino acid sequence described herein (e.g., SEQ ID NO: 519), and the light chain constant region contains the amino acid sequence of the human lambda light chain constant region. In a particular embodiment, an antibody described herein that immunospecifically binds to GITR (e.g., human GITR) contains a light chain, wherein the amino acid sequence of the VL domain contains (SEQ ID NO: 207 or 208) and the light chain constant region contains the amino acid sequence of the human kappa light chain or lambda light chain constant region. Non-limiting examples of human constant region sequences have been described in the art, for example, see US Pat. No. 5,693,780 and Kabat EA et al. (1991), supra. In a particular embodiment, an antibody or fragment thereof described herein that specifically binds to GITR (e.g., human GITR) comprises a light chain containing an amino acid sequence selected from the group consisting of SEQ ID NOs: 555, 556, 571-576 and 580. In a specific embodiment, an antibody or fragment thereof described herein that specifically binds to GITR (e.g., human GITR) comprises a light chain containing an amino acid sequence selected from the group consisting of SEQ ID NOs: 571-576. With respect to the heavy chain, in a particular embodiment, the heavy chain of an antibody described herein may be an alpha (α), delta (δ), epsilon (ε), gamma (γ) or mu (μ) heavy chain. In another specific embodiment, the heavy chain of an antibody described herein may include a human alpha (α), delta (δ), epsilon (ε), gamma (γ) or mu (μ) human heavy chain. In a particular embodiment, an antibody described herein that immunospecifically binds to GITR (e.g., human GITR) comprises a heavy chain, wherein the amino acid sequence of the VH domain may comprise any amino acid sequence described herein (e.g., any of SEQ ID NO : 201, 203, 206 or 215-389), and the heavy chain constant region contains the amino acid sequence of the human heavy chain constant region gamma (γ). In a particular embodiment, an antibody described herein that specifically binds to GITR (e.g., human GITR) comprises a heavy chain, wherein the VH domain amino acid sequence comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 553, 554 , 567-570 and 579, and the heavy chain constant region contains the human heavy chain amino acid sequence described herein or known in the art. In a particular embodiment, an antibody described herein that specifically binds to GITR (e.g., human GITR) comprises a heavy chain, wherein the VH domain amino acid sequence comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 581 and 582 , and the heavy chain constant region contains the human heavy chain amino acid sequence described herein or known in the art. Non-limiting examples of human constant region sequences have been described in the art, for example, see US Pat. No. 5,693,780 and Kabat EA et al. (1991), supra.

In a particular embodiment, an antibody or fragment thereof described herein that specifically binds to GITR (e.g., human GITR) comprises a heavy chain containing an amino acid sequence selected from the group consisting of SEQ ID NOs: 553, 554, 567- 570 and 579. In a particular embodiment, an antibody or fragment thereof described herein that specifically binds to GITR (e.g., human GITR) comprises a heavy chain comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 581 and 582. In a particular embodiment, an antibody or fragment thereof that binds to GITR (eg, human GITR) contains a heavy chain containing the amino acid sequence of SEQ ID NO: 567-570. In a specific embodiment of the invention, an antibody described herein that immunospecifically binds to GITR (e.g., human GITR) contains a VL domain and a VH domain containing any of the amino acid sequences described herein, and the constant regions contain the amino acid sequences of the constant regions of the molecules immunoglobulins IgG, IgE, IgM, IgD, IgA

- 92 040077 or IgY or human immunoglobulin molecules IgG, IgE, IgM, IgD, IgA or IgY. In another specific embodiment, an antibody described herein that immunospecifically binds to GITR (e.g., human GITR) comprises a VL domain and a VH domain containing any of the amino acid sequences described herein, and the constant regions comprise the amino acid sequences of the constant regions. IgG, IgE, IgM, IgD, IgA or IgY immunoglobulin molecules of any class (eg IgG1, IgG2, IgG3, IgG4, IgA1 and IgA2) or any subclass (eg IgG2a and IgG2b) of immunoglobulin molecules. In a particular embodiment, the constant regions comprise the amino acid sequences of the constant regions of human IgG, IgE, IgM, IgD, IgA, or IgY immunoglobulin molecules of any class (e.g., IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2) or any subclass (e.g., IgG2a). and IgG2b) immunoglobulin molecules.

In another specific embodiment, an antibody described herein that immunospecifically binds to GITR (e.g., human GITR) comprises a VL domain and a VH domain containing any of the amino acid sequences described herein, and the constant regions comprise the amino acid sequences of the constant regions. human IgG1 (eg Glm3, Glm17.1 or Glm17.1.2 allotypes) or human IgG4. In a particular embodiment, an antibody described herein that immunospecifically binds to GITR (e.g., human GITR) comprises a VL domain and a VH domain containing any of the amino acid sequences described herein, and the constant regions comprise the amino acid sequences of the human constant region. IgG1 (Glm3 allotype). Non-limiting examples of human constant regions have been described in the art, for example, see Kabat EA et al. (1991), supra.

In another embodiment, an antibody or fragment thereof described herein that specifically binds to GITR (e.g., human GITR) comprises a light chain containing an amino acid sequence selected from the group consisting of SEQ ID NOs: 555, 556, 571- 576 and 580, and a heavy chain containing an amino acid sequence selected from the group consisting of SEQ ID NOs: 553, 554, 567-570, and 579. In another embodiment, an antibody described herein, or a fragment thereof, that specifically binds to GITR (e.g., human GITR) comprises a light chain containing the amino acid sequence of SEQ ID NO: 576 and a heavy chain containing an amino acid sequence selected from the group consisting of SEQ ID NO: 581 and 582. In a particular embodiment, an antibody or its fragment that specifically binds to GITR (e.g., human GITR) contains a light chain containing an amino acid the sequence of SEQ ID NO: 555 or 556, and a heavy chain containing the amino acid sequence of SEQ ID NO: 554.

In certain embodiments, the Fc region of an antibody or fragment thereof described herein (e.g., the CH2 domain (human IgG1 residues 231-340) and/or the CH3 domain (human IgG1 residues 341-447), and/or the hinge region with one, two or more mutations (eg, amino acid substitutions) to change one or more functional properties of the antibody, such as serum half-life, complement fixation, Fc-binding receptor and/or antibody-dependent cellular cytotoxicity.

In certain embodiments, one, two, or more mutations (e.g., amino acid substitutions) are introduced into the hinge region of the Fc region (CH1 domain) such that the number of cysteine residues in the hinge region changes (e.g., up or down) as described, for example, in US Pat. No. 5,677,425. The number of cysteine residues in the hinge region of the CH1 domain can be changed, for example, to facilitate the assembly of light and heavy chains, or to change (eg, increase or decrease) the stability of the antibody.

In some embodiments, the Fc region of an antibody or fragment thereof described herein (e.g., a CH2 domain (human IgG1 residues 231-340) and/or a CH3 domain (human IgG1 residues 341-447), and/or a hinge region with numbering according to the Kabat numbering system (for example, Kabat's EU index)) introduced one, two or more mutations (for example, amino acid substitutions) to increase or decrease the affinity of the antibody for the Fc receptor (for example, the activated Fc receptor) on the surface of the effector cell . Mutations in the Fc region of an antibody or fragment thereof that decrease or increase the affinity of the antibody for the Fc receptor, as well as methods for introducing such mutations into the Fc receptor or fragment thereof, are known to those skilled in the art. Examples of mutations in the Fc region of an antibody that can be made to change the affinity of the antibody for the Fc receptor are described, for example, in Smith P et al. (2012) PNAS 109: 6181-6186, US Pat. No. 6,737,056 and International Publications No. WO 02/060919; W098/23289; and WO 97/34631, which are incorporated herein by reference.

In a specific embodiment of the invention, one, two or more amino acid mutations (i.e., substitutions, insertions, or deletions) are made to the IgG constant domain or FcRn-binding fragment (preferably an Fc domain fragment or hinge-Fc region) to change (e.g., decrease

- 93 040077 or increase) in vivo half-life of the antibody. See, for example, International Publications No. WO 02/060919; W098/23289; and WO 97/34631; and US Pat. Nos. 5,869,046; 6,121,022; In some embodiments, one, two, or more amino acid mutations (i.e., substitutions, insertions, or deletions) are introduced into the IgG constant domain or FcRn-binding fragment (preferably an Fc domain fragment or hinge-Fc region) to reduce the half-life of the antibody in vivo. In other embodiments, one, two, or more amino acid mutations (i.e., substitutions, insertions, or deletions) are introduced into the IgG constant domain or FcRn-binding fragment (preferably an Fc domain fragment or hinge-Fc region) to increase the in vivo half-life of the antibody. . In a particular embodiment, the antibodies may contain one or more amino acid mutations (e.g., substitutions) in the second constant domain (CH2) (human IgG1 residues 231-340) and/or the third constant domain (CH3) (human IgG1 residues 341-447) numbered according to Kabat's EU index (Kabat EA et al. (1991), supra). In a particular embodiment, the IgG1 constant region of the antibody or antigen-binding fragment described herein comprises a methionine (M) to tyrosine (Y) substitution at position 252, a serine (S) to threonine (T) substitution at position 254, and a threonine (T ) for glutamic acid (E) at position 256, numbered according to Kabat's EU index. See US patent No. 7658921, which is incorporated into this document by reference. This type of IgG mutant, called the YTE mutant, has been shown to have a half-life four times longer than wild-type versions of the same antibody (see Dall'Acqua WF et al. (2006) J Biol Chem 281: 23514-24 ). In certain embodiments of the invention, the antibody or antigen-binding fragment contains an IgG constant domain containing one, two, three or more amino acid substitutions of amino acid residues at positions 251-257, 285-290, 308-314, 385-389 and 428-436, numbered according to Kabat's EU index.

In an additional embodiment of the invention, one, two or more amino acid substitutions are made in the Fc region of the IgG constant domain to alter the effector(s) function(s) of the antibody. For example, one, two or more amino acids selected from amino acid residues 234, 235, 236, 237, 297, 318, 320, and 322, numbered according to Kabat's EU index, can be replaced with a different amino acid residue such that the antibody has an altered affinity. in relation to the effector ligand, but retained the antigen-binding ability of the parent antibody. The effector ligand for which the affinity is changed can be, for example, an Fc receptor or a C1 complement component. This approach is described in detail in US Pat. See, for example, US Pat. In certain embodiments, one or more amino acid substitutions can be made to the Fc region of an antibody described herein to remove potential glycosylation sites in the Fc region, which may reduce Fc receptor binding (see, e.g., Shields RL et al. (2001) J Biol Chem 276: 6591-604). In various embodiments of the invention, one or more of the following mutations can be introduced into the constant region of an antibody described herein: N297A substitution; N297Q replacement; L235A replacement and L237A replacement; L234A replacement and L235A replacement; replacement for E233P; replacement L234V; replacement L235A; deletion C236; replacement R238A; replacement D265A; A327Q replacement; or replacement P329A, numbered according to Kabat's EU index.

In a particular embodiment, the antibody described herein, or an antigen-binding fragment thereof, comprises an IgG1 constant domain with the amino acid substitution N297Q or N297A.

In certain embodiments of the invention, one or more amino acids selected from amino acid residues 329, 331, and 322 in the constant region of the antibody described herein, numbered according to Kabat's EU index, may be replaced with a different amino acid residue such that the antibody has altered binding. Clq and/or reduced or absent complement-dependent cytotoxicity (CDC). This approach is described in detail in US patent No. 6194551 (Idusogie et al.). In some embodiments, one or more amino acid residues within amino acid positions 231 to 238 in the N-terminal region of the CH2 domain of an antibody described herein are altered to alter the ability of the antibody to fix complement. This approach is further described in International Publication No. WO 94/29351. In certain embodiments, the Fc region of an antibody described herein is modified to increase the ability of the antibody to mediate antibody-dependent cellular cytotoxicity (ADCC) and/or increase the affinity of the antibody for the Fcy receptor by mutating one or more amino acids (e.g., amino acid substitutions). ) in the following positions: 238, 239, 248, 249, 252, 254, 255, 256, 258, 265, 267, 268, 269, 270, 272, 276, 278, 280,

- 94 040077

283, 285, 286, 289, 290, 292, 293, 294, 295, 296, 298, 301, 303, 305, 307, 309, 312, 315, 320, 322, 324, 326,

327, 329, 330, 331, 333, 334, 335, 337, 338, 340, 360, 373, 376, 378, 382, 388, 389, 398, 414, 416, 419, 430,

434, 435, 437, 438 and 439, numbered according to Kabat's EU index.

This approach is further described in International Publication No. WO 00/42072. In certain embodiments of the invention, the antibody described herein contains the constant region of the IgG4 antibody, and serine at amino acid residue 228 of the heavy chain, numbered according to Kabat's EU index, is replaced by proline.

It has been reported that fucose-reduced antibodies have increased affinity for Fc receptors such as, for example, FcyRIIIa. Accordingly, in certain embodiments, the antibodies described herein, or antigen-binding fragments thereof, are fucose-reduced or free of fucose. Such antibodies can be obtained using methods known in the art. For example, antibodies can be expressed in cells with insufficient or no ability to fucosylate. In a specific example, cell lines that knock out both alleles of α1,6-fucosyltransferase can be used to generate fucose-reduced antibodies. The Potelligent® system (Lonza) is an example of a system that can be used to generate fucose-reduced antibodies. Alternatively, fucose-reduced antibodies or antigen-binding fragments can be obtained, for example, by: (i) culturing cells under conditions that prevent or reduce fucosylation; (ii) post-translational removal of fucose (eg, by the enzyme fucosidase); (iii) post-translational addition of the desired carbohydrate, eg after recombinant expression of a non-glycosylated glycoprotein; or (iv) purifying the glycoprotein so as to select antibodies or antigen-binding fragments thereof that are not fucosylated. See, for example, Longmore GD & Schachter H (1982) Carbohydr Res 100: 365-92 and ImaiNishiya H et al. (2007) Navy Biotechnol. 7:84 regarding methods for producing antibodies or antigen-binding fragments without fucose or with a reduced fucose content. In certain embodiments, the antibodies described herein, or antigen-binding fragments thereof, have increased affinity for CD32B (also known as FcyRIIB or FCGR2B), for example, compared to an antibody with a wild-type Fc region, for example, IgG1 Fc. In certain embodiments, the antibodies described herein, or antigen-binding fragments thereof, have a selective increased affinity for CD32B (FcyRIIB) over both CD32A (FcyRIIA) and CD16 (FcyRIIIA). Sequence changes that result in increased affinity for CD32B are for example Mimoto et al., Protein Engineering, Design & Selection 10: 589-598 (2013), Chu et al., Molecular Immunology 45: 3926-3933 (2008), and Strohl, Current Opinion in Biology 20: 685-691 (2009), each of which is incorporated herein by reference in its entirety. In some embodiments, an antibody or antigen-binding fragment with increased affinity for CD32B comprises a heavy chain constant region, e.g., an IgG1 constant region, or a fragment thereof containing a mutation selected from the group consisting of: G236D, P238D, S239D, S267E, L328F , L328E, arginine inserted at position 236, and combinations thereof, numbered according to the EU index (Kabat et al., Sequences of Proteins of Immunological Interest, U.S. Department of Health and Human Services, Bethesda (1991)). In some embodiments, the antibody or antigen-binding fragment with increased affinity for CD32B comprises a heavy chain constant region, such as an IgG1 constant region, or a fragment thereof containing the S267E and L328F substitutions. In some embodiments, an antibody or antigen-binding fragment with increased affinity for CD32B comprises a heavy chain constant region, such as an IgG1 constant region, or a fragment thereof containing the P238D and L328E substitutions. In some embodiments, an antibody or antigen-binding fragment with increased affinity for CD32B comprises a heavy chain constant region, such as an IgG1 constant region, or a fragment thereof, containing a P238D substitution and a substitution selected from the group consisting of E233D, G237D, H268D, P271G , A330R and their combinations. In some embodiments, an antibody or antigen-binding fragment with increased affinity for CD32B comprises a heavy chain constant region, e.g., an IgG1 constant region, or a fragment thereof containing substitutions P238D, E233D, G237D, H268D, p271G, and A330R. In some embodiments, an antibody or antigen-binding fragment with increased affinity for CD32B comprises a heavy chain constant region, such as an IgG1 constant region, or a fragment thereof containing G236D and S267E. In some embodiments, an antibody or antigen-binding fragment with increased affinity for CD32B comprises a heavy chain constant region, such as an IgG1 constant region, or a fragment thereof containing S239D and S267E. In some embodiments, an antibody or antigen-binding fragment with increased affinity for CD32B comprises a heavy chain constant region, such as an IgG1 constant region, or a fragment thereof containing S267E and L328F. In some embodiments, an antibody or antigen-binding fragment with increased affinity for

CD32B contains a heavy chain constant region, for example, an IgG1 constant region, or a fragment thereof containing arginine inserted at position 236, and L328R.

In another specific embodiment, an antibody described herein that immunospecifically binds to GITR (e.g., human GITR) comprises a light chain and a heavy chain, wherein (i) the light chain comprises a VL domain containing VL CDR1, VL CDR2, and VL CDR3, имеющие аминокислотные последовательности любого из Hum231#2, pab1964, pab1965, pab1966, pab1967, pab1968, pab1969, pab1970, pab1971, pab1972, pab1973, pab1975, pab1976, pab1977, pab1979, pab1980, pab1981, pab1983, Hum231#1, 231 -32-15, or antibodies 1-107, or antibodies pab2159, pab2160 or pab2161 (for example, those listed in Table 1); (ii) the heavy chain contains a VH domain containing VH CDR1, VH CDR2 and VH CDR3 having the amino acid sequences of any of Hum231#2, pab1964, pab1965, pab1966, pab1967, pab1968, pab1969, pab1970, pab1971, pab1972, pab1973, pab1975 , pab1976, pab1977, pab1979, pab1980, pab1981, pab1983, Hum231#1, 231-32-15, or antibodies 1-107, or antibodies pab2159, pab2160, or pab2161 (for example, those listed in Table 2); (iii) the light chain further comprises a light chain constant domain comprising the amino acid sequence of a human kappa light chain constant domain; and (iv) the heavy chain further comprises a heavy chain constant domain comprising the amino acid sequence of a human IgG1 heavy chain constant domain (optionally, IgG1 (Glm3 allotype)).

In another specific embodiment, an antibody described herein that immunospecifically binds to GITR (e.g., human GITR) comprises a light chain and a heavy chain, wherein (i) the light chain comprises a VL domain containing the amino acid sequence of any of the antibodies Hum231# 2, pab1964, pab1965, pab1966, pab1967, pab1968, pab1969, pab1970, pab1971, pab1972, pab1973, pab1975, pab1976, pab1977, pab1979, pab1980, pab1981, pab1983, pab1980, pab1981, pab1983, Hum231# or antibodies 107, or antibodies pab2159, pab2160 or pab2161, (for example, SEQ ID NO: 202, 204, 205, 207, 208, or 400-518, or SEQ ID NO: 519); (ii) the heavy chain contains a VH domain containing the amino acid sequence of any of the antibodies Hum231#2, pab1964, pab1965, pab1966, pab1967, pab1968, pab1969, pab1970, pab1971, pab1972, pab1973, pab1975, pab1976, pab1970, pab1979 pab1981, pab1983, Hum231#1, 231-32-15, or antibodies 1-107, or antibodies pab2159, pab2160 or pab2161, (for example, SEQ ID NO: 201, 203, 206 or 215-389); (iii) the light chain further comprises a constant domain comprising the amino acid sequence of the human kappa light chain constant domain; and (iv) the heavy chain further comprises a constant domain comprising the amino acid sequence of a human IgG1 heavy chain constant domain (optionally, IgG1 (Glm3 allotype)).

In another specific embodiment, an antibody described herein that immunospecifically binds to GITR (e.g., human GITR) comprises a light chain and a heavy chain, wherein (i) the light chain comprises a VL domain containing the amino acid sequence Hum231#1 or Hum231 #2 (for example, SEQ ID NO: 207 or 208); (ii) the heavy chain contains a VH domain containing the amino acid sequence Hum231#1 or Hum231#2 (eg, SEQ ID NO: 206); (iii) the light chain further comprises a constant domain comprising the amino acid sequence of the human kappa light chain constant domain; and (iv) the heavy chain further comprises a constant domain comprising the amino acid sequence of a human IgG1 heavy chain constant domain (optionally, IgG1 (Glm3 allotype)).

In another specific embodiment, an antibody described herein that immunospecifically binds to GITR (e.g., human GITR) comprises a light chain and a heavy chain, wherein (i) the light chain comprises a VL domain containing VL CDR1, VL CDR2, and VL CDR3 having the amino acid sequences of any of the antibodies described herein, e.g. , pab1983, Hum231#1, 231-32-15, or antibodies 1-107, or antibodies pab2159, pab2160 or pab2161 (for example, those listed in Table 1); (ii) the heavy chain contains a VH domain containing VH CDR1, VH CDR2 and VH CDR3 having the amino acid sequences of any of the antibodies described herein, e.g. , pab1971, pab1972, pab1973, pab1975, pab1976, pab1977, pab1979, pab1980, pab1981, pab1983, Hum231#1, 231-32-15, or antibodies 1-107, or antibodies pab2159, pab2160, or pab2161 (for example, those listed in Table .2); (iii) the light chain further comprises a light chain constant domain comprising the amino acid sequence of a human IgG4 constant domain; and (iv) the heavy chain further comprises a heavy chain constant domain comprising the amino acid sequence of a human IgG4 heavy chain constant domain.

In another specific embodiment, an antibody described herein that immunospecifically binds to GITR (e.g., human GITR) comprises a light chain and a heavy chain, wherein (i) the light chain comprises a VL domain containing the amino acid sequence of any of those described herein. antibody document, e.g. Hum231#2, pab1964,

- 96 040077 pab1965, pab1966, pab1967, pab1968, pab1969, pab1970, pab1971, pab1972, pab1973, pab1975, pab1976, pab1977, pab1979, pab1980, pab1981, pab1983, Hum231#1, 231-32-15, или антител 1-107 , or antibodies pab2159, pab2160 or pab2161 (for example, SEQ ID NO: 202, 204, 205, 207, 208, or 400-518, or SEQ ID NO: 519); (ii) the heavy chain contains a VH domain containing the amino acid sequence of any of the antibodies described herein, e.g. , pab1977, pab1979, pab1980, pab1981, pab1983, Hum231#1, 231-32-15, or antibodies 1-107, or antibodies pab2159, pab2160 or pab2161 (for example, SEQ ID NO: 201, 203, 206 or 215-389 ); (iii) the light chain further comprises a constant domain comprising the amino acid sequence of a human IgG4 light chain constant domain; and (iv) the heavy chain further comprises a constant domain comprising the amino acid sequence of a human IgG4 heavy chain constant domain. In another specific embodiment, an antibody described herein that immunospecifically binds to GITR (e.g., human GITR) comprises a light chain and a heavy chain, wherein (i) the light chain contains a VL domain containing the amino acid sequence of any of Hum231#1 or Hum231#2 (eg SEQ ID NO: 207 or 208); (ii) the heavy chain contains a VH domain containing the amino acid sequence of either Hum231#1 or Hum231#2 (eg, SEQ ID NO: 206); (iii) the light chain further comprises a constant domain comprising the amino acid sequence of a human IgG4 light chain constant domain; and (iv) the heavy chain further comprises a constant domain comprising the amino acid sequence of a human IgG4 heavy chain constant domain.

In a particular embodiment, an antibody provided herein that specifically binds to GITR (e.g., human GITR) comprises (a) a heavy chain comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 553, 554 and from 567 up to 570; and (b) a light chain comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 555, 556, and 571 to 576. In a particular embodiment, an antibody provided herein that specifically binds to GITR (e.g., human GITR), contains (a) a heavy chain containing an amino acid sequence selected from the group consisting of SEQ ID NO: 581 or 582; and (b) a light chain comprising the amino acid sequence of SEQ ID NO: 576. In another specific embodiment, an antibody provided herein that specifically binds to GITR (e.g., human GITR) comprises (a) a heavy chain comprising the amino acid sequence SEQ ID NO: 553; and (b) a light chain comprising the amino acid sequence of SEQ ID NO: 556. In another specific embodiment, an antibody provided herein that specifically binds to GITR (e.g., human GITR) comprises (a) a heavy chain comprising the amino acid sequence SEQ ID NO: 554; and (b) a light chain comprising the amino acid sequence of SEQ ID NO: 556. In another specific embodiment, an antibody provided herein that specifically binds to GITR (e.g., human GITR) comprises (a) a heavy chain comprising the amino acid sequence SEQ ID NO: 581; and (b) a light chain comprising the amino acid sequence of SEQ ID NO: 556. In another specific embodiment, an antibody provided herein that specifically binds to GITR (e.g., human GITR) comprises (a) a heavy chain comprising the amino acid sequence SEQ ID NO: 582; and (b) a light chain comprising the amino acid sequence of SEQ ID NO: 556. In another specific embodiment, an antibody provided herein that specifically binds to GITR (e.g., human GITR) comprises (a) a heavy chain comprising the amino acid sequence SEQ ID NO: 553; and (b) a light chain comprising the amino acid sequence of SEQ ID NO: 555. In another specific embodiment, an antibody provided herein that specifically binds to GITR (e.g., human GITR) comprises (a) a heavy chain comprising the amino acid sequence SEQ ID NO: 554; and (b) a light chain comprising the amino acid sequence of SEQ ID NO: 555. In another specific embodiment, an antibody provided herein that specifically binds to GITR (e.g., human GITR) comprises (a) a heavy chain comprising the amino acid sequence SEQ ID NO: 567; and (b) a light chain comprising the amino acid sequence of SEQ ID NO: 573. In another specific embodiment, an antibody provided herein that specifically binds to GITR (e.g., human GITR) comprises (a) a heavy chain comprising the amino acid sequence SEQ ID NO: 567; and (b) a light chain comprising the amino acid sequence of SEQ ID NO: 576. In another specific embodiment, an antibody provided herein that specifically binds to GITR (e.g., human GITR) comprises (a) a heavy chain comprising the amino acid sequence SEQ ID NO: 554; and (b) a light chain comprising the amino acid sequence of SEQ ID NO: 576. In another specific embodiment, an antibody provided herein that specifically binds to GITR (e.g., human GITR) comprises

- 97 040077 (a) a heavy chain containing the amino acid sequence of SEQ ID NO: 581; and (b) a light chain comprising the amino acid sequence of SEQ ID NO: 576. In another specific embodiment, an antibody provided herein that specifically binds to GITR (e.g., human GITR) comprises (a) a heavy chain comprising the amino acid sequence SEQ ID NO: 582; and (b) a light chain containing the amino acid sequence of SEQ ID NO: 576.

In another specific embodiment, an antibody provided herein that specifically binds to GITR (e.g., human GITR) comprises (a) a heavy chain comprising the amino acid sequence of SEQ ID NO: 553 with the amino acid substitution of N for A or Q at the amino acid position 298; and (b) a light chain comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 555, 556, and 571 to 576. In another specific embodiment, an antibody provided herein that specifically binds to GITR (e.g., human GITR), contains (a) a heavy chain containing the amino acid sequence of SEQ ID NO: 553 with the amino acid substitution of N for A or Q at amino acid position 298; and (b) a light chain comprising the amino acid sequence of SEQ ID NO: 556. In another specific embodiment, an antibody provided herein that specifically binds to GITR (e.g., human GITR) comprises (a) a heavy chain comprising the amino acid sequence SEQ ID NO: 553 with amino acid substitution of N for A or Q at amino acid position 298; and (b) a light chain comprising the amino acid sequence of SEQ ID NO: 555. In certain embodiments, an antibody or fragment thereof described herein that specifically binds to GITR (e.g., human GITR) contains one, two, three, or four VL framework regions (FR) having the amino acid sequence described herein for any of the described antibodies, e.g. , pab1975, pab1976, pab1977, pab1979, pab1980, pab1981, pab1983, 231-32-15, or antibodies 1-107, or antibodies pab2159, pab2160, or pab2161 (for example, see Table 3). In some embodiments, an antibody or fragment thereof that specifically binds to GITR (e.g., human GITR) contains one, two, three, or four VH framework regions (FR) having the amino acid sequence described herein for any of the described antibodies. , например, Hum231#1, Hum231#2, pab1964, pab1965, pab1966, pab1967, pab1968, pab1969, pab1970, pab1971, pab1972, pab1973, pab1975, pab1976, pab1977, pab1979, pab1980, pab1981, pab1983, 231-32-15 , or antibodies 1-107, or antibodies pab2159, pab2160 or pab2161 (for example, see Table 4). In certain embodiments, an antibody or fragment thereof that specifically binds to GITR (e.g., human GITR) contains one, two, three, four, five, six, seven, or eight FRs of one of the antibodies described herein (e.g., Hum231 #1 Hum231#2, pab1964, pab1965, pab1966, pab1967, pab1968, pab1969, pab1970, pab1971, pab1972, pab1973, pab1975, pab1976, pab1977, pab1979, pab1980, pab1983, pab198, or antibodies 107, or antibodies pab2159, pab2160 or pab2161). In specific embodiments, an antibody or fragment thereof described herein that immunospecifically binds to GITR (e.g., human GITR) contains framework regions (e.g., VL domain and/or VH domain frameworks) that are human framework regions or derived from human framework regions. Non-limiting examples of human frameworks are described in the art, for example, see Kabat EA et al. (1991) above. In a particular embodiment, an antibody described herein comprises framework regions (e.g., VL domain and/or VH domain frameworks) that are primate (e.g., monkey) frameworks or derived from primate (e.g., monkey) frameworks.

For example, CDRs from antigen-specific non-human antibodies, typically from rodents (eg mice or rats), are grafted into homologous human or simian acceptor framework regions. In one embodiment, the simian acceptor frameworks are from Old World monkeys. In a particular embodiment, the old world monkey acceptor framework is derived from Pan troglodytes, Pan paniscus, or Gorilla gorilla. In a particular embodiment, the simian acceptor frameworks are derived from the chimpanzee Pan troglodytes. In a particular embodiment, the simian acceptor frameworks are the acceptor frameworks of Old World monkeys. In a particular embodiment, the Old World monkey acceptor frameworks are derived from the Masas species. In a specific embodiment, the simian acceptor frameworks are derived from the cynomolgus cynomolgus macaque macaque. Simian framework sequences are described in US Patent Application Publication No. US 2005/0208625.

In certain embodiments, an antibody or fragment thereof described herein that specifically binds to GITR (e.g., human GITR) comprises one, two, or more VL (FR) framework regions having the amino acid sequences described herein for any of antibodies are given in table. 3 above. In some variants

- 98 040077 implementation of the invention described in this document, the antibody or fragment thereof, which specifically binds to GITR (for example, human GITR), contains one, two or more VH framework regions (FR) having the amino acid sequences described herein for any of antibodies are given in table. 4 above. In specific embodiments, an antibody or fragment thereof described herein that specifically binds to GITR (e.g., human GITR) comprises one, two, or more VL framework regions having the amino acid sequences described herein for any of the antibodies listed. in table. 3 above and one, two or more VH framework regions having the amino acid sequences described herein for the antibodies shown in Table. 4 above.

In certain embodiments, an antibody or fragment thereof described herein that specifically binds to GITR (e.g., human GITR) comprises VL domain framework regions having an amino acid sequence selected from the group consisting of SEQ ID NOs: 202, 207 , 208, 400-411, 413-416, 418-421, 423-448, 450-452, 454-464, 467-477, 481486, 488-513, or 515-518, and/or VH domain frameworks, having an amino acid sequence selected from the group consisting of SEQ ID NOs: 201, 206, 215, 217-234, 236-256, 258, 259, 261-265, 267, 268, 271-273, 276, 277, 280, 281, 283-285, 287, 288, 290, 291, 294, 296-299, 301, 304-306, 308, 313-316, 319, 320, 322-325, 327, 328, 333, 336, 338- 340, 342, 343, 345, 350, 354-356, 358-360, 362-368, 380, 384, or 387. In certain embodiments, an antibody described herein or a fragment thereof that specifically binds to GITR (e.g., human GITR), contains framework VL domain regions having an amino acid sequence selected from the group consisting of SEQ ID NOs: 202, 207, 208, 400-411, 413-416, 418-421, 423-448, 450-464, 467-477, 481486 , 488-513 or 515-519, and/or VH domain framework regions having an amino acid sequence selected from the group consisting of SEQ ID NOs: 201, 206, 215, 217-234, 236-256, 258, 259, 261-265, 267, 268, 270-273, 276, 277, 280, 281, 283-285, 287, 288, 290, 291, 294, 296-299, 301, 304-306, 308, 313-316, 319, 320, 322-325, 327, 328, 333, 336, 338-340, 342, 343, 345, 350, 354-356, 358-360 or 362-368. In some embodiments, an antibody or fragment thereof described herein that specifically binds to GITR (e.g., human GITR) comprises one, two, three, or four VL domain framework regions having the amino acid sequence of any of the antibodies described herein. , например, Hum231#1, Hum231#2, pab1964, pab1965, pab1966, pab1967, pab1968, pab1969, pab1970, pab1971, pab1972, pab1973, pab1975, pab1976, pab1977, pab1979, pab1980, pab1981, pab1983, 231-32-15 or antibodies 1-107 (e.g., SEQ ID NOs: 202, 207, 208, 400-411, 413-416, 418-421, 423-448, 450-452, 454-464, 467-477, 481-486, 488-513 or 515-518), with 1, 2, 3, 4, 5, 6, 7, 8, 9 or more amino acid mutations (eg, amino acid substitutions such as conservative amino acid substitutions), and/or VH framework regions -domains having the amino acid sequence of any of the antibodies described herein, for example, Hum231#1, Hum231#2, pab1964, pab1965, pab1966, pab1967, pab1968, pab1969, pab1970, pab1971, pab1972, pab1973, pab1975, pab1976, pab1977, pab1979, pab1980, pab1981, pab1983, 231-32-15 or antibodies 1-107 (e.g. SEQ ID 1, NO2: 202 217-234 236-256 258 259 261-265 267 268 271-273 276 277 280 281 283-285 287 288 290 291 294 296-299 , 301, 304-306, 308, 313-316, 319, 320, 322-325, 327, 328, 333, 336, 338-340, 342, 343, 345, 350, 354-356, 358-360, 362 -368, 380, 384 or 387). In some embodiments, an antibody or fragment thereof described herein that specifically binds to GITR (e.g., human GITR) comprises one, two, three, or four VL domain framework regions having the amino acid sequence of any of the antibodies described herein, e.g. , Hum231#1, Hum231#2, pab1964, pab1965, pab1966, pab1967, pab1968, pab1969, pab1970, pab1971, pab1972, pab1973, pab1975, pab1976, pab1977, pab1979, pab1980, pab1981, pab1983, 231-32-15, или antibodies 1-107, or antibodies pab2159, pab2160 or pab2161 (e.g., SEQ ID NOs: 202, 207, 208, 400411, 413-416, 418-421, 423-448, 450-464, 467-477, 481-486 , 488-513 or 515-519), with 1, 2, 3, 4, 5, 6, 7, 8, 9 or more amino acid mutations (eg, amino acid substitutions such as conservative amino acid substitutions), and/or framework regions VH domain having the amino acid sequence of any of the antibodies described herein, e.g. Hum231#1, Hum2 31#2, pab1964, pab1965, pab1966, pab1967, pab1968, pab1969, pab1970, pab1971, pab1972, pab1973, pab1975, pab1976, pab1977, pab1979, pab1980, pab1981, pab1983, or antibodies or pab2159, pab2160, or pab2161 antibodies (e.g., SEQ ID NOs: 201, 206, 215, 217-234, 236-256, 258, 259, 261-265, 267, 268, 270-273, 276, 277, 280, 281, 283-285, 287, 288, 290, 291, 294, 296-299, 301, 304-306, 308, 313-316, 319, 320, 322-325, 327, 328, 333, 336, 338- 340, 342, 343, 345, 350, 354-356, 358-360 or 362-368). In certain embodiments, an antibody or fragment thereof described herein that specifically binds to GITR (e.g., human GITR) comprises one, two, three, or four VH domain framework regions having the amino acid sequence of any of the antibodies described herein. , например, Hum231#1, Hum231#2, pab1964, pab1965, pab1966, pab1967, pab1968, pab1969, pab1970, pab1971, pab1972, pab1973, pab1975, pab1976, pab1977, pab1979, pab1980, pab1981, pab1983, 231-32-15 or antibodies 1-107, or antibodies pab2159, pab2160, pab2161 (for example, SEQ ID NO: 201, 203, 206 or 215-389), with 1, 2, 3, 4, 5, 6, 7, 8, 9 or more amino acid muta

- 99 040077 cations (for example, amino acid substitutions, such as conservative amino acid substitutions), and/or VL domain framework regions having the amino acid sequence of any of the antibodies described herein, for example, Hum231#1, Hum231#2, pab1964, pab1965 , pab1966, pab1967, pab1968, pab1969, pab1970, pab1971, pab1972, pab1973, pab1975, pab1976, pab1977, pab1979, pab1980, pab1981, pab1983, 231-32-15, или антител 1-107, или антител pab2159, pab2160 или pab2161 (for example, SEQ ID NO: 201, 203, 206 or 215-389). In some embodiments, an antibody or fragment thereof described herein that specifically binds to GITR (e.g., human GITR) comprises one, two, three, or four VL domain framework regions having the amino acid sequence of any of the antibodies described herein. , например, Hum231#1, Hum231#2, pab1964, pab1965, pab1966, pab1967, pab1968, pab1969, pab1970, pab1971, pab1972, pab1973, pab1975, pab1976, pab1977, pab1979, pab1980, pab1981, pab1983, 231-32-15 or antibodies 1-107 (e.g., SEQ ID NOs: 202, 207, 208, 400-411, 413-416, 418-421, 423-448, 450-452, 454-464, 467-477, 481486, 488- 513 or 515-518), with 1, 2, 3, 4, 5, 6, 7, 8, 9 or more amino acid mutations (e.g., amino acid substitutions such as conservative amino acid substitutions), and/or one, two, three or four VH domain framework regions having the amino acid sequence of SEQ ID NO: 201, 203, 206, or 215-389 with 1, 2, 3, 4, 5, 6, 7, 8, 9 or more amino acids no-acid mutations (eg, amino acid substitutions such as conservative amino acid substitutions). In some embodiments, an antibody or fragment thereof described herein that specifically binds to GITR (e.g., human GITR) comprises one, two, three, or four VL domain framework regions having the amino acid sequence of any of the antibodies described herein. , например, Hum231#1, Hum231#2, pab1964, pab1965, pab1966, pab1967, pab1968, pab1969, pab1970, pab1971, pab1972, pab1973, pab1975, pab1976, pab1977, pab1979, pab1980, pab1981, pab1983, 231-32-15 , or antibodies 1-107, or antibodies pab2159, pab2160 or pab2161 (for example, SEQ ID NO: 202, 207, 208, 400-411, 413-416, 418-421, 423-448, 450-464, 467-477 , 481-486, 488-513, or 515-519), with 1, 2, 3, 4, 5, 6, 7, 8, 9 or more amino acid mutations (eg, amino acid substitutions such as conservative amino acid substitutions), and /or one, two, three or four VH domain framework regions having the amino acid sequence of SEQ ID NO: 201, 203, 206 or 215-389, c 1, 2 , 3, 4, 5, 6, 7, 8, 9 or more amino acid mutations (eg, amino acid substitutions such as conservative amino acid substitutions). [00265] In certain embodiments, an antibody or fragment thereof described herein that specifically binds to GITR (e.g., human GITR) contains VL (FR) framework regions having at least 80%, at least 85%, at least 90%, at least 95%, or at least 98% sequence identity with the framework regions of the VL described in table. 3 above. In certain embodiments, an antibody or fragment thereof described herein that specifically binds to GITR (e.g., human GITR) contains VH (FR) framework regions having at least 80%, at least 85%, at least 90%, at least 95%, or at least 98% sequence identity with the framework regions of the VH described in table. 4 above. In some embodiments, an antibody or fragment thereof described herein that specifically binds to GITR (e.g., human GITR) contains VH framework regions (FR) having at least 80%, at least 85%, at least 90%, at least 95%, or at least 98% sequence identity with the framework regions of the VH described in table. 4 above and VL framework regions (FR) having at least 80%, at least 85%, at least 90%, at least 95%, or at least 98% sequence identity with the VL framework regions described in table. 3 above. In certain embodiments, an antibody or fragment thereof described herein that specifically binds to GITR (e.g., human GITR) contains VL (FR) framework regions having at least 80%, at least 85%, at least 90%, at least 95%, or at least 98% sequence identity with the VL frameworks described herein for Hum231#1, Hum231#2, pab1964, pab1965, pab1966, pab1967, pab1968, pab1969, pab1970, pab1971 . In some embodiments, an antibody or fragment thereof described herein that specifically binds to GITR (e.g., human GITR) contains VH framework regions (FR) having at least 80%, at least 85%, at least 90%, at least 95%, or at least 98% sequence identity to the VH frameworks described herein for Hum231#1, Hum231#2, pab1964, pab1965, pab1966, pab1967, pab1968, pab1969, pab1970, pab1971 , pab1972, pab1973, pab1975, pab1976, pab1977, pab1979, pab1980, pab1981, pab1983, 231-32-15, or antibodies 1-107, or antibodies pab2159, pab2160 or pab2161 (for example, those shown in Table 4). In certain embodiments, an antibody or fragment thereof described herein that specifically binds to GITR (e.g., human GITR) comprises: (i) VL (FR) framework regions having at least 80%, at least 85% , By

- 100 040077 at least 90%, at least 95%, or at least 98% sequence identity with the VL frameworks described herein for Hum231#1, Hum231#2, pab1964, pab1965, pab1966, pab1967, pab1968, pab1969 , pab1970, pab1971, pab1972, pab1973, pab1975, pab1976, pab1977, pab1979, pab1980, pab1981, pab1983, 231-32-15; ); and (ii) VH framework regions (FR) having at least 80%, at least 85%, at least 90%, at least 95%, or at least 98% sequence identity with the VH framework regions described in данном документе для Hum231#1, Hum231#2, pab1964, pab1965, pab1966, pab1967, pab1968, pab1969, pab1970, pab1971, pab1972, pab1973, pab1975, pab1976, pab1977, pab1979, pab1980, pab1981, pab1983, 23132-15, или antibodies 1-107, or antibodies pab2159, pab2160 or pab2161 (for example, those shown in Table 4).

Determination of percent identity between two sequences (eg, amino acid sequences or nucleotide sequences) can also be performed using a mathematical algorithm. A specific, non-limiting example of a mathematical algorithm used to compare two sequences is the Karlin S & Altschul SF (1990) PNAS 87: 2264-2268 algorithm modified as in Karlin S & Altschul SF (1993) PNAS 90: 5873-5877. Such an algorithm is included in the NBLAST and XBLAST programs by Altschul SF et al. (1990) J Mol Biol 215: 403. BLAST nucleotide searches can be performed with set parameters of the NBLAST nucleotide program, eg score=100, code length=12, to obtain nucleotide sequences homologous to the nucleic acid molecules described herein. A BLAST protein search can be performed with XBLAST program parameters set, eg, score 50, code length=3, to obtain amino acid sequences homologous to the protein molecule described herein. Gapped BLAST can be used to generate gap alignments for comparison purposes, as described in Altschul SF et al. (1997) Nuc Acids Res 25: 3389 3402. Alternatively, PSI BLAST can be used to perform an iterative search that reveals a long-range relationship between molecules (Id.). When using the BLAST, Gapped BLAST, and PSI Blast programs, you can use the default parameters of the respective programs (for example, XBLAST and NBLAST) (see, for example, National Center for Biotechnology Information (NCBI) online, ncbi.nlm.nih.gov) . Another specific, non-limiting example of a mathematical algorithm used for sequence comparison is Myers and Miller, 1988, CABIOS 4:11 17. This algorithm is included in the ALIGN program (version 2.0), which is part of the GCG sequence alignment software package. When using the ALIGN program to compare amino acid sequences, a PAM120 residue weight table, a gap length penalty of 12, and a gap opening penalty of 4 can be used.

Percent identity between two sequences can be determined using methods similar to those described above with or without gap resolution. When calculating the percentage of identity, as a rule, only exact matches are taken into account. In certain embodiments, an antibody or fragment thereof that immunospecifically binds to GITR (e.g., human GITR) contains a VL domain having at least 80%, at least 85%, at least 90%, at least 95% % or at least 98% sequence identity with the amino acid sequence of the VL domain of any of the antibodies Hum231#2, pab1964, pab1965, pab1966, pab1967, pab1968, pab1969, pab1970, pab1971, pab1972, pab1973, pab1975, pab1976, pab1977, pab1977 pab1980, pab1981, pab1983, Hum231#1, 231-32-15, or antibodies 1-107, or antibodies pab2159, pab2160 or pab2161 (for example, SEQ ID NO: 202, 204, 205, 207, 208 or 400-518, or SEQ ID NO: 519). In certain embodiments, an antibody or fragment thereof that immunospecifically binds to GITR (e.g., human GITR) contains a VL domain having at least 80%, at least 85%, at least 90%, at least 95% % or at least 98% sequence identity with the amino acid sequence of the VL domain of any of the antibodies Hum231#2, pab1964, pab1965, pab1966, pab1967, pab1968, pab1969, pab1970, pab1971, pab1972, pab1973, pab1975, pab1976, pab1977, pab1977 pab1980, pab1981, pab1983, Hum231#1, 231-32-15, or antibodies 1-107, or antibodies pab2159, pab2160 or pab2161, (for example, SEQ ID NO: 202, 204, 205, 207, 208 or 400-518 , or SEQ ID NO: 519), and the antibody or antigennegative fragment contains CDRs (eg, VL CDR) that are identical to the CDRs (eg, VL CDR) of the antibody shown in table. 1 and/or table. 2 (for example, the CDRs are identical to those of the specific antibody named in Tables 1 and/or 2).

In certain embodiments, an antibody or fragment thereof that immunospecifically binds to GITR (e.g., human GITR) contains a VL domain containing VL framework regions having at least 80%, at least 85%, at least 90% , at least 95% or at least 98% sequence identity with the amino acid sequence of the frame regions selected from the group consisting of SEQ ID NO: 202, 204, 205, 207, 208 and 400-518. In certain embodiments of the invention, an antibody or fragment thereof that immunospecifically binds to GITR (for example, human GITR) contains a VL domain containing VL framework regions having at least 80%, at least 85%,

- 101 040077 at least 90%, at least 95%, or at least 98% sequence identity with the amino acid sequence of SEQ ID NO: 519. In a particular embodiment, the antibody contains VL CDRs that are identical to the VL CDR of the antibody shown in Table . 1 (for example, VL CDR from one row in Table 1). In certain embodiments, an antibody or fragment thereof that immunospecifically binds to GITR (e.g., human GITR) contains a VH domain having at least 80%, at least 85%, at least 90%, at least 95% % or at least 98% sequence identity with the amino acid sequence of the VH domain SEQ ID NO: 201, 203, 206 or 215-389. In certain embodiments, an antibody or fragment thereof that immunospecifically binds to GITR (e.g., human GITR) contains a VH domain having at least 80%, at least 85%, at least 90%, at least 95% % or at least 98% sequence identity with the amino acid sequence of the VH domain of SEQ ID NOs: 201, 203, 206, or 215-389, wherein the antibody or antigen-binding fragment contains CDRs (e.g., VL CDR) that are identical to CDRs (e.g., VL CDR) of the antibody shown in table. 1 and/or table. 2 (for example, the CDRs are identical to those of the specific antibody named in Tables 1 and/or 2). In certain embodiments, an antibody or fragment thereof that immunospecifically binds to GITR (e.g., human GITR) contains a VH domain containing VH framework regions having at least 80%, at least 85%, at least 90% , at least 95% or at least 98% sequence identity with a framework amino acid sequence selected from the group consisting of SEQ ID NOs: 201, 203, 206, and 215389. In a particular embodiment, the antibody contains VH CDRs that are identical VH CDR of the antibody shown in table. 2 (eg VH CDR from one row in Table 2).

In certain embodiments, an antibody or fragment thereof that immunospecifically binds to GITR (e.g., human GITR) contains: (i) a VL domain having at least 80%, at least 85%, at least 90%, at least 95% or at least 98% sequence identity with the VL domain amino acid sequence selected from the group consisting of SEQ ID NOs: 202, 204, 205, 207, 208, and 400-518; and (ii) a VH domain having at least 80%, at least 85%, at least 90%, at least 95%, or at least 98% sequence identity with an amino acid sequence of a VH domain selected from the group consisting of from SEQ ID NO: 201, 203, 206 or 215-389. In certain embodiments, an antibody or fragment thereof that immunospecifically binds to GITR (e.g., human GITR) contains: (i) a VL domain having at least 80%, at least 85%, at least 90%, at least 95% or at least 98% sequence identity with the amino acid sequence of SEQ ID NO: 519; and (ii) a VH domain having at least 80%, at least 85%, at least 90%, at least 95%, or at least 98% sequence identity with the amino acid sequence of the VH domain of SEQ ID NO: 304. In certain embodiments, an antibody or fragment thereof that immunospecifically binds to GITR (e.g., human GITR) contains: (i) a VL domain having at least 80%, at least 85%, at least 90 %, at least 95% or at least 98% sequence identity with the amino acid sequence of the VL domain selected from the group consisting of SEQ ID NO: 202, 204, 205, 207, 208 and 400-518; and (ii) a VH domain having at least 80%, at least 85%, at least 90%, at least 95%, or at least 98% sequence identity with a VH domain amino acid sequence selected from the group , consisting of SEQ ID NO: 201, 203, 206 and 215-389, and the antibody or antigennegative fragment contains CDR (eg, VL CDR) that are identical to the CDR (eg, VL CDR) of the antibody shown in table. 1 and/or table. 2 (for example, the CDRs are identical to the CDRs of the specific antibody named in Tables 1 and/or 2). In certain embodiments, an antibody or fragment thereof that immunospecifically binds to GITR (e.g., human GITR) contains: (i) a VL domain having at least 80%, at least 85%, at least 90%, at least 95% or at least 98% sequence identity with the amino acid sequence of SEQ ID NO: 519; and (ii) a VH domain having at least 80%, at least 85%, at least 90%, at least 95%, or at least 98% sequence identity with the amino acid sequence of SEQ ID NO: 304, wherein the antibody or antigen-binding fragment contains CDRs (eg, VL CDR) that are identical to the CDRs (eg, VL CDR) of the antibody shown in Table. 1 and/or 2 (for example, the CDRs are identical to the CDRs of the particular antibody named in Tables 1 and/or 2).

In certain embodiments, an antibody or fragment thereof that immunospecifically binds to GITR (e.g., human GITR) contains: (i) a VL domain containing VL framework regions having at least 80%, at least 85%, at least 90%, at least 95%, or at least 98% sequence identity with an amino acid sequence of framework regions selected from the group consisting of SEQ ID NO: 202,

- 102 040077

204, 205, 207 and 208; and (ii) a VH domain comprising VH framework regions having at least 80%, at least 85%, at least 90%, at least 95%, or at least 98% sequence identity with the amino acid sequence of the framework regions. selected from the group consisting of SEQ ID NOs: 201, 203, 206 and 215-389. In a specific embodiment of the invention, the antibody contains VL CDRs that are identical to the VL CDRs of the antibody shown in Table. 3, and/or VH CDRs that are identical to the VH CDR of the antibody shown in table. 4.

In certain embodiments, an antibody or fragment thereof that immunospecifically binds to GITR (e.g., human GITR) contains a VH domain having at least 80%, at least 85%, at least 90%, at least 95% % or at least 98% sequence identity with the VH domain amino acid sequence selected from the group of SEQ ID NOs: 201, 203, 206 and 215-389. In certain embodiments, an antibody or fragment thereof that immunospecifically binds to GITR (e.g., human GITR) contains a VH domain having at least 80%, at least 85%, at least 90%, at least 95% % or at least 98% sequence identity with a VH domain amino acid sequence selected from the group of SEQ ID NOs: 201, 203, 206, and 215-389, wherein the antibody or antigen-binding fragment contains CDRs (e.g., VL CDRs) that are identical to CDRs (for example, VL CDR) antibodies shown in table. 1 and/or table. 2 (for example, the CDRs are identical to those of the specific antibody named in Tables 1 and/or 2).

In certain embodiments, an antibody or fragment thereof that immunospecifically binds to GITR (e.g., human GITR) contains a VH domain containing VH framework regions having at least 80%, at least 85%, at least 90% , at least 95% or at least 98% sequence identity with the amino acid sequence of the frame regions selected from the group consisting of SEQ ID NO: 201, 203, 206 and 215-389. In a specific embodiment of the invention, the antibody contains VH CDRs that are identical to the VH CDRs of the antibody shown in Table. 2 (eg VH CDR from one row in Table 2).

In another aspect, provided herein are antibodies that bind the same or overlapping GITR epitope (e.g., human GITR epitope) as an antibody described herein (e.g., Hum231#1, Hum231#2, pab1964, pab1965, pab1966, pab1967, pab1968, pab1969, pab1970, pab1971, pab1972, pab1973, pab1975, pab1976, pab1977, pab1979, pab1980, pab1981, pab1983, 231-32-15 или антитела 1-107) или антитела pab2159, pab2160, pab2161 или Hum231#2w . In certain embodiments, an antibody epitope can be determined using, for example, NMR spectroscopy, X-ray crystallographic studies, ELISA analysis, hydrogen/deuterium exchange coupled with mass spectrometry (e.g., electrospray liquid chromatography/mass spectrometry), matrix scanning analysis of oligopeptides and/or mapping by mutagenesis (eg, mapping by site-directed mutagenesis). In the case of X-ray crystallography, crystallization can be carried out using any methods known in the art (for example, Giege R et al. (1994) Acta Crystallogr D Biol Crystallogr 50(Pt 4): 339-350; McPherson A (1990) Eur J Biochem 189: 1-23; Chayen NE (1997) Structure 5: 1269-1274; McPherson A (1976) J Biol Chem 251: 6300-6303). Antibody crystals: antigen can be examined using well-known X-ray diffraction techniques and fine-tuning can be done using software such as X-PLOR (Yale University, 1992, supplied by Molecular Simulations, Inc.; see, for example, Meth Enzymol ( 1985) volumes 114 and 115, eds Wyckoff HW et al.; US patent application no. ) Meth Enzymol 276A: 361-423, ed Carter CW Roversi P et al (2000) Acta Crystallogr D Biol Crystallogr 56(Pt 10): 1316-1323). Mutagenesis mapping studies can be carried out using any method known to a person skilled in the art. See, for example, Champe M et al. (1995), supra, and Cunningham BC & Wells JA (1989), supra, for descriptions of mutagenesis methods, including alanine-scanning mutagenesis methods. In a particular embodiment, the epitope of an antibody or antigen-binding fragment thereof is determined using alanine-scanning mutagenesis assays as described in section 6 below. In addition, antibodies that recognize and bind the same or overlapping GITR epitopes (e.g., human GITR) can be detected using routine methods such as immunoassays, for example, by demonstrating the ability of an antibody to block another antibody from binding to a target antigen, .e. conducting a competitive binding analysis. A competitive binding assay can also be used to determine if two antibodies have similar binding specificity for an epitope. Competitive binding can be determined in an assay in which the immunoglobulin under test inhibits the specific binding of a reference antibody to a common antigen, such as GITR. A large number of competitive binding assays are known, for example: solid phase direct or indirect radioimmunoassay (RIA), solid phase direct or indirect enzyme immunoassay (EIA), competitive sandwich assay (see Stahli C et al. (1983) Methods Enzymol 9: 242-253 ); solid phase direct EIA with biotin and avidin (see Kirkland TN et al. (1986) J Immunol 137: 3614-9); solid phase direct analysis with labeling, solid phase direct

- 103 040077 labeled sandwich assay (see Harlow E & Lane D, (1988) Antibodies: A Laboratory Manual, Cold Spring Harbor Press); solid phase direct RIA labeled using the I-125 label (see Morel GA et al. (1988) Mol Immunol 25(1): 7-15); solid phase direct EIA with biotin and avidin (Cheung RC et al. (1990) Virology 176: 546-52); and direct RIA with tagging. (Moldenhauer G et al. (1990) Scand J Immunol 32: 77-82). Typically, such an assay involves the use of a purified antigen (eg, GITR, such as human GITR) bound to a solid surface or cells carrying an unlabeled immunoglobulin of interest and a labeled standard immunoglobulin. Competitive inhibition can be measured by quantifying the label bound to a solid surface or cells in the presence of the immunoglobulin being tested. Usually, the immunoglobulin under investigation is present in excess. Typically, if the competing antibody is present in excess, it will inhibit specific binding of the reference antibody to the common antigen by at least 50-55%, 55-60%, 60-65%, 65-70% 70-75% or more. The competition binding assay can be performed in a wide variety of formats using either a labeled antigen or a labeled antibody. In the conventional version of this assay, the antigen is immobilized in a 96-well plate. The ability of unlabeled antibodies to block the binding of labeled antibodies to the antigen is then determined using radioactive or enzymatic labels. For further details, see, for example, Wagener C et al. (1983) J Immunol 130: 2308-2315; Wagener C et al. (1984) J Immunol Methods 68: 269-274; Kuroki M et al. (1990) Cancer Res 50: 4872-4879; Kuroki M et al. (1992) Immunol Invest 21: 523-538; Kuroki M et al. (1992) Hybridoma 11: 391-407 and Antibodies: A Laboratory Manual, Ed Harlow E & Lane D editors, supra, pp. 386-389.

In one embodiment of the invention, the competitive analysis is carried out by surface plasmon resonance (BIAcore®), for example, by the tandem approach described in Abdiche YN et al. (2009) Analytical Biochem 386: 172-180, in which the GITR antigen is immobilized on the surface of a chip, such as a CM5 sensor chip, and then anti-GITR antibodies are passed through the chip. To determine if an antibody competes with an anti-GITR antibody described herein or an antigen-binding fragment thereof, anti-GITR is first passed through the surface of the chip to achieve saturation, and then a potentially competing antibody is added. Thereafter, the binding of the competing antibody relative to the non-competing control can be determined and quantified.

In certain aspects, a competitive binding assay can be used to determine if an antibody is competitively blocked, e.g., in a dose-dependent manner, by another antibody, e.g., the antibody binds predominantly the same epitope or overlapping epitopes as the reference antibody if the two antibodies recognize identical or sterically overlapping epitopes in a competitive binding assay, such as a competitive ELISA, which can be performed in any of a variety of formats using either a labeled antigen or a labeled antibody. In a particular embodiment, an antibody can be tested in a competitive binding assay with an antibody described herein (e.g., Hum231#1, Hum231#2, pab1964, pab1965, pab1966, pab1967, pab1968, pab1969, pab1970, pab1971, pab1972, pab1973 , pab1975, pab1976, pab1977, pab1979, pab1980, pab1981, pab1983, 23132-15, or antibodies 1-107, or antibodies pab2159, pab2160, pab2161, or Hum231#2w) or a chimeric antibody, or a Fab antibody, or an antibody containing a VH CDR and VL CDR of an antibody described herein (e.g., Hum231#1, Hum231#2, pab1964, pab1965, pab1966, pab1967, pab1968, pab1969, pab1970, pab1971, pab1972, pab1973, pab1975, pab1976, pab1977, pab1988, pab1978, pab1983, 231-32-15 or antibodies 1-107, or antibodies pab2159, pab2160, pab2161 or Hum231#2w).

In another aspect, provided herein are antibodies that compete (e.g., in a dose-dependent manner) for binding to GITR (e.g., human GITR) with an antibody described herein (e.g., Hum231#1, Hum231#2, pab1964, pab1965, pab1966, pab1967, pab1968, pab1969, pab1970, pab1971, pab1972, pab1973, pab1975, pab1976, pab1977, pab1979, pab1980, pab1981, pab1983, 231-32-15 или антителами 1-107) или антителами pab2159, pab2160, pab2161 или Hum231#2w as determined by an assay known to one of skill in the art or described herein (eg, a competitive ELISA or surface plasmon resonance assay). In another aspect, provided herein are antibodies that competitively inhibit binding (e.g., in a dose-dependent manner) of an antibody described herein (e.g., Hum231#1, Hum231#2, pab1964, pab1965, pab1966, pab1967, pab1968, pab1969, pab1970, pab1971 , pab1972, pab1973, pab1975, pab1976, pab1977, pab1979, pab1980, pab1981, pab1983, 231-32-15 or antibody 1-107, or antibody pab2159, pab2160, pab2161 or Hum231#2w) with human GITR (e.g.) as determined by an assay known to one of skill in the art or described herein (eg competitive ELISA or suspension matrix assay or surface plasmon resonance as described in Example 6 below). In specific embodiments of the invention, such a competitive blocking antibody activates, induces, or enhances one or more GITR activities. In specific aspects, this document provides an antibody that competes (e.g., in a dose-dependent manner) for specific binding to GITR (e.g., human GITR), with an antibody comprising the amino acid sequences described herein (e.g., VL and/or

- 104 040077

VH антитела Hum231#1, Hum231#2, pab1964, pab1965, pab1966, pab1967, pab1968, pab1969, pab1970, pab1971, pab1972, pab1973, pab1975, pab1976, pab1977, pab1979, pab1980, pab1981, pab1983, 231-32-15 или antibodies 1-107, or antibodies pab2159, pab2160 or pab2161 or Hum231#2w), as determined by an assay known to one of skill in the art or described herein (e.g. competitive ELISA assay or suspension array assay or surface plasmon resonance described in Example 6 below).

In certain embodiments, provided herein is an antibody that competes with an antibody described herein for binding to GITR (e.g., human GITR) to the same extent that an antibody described herein competes with itself for binding to GITR (eg human GITR). In some embodiments, provided herein is a first antibody that competes with an antibody described herein for binding to GITR (e.g., human GITR), wherein the first antibody competes for binding in an assay comprising the steps of: (a) incubation in a container of GITR-transfected cells with the first antibody or unlabeled form; and (b) adding the labeled antibody described herein to the container and incubating the cells in the container; and (c) detecting binding of labeled antibody described herein to cells. In certain embodiments of the invention, provided herein is a first antibody that competes with an antibody described herein for binding to GITR (e.g., human GITR), wherein the competition manifests itself as a decrease in the binding of the first antibody to GITR by more than 80% (e.g., 85%, 90%, 95%, or 98%, or 80% to 85%, 80% to 90%, 85% to 90%, or 85% to 95%).

In specific aspects, this document provides an antibody that competes (eg, in a dose-dependent manner) for specific binding to GITR (eg, human GITR), with an antibody comprising a VL domain having an amino acid sequence selected from the group consisting of SEQ ID 202 , 207, 208, 400-411, 413-416, 418-421, 423-448, 450-452, 454-464, 467-477, 481486, 488-513 and a sequence selected from the group consisting of SEQ ID NOs: 201, 206, 215, 217-234, 236-256, 258, 259, 261-265, 267, 268, 271-273, 276, 277, 280, 281, 283-285, 287, 288, 290, 291, 294, 296-299, 301, 304-306, 308, 313-316, 319, 320, 322-325, 327, 328, 333, 336, 338-340, 342, 343, 350, 354-356, 358-360, 362-368, 380, 384, and 387. In specific aspects, this document provides an antibody that competes (e.g., in a dose-dependent manner) for specific binding to GITR (e.g., human GITR), with an antibody containing a VL domain having an amine an acid sequence selected from the group consisting of SEQ ID nos. 202, 207, 208, 400-411, 413-416, 418-421, 423-448, 450-452, 454-464, 467-477, 481-486, 488 -513 and 515-519, and a VH domain having an amino acid sequence selected from the group consisting of SEQ ID NOs: 201, 206, 215, 217-234, 236-256, 258, 259, 261-265, 267, 268, 270-273, 276, 277, 280, 281, 283-285, 287, 288, 290, 291, 294, 296-299, 301, 304-306, 308, 313-316, 319, 320, 322- 325, 327, 328, 333, 336, 338-340, 342, 343, 345, 350, 354-356, 358-360 and 362-368. In specific aspects, this document provides an antibody that competes (e.g., in a dose-dependent manner) for specific binding to GITR (e.g., human GITR), with an antibody containing (i) a VL domain containing VL CDR1, VL CDR2, and VL CDR3, having the amino acid sequence of the VL CDR of the antibody shown in table. 1; and (ii) a VH domain containing VH CDR1, VH CDR2, and VH CDR3 having the amino acid sequences of the CDR of the antibody shown in Table. 2 (for example, the VH CDR of the specific antibody named in Table 1, such as 231-32-15, Hum231#1, or Hum231#2).

In a specific embodiment, this document provides an antibody that competes (eg, in a dose-dependent manner) for specific binding to GITR (eg, human GITR), with an antibody containing VH and VL CDR 231-32-15 (SEQ ID NO: 201 and 202).

In a particular embodiment, an antibody described herein is an antibody that is competitively blocked (e.g., in a dose-dependent manner) by an antibody containing a VL domain having an amino acid sequence selected from the group consisting of SEQ ID NOs: 202, 207, 208, 400-411, 413-416, 418-421, 423-448, 450-452, 454-464, 467-477, 481-486, 488-513 and 515-518, and a VH domain having the amino acid sequence selected from the group consisting of SEQ ID NOs: 201, 206, 215, 217-234, 236-256, 258, 259, 261-265, 267, 268, 271-273, 276, 277, 280, 281, 283-285 308 , 345, 350, 354-356, 358-360, 362-368, 380, 384 and 387, for specific binding to GITR (eg, human GITR). In a particular embodiment, an antibody described herein is an antibody that is competitively blocked (e.g., in a dose-dependent manner) by an antibody containing a VL domain having an amino acid sequence selected from the group consisting of SEQ ID NOs: 202, 207, 208, 400-411, 413-416, 418-421, 423-448, 450-464, 467-477, 481-486, 488-513 and 515-519, and a VH domain having an amino acid sequence selected from the group consisting of from SEQ ID NOs: 201, 206, 215, 217-234, 236-256, 258, 259, 261-265, 267, 268, 270-273, 276, 277, 280, 281, 283-285, 287, 288 , 290, 291, 294, 296-299, 301, 304-306, 308, 313-316, 319, 320, 322-325, 327, 328, 333, 336, 338-340, 342, 343, 345, 350 , 354-356, 358-360 and 362-368, for

- 105 040077 specific binding to GITR (eg human GITR).

In one embodiment, an antibody described herein is an antibody that is competitively blocked by an antibody comprising a VL domain having the amino acid sequence of SEQ ID NO: 207 or 208 and a VH domain having the amino acid sequence of SEQ ID NO: 206, for specific binding to GITR (eg human GITR).

In another specific embodiment, an antibody described herein is an antibody that is competitively blocked (e.g., in a dose-dependent manner) by an antibody comprising (i) a VL domain comprising VL CDR1, VL CDR2, and VL CDR3 having the amino acid sequences of the CDRs of the antibody, given in table. 1 (for example, the VL CDR of the specific antibody named in Table 1); and (ii) a VH domain containing VH CDR1, VH CDR2, and VH CDR3 having the amino acid sequences of the CDR of the antibody shown in Table. 2.

In specific aspects, provided herein is an antibody, or antigen-binding fragment thereof, that immunospecifically binds to the same epitope as the antibody (e.g., any of Hum231#1, Hum231#2, pab1964, pab1965, pab1966, pab1967, pab1968, pab1969, pab1970, pab1971, pab1972, pab1973, pab1975, pab1976, pab1977, pab1979, pab1980, pab1981, pab1983, 231-32-15 or pab2159, pab2160, pab2161 or Hum231#2w antibodies described in this) document amino acid sequences (see, for example, tables 1-4), with respect to specific binding to GITR (eg, human GITR). To determine if two antibodies bind to the same epitope, assay methods known to those skilled in the art or described herein (eg, x-ray crystallography, ELISA assay, etc.) can be used. In a particular embodiment, an antibody described herein, or an antigen-binding fragment thereof, immunospecifically binds to the same epitope as the antibody (e.g., any of Hum231#1, Hum231#2, pab1964, pab1965, pab1966, pab1967, pab1968, pab1969, pab1970, pab1971, pab1972, pab1973, pab1975, pab1976, pab1977, pab1979, pab1980, pab1981, pab1983, 231-32-15 or antibodies 1-107) containing a VL domain having an amino acid sequence selected from the group consisting of SEQ ID NOs: 202, 207, 208, 400-411, 413-416, 418-421, 423-448, 450-452, 454-464, 467-477, 481-486, 488-513 and 515-518, and VH domain having an amino acid sequence selected from the group consisting of SEQ ID NOs: 201, 206, 215, 217-234, 236-256, 258, 259, 261-265, 267, 268, 271-273, 276, 277 280 281 283-285 287 288 290 291 294 296-299 301 304306 308 313-316 319 320 322-325 327 328 333 336 338-340, 342, 343, 345, 350, 354-356, 358-360, 362368, 380, 384 and 387) . In a particular embodiment, an antibody described herein, or an antigen-binding fragment thereof, immunospecifically binds to the same epitope as the antibody (e.g., any of Hum231#1, Hum231#2, pab1964, pab1965, pab1966, pab1967, pab1968, pab1969, pab1970, pab1971, pab1972, pab1973, pab1975, pab1976, pab1977, pab1979, pab1980, pab1981, pab1983, 231-32-15 or antibodies 1-107, or antibodies pab2159, pab2160, pab2161 or Hum231#2w domain), containing having an amino acid sequence selected from the group consisting of SEQ ID NOs: 202, 207, 208, 400-411, 413-416, 418-421, 423-448, 450-464, 467-477, 481-486, 488 -513 and 515-519, and a VH domain having an amino acid sequence selected from the group consisting of SEQ ID NOs: 201, 206, 215, 217-234, 236-256, 258, 259, 261-265, 267, 268, 270-273, 276, 277, 280, 281, 283-285, 287, 288, 290, 291, 294, 296-299, 301, 304-306, 308, 313-316, 319, 320, 322- 325, 327, 328, 333, 336, 338-340, 342, 343, 345, 3 50, 354-356, 358-360 and 362-368.

In a specific embodiment, an antibody described herein, or an antigen-binding fragment thereof, immunospecifically binds to the same epitope that binds an antibody containing the VH domain and the VL domain of the antibody Hum231#1 or Hum231#2 (SEQ ID NOS: 206 and 207 or SEQ ID NOs: 206 and 208, respectively), or an epitope that overlaps an epitope of an antibody containing the VH domain and VL domain of a Hum231#1 or Hum231#2 antibody (SEQ ID NOs: 206 and 207 or SEQ ID NOs: 206 and 208 respectively).

In another specific embodiment of the invention, an antibody described herein, or an antigen-binding fragment thereof, immunospecifically binds to the same epitope as an antibody containing (i) a VL domain containing VL CDR1, VL CDR2, and VL CDR3 having the amino acid sequences of the CDRs of the antibody, given in table. 1 (for example, the VL CDR of the specific antibody named in Table 1); and (ii) a VH domain containing VH CDR1, VH CDR2, and VH CDR3 having the amino acid sequences of the CDR of the antibody shown in Table. 2 (for example, the VH CDR of the specific antibody named in Table 2).

In a particular embodiment, an antibody described herein, or an antigen-binding fragment thereof, that specifically binds to GITR (e.g., human GITR) and competitively blocks (e.g., in a dose-dependent manner) antibody binding 231-32-15, Hum231#1, Hum231#2 or Hum231#2w with GITR (eg, human GITR), contains a light chain variable region (VL) and a heavy chain variable region (VH), while (i) VL contains:

(a) VL CDR1 containing the amino acid sequence KSSQSX1X2X ₃ X4X5X ₆ X ₇ KX ₈ YLX ₉ (SEQ ID NO: 4), where

- 106 040077

X ₁ is L, A, V, I, P, F or M,

X ₂ is L, A, V, I, P, F, M or S,

X ₃ is N, G, Q, S, T, C, W, Y, or A,

X ₄ is S, G, N, Q, T, C, W, Y, or A,

X ₅ is G, N, Q, S, T, C, W, Y or A,

X ₆ is N, G, Q, S, T, C, W, Y, or A,

X ₇ is Q, G, N, S, T, C, W, Y, or A,

X ₈ is N, G, Q, S, T, C, W, Y, or A,

X9 is T, G, N, Q, S, C, W, Y, V, I, or A; and/or (b) a VL CDR2 containing the amino acid sequence X1ASTRX2X3 (SEQ ID NO: 5), where

X1 is W, G, N, Q, S, T, C, Y, F, H or A,

X2 is E, D or A,

X ₃ represents S, G, N, Q, T, C, W, Y or A; and/or (c) a VL CDR3 containing the amino acid sequence QX1X2YX3X4PYT (SEQ ID NO: 6), where

X ₁ is N, G, Q, S, T, C, W or Y,

X ₂ is D, E or Y,

X ₃ is S, G, N, Q, T, C, W, Y or A,

X ₄ is Y, G, N, Q, S, T, C, W, F, H, L, or A; and (ii) VH contains:

(a) VH CDR1 containing the amino acid sequence X1YX2MX3 (SEQ ID NO: 1) in which

X1 is D, E, G or A,

X2 is A, V, L, I, P, F, M or Y,

X3 is Y, G, N, Q, S, T, C, W, F, or H; and/or (b) a VH CDR2 containing the amino acid sequence X1IX ₂ X ₃ X ₄ SGX ₅ X ₆ X ₇ YX ₈ QKFX ₉ X ₁₀ (SEQ ID NO: 2), wherein

X ₁ is V, A, L, I, P, F, M or T,

X ₂ represents R, K, H, Q or A,

X ₃ is T, G, N, Q, S, C, W, Y, V, I, or P,

X ₄ is Y, G, N, Q, S, T, C, W, F, H or A,

X5 is D, E, G or A,

X6 is V, A, L, I, P, F, M or T,

X7 is T, G, N, Q, S, C, W, Y, V, I, P, or A,

X ₈ is N, G, Q, S, T, C, W, Y, or A,

X9 is K, R, H, Q or A,

X10 is D, E, G or A; and/or (c) a VH CDR3 containing the amino acid sequence SGTVRGX1X2X3 (SEQ ID NO: 3) wherein

X ₁ is F, A, V, L, I, P, M, Y, W, H or S,

X ₂ is A or D,

X ₃ is Y, G, N, Q, S, T, C, W, F, H, or V.

In a particular embodiment, an antibody described herein, or an antigen-binding fragment thereof, that specifically binds to GITR (e.g., human GITR) and competitively blocks (e.g., in a dose-dependent manner) antibody binding 231-32-15, Hum231#1, Hum231#2 or Hum231#2w with GITR (eg, human GITR), contains a light chain variable region (VL) and a heavy chain variable region (VH), while (i) VL contains:

(a) VL CDR1 containing the amino acid sequence KSSQSLLNSX1NQKNYLX2 (SEQ ID NO: 10) in which

X ₁ is G or S,

X ₂ is T or S; and/or (b) a VL CDR2 containing the amino acid sequence WASTRES (SEQ ID NO: 11); and/or (c) a VL CDR3 containing the amino acid sequence QNX1YSX ₂ PYT (SEQ ID NO: 12), in which

X1 is D or E,

X2 is Y, F or S, and (ii) VH contains:

(a) VH CDR1 containing the amino acid sequence X1YX ₂ MX ₃ (SEQ ID NO: 7) in which

X ₁ is D, E or G,

X ₂ is A or V,

- 107 040077

X3 is Y or H; and/or (b) a VH CDR2 containing the amino acid sequence X1IX2TX3SGX4X5X6YNQKFX7X8 (SEQ ID NO: 8), wherein

X ₁ is V or L,

X2 is R, K or Q,

X ₃ is Y or F,

X ₄ is D, E or G,

X ₅ is V or L,

X ₆ is T or S,

X7 is K, R or Q,

X8 is D, E or G; and/or (c) a VH CDR3 containing the amino acid sequence SGTVRGFAY (SEQ ID NO: 9).

In some embodiments, an antibody that competes with an antibody described herein for binding to GITR (e.g., human GITR) or binds the same or overlapping epitope as an antibody described herein (e.g., Hum231#1, Hum231#2 , pab1964, pab1965, pab1966, pab1967, pab1968, pab1969, pab1970, pab1971, pab1972, pab1973, pab1975, pab1976, pab1977, pab1979, pab1980, pab1981, pab1983, 231-32-15 или антитела 1-107, или антитела pab2159, pab2160, pab2161, or Hum231#2w) prevents GITRL (eg, human GITRL) from binding to GITR (eg, human GITR) by less than 85, 80, 75, 70, 65, 60, 55, 50, 45, 40, 35 , 30, 25, 20, or 10% as assessed by a method known to the person skilled in the art or described herein. In a particular embodiment, an antibody or antigen-binding fragment thereof that competes with an antibody described herein for binding to GITR (e.g., human GITR) or binds the same epitope or overlapping epitope as the antibody described herein inhibits GITRL binding ( e.g. human GITRL) with a GITR (e.g. human GITR) less than 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, or 10% as assessed by the method, described in Example 2 below (eg section 6.2.5.2 or 6.2.5.4 below). In another specific embodiment, an antibody or antigen-binding fragment thereof that competes with an antibody described herein for binding to GITR (e.g., human GITR) or binds the same epitope or an overlapping epitope as the antibody described herein, at a concentration of 1000 , 950, 900, 850, 800, 750, 700, 650, 600, 550, 500, 450, 400, 350, 333, 300, 250, 200, 100, 50, or 10 ng/ml inhibits binding 1.5, 1 .4, 1.3, 1.2, 1.1, 1, 0.9, 0.8, 0.7, 0.6, 0.5, 0.4, 0.3, 0.2 or 0 .1 nM labeled GITRL (e.g., GITRL-PE) with bead-bound GITR (e.g., human GITR bound to Luminex® beads) at 9, 8, 7, 6, 5, 4, or 3 pg/mL per bead less than than 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, or 10% compared to binding 1.5, 1.4, 1.3, 1, 2, 1.1, 1, 0.9, 0.8, 0.7, 0.6, 0.5, 0.4, 0.3, 0.2, or 0.1 nM labeled GITRL with GITR bound with granules at a concentration of 9 pg / ml, 8 pg / ml, 7 pg / ml, 6 pg / ml, 5 pg/ml, 4 or 3 pg/ml per bead, in the absence of an anti-GITR antibody or antigen-binding fragment thereof in a suspension matrix assay (eg Luminex® 200 system). In another specific embodiment, an antibody or antigen-binding fragment thereof that competes with an antibody described herein for binding to GITR (e.g., human GITR) or binds the same epitope or an overlapping epitope as the antibody described herein, at a concentration of 1000 to 750 ng/mL, 1000 to 500 ng/mL, 850 to 500 ng/mL, 750 to 500 ng/mL, 600 to 500 ng/mL, 500 to 400 ng/mL, 400 to 300 ng/mL or 300 to 200 ng/mL inhibits binding 1.5, 1.4, 1.3, 1.2, 1.1, 1, 0.9, 0.8, 0.7, 0, 6, 0.5, 0.4, 0.3, 0.2, or 0.1 nM labeled GITRL (eg, GITRL-PE) with GITR associated with beads (eg, human GITR associated with Luminex® beads) at a concentration 9, 8, 7, 6, 5, 4 or 3 pg/ml per granule less than 85, 80, 75, 70, 65, 60, 55, 50, 45, 40, 35, 30, 25, 2o% or 10% compared to binding 1.5, 1.4, 1.3, 1.2, 1.1, 1, 0.9, 0.8, 0.7, 0.6, 0.5, 0, 4, 0.3, 0.2, or 0.1 nM labeled GITRL with GITR associated with g ranula at a concentration of 9, 8, 7, 6, 5, 4 or 3 pg/ml per granule, in the absence of anti-GITR antibody or its antigen-binding fragment in the suspension matrix analysis (for example, the Luminex® 200 system). In another specific embodiment, an antibody, or antigen-binding fragment thereof, that competes with an antibody described herein for binding to GITR (e.g., human GITR) or binds the same epitope or an overlapping epitope as the antibody described herein, at a concentration of 3500 . ml inhibits binding 1.5, 1.4, 1.3, 1.2, 1.1, 1, 0.9, 0.8, 0.7, 0.6, 0.5, 0.4, 0 .3, 0.2, or 0.1 nM labeled GITRL (eg, GITRL-PE) with GITR bound to beads (eg, human GITR bound to Luminex® beads) at 9, 8, 7, 6, 5, 4 or 3 pg/ml per bead less than 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, or 10% compared to a binding of 1.5, 1, 4, 1.3, 1.2, 1.1, 1, 0.9, 0.8, 0.7, 0.6, 0.5, 0.4, 0.3, 0.2 or 0, 1 nM labeled GITRL with GITR bound to beads in conc. concentrations of 9, 8, 7, 6, 5, 4, or 3 pg/mL per bead, in the absence of anti-GITR antibody or antigen-binding fragment thereof in a suspension matrix assay (e.g. Luminex® system

- 108 040077

200). In another specific embodiment, an antibody or antigen-binding fragment thereof that competes with an antibody described herein for binding to GITR (e.g., human GITR) or binds the same epitope or an overlapping epitope as the antibody described herein, at a concentration of 3500 to 3200 ng/mL, 3500 to 3000 ng/mL, 3200 to 2500 ng/mL, 3000 to 2200 ng/mL, 2500 to 1800 ng/mL, 2000 to 1500 ng/mL, 1700 to 1200 ng/mL or 1500 to 1000 ng/mL inhibits binding 1.5, 1.4, 1.3, 1.2, 1.1, 1, 0.9, 0.8, 0.7, 0, 6, 0.5, 0.4, 0.3, 0.2, or 0.1 nM labeled GITRL (eg, GITRL-PE) with GITR associated with beads (eg, human GITR associated with Luminex® beads) at a concentration 9, 8, 7, 6, 5, 4 or 3 pg/ml per granule less than 85, 80, 75, 70, 65, 60, 55, 50, 45, 40, 35, 30, 25, 20 or 10 % compared to binding 1.5, 1.4, 1.3, 1.2, 1.1, 1, 0.9, 0.8, 0.7, 0.6, 0.5, 0.4 , 0.3, 0.2, or 0.1 nM labeled GITRL with GITR, bound to beads at a concentration of 9, 8, 7, 6, 5, 4, or 3 pg/ml per bead, in the absence of anti-GITR antibody or antigen-binding fragment thereof in a suspension matrix assay (eg, Luminex® 200 system).

In certain embodiments, an antibody that competes with the antibody described herein for binding to GITR (e.g., human GITR) or binds the same or overlapping epitope as the antibody described herein at a concentration of 3000 ng/mL prevents binding of 0 .5 nM GITRL (eg human GITRL) with GITR (eg human GITR) less than 85% or less than 80% when GITR (eg human GITR) is bound to beads (eg Luminex® beads) at a concentration 5 pg/mL per bead compared to binding of 0.5 nM labeled GITRL to bead-bound GITR at 5 pg/mL/bead in the absence of anti-GITR antibody or antigen-binding fragment thereof in a suspension matrix assay (e.g., system Luminex® 200). In certain embodiments, an antibody that competes with the antibody described herein for binding to GITR (e.g., human GITR) or binds the same or overlapping epitope as the antibody described herein at a concentration of 1000 ng/mL prevents binding of 0 .5 nM GITRL (eg, human GITRL) with GITR (eg, human GITR) less than 85%, less than 80%, or less than 75% when GITR (eg, human GITR) is bound to beads (eg, Luminex® Beads) at 5 pg/mL per bead compared to binding of 0.5 nM labeled GITRL to bead-bound GITR at 5 pg/mL/bead in the absence of anti-GITR antibody or antigen-binding fragment thereof in a suspension matrix assay (e.g. Luminex® 200 system). In certain embodiments, an antibody that competes with the antibody described herein for binding to GITR (e.g., human GITR) or binds the same or overlapping epitope as the antibody described herein at a concentration of 333 ng/mL prevents binding of 0 .5 nM GITRL (eg human GITRL) with GITR (eg human GITR) less than 70% or less than 65% when GITR (eg human GITR) is bound to beads (eg Luminex® beads) at a concentration 5 pg/mL per bead compared to binding of 0.5 nM labeled GITRL to bead-bound GITR at 5 pg/mL/bead in the absence of anti-GITR antibody or antigen-binding fragment thereof in a suspension matrix assay (e.g., system Luminex® 200). In certain embodiments, an antibody that competes with the antibody described herein for binding to GITR (e.g., human GITR) or binds the same or overlapping epitope as the antibody described herein at a concentration of 111 ng/mL prevents binding of 0 .5 nM GITRL (eg, human GITRL) with GITR (eg, human GITR) less than 65%, less than 60%, or less than 55% when GITR (eg, human GITR) is bound to beads (eg, Luminex® Beads) at 5 pg/mL per bead compared to binding of 0.5 nM labeled GITRL to bead-bound GITR at 5 pg/mL/bead in the absence of anti-GITR antibody or antigen-binding fragment thereof in a suspension matrix assay (e.g. Luminex® 200 system). In certain embodiments, an antibody that competes with the antibody described herein for binding to GITR (e.g., human GITR) or binds the same or overlapping epitope as the antibody described herein at a concentration of 37 ng/mL prevents binding of 0 .5 nM GITRL (eg human GITRL) with GITR (eg human GITR) less than 40% when GITR (eg human GITR) is bound to beads (eg Luminex® beads) at 5 pg/mL per bead compared to the binding of 0.5 nM labeled GITRL to bead-bound GITR at 5 pg/mL/bead in the absence of anti-GITR antibody or antigen-binding fragment thereof in a suspension matrix assay (eg, Luminex® 200 system). In certain embodiments, an antibody that competes with the antibody described herein for binding to GITR (e.g., human GITR) or binds the same or overlapping epitope as the antibody described herein at a concentration of 12 ng/mL prevents binding of 0 .5 nM GITRL (eg human GITRL) with GITR (eg human GITR) less than 20% when GITR (eg human GITR) is bound to beads (eg Luminex® beads) at a concentration of 5

- 109 040077 pg/ml per bead compared to binding of 0.5 nM labeled GITRL to bead-bound GITR at 5 pg/ml/bead in the absence of anti-GITR antibody or antigen-binding fragment thereof in a suspension matrix assay (e.g. , Luminex® 200 system).

In another embodiment, a certain amount of labeled GITRL (e.g., human GITRL-PE) binds to bead-bound GITR (e.g., human GITR bound to Luminex® beads) in the presence of an antibody that competes with the antibody described herein for binding to GITR or binds the same or overlapping epitope as an antibody described herein in a method comprising: (a) binding a GITR (eg, human GITR) to beads (eg, human GITR bound to Luminex® beads) at a concentration of 5 pg/ml per granule; (b) incubating the well with GITR-bound beads at a concentration of 40 beads/µl with 3000, 2500, 2θθ0, 1500, 1000, 750, 500, 250, 100, 50, or 10 ng/ml of a competitive antibody or an antibody that binds to same or overlapping epitope, for a first time period (e.g., 30, 60 min, 1.5 h, 2, 2.5, or 3 h), with the well containing 700, 750, 800, 850, 900, 950, 1000 , 110θ, 1200, 1300, 1400 or 1500 pellets; (c) adding labeled GITRL (e.g., human GITRL-PE) to the well to obtain a final concentration of 1.5, 1.4, 1.3, 1.2, 1.1, 1, 0.9, 0.8, 0.7, 0.6, 0.5, 0.4, 0.3, 0.2, or 0.1 nM (in specific embodiments, 0.5 nM) labeled GITRL and 20 bead/µl bead-bound GITR , and incubation for a second period of time (for example, 30 minutes, 1 hour, 1.5, 2, 2.5, or 3 hours); and (d) detecting labeled GITRL associated with bead-bound GITR, for example, in a suspension matrix assay such as the Luminex® 200 system. In specific embodiments, the amount of labeled GITRL associated with bead-bound GITR in the presence of a competing antibody, or an antibody that binds to the same or overlapping epitope is defined relative to the amount of labeled GITRL associated with bead-bound GITR in the absence of a competing antibody or an antibody that binds to the same or overlapping epitope. In certain embodiments of the invention, the absence of a competing antibody, or an antibody that binds to the same or overlapping epitope, means the absence of an antibody or antigen-binding fragment in the well. In other embodiments, the absence of a competing antibody or an antibody that binds to the same or overlapping epitope means that an isotype control antibody is present in the well that does not bind to GITR. According to these embodiments, the amount of labeled GITRL bound to bead-bound GITR in the presence of a competing antibody or an antibody that binds to the same or overlapping epitope is, in some embodiments, at least 20, 25, 30, 35%, 40%, 45%, 50%, 55%, or 60%, or 20% to 60%, 30% to 50%, or 20% to 70% of the amount of labeled GITRL bound to bead-bound GITR, in the absence of a competing antibody or antibody, that binds to the same or overlapping epitope.

In certain embodiments, at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, or 75% of GITRL (e.g., human GITRL) binds to GITR (e.g., human GITR) in the presence of an antibody or antigen-binding fragment thereof that competes with the antibody described herein for binding to GITR (e.g., human GITR) or binds to the same epitope or an overlapping epitope as the antibody described herein, as assessed by the method , known to a person skilled in the art or described in this document. In a particular embodiment, at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, or 75% of GITRL (e.g., human GITRL) binds to GITR (e.g., human GITR) in the presence of an antibody or antigen-binding fragment thereof that competes with the antibody described herein for binding to GITR (e.g., human GITR) or binds to the same epitope or an overlapping epitope as the antibody described herein, as assessed by the method described in Example 2 below (eg Sections 6.2.5.2 or 6.2.5.4 below). In another specific embodiment of the invention, at least 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70% or 75% 1.5, 1.4, 1.3, 1.2, 1.1, 1, 0.9, 0.8, 0.7, 0.6, 0.5, 0.4, 0.3, 0.2, or 0.1 nM labeled GITRL (e.g. , labeled human GITRL, such as hGITRL-PE) binds to bead-bound GITR (e.g., human GITR bound to Luminex® beads) at a concentration of 9, 8, 7, 6, 5, 4, or 3 pg/mL per bead in presence of 1000, 950, 900, 850, 800, 750, 700, 650, 600, 550, 500, 450, 400, 350, 333, 300, 250, 200, 100, 50, or 10 ng/mL of antibody or antigen-binding fragment thereof that competes with the antibody described herein for binding to GITR (e.g., human GITR) or binds to the same epitope or overlapping epitope as the antibody described herein compared to binding 1.5, 1.4, 1 .3, 1.2, 1.1, 1, 0.9, 0.8, 0.7, 0.6, 0.5, 0.4, 0.3, 0.2, or 0.1 nM labeled GiTRL with GITR associated with granules in a concentrate 9, 8, 7, 6, 5, 4, or 3 pg/ml per bead, in the absence of anti-GITR antibody or antigen-binding fragment thereof in a suspension matrix assay (eg, Luminex® 200 system). In another specific embodiment of the invention, at least 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70 or 75% 1.5, 1.4, 1.3, 1 .2, 1.1, 1, 0.9, 0.8, 0.7, 0.6, 0.5, 0.4, 0.3, 0.2 or 0.1 nM labeled GITRL

- 110 040077 (e.g. labeled human GITRL such as hGITRL-PE) binds to bead-bound GITR (e.g. human GITR bound to Luminex® beads) at a concentration of 9, 8, 7, 6, 5, 4, or 3 pg /ml per granule in the presence of 3500, 3400, 3300, 3200, 3100, 3000, 2900, 2800, 2700, 2600, 2500, 2400, 2300, 2200, 2100, 2000, 1900, 18.00, 1700, 160 1300, 1200, or 1100 ng/mL of an antibody or antigen-binding fragment thereof that competes with the antibody described herein for binding to GITR (e.g., human GITR) or binds to the same epitope or an overlapping epitope as the antibody described herein, compared to binding 1.5, 1.4, 1.3, 1.2, 1.1, 1, 0.9, 0.8, 0.7, 0.6, 0.5, 0.4, 0.3, 0.2, or 0.1 nM labeled GITRL with GITR bound to beads at 9, 8, 7, 6, 5, 4, or 3 pg/mL per bead, in the absence of anti-GITR antibody or antigen-binding antibody thereof fragment in suspension matrix analysis (for example, with Luminex® 200 system). In certain embodiments, an antibody that competes with an antibody described herein for binding to GITR (e.g., human GITR) or binds the same or overlapping epitope as the antibody described herein at a concentration of 3000 ng/mL does not prevent binding 0.5 nM GITRL (eg human GITRL) with GITR (eg human GITR) greater than 15% or greater than 20% when GITR (eg human GITR) is bound to beads (eg Luminex® beads) in concentration of 5 pg/mL per bead compared to binding of 0.5 nM labeled GITRL to bead-bound GITR at 5 pg/mL/bead in the absence of anti-GITR antibody or antigen-binding fragment thereof in a suspension matrix assay (e.g., Luminex® 200 system). In certain embodiments, an antibody that competes with an antibody described herein for binding to GITR (e.g., human GITR) or binds the same or overlapping epitope as the antibody described herein at a concentration of 1000 ng/mL does not prevent binding 0.5 nM GITRL (eg, human GITRL) with GITR (eg, human GITR) greater than 15%, greater than 20%, or greater than 25% when GITR (eg, human GITR) is bead-bound (eg , Luminex® Beads) at 5 pg/mL per bead compared to binding of 0.5 nM labeled GITRL to bead-bound GITR at 5 pg/mL/bead in the absence of anti-GITR antibody or antigen-binding fragment thereof in the suspension matrix. analysis (eg Luminex® 200 system). In certain embodiments, an antibody that competes with the antibody described herein for binding to GITR (e.g., human GITR) or binds the same or overlapping epitope as the antibody described herein at a concentration of 333 ng/mL does not prevent binding 0.5 nM GITRL (eg human GITRL) with GITR (eg human GITR) greater than 30% or greater than 35% when GITR (eg human GITR) is bound to beads (eg Luminex® beads) in concentration of 5 pg/mL per bead compared to binding of 0.5 nM labeled GITRL to bead-bound GITR at 5 pg/mL/bead in the absence of anti-GITR antibody or antigen-binding fragment thereof in a suspension matrix assay (e.g., Luminex® 200 system). In certain embodiments, an antibody that competes with an antibody described herein for binding to GITR (e.g., human GITR) or binds the same or overlapping epitope as the antibody described herein at a concentration of 111 ng/mL does not prevent binding 0.5 nM GITRL (eg, human GITRL) with GITR (eg, human GITR) greater than 35%, greater than 40%, or greater than 45% when GITR (eg, human GITR) is bead-bound (eg , Luminex® Beads) at 5 pg/mL per bead compared to binding of 0.5 nM labeled GITRL to bead-bound GITR at 5 pg/mL/bead in the absence of anti-GITR antibody or antigen-binding fragment thereof in the suspension matrix. analysis (eg Luminex® 200 system). In certain embodiments, an antibody that competes with the antibody described herein for binding to GITR (e.g., human GITR) or binds the same or overlapping epitope as the antibody described herein at a concentration of 37 ng/mL does not prevent binding 0.5 nM GITRL (eg human GITRL) with GITR (eg human GITR) greater than 60% when GITR (eg human GITR) is bound to beads (eg Luminex® beads) at 5 pg/mL per bead versus binding of 0.5 nM labeled GITRL to bead-bound GITR at 5 pg/ml/bead in the absence of anti-GITR antibody or antigen-binding fragment thereof in a suspension matrix assay (e.g. Luminex® 200 system). In certain embodiments, an antibody that competes with the antibody described herein for binding to GITR (e.g., human GITR) or binds the same or overlapping epitope as the antibody described herein at a concentration of 12 ng/mL does not prevent binding 0.5 nM GITRL (eg human GITRL) with GITR (eg human GITR) greater than 85% when GITR (eg human GITR) is bound to beads (eg Luminex® beads) at 5 pg/mL per bead versus binding of 0.5 nM labeled GITRL to bead-bound GITR at 5 pg/ml/bead in the absence of anti-GITR antibody or antigen-binding fragment thereof in a suspension matrix assay (e.g. Luminex® 200 system).

- 111 040077

In certain embodiments, provided herein is an antibody that competes with an antibody described herein for binding to GITR (e.g., human GITR) or binds the same or overlapping epitope as the antibody described herein at a concentration of 150, 145 , 140, 135, 130, 125, 120, 115, 110, 105, or 100 nM associated with GITR (e.g., human GITR) immobilized on a chip (e.g., CM5 sensor chip), inhibits binding 150, 145, 140, 135 , 130, 125, 120, 115, 110, 105, or 10o nM GITRL (e.g., non-covalently bound human GITRL trimer) with less than 60%, less than 55%, less than 50%, less than 45%, less than 40%, less than 35%, less than 30%, less than 25%, less than 20%, or less than 15%. In certain embodiments, provided herein is an antibody that competes with an antibody described herein for binding to GITR (e.g., human GITR) or binds the same or overlapping epitope as the antibody described herein, wherein the competing antibody or an antibody that binds the same or overlapping epitope as an antibody described herein at 125 nM bound to a GITR (e.g., human GITR) immobilized on an array (e.g., CM5 sensor chip) inhibits binding of 125 nM GITRL ( for example, non-covalently bound human GITRL trimer) with GITR immobilized on the chip less than 60%, less than 55%, less than 50%, less than 45%, less than 40%, less than 35%, less more than 30%, less than 25%, less than 20% or less than 15%.

In certain embodiments, an antibody or fragment thereof that competes with an antibody described herein for binding to GITR (e.g., human GITR) or binds the same epitope or overlapping epitope as an antibody described herein binds to GITR (e.g., , human GITR) with a dissociation rate constant (k _dis s) of 8.5x10'3 s ^-1 or less, 3.5x10'3 s ^-1 or less, 5x10'3 s ^-1 or less, 2.5x10' 3 s ^-1 or less, 1x10'3 s ^-1 or less, 8.5x10 ^-4 s ^-1 or less, 5x10 ^-4 s ^-1 or less, 3.5x10'4 s ^-1 or less, 2.5x10 '4 s ^-1 or less, 1x10'4 s ^-1 or less, 8.5x10'5 s ^-1 or less, 3.5x10'5 s ^-1 or less, 5x10'5 s ^-1 or less, 2, 5x10'5 s ^-1 or less, 1x10'5 s ^-1 or less, 8.5x10'6 s ^-1 or less, 5x10 ^-6 s ^-1 or less, 3.5x10'6 s ^-1 or less, ^{2.5x10'6s -1} or less, 1x10'6s ^-1 or less, 8.5x10 ^{-7s -1} or less, 5x10 ^{-7s -1} or less, 2.5x10 ^{-7s -1} or less , 1x10 ^-7 s ^-1 or less, 8.5x10'8 s ^{-1 or} less or less, 5x10'8 s ^-1 or less, 2.5x10'8 s ^-1 or less, 1x10'8 s ^-1 or less, 8.5x10'9 s ^-1 or less, 5x10'9 s ^-1 or less less, 2.5x10'9 s ^-1 or less, or 1x10'9 s ^-1 or less. In some embodiments, an antibody or fragment thereof that competes with an antibody described herein for binding to GITR (e.g., human GITR) or binds the same epitope or overlapping epitope as an antibody described herein binds to GITR (e.g., , human GITR) with cdiss ranging from 9.5x10'5 to 1x10 ^-9 s ^-1 , from 8.5x10'5 to 1x10 ^-9 s ^-1 , from 5x10'5 to 1x10 ^-9 s ^-1 , from 9 , 5x10'5 to 1x10'8 s ^-1 , 5x10'5 to 1x10'8 s ^-1 , 9.5x10'5 to 1x10 ^-7 s ^-1 , 5x10'5 to 1x10 ^-7 s ^-1 , 9.5x10'5 to 5x10'6 s ^-1 , 9.5x10'5 to 1x10'5 s ^-1 , 8.5x10'3 to 1x10'4 s ^-1 , 5x10'3 to 2.5x10 '4 s ^-1 , 8.5x10'3 to 1x10'5 s ^-1 , 8.5x10'5 to 5x10'5 s ^-1 . In certain embodiments of the invention, kdiss is determined using a monovalent antibody, such as a Fab fragment, and measurements are made, for example, using BIAcore® surface plasmon resonance technology. In other embodiments of the invention, kdiss is determined using a bivalent antibody, and measurements are made, for example, using BIAcore® surface plasmon resonance technology. In a specific embodiment of the invention, k _diss is determined by the analysis method described in Section 6 below.

In certain embodiments, an antibody or fragment thereof that competes with an antibody described herein for binding to GITR (e.g., human GITR) or binds the same epitope or overlapping epitope as an antibody described herein binds to GITR (e.g., , human GITR) with an association rate constant (k_acc) of at least 105 M^-1With^-1, at least 2.5x105 M^-1With^-1, at least 3.5x105 M^-1With^-1, at least 5x105 M^-1With^-1, at least 106 M^-1With^-1, at least 2.5x106 M^-1With^-1, at least 3.5x106 M^-1With^-1, at least 5x106 M^-1With^-1, at least 10⁷ M^-1With^-1, at least 5x10⁷ M 1s^-1, at least 108 M^-1With^-1, at least 5x108 M^-1With^-1 or at least 10⁹ M^-1With^-1. In some embodiments, an antibody or fragment thereof that competes with an antibody described herein for binding to GITR (e.g., human GITR) or binds the same epitope or overlapping epitope as an antibody described herein binds to GITR (e.g., , human GITR) with kacc from 1x105 M^-1With^-1 up to 5x105 M^-1With^-1, from 1x105 M^-1With^-1 up to 1x106 M^-1With^-1, from 3.5x105 M^-1With^-1 up to 2.5x106 M^-1With^-1, from 3.5x105 M^-1With^-1 up to 3.5x106 M^-1With^-1, from 1x105 M^-1With^-1 up to 5x106 M^-1With^-1, from 1x105 M^-1With^-1 up to 1x10⁷ M^-1With^-1, from 1x105 M^-1With^-1 up to 5x10⁷ M^-1With^-1, from 1x105 M^-1With^-1 up to 108 M^-1With^-1, from 1x105 M^-1With^-1 up to 1x10⁹ M^-1With^-1, from 1x106 M^-1With^-1 up to 1x10⁷ M^-1With^-1, from 1x106 M^-1With^-1 up to 1x108 M^-1With^-1, from 1x106 M^-1With^-1 up to 1x10⁹ M^-1With^-1, from 1x10⁷ M^-1With^-1 up to 1x108 M^-1With^-1, from 1x10⁷ M^-1With^-1 up to 1x10⁹ M^-1With^-1, from 1x108 M^-1With^-1 up to 1x10⁹ M^-1With^-1. In certain embodiments of the invention, kacc is determined using a monovalent antibody, such as a Fab fragment, and measurements are made, for example, using BIAcore® surface plasmon resonance technology. In other embodiments of the invention k_acc determined using a bivalent antibody and measured using, for example, BIAcore® surface plasmon resonance technology. In a specific embodiment of the invention, k_acc determined by the analysis method described in Section 6 below.

In certain embodiments, an antibody or fragment thereof that competes with an antibody described herein for binding to GITR (e.g., human GITR) or binds the same epitope or overlapping epitope as an antibody described herein binds to GITR (e.g., , human GITR) with CD less than 7, 6, 5, 4.5, 4, 3.5, 3, 2.5, 2, 1.5, 1, 0.75, 0.5, 0.25 or 0.1 nM. In some embodiments, an antibody or fragment thereof that competes with an antibody described herein for binding to GITR (e.g., human GITR) or binds the same epitope or overlapping epitope as an antibody described herein binds to GITR (e.g., , human GITR) with CDs around 7, 6, 5, 4.5, 4, 3.5, 3, 2.5, 2, 1.5, 1, 0.75, 0.5, 0.25 or 0.1 nM. In certain embodiments, an antibody described herein or a fragment thereof that competes with an antibody described herein for binding to GITR (e.g., human GITR) or binds the same epitope or overlapping epitope as the antibody described herein binds with GITR (e.g. human GITR) with Kd of 7 to 4 nM, 7 to 5 nM, 6 to 4 nM, 5 to 3 nM, 5 to 1 nM, 5 to 0.5 nM, 4 to 3 nM, 4 to 2 nM, 4 to 1 nM, 4 to 0.5 nM, 3 to 2 nM, 3 to 1 nM, 3 to 0.5 nM, 2 to 1 nM, 2 to 0.5 nM, 3 to 0.1 nM, 2 to 0.1 nM, 1 to 0.1 nM, or 0.5 to 0.1 nM. In certain embodiments, Kd is calculated as the ratio of k _gu cc/k _acc , and k _acc and k _duss are determined using a monovalent antibody such as a Fab fragment, and measurements are made, for example, using BIAcore® surface plasmon resonance technology. In other embodiments, Kd is calculated as the ratio of k _gu cc/k _acc , and k _acc and k _duss are determined using a bivalent antibody such as a Fab fragment, and measurements are made, for example, using BIAcore® surface plasmon resonance technology. In a particular embodiment of the invention, Kd is calculated as shown in the examples in Section 6 below (eg Example 2).

In certain embodiments, an epitope of an antibody described herein is used as an immunogen to produce antibodies. See, for example, section 5.2, below, for methods for producing antibodies. In specific aspects, a disclosed antibody or fragment thereof that specifically binds to GITR (e.g., human GITR) does not inhibit (e.g., in a dose-dependent manner) the binding of mouse 6C8 antibody to GITR (e.g., human GITR) in an assay known to those skilled in the art. or described in this document. See, for example, US Pat. No. 7,812,135 for a description of the mouse 6C8 antibody. In certain embodiments, at least 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more of the mouse 6C8 antibody binds to GITR (e.g. , human GITR) in the presence of a described antibody or fragment thereof that specifically binds to GITR (eg, human GITR) as assessed by a method known to one of skill in the art or described herein. In a specific embodiment, the disclosed antibody, or fragment thereof, that specifically binds to GITR (e.g., human GITR) does not inhibit (e.g., in a dose-dependent manner) the binding of mouse 6C8 antibody to GITR (e.g., human GITR) as assessed by the method described in Example 6 below. In certain embodiments, at least 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more of the mouse 6C8 antibody binds to GITR (e.g. , human GITR) in the presence of a described antibody or fragment thereof that specifically binds to GITR (eg, human GITR), as assessed by the method described in Example 6 below.

In some embodiments, the anti-GITR antibodies described herein may be multispecific antibodies, eg, bispecific antibodies. In a specific embodiment, the anti-GITR antibody described herein is a bispecific antibody, wherein the antibody has specificity for at least two different, generally non-overlapping, epitopes. In a particular embodiment, the bispecific antibody comprises one arm containing an antibody described herein with specificity for GITR (e.g., human GITR) and a second arm containing an antibody with specificity for a different epitope on GITR (e.g., human GITR) or an epitope on another molecule, such as PD-1, PD-L1, PD-L2, CTLA-4, TIM-3, LAG-3, or OX40. For example, a bispecific antibody may comprise one arm containing an antibody with specificity for GITR described herein (e.g., human GITR) and a second arm containing an antibody with specificity for CTLA-4, such as tremelimumab (Pfizer), ipilimumab (Yervoy® , Bristol-Meyers Squibb), an antibody that binds the same epitope as tremelimumab or an overlapping epitope, or an antibody that binds the same epitope as ipilimumab or an overlapping epitope.

In specific aspects, an antibody or fragment thereof described herein that immunospecifically binds to GITR (eg, human GITR) acts as an agonist.

- 113 040077

In certain embodiments, an antibody or fragment thereof described herein that immunospecifically binds to GITR (e.g., human GITR) increases the activity of GITR (e.g., human GITR) by at least about 1.2, 1.3, 1, 4, 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 times as assessed by the methods described herein and/or known to those skilled in the art compared to GITR activity (e.g., human GITR) in the presence or absence of GITRL stimulation (e.g., human GITRL) without any either an antibody or an unrelated antibody (eg, an antibody that does not immunospecifically bind to GITR). In certain embodiments, an antibody or fragment thereof described herein that immunospecifically binds to GITR (e.g., human GITR) increases GITR (e.g., human GITR) activity by at least 5, 10, 15, 20, 25, 30 , 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% as assessed by the methods described herein and/or known to a person skilled in the art, according to compared to GITR activity (eg, human GITR) in the presence or absence of GITRL (eg, human GITRL) stimulation without any antibody or with an unrelated antibody (eg, an antibody that does not immunospecifically bind to GITR). Non-limiting examples of GITR (eg, human GITR) activity may include cell proliferation, GITR signaling (eg, human GITR), cell survival, and cytokine production (eg, IL-2, IL-6, IL-10, TNF-α, and IFN -γ). In specific embodiments, an antibody or fragment thereof described herein that immunospecifically binds to GITR (e.g., human GITR) induces or enhances GITR (e.g., human GITR) activity in conjunction with GITRL (e.g., human GITRL). In certain embodiments, an antibody or fragment thereof described herein that immunospecifically binds to GITR (e.g., human GITR) induces, enhances, or enhances GITR (e.g., human GITR) activity in the absence of GITRL (e.g., human GITRL). In specific embodiments, the antibody or antigen-binding fragment induces, enhances, or enhances GITR activity and does not inhibit (eg, does not completely or only partially inhibit) the binding of GITRL to GITR. In specific embodiments of the invention, the increase in GITR activity is evaluated as described in the examples below.

In certain aspects, an antibody or fragment thereof described herein that immunospecifically binds to GITR (e.g., human GITR) induces, enhances, or enhances cell proliferation of cells that express GITR and that respond to GITR signaling (e.g., cells that proliferate in response to GITR stimulation and GITR signaling such as T cells). Cell proliferation assay methods are described in the art, such as ³ H-thymidine incorporation assay, BrdU incorporation assay, or CFSE assay, as described in Example 3, and can be easily performed by one skilled in the art. In specific embodiments, T cells (e.g., CD4+ or CD8+ effector T cells) that have been stimulated with a T cell mitogen or an agent that stimulates the T cell receptor complex (e.g., phytohemagglutinin (PHA) and/or phorbol myristacetate (PMA) or an antibody that stimulates the PTK complex, such as an anti-CD3 antibody and an anti-CD28 antibody), in the presence of an antibody described herein or a fragment thereof that immunospecifically binds to GITR (e.g., human GITR), are characterized by increased cell proliferation compared to with T cells that were stimulated only with a T cell mitogen or an agent that stimulates the T cell receptor complex (phytohemagglutinin (PHA) and/or phorbol myristacetate (PMA), or an antibody that stimulates the PTK complex, such as an anti-CD3 antibody and an anti -CD28 antibody). See Example 3, below, which demonstrates an increase in T cell proliferation in the presence of an antibody described herein that immunospecifically binds to GITR. In one embodiment, CD8+ T cells that have been stimulated with a T cell mitogen or an agent that stimulates the T cell receptor complex (e.g., phytohemagglutinin (PHA) and/or phorbol myristacetate (PMA), or an antibody that stimulates the PTK complex, such as anti-CD3 antibody and antu-CD28 antibody), in the presence of an antibody or fragment thereof described herein that immunospecifically binds to GITR (e.g., human GITR), are characterized by increased cell proliferation compared to T cells that were stimulated with T cell mitogen alone or an agent that stimulates the T cell receptor complex (eg, phytohemagglutinin (PHA) and/or phorbol myristacetate (PMA), or an antibody that stimulates the PTK complex, such as an anti-CD3 antibody and an anti-CD28 antibody). In another embodiment, CD4+ T cells that have been stimulated with a T cell mitogen or an agent that stimulates the T cell receptor complex (e.g., phytohemagglutinin (PHA) and/or phorbol myristacetate (PMA), or an antibody that stimulates the PTK complex, such as anti- CD3 antibody and anti-CD28 antibody), in the presence of an antibody or fragment thereof described herein that immunospecifically binds to GITR (e.g., human GITR), are characterized by increased cell proliferation compared to T cells that were stimulated with T cell mitogen alone or an agent that stimulates the T cell receptor complex (eg, phytohemagglutinin (PHA) and/or phorbol myristacetate (PMA), or an antibody that stimulates the PTK complex, such as an anti-CD3 antibody and an antiCD28 antibody). In another embodiment, CD4+ T cells and CD8+ T cells that have been stimulated with a T cell mitogen or an agent that stimulates the T cell receptor complex (e.g., phytohemagglutinin (PHA) and/or phorbol myristacetate (PMA) or an antibody that stimulates PTK -complex, such as an anti-CD3 antibody and an anti-CD28 antibody), in the presence of an antibody described herein or a fragment thereof that immunospecifically binds to GITR (e.g., human GITR), are characterized by increased cell proliferation compared to T cells, stimulated with only a T cell mitogen or an agent that stimulates the T cell receptor complex (eg, phytohemagglutinin (PHA) and/or phorbol myristacetate (PMA), or an antibody that stimulates the PTK complex, such as an anti-CD3 antibody and an anti-CD28 antibody ). In some embodiments, T cells that have not been stimulated with a T cell mitogen or an agent that stimulates the T cell receptor complex (e.g., phytohemagglutinin (PHA) and/or phorbol myristacetate (PMA), or an antibody that stimulates the PTK complex, such as anti-CD3 antibody and anti-CD28 antibody), in the presence of an antibody or fragment thereof described herein that immunospecifically binds to GITR (e.g., human GITR), are characterized by increased GITR activity and/or increased NF-kB activity compared to T cells in the absence of an antibody described herein, or a fragment thereof, that immunospecifically binds to GITR (eg, human GITR).

In specific embodiments, an antibody or fragment thereof described herein that immunospecifically binds to GITR (e.g., human GITR) increases cell proliferation (e.g., of T cells, such as CD4 and CD8 effector T cells) by at least about 1.2, 1.3, 1.4, 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5, 6, 7, 8, 9, 10, 15, 20 , 30, 40, 50, 60, 70, 80, 90, or 100 times as assessed by methods described herein or known to those skilled in the art (such as ³ H-thymidine incorporation assay, BrdU incorporation assay, or CFSE assay described in Example 3 below) compared to the activity of GITR (e.g., human GITR) in the presence or absence of GITRL stimulation (e.g., human GITRL) without any antibody or with an unrelated antibody (e.g., an antibody that does not immunospecifically bind to GITR ). In specific embodiments, an antibody or fragment thereof described herein that immunospecifically binds to GITR (e.g., human GITR) increases cell proliferation (e.g., of T cells, such as CD4 and CD8 effector T cells) by at least about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 98, or 99% as assessed by the methods described in this document or known to those skilled in the art (eg, such as the ³ H-thymidine inclusion assay, BrdU inclusion assay, or CFSE assay described in Example 3, below), compared to GITR activity (eg, human GITR) in the presence or absence of stimulation of GITRL (eg, human GITRL) without any antibody or with an unrelated antibody (eg, an antibody that does not immunospecifically bind to GITR).

In some embodiments, T cells (e.g., CD4+ or CD8+ effector T cells) that are stimulated with a T cell mitogen (e.g., an anti-CD3 antibody or phorbol ester) in the presence of an antibody or fragment thereof described herein that is immunospecifically binds to GITR (e.g., human GITR), have cell proliferation increased by at least about 1.2, 1.3, 1.4, 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 times, compared to T cells stimulated with T-mitogen alone cells as assessed by methods described herein or known to those skilled in the art (eg, such as the ^.sup.3 H-thymidine inclusion assay, BrdU inclusion assay, or CFSE assay described in Example 3 below). In some embodiments, T cells (e.g., CD4+ or CD8+ effector T cells) that have been stimulated with a T cell mitogen or an agent that stimulates the T cell receptor complex (e.g., phytohemagglutinin (PHA) and/or phorbol myristacetate (PMA) or an antibody that stimulates the PTK complex, such as an anti-CD3 antibody and an anti-CD28 antibody), in the presence of an antibody or fragment thereof described herein that immunospecifically binds to GITR (e.g., human GITR), are characterized by cell proliferation increased by at least by about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 98 or 99%, compared to T cells, stimulated with only a T cell mitogen or an agent that stimulates the T cell receptor complex (eg, phytohemagglutinin (PHA) and/or phorbol myristacetate (PMA), or an antibody that stimulates the PTK complex, such as an anti-CD3 antibody and an anti-CD28 antibody ), according to the estimation methods, opi given herein or known to those skilled in the art (eg, such as ^{the 3} H-thymidine inclusion assay, the BrdU inclusion assay, or the CFSE assay described in Example 3 below). In a specific embodiment of the invention, cell proliferation is assessed as described in Example 3 below. In certain aspects, an antibody described herein, or a fragment thereof, that immunospecifically binds to GITR (e.g.,

- 115 040077 human GITR), increases the survival of cells (for example, T cells, such as effector T cells CD4 and CD8). In a specific embodiment, T cells (e.g., CD4+ or CD8+ effector T cells) that have been stimulated with a T cell mitogen or an agent that stimulates the T cell receptor complex (e.g., phytohemagglutinin (PHA) and/or phorbol myristacetate (PMA), or an antibody that stimulates the PTK complex, such as an anti-CD3 antibody and an anti-CD28 antibody), in the presence of an antibody described herein, or a fragment thereof that immunospecifically binds to GITR (e.g., human GITR), are characterized by increased survival compared to T cells stimulated with T cell mitogen alone. Methods for assaying cell survival are described in the art (eg trypan blue displacement assay) and can easily be performed by one of skill in the art. In specific embodiments, an antibody or fragment thereof described herein that immunospecifically binds to GITR (e.g., human GITR) enhances cellular survival (e.g., of T cells, such as CD4 and CD8 effector T cells) by at least about 1.2, 1.3, 1.4, 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5, 6, 7, 8, 9, 10, 15, 20 , 30, 40, 50, 60, 70, 80, 90, or 100 times as assessed by methods described herein or known to those skilled in the art (e.g. trypan blue displacement assay), compared to cell survival in the presence or absence of stimulation of GITRL (eg, human GITRL) without any antibody or with an unrelated antibody (eg, an antibody that does not immunospecifically bind to GITR). In specific embodiments, an antibody or fragment thereof described herein that immunospecifically binds to GITR (e.g., human GITR) enhances cellular survival (e.g., of T cells, such as CD4 and CD8 effector T cells) by at least about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 98, or 99% as assessed by the methods described in this document or known to one of skill in the art (e.g., trypan blue displacement assay), compared to cell survival in the presence or absence of GITRL stimulation (e.g., human GITRL) without any antibody or with an unrelated antibody (e.g., an antibody that is immunospecifically does not link to GITR).

In some embodiments, T cells (e.g., CD4+ or CD8+ effector T cells) that have been stimulated with a T cell mitogen (e.g., an anti-CD3 antibody or phorbol ester) in the presence of an antibody described herein or a fragment thereof that binds immunospecifically to GITR (e.g., human GITR), have cell survival increased by at least about 1.2, 1.3, 1.4, 1.5, 2, 2.5, 3, 3.5, 4 , 4.5, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 times, compared to T cells stimulated with mitogen T alone α-cells or an agent that stimulates the T-cell receptor complex (eg, phytohemagglutinin (PHA) and/or phorbol myristacetate (PMA), or an antibody that stimulates the PTK complex, such as an anti-CD3 antibody and an anti-CD28 antibody), as assessed by methods described herein or known to those skilled in the art (eg, trypan blue displacement assay). In some embodiments, T cells (e.g., CD4+ or CD8+ effector T cells) that have been stimulated with a T cell mitogen or an agent that stimulates the T cell receptor complex (e.g., phytohemagglutinin (PHA) and/or phorbol myristacetate (PMA) or an antibody that stimulates the PTK complex, such as an anti-CD3 antibody and an anti-CD28 antibody), in the presence of an antibody or fragment thereof described herein that immunospecifically binds to GITR (e.g., human GITR), are characterized by cell survival increased by less than about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% T cells stimulated with T cell mitogen alone, as assessed by methods described herein or known to one of skill in the art (eg, trypan blue displacement assay).

In certain embodiments, an antibody or fragment thereof described herein that immunospecifically binds to GITR (e.g., human GITR) protects effector T cells (e.g., CD4+ or CD8+ effector T cells) from activation-induced cell death. In some embodiments, an antibody or fragment thereof described herein that immunospecifically binds to GITR (e.g., human GITR) induces resistance of effector T cells (e.g., CD4+ or CD8+ effector T cells) to Treg-mediated suppression. In specific embodiments, an antibody or fragment thereof described herein that immunospecifically binds to GITR (e.g., human GITR) induces, enhances, or enhances the production of cytokines (e.g., IL-2, IL-6, IL-10, TNF- α and IFN-γ) by at least about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 98 or 99% as assessed by the methods described herein (see examples below, such as example 3) or known to those skilled in the art, compared to cytokine production with or without GITRL stimulation (e.g., human GITRL) without any either an antibody or with an unrelated antibody (eg, an antibody that does not immunospecifically bind to GITR). In specific embodiments of the invention

- 116 040077 an antibody or fragment thereof described herein that immunospecifically binds to GITR (e.g., human GITR), induces or increases the production of cytokines (e.g., IL2, IL-6, IL-10, TNF-α, and IFN-γ) at least about 1.2, 1.3, 1.4, 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5, 6, 7, 8, 9, 10 , 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 times as assessed by the methods described herein (see the examples below, such as Example 3) or known to a person skilled in the art, by versus cytokine production with or without GITRL stimulation (eg, human GITRL) without any antibody or with an unrelated antibody (eg, an antibody that does not immunospecifically bind to GITR).

In certain embodiments, T cells (e.g., CD4+ or CD8+ effector T cells) that have been stimulated with a T cell mitogen or an agent that stimulates the T cell receptor complex (e.g., phytohemagglutinin (PHA) and/or phorbol myristacetate (PMA) or an antibody that stimulates the PTK complex, such as an anti-CD3 antibody and an anti-CD28 antibody), in the presence of an antibody or fragment thereof described herein that binds immunospecifically to GITR (e.g., human GITR), are characterized by the production of cytokines (e.g., IL-2, IL-6, IL-10, TNF-α and IFN-γ) increased by at least about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60 , 65, 70, 75, 80, 85, 90, 95, 98, or 99%, compared to T cells that were stimulated with a T cell mitogen alone or an agent that stimulates the T cell receptor complex (eg, phytohemagglutinin (PHA) and/or phorbol myristacetate (PMA), or an antibody that stimulates the RTK complex, such as an anti-CD3 antibody and an ant and -CD28 antibody), as assessed by methods described herein or known to those skilled in the art (eg, ELISA assay or as described in the examples below). In some embodiments, T cells (e.g., CD4+ or CD8+ effector T cells) that have been stimulated with a T cell mitogen or an agent that stimulates the T cell receptor complex (e.g., phytohemagglutinin (PHA) and/or phorbol myristacetate (PMA) or an antibody that stimulates the PTK complex, such as an anti-CD3 antibody and an anti-CD28 antibody), in the presence of an antibody or fragment thereof described herein that binds immunospecifically to GITR (e.g., human GITR), are characterized by the production of cytokines (e.g., IL-2, IL-6, IL-10, TNF-α, and IFN-γ), increased by at least about 1.2, 1.3, 1.4, 1.5, 2, 2.5, 3 , 3.5, 4, 4.5, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90 or 100 times compared to T cells, stimulated with only a T cell mitogen or a T cell receptor complex stimulating agent (eg, phytohemagglutinin (PHA) and/or phorbol myristacetate (PMA), or an antibody that stimulates the PTK complex, such as anti α-CD3 antibody and antu-CD28 antibody) as assessed by methods described herein or known to those skilled in the art (eg, ELISA assay or as described in the examples below). In certain embodiments, the anti-GITR antibody, or antigen-binding fragment thereof, induces, enhances, or activates GITR activity in the absence of a PTK agonist (eg, an antu-CD3 antibody). GITR activity can be assessed by determining the activation of canonical and non-canonical NF-kB pathways. GITR activity can be assessed by determining the activation of signaling pathways mediated by the TRAF adapter. The TRAF adapter is selected from the group consisting of TRAF1, TRAF2, TRAF3, TRAF4 and TRAF5. GITR activity can be assessed by determining the activation of the MAPK/ERK pathway (also referred to as the Ras-Raf-MEK-ERK pathway). Examples of a PTK agonist include, but are not limited to, antibodies targeting the T cell receptor complex (e.g., an anti-CD3 antibody) and peptides associated with human leukocyte antigens, e.g., MHC class I and MHC class II, wherein the peptides are derived from self, mutated self or pathogen-associated proteins (for example, viral or bacterial).

An anti-GITR antibody, or antigen-binding fragment thereof, may be fused or conjugated (eg, covalently or non-covalently linked) to a detectable label or substance. Examples of detectable labels or substances include enzyme labels such as glucose oxidase; radioisotopes such as iodine ( ¹²⁵ I, ¹²¹ I), carbon ( ¹⁴ C), sulfur ( ³⁵ S), tritium ( ³ H), indium ( ¹²¹ In) and technetium ( ⁹⁹ Tc); luminescent labels such as luminol; and fluorescent labels such as fluorescein and rhodamine, and biotin. Such labeled antibodies, or antigen-binding fragments thereof, can be used to detect a GITR protein (eg, human GITR). See, for example, section 5.4.2 below.

5.2. Obtaining antibodies

Antibodies or fragments thereof that immunospecifically bind to GITR (eg, human GITR) can be produced by any method known in the art for antibody synthesis, eg, chemical synthesis or recombinant expression methods. The methods described herein employ, unless otherwise indicated, conventional techniques in molecular biology, microbiology, genetic analysis, recombinant DNA, organic chemistry, biochemistry, PCR, oligonucleotide synthesis and modification, nucleic acid hybridization, and related arts. These methods are described, for example, in the references listed in this document, and fully explained in the literature. See, for example, Maniatis T et al. (1982) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press; Sambrook J et al. (1989), Molecular Cloning: A

- 117 040077

Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press; Sambrook J et al. (2001) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY; Ausubel FM et al., Current Protocols in Molecular Biology, John Wiley & Sons (1987 and annual updates); Current Protocols in Immunology, John Wiley & Sons (1987 and annual updates) Gait (ed.) (1984) Oligonucleotide Synthesis: A Practical Approach, IRL Press; Eckstein (ed.) (1991) Oligonucleotides and Analogues: A Practical Approach, IRL Press; Birren B et al. (eds.) (1999) Genome Analysis: A Laboratory Manual, Cold Spring Harbor Laboratory Press.

In a specific embodiment, an antibody described herein is an antibody (e.g., a recombinant antibody) obtained, expressed, generated, or isolated by any means, which includes the creation, for example, through synthesis, of genetically engineering DNA sequences. In certain embodiments, such an antibody contains sequences (eg, DNA sequences or amino acid sequences) that do not naturally exist in the animal or mammalian (eg, human) germline antibody repertoire in vivo.

In a specific aspect, provided herein is a method for producing an antibody, or antigen-binding fragment thereof, that immunospecifically binds to GITR (eg, human GITR), comprising culturing a cell or host cell as described herein. In a certain aspect, this document provides a method for producing an antibody or antigen-binding fragment that immunospecifically binds to GITR (for example, human GITR), including the expression (for example, recombinant expression) of the antibody or antigen-binding fragment using the cell or cell described herein - a host (eg, a host cell or cell containing polynucleotides encoding an antibody described herein). In a particular embodiment of the invention, the cell is an isolated cell. In a specific embodiment of the invention, exogenous polynucleotides have been introduced into the cell. In a particular embodiment, the method further comprises the step of purifying an antibody, or an antigen-binding fragment thereof, derived from a host cell or cell.

Methods for making polyclonal antibodies are known in the art (see, for example, Chapter 11 in: Short Protocols in Molecular Biology, (2002) 5th Ed., Ausubel FM et al., eds., John Wiley and Sons, New York).

Monoclonal antibodies can be obtained using a variety of methods known in the art, including the use of hybridoma, recombinant methods and the phage display method, and combinations thereof. For example, monoclonal antibodies can be made using hybridoma technologies, including those known in the art and described, for example, in Harlow E & Lane D, Antibodies: A Laboratory Manual, (Cold Spring Harbor Laboratory Press, 2nd ed. 1988) ; Hammerling GJ et al., in: Monoclonal Antibodies and T-Cell Hybridomas 563 681 (Elsevier, N.Y., 1981). In the context of this document, the term monoclonal antibody is not limited to antibodies obtained using hybridoma technology. For example, monoclonal antibodies can be produced recombinantly from host cells exogenously expressing an antibody described herein or a fragment thereof, such as the light chain and/or heavy chain of such an antibody.

In specific embodiments of the invention in the context of this document, a monoclonal antibody is an antibody produced by a single cell (for example, a hybridoma or a host cell that produces a recombinant antibody), while the antibody immunospecifically binds to GITR (for example, human GITR) as defined, for example, ELISA or other antigen binding or competitive binding assay known in the art or exemplified herein. In specific embodiments, the monoclonal antibody may be a chimeric antibody or a humanized antibody. In certain embodiments, the monoclonal antibody is a monovalent antibody or a multivalent (eg, bivalent) antibody. In specific embodiments, the monoclonal antibody is a monospecific or multispecific antibody (eg, a bispecific antibody). The monoclonal antibodies described herein may, for example, be prepared by the hybridoma method as described in Kohler G & Milstein C (1975) Nature 256:495, or may, for example, be isolated from phage libraries using the methods described herein. Other methods for obtaining clonal cell lines and the monoclonal antibodies they express are well known in the art (see, for example, Chapter 11 in: Short Protocols in Molecular Biology, (2002) 5th Ed., Ausubel FM et al., supra).

Methods for generating and screening for specific antibodies using hybridoma technology are routine and well known in the art. For example, in the hybridoma method, a mouse or other suitable host animal such as a sheep, goat, rabbit, rat, hamster, or macaque is immunized to obtain lymphocytes that produce or are capable of producing antibodies that specifically bind to a protein (e.g., GITR( eg human GITR) used for immunization. Alternatively, lymphocytes can be immunized in vitro. The lymphocytes are then fused with myeloma cells using a suitable cross-linking agent, such as polyethylene glycol, to obtain a hybridoma cell (Goding JW (Ed), Monoclonal Antibodies: Principles and Practice, p. 59-103 (Academic Press, 1986)) . In addition, the RIMMS (multiple boost site) method can be used to immunize an animal (Kilpatrick KE et al. (1997) Hybridoma 16:381-9, incorporated by reference in its entirety).

In some embodiments, mice (or other animals such as rats, monkeys, donkeys, pigs, sheep, hamsters, or dogs) can be immunized with an antigen (e.g., GITR (e.g., human GITR)), and after an immune response has been detected, for example, detection of antibodies specific for the antigen, obtain mouse spleens and isolate splenocytes. The splenocytes are then fused using well known techniques with any suitable myeloma cells, eg, cells from the SP20 cell line available from the American Type Culture Collection (ATCC®) (Manassas, VA) to form hybridomas. Selection and cloning of hybridomas is carried out by the method of limiting dilution. In certain embodiments of the invention, lymph nodes from immunized mice are obtained, the cells of which are fused with NS0 myeloma cells.

The hybridoma cells thus obtained are seeded and grown in a suitable culture medium, which preferably contains one or more substances that inhibit the growth or survival of unfused parental myeloma cells. For example, if the parental myeloma cells lack the enzyme hypoxanthine-guanine phosphoribosyltransferase (HGPRT or HGPRT), hybridoma culture media typically contains hypoxanthine, aminopterine, and thymidine (HAT medium), which inhibit the growth of HGPRT-deficient cells.

In particular embodiments of the invention, myeloma cells are used that are to be efficiently fused, maintain stable high levels of antibody production by selected antibody-producing cells, and are sensitive to media such as HAT media. Among these myeloma cell lines are mouse myeloma lines such as the NS0 cell line, or derived from mouse tumors MOPC-21 and MPC-11, available from the Salk Institute Cell Distribution Center, San Diego, CA, USA, and SP-2 cells or X63-Ag8.653, available from the American Type Culture Collection, Rockville, MD, USA. Human myeloma and mouse-human heteromyeloma cell lines have also been described for the production of human monoclonal antibodies (Kozbor D (1984) J Immunol 133: 3001-5; Brodeur et al., Monoclonal Antibody Production Techniques and Applications, pp. 51-63 (Marcel Dekker, Inc., New York, 1987)).

The culture medium in which the hybridoma cells grow is evaluated for the production of monoclonal antibodies directed against GITR (eg, human GITR). The binding specificity of monoclonal antibodies produced by hybridoma cells is determined by methods known in the art, for example, by immunoprecipitation or in vitro binding assays such as radioimmunoassay (RIA) or enzyme-linked immunosorbent assay (ELISA).

Once hybridoma cells have been identified that produce antibodies with the desired specificity, affinity, and/or activity, clones can be subcloned using limiting dilution procedures and grown by standard methods (Goding JW (Ed), Monoclonal Antibodies: Principles and Practice, supra). Suitable culture media for this purpose include, for example, D-MEM or RPMI 1640 medium. In addition, hybridoma cells can be grown in vivo as ascitic tumors in animals.

The monoclonal antibodies secreted by the subclones are conveniently separated from the culture medium, ascitic fluid, or serum by conventional immunoglobulin purification procedures such as, for example, protein A sepharose, hydroxyapatite, gel electrophoresis, dialysis, or affinity chromatography. The antibodies described herein include antibody fragments that recognize a specific GITR (eg, human GITR) and can be generated by any method known to those skilled in the art. For example, the Fab and F(ab') ₂ fragments described herein can be produced by proteolytic cleavage of immunoglobulin molecules with enzymes such as papain (to produce Fab fragments) or pepsin (to produce F(ab') 2 fragments). The Fab fragment corresponds to one of two identical arms of the antibody molecule and contains a complete light chain paired with the VH and CH1 domains of the heavy chain. The F(ab') ₂ fragment contains two antigen-binding arms of the antibody molecule linked by disulfide bonds in the hinge region.

Additionally, the antibodies described herein, or antigen-binding fragments thereof, can also be generated using various phage display techniques known in the art. In phage display methods, functional domains of antibodies are displayed on the surface of phage particles that carry the polynucleotide sequences that encode them. In particular, DNA sequences encoding the VH and VL domains are amplified from animal cDNA libraries (eg, human or mouse diseased tissue cDNA libraries). The DNA encoding the VH and VL domains are recombined with the scFv linker by NDP and cloned into a phagemid vector. The vector is electroporated into E. coli and E. coli is infected with helper phage. The phage used in these methods is typically filamentous phage, including fd and M13, and the VH and VL domains are typically fused recombinantly to the gene III or gene VIII of the phage. The selection or detection of a phage expressing an antigen-binding domain that binds to a particular antigen can be carried out by means of an antigen, for example, using a labeled antigen or an antigen bound or immobilized on a solid surface or bead. Examples of phage display methods that can be used to generate the antibodies described herein include those described in Brinkman U et al. (1995) J Immunol Methods 182: 41-50; Ames RS et al. (1995) J Immunol Methods 184: 177-186; Kettleborough CA et al. (1994) Eur J Immunol 24: 952-958; Persic L et al. (1997) Gene 187: 9-18; Burton DR & Barbas CF (1994) Advan Immunol 57: 191-280; PCT Application No. PCT/GB91/001134; International Publication Nos. WO 90/02809, WO 91/10737, WO 92/01047, WO 92/18619, WO 93/1 1236, WO 95/15982, WO 95/20401 and WO 97/13844; and US Pat.

As described in the references above, after phage selection, the antibody-coding regions of the phage can be isolated and used to generate whole antibodies, including human antibodies, or any other antigen-binding fragment, and expressed in any desired host organism, including mammalian cells, insect cells, plant cells, yeast and bacteria, for example, as described below. Methods for recombinant production of antibody fragments such as Fab, Fab' and F(ab') ₂ fragments can also be used using methods known in the art, such as those disclosed in PCT Publication No. WO 92/22324; Mullinax R.L. et al. (1992) BioTechniques 12(6): 864-9; Sawai H et al. (1995) Am J Reprod Immunol 34: 26-34; and Better M et al. (1988) Science 240: 1041-1043. In one aspect, PCR primers including VH or VL nucleotide sequences, a restriction site, and a flanking sequence to protect the restriction site can be used to generate whole antibodies to amplify VH or VL sequences from a template, such as scFv clones. Using cloning techniques known to those skilled in the art, PCR-amplified VH domains can be cloned into vectors expressing the VH constant region, and PCR-amplified VL domains can be cloned into vectors expressing the VL constant region, such as human kappa or lambda constants. areas. The VH and VL domains can also be cloned into a single vector expressing the desired constant regions. Then, using methods known to those skilled in the art, the heavy chain conversion vectors and the light chain conversion vectors are co-transfected into cell lines to produce stable or transient cell lines that express full-length antibodies, eg, IgG.

A chimeric antibody is a molecule in which different parts of the antibody are derived from different immunoglobulin molecules. For example, a chimeric antibody may comprise the variable region of a mouse or rat monoclonal antibody fused to a constant region of a human antibody. Methods for producing chimeric antibodies are known in the art. See, for example, Morrison SL (1985) Science 229: 1202-7; Oi VT & Morrison SL (1986) BioTechniques 4: 214-221; Gillies SD et al. (1989) J Immunol Methods 125: 191-202; and US Pat. Nos. 5,807,715; 4,816,567; In specific embodiments, the humanized antibody also contains at least a portion of an immunoglobulin constant region (Fc), typically a human immunoglobulin. The antibody may also contain the CH1, hinge, CH2, CH3 and CH4 regions of the heavy chain. The humanized antibody can be selected from any class of immunoglobulins, including IgM, IgG, IgD, IgA, and IgE, and any isotype, including IgG1, IgG2, IgG3, and IgG4. Humanized antibodies can be obtained using a variety of methods known in the art, including, but not limited to, CDR grafting (European Patent No. 239400; International Publication No. WO 91/09967; and US Pat. Nos. 5225539, 5530101 and 5585089), vining or surface modification (EP 592106 and EP 519596; Padlan EA (1991) Mol Immunol 28(4/5): 489-498; Studnicka GM et al. (1994) Prot Engineering 7(6): 805-814 and Roguska MA et al (1994) PNAS 91: 969-973), strand shuffling (US Pat. No. 5,565,332) and methods disclosed in, for example, US Pat. No. 6,407,213, US Pat. 17105; Tan P et al. (2002) J Immunol 169: 1119-25; Caldas C et al. (2000) Protein Eng. 13(5): 353-60; Morea V et al. (2000) Methods 20(3): 267-79; Baca M et al. (1997) J Biol Chem 272(16): 10678-84; Roguska M.A. et al. (1996) Protein Eng 9(10): 895 904; Couto JR et al. (1995) Cancer Res. 55 (23 Supp): 5973s-5977s; Couto JR et al. (1995) Cancer Res 55(8): 1717-22; Sandhu JS (1994) Gene 150(2): 409-10 and Pedersen JT et al. (1994) J Mol Biol 235(3): 959-73. See also U.S. Patent Application Publication No. US 2005/0042664 A1 (Feb. 24, 2005), which is incorporated herein by reference in its entirety. Methods for making multispecific (eg, bispecific) antibodies have been described, for example, in US Pat. Nos. 7,951,917; 7,183,076; 5989830; 5869620; 6132992 and 8586713.

Single domain antibodies, for example, antibodies lacking light chains, can be prepared by methods well known in the art. See Riechmann L & Muyldermans S (1999) J

- 120 040077

Immunol 231: 25-38; Nuttall SD et al. (2000) Curr Pharm Biotechnol 1(3): 253-263; Muyldermans S, (2001) J

Biotechnol 74(4): 277-302; US patent No. 6005079; and International Publications No. WO 94/04678, WO

94/25591 and WO 01/44301.

In addition, antibodies that bind multispecifically to the GITR antigen can in turn be used to generate antibodies that mimic the antigen using techniques well known to those skilled in the art. (See, for example, Greenspan NS & Bona CA (1989) FASEB J 7(5): 437-444; and Nissinoff A (1991) J Immunol 147(8): 2429-2438).

In specific embodiments, an antibody described herein that binds to the same GITR epitope (eg, human GITR) as an anti-GITR antibody described herein is a human antibody or an antigen-binding fragment thereof. In specific embodiments, an antibody described herein that competitively blocks (e.g., in a dose-dependent manner) the binding of any of the antibodies described herein (e.g., Hum231#1, Hum231#2, pab1964, pab1965, pab1966, pab1967, pab1968, pab1969 , pab1970, pab1971, pab1972, pab1973, pab1975, pab1976, pab1977, pab1979, pab1980, pab1981, pab1983, 231-32-15 or antibody 1-107, or antibody pab2159, pab2160, pab2161 or Hum231 , human GITR) is a human antibody or antigen-binding fragment thereof. Human antibodies can be obtained by any method known in the art. For example, transgenic mice that are unable to express functional endogenous immunoglobulins but that can express human immunoglobulin genes can be used. In particular, human immunoglobulin heavy and light chain gene complexes can be introduced randomly or by homologous recombination into mouse embryonic stem cells. Alternatively, in addition to the human heavy and light chain genes, the human variable region, constant region, and D region can be introduced into mouse embryonic stem cells. Mouse immunoglobulin heavy and light chain genes can be rendered non-functional alone or simultaneously with the introduction of human immunoglobulin loci by homologous recombination. In particular, homozygous deletion of the JH region interferes with the production of endogenous antibodies. Modified embryonic stem cells are expanded and microinjected into blastocysts to produce chimeric mice. The chimeric mice are then bred to produce homozygous offspring that express human antibodies. Transgenic mice are routinely immunized with a selected antigen, eg all or part of the antigen (eg GITR). Monoclonal antibodies directed against the antigen can be obtained from immunized, transgenic mice using conventional hybridoma technology. The human immunoglobulin transgenes carried by transgenic mice are rearranged during B cell differentiation and subsequently undergo class switching and somatic mutation. Thus, using this method, therapeutically useful IgG, IgA, IgM and IgE antibodies can be obtained. For a review of this human antibody technology, see Lonberg N & Huszar D (1995) Int Rev Immunol 13:65-93. For a detailed discussion of this technology for the production of human antibodies and human monoclonal antibodies, as well as protocols for the production of such antibodies, see, for example, International Publications No. WO 98/24893, WO 96/34096 and WO 96/33735; and US Pat. Nos. 5,413,923; 5,625,126; 5,633,425; 5,569,825; 5,661,016; Mederex, Inc./Gen Pharm; U.S. Patent Nos. 5,545,806 and 5,569,825), Trans Chromo Mouse™ (Kirin), and KM Mouse™ (Medarex/Kirin).

Human antibodies that specifically bind to GITR (eg, human GITR) can be generated by a variety of methods known in the art, including the phage display methods described above using antibody libraries derived from human immunoglobulin sequences. See also US Pat. Nos. 4,444,887, 4,716,111, and 5,885,793; and International Publication Nos. WO 98/46645, WO 98/50433, WO 98/24893, WO 98/16654, WO 96/34096, WO 96/33735 and WO 91/10741.

In some embodiments of the invention, human antibodies can be obtained using mouse-human hybridomas. For example, human peripheral blood lymphocytes transformed with Epstein-Barr virus (EBV) can be fused with mouse myeloma cells to produce mouse-human hybridomas that secrete human monoclonal antibodies, and these mouse-human hybridomas can be screened to determine those that secrete human antibodies. monoclonal antibodies that immunospecifically bind to the target antigen (eg, GITR (eg, human GITR)). Such methods are known and described in the art, see, for example, Shinmoto H et al. (2004) Cytotechnology 46: 19-23; Naganawa Y et al. (2005) Human Antibodies 14:27-31.

- 121 040077

5.2.1. Polynucleotides

In certain aspects, provided herein are polynucleotides comprising a nucleotide sequence encoding an antibody described herein, or an antigen-binding fragment thereof (e.g., a light chain variable region and/or a heavy chain variable region) that immunospecifically binds to a GITR antigen (e.g., human GITR ), and vectors, eg, vectors containing such polynucleotides for recombinant expression in host cells (eg, E. coli and mammalian cells). Provided herein are polynucleotides containing nucleotide sequences encoding any of the antibodies provided herein, as well as vectors containing such polynucleotide sequences, such as expression vectors for efficient expression in host cells, such as mammalian cells.

As used herein, an isolated polynucleotide or nucleic acid molecule is one that is separated from other nucleic acid molecules that are present in a natural source (eg, mouse or human) of the nucleic acid molecules. In addition, an isolated nucleic acid molecule, such as a cDNA molecule, may be substantially free of other cellular material or culture medium when produced by recombinant methods, or substantially free of chemical precursors or other chemicals when chemically synthesized. For example, the expression substantially free includes preparations of polynucleotides or nucleic acid molecules containing less than about 15%, 10%, 5%, 2%, 1%, 0.5%, or 0.1% (in particular, less than about 10%) of other material, for example, cell material, culture medium, other nucleic acid molecules, chemical precursors, and/or other chemicals. In a particular embodiment, the nucleic acid molecule(s) encoding the antibody described herein is isolated or purified.

In specific aspects, provided herein are polynucleotides comprising nucleotide sequences encoding antibodies, or antigen-binding fragments thereof, that immunospecifically bind to a GITR polypeptide (e.g., human GITR) and contain the amino acid sequences described herein, as well as antibodies that compete with such antibodies. for binding to a GITR polypeptide (eg, in a dose-dependent manner) or that bind to the same epitope as such antibodies. In certain aspects, provided herein are polynucleotides comprising a nucleotide sequence encoding a light chain or a heavy chain of an antibody described herein. The polynucleotides may comprise nucleotide sequences encoding a light chain containing the VL FR and CDR of the antibodies described herein (see, for example, Tables 1 and 3). The polynucleotides may contain nucleotide sequences encoding a heavy chain containing the VH FR and CDR of the antibodies described herein (see, for example, Tables 2 and 4). In specific embodiments, the polynucleotide described herein encodes a VL domain containing an amino acid sequence selected from the group consisting of SEQ ID NOs: 202, 204, 205, 207, 208, and 400-518. In specific embodiments, the polynucleotide described herein encodes a VL domain containing the amino acid sequence of SEQ ID NO: 519. In specific embodiments, the polynucleotide described herein encodes a VH domain containing an amino acid sequence selected from the group consisting of SEQ ID NOs: 201, 203, 206 and 215-389. In specific embodiments, the polynucleotide described herein encodes a VL domain containing the amino acid sequence of any of the antibodies 231-32-15, Hum231#1, or Hum231#2 (eg, SEQ ID NO: 202, 207, or 208). In specific embodiments, the polynucleotide described herein encodes a VH domain containing the amino acid sequence of any of antibodies 231-32-15, Hum231#1, or Hum231#2 (eg, SEQ ID NO: 201 or 206). In specific embodiments of the invention, the polynucleotide described herein encodes a VL domain and a VH domain containing the amino acid sequence of any of the antibodies 231-32-15, Hum231#1 or Hum231#2 (for example, SEQ ID NO: 201-202 and/ or 206-208).

In specific embodiments of the invention, this document provides polynucleotides containing a nucleotide sequence encoding an anti-GITR antibody containing three VL chain CDRs, for example, containing the VL CDR1, VL CDR2 and VL CDR3 of any of the antibodies described herein (for example, see Table 1, for example VL CDR from one row in Table 1). In specific embodiments of the invention, this document provides polynucleotides containing three VH chain CDRs, for example, containing VH CDR1, VH CDR2 and VH CDR3 of any of the antibodies described herein (for example, see Table 2, for example, VH CDR from one row in Table 2). In specific embodiments of the invention, this document provides polynucleotides containing a nucleotide sequence encoding an anti-GITR antibody containing three VL chain CDRs, for example, containing VL CDR1, VL CDR2 and VL CDR3 of any of the antibodies described herein (for example, see 122 040077 VH CDR1, VH CDR2 and VH CDR3 of any of the antibodies described herein (for example, see Table 2, for example, VH CDR from one row in Table 2). In specific embodiments, the polynucleotide described herein encodes the VL CDR of any of antibodies 231-3215, Hum231#1, or Hum231#2 (eg, SEQ ID NO: 16, 17, or 18). In specific embodiments, a polynucleotide described herein encodes the VH CDR of any of antibodies 23132-15, Hum231#1, or Hum231#2 (eg, SEQ ID NO: 13, 14, or 15). In specific embodiments, the polynucleotide described herein encodes the VL CDR and VH CDR of any of antibodies 231-32-15, Hum231#1, or Hum231#2 (eg, SEQ ID NOs: 13-18).

In specific embodiments of the invention, this document provides polynucleotides containing a nucleotide sequence encoding an anti-GITR antibody containing a VL domain, for example, containing FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4, containing the amino acid sequence described herein (for example , see Tables 1 and 3, for example VL CDR and VL FR of the specific antibody named in Table). In specific embodiments of the invention, this document provides polynucleotides containing a nucleotide sequence encoding an anti-GITR antibody containing a VH domain, for example, containing FR1-CDR1FR2-CDR2-FR3-CDR3-FR4, containing the amino acid sequence described herein (for example , see Tables 2 and 4, for example, VH CDR and VH FR of the specific antibody named in Table). In certain embodiments of the invention, the polynucleotide described herein comprises a nucleotide sequence encoding the antibody proposed herein, containing the light chain variable region containing the amino acid sequence described herein (for example, SEQ ID NO: 202, 204, 205, 207, 208 and 400518 or SEQ ID NO: 519), wherein the antibody immunospecifically binds to GITR (eg, human GITR). In a certain embodiment, the polynucleotide described herein comprises a nucleotide sequence encoding the Hum231#1 or Hum231#2 or Hum231#2w antibodies as provided herein, comprising a light chain variable region containing the amino acid sequence described herein (e.g., SEQ ID NO: 207 or 208). In certain embodiments of the invention, the polynucleotide described herein comprises a nucleotide sequence encoding the antibody proposed herein, containing the heavy chain variable region containing the amino acid sequence described herein (for example, SEQ ID NOS: 201, 203, 206 and 215389), wherein the antibody immunospecifically binds to GITR (eg, human GITR). In a particular embodiment, a polynucleotide described herein comprises a nucleotide sequence encoding a Hum231#1, Hum231#2, or Hum231#2w antibody as provided herein, comprising a heavy chain variable region comprising the amino acid sequence described herein (e.g., SEQ ID NO: 206).

In certain aspects, the polynucleotide contains a nucleotide sequence encoding an antibody described herein, containing a VL domain containing one or more VL FRs having the amino acid sequence described herein (for example, see Table 3, for example, frame regions from one row table), while the antibody immunospecifically binds to GITR (for example, human GITR). In certain aspects, the polynucleotide comprises a nucleotide sequence encoding an antibody described herein, comprising a VH domain containing one or more VH FRs having the amino acid sequence described herein (e.g., see Table 4, e.g., framework regions from one row table), while the antibody immunospecifically binds to GITR (for example, human GITR).

In specific embodiments, a polynucleotide provided herein comprises a nucleotide sequence encoding an antibody described herein, comprising framework regions (e.g., VL domain and VH domain frameworks) that are human framework regions, wherein the antibody immunospecifically binds with GITR (e.g. human GITR). In certain embodiments, the polynucleotide provided herein comprises a nucleotide sequence encoding an antibody or fragment (eg, CDR or variable domain) described in section 5.1 above.

In specific aspects, provided herein is a polynucleotide comprising a nucleotide sequence encoding an antibody comprising a light chain and a heavy chain, eg, a separate light chain and a heavy chain. With respect to the light chain, in a particular embodiment of the invention, the polynucleotide provided herein comprises a nucleotide sequence encoding a kappa light chain. In another specific embodiment, the polynucleotide provided herein comprises a nucleotide sequence encoding a lambda light chain. In another specific embodiment, a polynucleotide provided herein comprises a nucleotide sequence encoding an antibody described herein comprising a human kappa light chain or a human lambda light chain. In a particular embodiment, the polynucleotide provided herein comprises a nucleotide sequence encoding an anti

- 123 040077 body that immunospecifically binds to GITR (for example, human GITR), and the antibody contains a light chain, while the amino acid sequence of the VL domain may contain any amino acid sequence described in this document (for example, SEQ ID NO: 202, 204 , 205, 207, 208 and 400-518 or SEQ ID NO: 519), and the light chain constant region contains the amino acid sequence of the human kappa light chain constant region. In another specific embodiment, the polynucleotide provided herein comprises a nucleotide sequence encoding an antibody described herein that immunospecifically binds to GITR (e.g., human GITR) and contains a light chain, wherein the amino acid sequence of the VL domain may comprise any amino acid the sequence described herein (e.g., SEQ ID NOS: 202, 204, 205, 207, 208, and 400-518 or SEQ ID NOS: 519) and the light chain constant region contains the amino acid sequence of the human lambda light chain constant region. For example, human constant region sequences may be those described in US Pat. contains a heavy chain, while the amino acid sequence of the VH domain may contain any amino acid sequence described in this document (for example, SEQ ID NO: 201, 203, 206 and 215-389), and the heavy chain constant region contains the amino acid sequence of the human constant region heavy chain gamma (γ).

In a certain embodiment, a polynucleotide provided herein comprises a nucleotide sequence encoding the VH domain and/or VL domain of an antibody described herein (e.g., Hum231#1, Hum231#2, pab1964, pab1965, pab1966, pab1967, pab1968, pab1969, pab1970, pab1971, pab1972, pab1973, pab1975, pab1976, pab1977, pab1979, pab1980, pab1981, pab1983, 231-32-15 or antibodies 1-107 such as SEQ ID NO: 209 or 800-974 for the VH domain or SEQ ID NO: 210, 211, or 1001-1126 for the VL domain) that binds immunospecifically to GITR (eg, human GITR). In a particular embodiment, a polynucleotide provided herein comprises a nucleotide sequence encoding the VH domain and/or VL domain of an antibody described herein (e.g., Hum231#1, Hum231#2, pab1964, pab1965, pab1966, pab1967, pab1968, pab1969, pab1970, pab1971, pab1972, pab1973, pab1975, pab1976, pab1977, pab1979, pab1980, pab1981, pab1983, 231-32-15 or antibodies 1-107 or pab2159, pab2160 or pab2161 antibodies such as SEQ ID NO: 209 or -974 for VH domain or SEQ ID NO: 210, 211 or 1000-1118 for VL domain) that immunospecifically binds to GITR (eg human GITR). In a certain embodiment, the polynucleotide provided herein comprises a nucleotide sequence encoding the VH domain and/or VL domain of a Hum231#1 or Hum231# antibody (eg, SEQ ID NO: 209-211). In another specific embodiment, the polynucleotide provided herein comprises a nucleotide sequence encoding an antibody (or antigen-binding fragment thereof) described herein that binds immunospecifically to a GITR (e.g., human GITR), wherein the antibody contains a VL domain and a VH domain. containing the amino acid sequences described herein, and the constant regions contain the amino acid sequences of human IgG1 constant regions (eg, allotype 1, 17, or 3) or human IgG4.

In a specific embodiment of the invention, provided herein are polynucleotides comprising a nucleotide sequence encoding an anti-GITR antibody or an antigen-binding fragment or domain thereof as set forth herein, see, for example, Table 1. 1-4, e.g. antibody Hum231#1, Hum231#2, pab1964, pab1965, pab1966, pab1967, pab1968, pab1969, pab1970, pab1971, pab1972, pab1973, pab1975, pab1976, pab1977, pab1980, pab1989, pab1989, pab1989 -32-15 or antibodies 1-107, or antibodies pab2159, pab2160, pab2161 or Hum231#2w.

Also provided herein are polynucleotides encoding an anti-GITR antibody or fragment thereof that are optimized, for example, by codon/RNA optimization, replacement of heterologous signal sequences, and removal of mRNA instability elements. Methods for obtaining optimized nucleic acids encoding an anti-GITR antibody or fragment (e.g., light chain, heavy chain, VH domain, or VL domain) for recombinant expression by making codon changes and/or deleting inhibitory regions in mRNA can be performed by adapting the optimization methods described in, for example, US Pat. Nos. 5,965,726; 6174666; 6291664; 6414132; and 6794498 respectively. For example, potential splice sites and instability elements (eg, A/T or A/U rich elements) in RNA can be mutated without changing the amino acids encoded by the nucleotide sequences to increase the stability of the RNA for recombinant expression. Changes take advantage of the degeneracy of the genetic code, such as using an alternative codon for an identical amino acid. In some embodiments of the invention, it may be necessary to change one or more codons to encode a conservative mutation, for example, a similar amino acid with a similar chemical structure

- 124 040077 and the properties and/or function of the original amino acid. Such methods can increase the expression of an anti-GITR antibody or fragment thereof by at least 1, 2, 3, 4, 5, 10, 20, 30, 40, 50, 60, 70, 80, times, or 100 times or more compared to with the expression of an anti-GITR antibody encoded by polynucleotides that have not been optimized.

In certain embodiments, an optimized polynucleotide sequence encoding an anti-GITR antibody or fragment thereof (e.g., VL domain and/or VH domain) described herein can hybridize to an antisense (e.g., complementary) polynucleotide of a non-optimized polynucleotide sequence encoding an anti-GITR antibody described herein, or a fragment thereof (eg, VL domain and/or VH domain). In specific embodiments, an optimized nucleotide sequence encoding an anti-GITR antibody or fragment thereof as described herein is hybridized under high stringency conditions to an antisense polynucleotide of a non-optimized polynucleotide sequence encoding an anti-GITR antibody or fragment thereof as described. In a particular embodiment, an optimized nucleotide sequence encoding an anti-GITR antibody or fragment thereof described herein is hybridized under high, moderate, or low stringency conditions to an antisense polynucleotide of a non-optimized nucleotide sequence encoding an anti-GITR antibody or fragment thereof described herein. Information regarding hybridization conditions has been described, for example, in US Patent Application Publication No. US 2005/0048549 (eg, paragraphs 72-73), which is incorporated herein by reference. Polynucleotides can be obtained and the nucleotide sequence of polynucleotides can be determined by any method known in the art. Nucleotide sequences encoding the antibodies described herein, for example, the antibodies described in table. 1-4 and modified versions of these antibodies can be detected by methods well known in the art, i. the assembly of nucleotide codons encoding specific amino acids is carried out so as to obtain a nucleic acid that encodes an antibody. Such an antibody-encoding polynucleotide can be assembled from chemically synthesized oligonucleotides (e.g., as described in Kutmeier G et al. (1994), BioTechniques 17:242-6), which, in brief, involves the synthesis of overlapping oligonucleotides containing portions of a sequence encoding antibody, and amplification of the ligated oligonucleotides by PCR.

Alternatively, a polynucleotide encoding an antibody described herein can be obtained from a nucleic acid from a suitable source (eg, hybridoma) using methods well known in the art (eg, PCR and other molecular cloning methods). For example, PCR amplification using synthetic primers that hybridize to the 3' and 5' ends of a known sequence can be performed using genomic DNA obtained from hybridoma cells producing the antibody of interest.

Such PCR amplification techniques can be used to generate nucleic acids containing a sequence encoding the light chain and/or heavy chain of an antibody. Such PCR amplification techniques can be used to generate nucleic acids containing a sequence encoding a light chain variable region and/or an antibody heavy chain variable region. The amplified nucleic acids can be cloned into vectors for expression in host cells and for further cloning, for example to generate chimeric and humanized antibodies.

If a clone containing a nucleic acid encoding a particular antibody is not available, but the sequence of the antibody molecule is known, the immunoglobulin-encoding nucleic acid can be chemically synthesized or obtained from a suitable source (e.g., an antibody cDNA library or a cDNA library derived from or nucleic acid, preferably poly A + RNA isolated from any antibody-expressing tissue or cell, such as hybridoma cells selected to express the antibody described herein) by PCR amplification using synthetic primers that hybridize at the 3' and 5' ends of the sequence, or aided by cloning using an oligonucleotide probe specific for a particular gene sequence to determine, for example, a cDNA clone from a cDNA library that encodes an antibody. The amplified nucleic acids obtained by PCR can then be cloned into replicable cloning vectors using any method well known in the art. DNA encoding the anti-GITR antibodies described herein can be readily isolated and sequenced using conventional procedures (eg, using oligonucleotide probes that are capable of specifically binding to the genes encoding the heavy and light chains of anti-GITR antibodies). Hybridoma cells can serve as a source of such DNA. Once isolated, the DNA can be introduced into expression vectors which are then transfected into host cells such as E. coli cells, simian COS cells, Chinese Hamster Ovary (CHO) cells (e.g., CHO cells from the CHO GS System™ (Lonza)) or myeloma cells that do not otherwise produce immunoglobulin protein to synthesize anti-GITR antibodies in recombinant host cells.

- 125 040077

To generate whole antibodies, PCR primers, including VH or VL nucleotide sequences, a restriction site, and flanking sequences to protect the restriction site, can be used to amplify VH or VL sequences in scFv clones. Using cloning techniques known to those skilled in the art, PCR-amplified VH domains can be cloned into vectors expressing a heavy chain constant region, e.g., the human gamma 4 constant region, and PCR-amplified VL domains can be cloned into vectors expressing the constant region light chain, such as human kappa or lambda constant regions. In certain embodiments, vectors for expressing VH or VL domains comprise an EF-1a promoter, a secretion signal, a cloning site for the variable domain, constant domains, and a selectable marker such as neomycin. The VH and VL domains can also be cloned into a vector expressing the desired constant regions. The heavy chain conversion vectors and light chain conversion vectors are then co-transfected into cell lines to generate stable or transient cell lines that express full-length antibodies, eg, IgG, using methods known to those skilled in the art.

The DNA can also be modified, for example, by replacing the coding sequence with the human heavy and light chain constant domains of murine sequences, or by covalently linking an immunoglobulin coding sequence to all or part of a sequence encoding a non-immunoglobulin polypeptide.

Also provided are polynucleotides that hybridize under high, moderate, or low stringency conditions to polynucleotides that encode an antibody as described herein. In specific embodiments, the polynucleotides described herein hybridize under high, moderate, or low stringency conditions with the polynucleotides provided herein encoding the VH domain (e.g., SEQ ID NOs: 201, 203, 206, and 215-389) and/or VL domain (eg 202, 204, 205, 207, 208 and 400-518 or SEQ ID NO: 519).

Hybridization conditions have been described in the art and known to those skilled in the art. For example, stringent hybridization may include hybridization to filter-bound DNA in x6 sodium chloride/sodium citrate (SSC) at about 45°C followed by one or more washes in 0.2xSSC/0.1% SDS at about 50-65 °C; hybridization under high stringency conditions may include hybridization with filter-bound nucleic acid in 6xSSC at about 45°C followed by one or more washes in 0.1xSSC/0.2% SDS at about 68°C. Other stringency conditions for hybridization are known to those skilled in the art and are described, for example, in Ausubel FM et al., eds., (1989) Current Protocols in Molecular Biology, Vol. I, Green Publishing Associates, Inc. and John Wiley & Sons, Inc., New York on pages 6.3.1-6.3.6 and 2.10.3.

5.2.2. Cells and vectors

In certain aspects, provided herein are cells (e.g., host cells) that express (e.g., recombinantly) the antibodies (or antigen-binding fragments thereof) described herein that specifically bind to GITR (e.g., human GITR) and associated with them. polynucleotides and expression vectors. Provided herein are (eg, expression vectors) containing polynucleotides containing nucleotide sequences encoding anti-GITR antibodies or fragments for recombinant expression in host cells, preferably mammalian cells. Also provided herein are host cells containing such vectors for recombinant expression of the anti-GITR antibodies described herein (eg, human or humanized antibodies). In a specific aspect, provided herein are methods for producing an antibody described herein, comprising expressing such an antibody from a host cell. Recombinant expression of an antibody described herein (e.g., a full length antibody described herein, an antibody heavy and/or light chain, or a single chain antibody) that specifically binds to GITR (e.g., human GITR) involves constructing an expression vector containing a polynucleotide that encodes an antibody. After obtaining a polynucleotide encoding an antibody molecule described herein, an antibody heavy and/or light chain, or a fragment thereof (for example, heavy and/or light chain variable domains), a vector for obtaining an antibody molecule can be obtained using recombinant DNA technology using well methods known in the art. Therefore, this document describes methods for producing a protein by expressing a polynucleotide containing a nucleotide sequence encoding an antibody or antibody fragment (eg, a light chain or a heavy chain). Methods well known to those skilled in the art can be used to construct expression vectors containing sequences encoding an antibody or antibody fragment (eg, light chain or heavy chain) and appropriate transcriptional and translational control signals. These methods include, for example, in vitro recombinant DNA technologies, synthetic technologies, and in vivo genetic recombination. Also proposed replicable vectors containing the nucleotide sequence,

- 126 040077 encoding an antibody molecule described herein, an antibody heavy or light chain, an antibody heavy or light chain variable domain or a fragment thereof, or a heavy or light chain CDR operably linked to a promoter. Such vectors may, for example, contain a nucleotide sequence encoding the constant region of an antibody molecule (see, for example, International Publication Nos. WO 86/05807 and WO 89/01036; and US Pat. No. 5,122,464) and the variable domains of the antibody can be cloned into such a vector. to express complete heavy, complete light chain, or complete heavy and light chains.

The expression vector can be transfected into a cell (e.g., a host cell) using conventional methods, and the resulting cells can then be cultured using conventional methods to produce an antibody described herein (e.g., an antibody containing the CDR of any of the Hum231#1, Hum231#2, pab1964, pab1965, pab1966, pab1967, pab1968, pab1969, pab1970, pab1971, pab1972, pab1973, pab1975, pab1976, pab1977, pab1979, pab1980, pab1981, pab1983, or antibodies antibodies pab2159, pab2160 or pab2161) or a fragment thereof. Therefore, provided herein are host cells comprising a polynucleotide encoding an antibody described herein, or fragments thereof, or a heavy or light chain, or fragments thereof, or a single chain antibody (e.g., an antibody containing the CDR of any of the Hum231#1 antibodies , Hum231#2, pab1964, pab1965, pab1966, pab1967, pab1968, pab1969, pab1970, pab1971, pab1972, pab1973, pab1975, pab1976, pab1977, pab1979, pab1980, pab1981, pab1983, or antibodies pab2159, pab2160 or pab2161) operably linked to a promoter to express such sequences in a host cell. In certain embodiments of the invention for the expression of double-chain antibodies, vectors encoding separately heavy and light chains can be co-expressed in a host cell to express the entire immunoglobulin molecule, as described below. In certain embodiments of the invention, the host cell contains a vector containing a polynucleotide encoding both the heavy chain and the light chain of an antibody described herein (for example, an antibody containing the CDR of any of the antibodies Hum231#1, Hum231#2, pab1964, pab1965, pab1966, pab1967, pab1968, pab1969, pab1970, pab1971, pab1972, pab1973, pab1975, pab1976, pab1977, pab1979, pab1980, pab1981, pab1983, 231-32-15 or pab125 antibodies or pab125) its fragment. In specific embodiments, the host cell contains two different vectors, wherein the first vector contains a polynucleotide encoding the heavy chain or heavy chain variable region of an antibody described herein (e.g., an antibody containing the CDR of any of the antibodies Hum231#1, Hum231#2 , pab1964, pab1965, pab1966, pab1967, pab1968, pab1969, pab1970, pab1971, pab1972, pab1973, pab1975, pab1976, pab1977, pab1979, pab1980, pab1981, pab1983, 231-32-15 или антител 1-107, или антител pab2159, pab2160 or pab2161) or a fragment thereof, and the second contains a polynucleotide encoding the light chain or variable region of the light chain of the antibody described herein (for example, an antibody containing the CDR of any of the antibodies Hum231#1, Hum231#2, pab1964, pab1965, pab1966, pab1967, pab1968, pab1969, pab1970, pab1971, pab1972, pab1973, pab1975, pab1976, pab1977, pab1979, pab1980, pab1981, pab1983, 231-32-15 or antibody pab2159, or pab2159 fragment1) nta. In other embodiments, the first host cell comprises a first vector containing a polynucleotide encoding the heavy chain or heavy chain variable region of an antibody described herein (e.g., an antibody containing the CDR of any of the antibodies Hum231#1, Hum231#2, pab1964, pab1965 , pab1966, pab1967, pab1968, pab1969, pab1970, pab1971, pab1972, pab1973, pab1975, pab1976, pab1977, pab1979, pab1980, pab1981, pab1983, 231-32-15 или антител 1-107, или антител pab2159, pab2160 или pab2161) or a fragment thereof, and the second host cell contains a second vector containing a polynucleotide encoding the light chain or light chain variable region of the antibody described herein (for example, an antibody containing the CDR of any of the antibodies Hum231#1, Hum231#2, pab1964, pab1965 , pab1966, pab1967, pab1968, pab1969, pab1970, pab1971, pab1972, pab1973, pab1975, pab1976, pab1977, pab1979, pab1980, pab1981, pab1983, 231-32-15 or pab16 antibodies 1). In specific embodiments, the heavy chain/heavy chain variable region expressed by the first cell associates with the light chain/light chain variable region from the second cell to form an anti-GITR antibody described herein (e.g., an antibody containing the CDR of any of the Hum231# antibodies 1, Hum231#2, pab1964, pab1965, pab1966, pab1967, pab1968, pab1969, pab1970, pab1971, pab1972, pab1973, pab1975, pab1976, pab1977, pab1979, pab1980, pab1983, pab1983, , or pab2159, pab2160 or pab2161 antibodies) or an antigen-binding fragment thereof. In certain embodiments of the invention, provided herein is a population of host cells comprising such a first host cell and a second host cell. In a particular embodiment, this document provides a population of vectors comprising a first vector containing a polynucleotide encoding the light chain/light chain variable region of an antiGITR antibody described herein (e.g., an antibody containing the CDR of any of the antibodies Hum231#1, Hum231#2 or antibodies

- 127 040077 pab2159, pab2160 or pab2161), and a second vector containing a polynucleotide encoding the heavy chain/heavy chain variable region of an anti-GITR antibody described herein (for example, an antibody containing the CDR of any of the antibodies Hum231#1, Hum231#2 , pab1964, pab1965, pab1966, pab1967, pab1968, pab1969, pab1970, pab1971, pab1972, pab1973, pab1975, pab1976, pab1977, pab1979, pab1980, pab1981, pab1983, 231-32-15 или антител 1-107, или антител pab2159, pab2160 or pab2161).

A variety of host-expression vector systems can be used to express the antibody molecules described herein (e.g., antibodies containing the CDRs of any of the antibodies Hum231#1, Hum231#2, pab1964, pab1965, pab1966, pab1967, pab1968, pab1969, pab1970, pab1971, pab1972, pab1973, pab1975, pab1976, pab1977, pab1979, pab1980, pab1981, pab1983, 231-32-15 or antibodies 1-107, or antibodies pab2159, pab2160 or pab2161 (see, for example, US Pat. No. 5,807,715). host expression vectors are means by which coding sequences of interest can be generated and subsequently purified, but are also cells that, when transformed or transfected with suitable nucleotide coding sequences, express the antibody molecule described herein in situ.They include, but are not limited to, microorganisms such as bacteria (e.g. E. coli and B. subtilis) transformed with recombinant expression vectors orami based on bacteriophage DNA, plasmid DNA or cosmid DNA containing antibody-coding sequences; yeast (eg, Saccharomyces Pichia) transformed with recombinant yeast expression vectors containing antibody-coding sequences; insect cell systems infected with recombinant viral expression vectors (eg, baculovirus) containing antibody-coding sequences; plant cell systems (e.g. green algae such as Chlamydomonas reinhardtii) infected with recombinant viral expression vectors (e.g. cauliflower mosaic virus, CMV; tobacco mosaic virus, TMV) or transformed with recombinant plasmid expression vectors (e.g. Ti-plasmid), containing antibody-coding sequences; or mammalian cell systems (eg, COS cells (eg, COS1 or COS), CHO, BHK, MDCK, HEK 293, NSO, PER.C6, VERO, CRL7O3O, HsS78Bst, HeLa and NIH 3T3, HEK-293T, HepG2, SP210 , R1.1, B-W, L-M, BSC1, BSC40, YB/20, and BMT10) carrying recombinant expression constructs containing promoters derived from the genome of mammalian cells (eg, metallothionein promoter) or mammalian viruses (eg, adenovirus late promoter; 7 ,5K vaccinia virus promoter). In a particular embodiment, cells for expressing the antibodies described herein (e.g., antibodies containing the CDRs of any of the antibodies Hum231#1, Hum231#2, pab1964, pab1965, pab1966, pab1967, pab1968, pab1969, pab1970, pab1971, pab1972, pab1973 , pab1975, pab1976, pab1977, pab1979, pab1980, pab1981, pab1983, 231-32-15 or antibody 1-107 or antibody pab2159, pab2160 or pab2161) or antigen-binding fragments thereof are CHO cells, e.g. CHO cells from CHO GS System™ (Lonza). In a particular embodiment, the cells for expressing the antibodies described herein are human cells, eg, human cell lines. In a particular embodiment, the mammalian expression vector is pOptiVEC™ or pcDNA3.3. In a particular embodiment, bacterial cells such as Escherichia coli or eukaryotic cells (eg mammalian cells), especially when expressing an entire recombinant antibody molecule, are used to express the recombinant antibody molecule. For example, mammalian cells such as Chinese Hamster Ovary (CHO) cells, in combination with a vector such as the basic mid-early promoter element of the human cytomegalovirus gene, are an efficient antibody expression system (Foecking MK & Hofstetter H (1986) Gene 45: 101-5 and Cockett MI et al (1990) Biotechnology 8(7): 662-7). In certain embodiments, the antibodies described herein are produced by CHO cells or NS0 cells. In a particular embodiment, the expression of nucleotide sequences encoding antibodies described herein that immunospecifically bind GITR (eg, human GITR) is regulated by an inducible promoter, a constitutive promoter, or a tissue-specific promoter.

In bacterial systems, a large number of expression vectors can advantageously be selected depending on the intended use and the antibody molecule being expressed. For example, when it is necessary to obtain a large amount of such an antibody to create pharmaceutical compositions of antibody molecules, it is desirable to use vectors that drive the expression of high levels of fused protein products that are easy to purify. Such vectors include, but are not limited to, the E. coli pUR278 expression vector (Ruether U & Mueller-Hill B (1983) EMBO J 2: 17911794) wherein the antibody coding sequence can be ligated separately into a vector in frame with lac coding regions Z so as to get the product of the merger; pIN vectors (Inouye S & Inouye M (1985) Nuc Acids Res 13: 3101-3109; Van Heeke G & Schuster SM (1989) J Biol Chem 24: 55035509); and the like. For example, pGEX vectors can also be used to express foreign polypeptides as glutathione 5-transferase (GST) fusion proteins. In general, such fusion proteins are soluble and readily purified from lysed cells by adsorption and binding to glutathione-agarose matrix beads followed by elution in the presence of free glutathione. The pGEX vectors are designed to contain thrombin or factor Xa protease cleavage sites so that the cloned target gene product can be released from the GST component.

In insect systems, for example, Autographa californica nuclear polyhedrosis virus (AcNPV) can be used to express foreign genomes. This virus grows in the cells of Spodoptera frugiperda. An antibody coding sequence can be separately cloned into non-essential regions (eg the polyhedrin gene) of the virus and placed under the control of an AcNPV promoter (eg the polyhedrin promoter). A wide variety of viral expression systems can be used in mammalian host cells. In cases where an adenovirus expression vector is used, the antibody coding sequence of interest can be ligated into an adenovirus transcription/translational control complex, eg, a late promoter and a three-component leader sequence. The chimeric gene can then be inserted into the adenovirus genome by in vitro or in vivo recombination. Insertion into a non-essential region of the viral genome (e.g. E1 or E3 region) will result in a recombinant virus that is viable and capable of expressing the antibody molecule in infected hosts (e.g., see Logan J & Shenk T (1984) PNAS 81(12): 3655-9). Special initiation signals may also be required for efficient translation of the inserted antibody coding sequence. These signals include the initiation codon ATG and adjacent sequences. In addition, the initiation codon must be in phase with the reading frame of the required coding sequence to ensure translation of the entire insert. These exogenous translational control signals and initiation codons can be of various origins, both natural and synthetic. Expression efficiency can be increased by including appropriate transcriptional enhancer elements, transcriptional terminators, etc. (see, for example, Bitter G et al. (1987) Methods Enzymol. 153: 516-544).

In addition, a host cell strain can be selected that modulates the expression of the inserted sequences, or modifies and processes the gene product in the specific manner desired. Such modifications (eg, glycosylation) and processing (eg, cleavage) of protein products may be important for protein function. Different host cells have characteristic and specific mechanisms for post-translational processing and modification of proteins and gene products. Appropriate cell lines or host cell systems can be selected to ensure correct modification and processing of the expressed foreign protein. From this point of view, it is possible to use eukaryotic host cells that possess the cellular apparatus for proper processing of the primary transcript, glycosylation, and phosphorylation of the gene product. Such mammalian host cells include, but are not limited to, CHO, VERO, BHK, Hela, MDCK, HEK 293, NIH 3T3, W138, BT483, Hs578T, HTB2, BT2O and T47D, NS0 cells (a mouse myeloma cell line that endogenously does not produce any immunoglobulin chains), CRL7O3O, COS (eg COS1 or COS), PER.C6, VERO, HsS78Bst, HEK-293T, HepG2, SP210, R1.1, B-W, L-M, BSC1, BSC40, YB/ 20, BMT10 and HsS78Bst. In certain embodiments, the anti-GITR antibodies described herein (e.g., an antibody containing the CDR of any of the antibodies Hum231#1, Hum231#2, pab1964, pab1965, pab1966, pab1967, pab1968, pab1969, pab1970, pab1971, pab1972, pab1973 , pab1975, pab1976, pab1977, pab1979, pab1980, pab1981, pab1983, 23132-15 or antibody 1-107 or antibody pab2159, pab2160 or pab2161) are produced in mammalian cells such as CHO cells.

In a particular embodiment, the antibodies described herein, or antigen-binding fragments thereof, are fucose-reduced or free of fucose. Such antibodies can be obtained by methods known to the person skilled in the art. For example, antibodies can be expressed in cells with insufficient or no ability to fucosylate. In a specific example, to obtain antibodies or antigen-binding fragments with reduced fucose content, cell lines with a knockout of both alleles of α1,6 fucosyltransferase can be used. The Potelligent® system (Lonza) is an example of a system that can be used to generate fucose-reduced antibodies or antigen-binding fragments thereof. For long-term highly productive production of recombinant proteins, it is possible to create cells with stable expression. For example, cell lines can be constructed that stably express an anti-GITR antibody described herein (e.g., an antibody containing the CDR of any of the antibodies Hum231#1, Hum231#2, pab1964, pab1965, pab1966, pab1967, pab1968, pab1969, pab1970, pab1971, pab1972, pab1973, pab1975, pab1976, pab1977, pab1979, pab1980, pab1981, pab1983, 23132-15 or antibody 1-107 or antibody pab2159, pab2160 or pab2161) or an antigen-binding fragment thereof. In specific embodiments, a cell provided herein stably expresses a light chain/light chain variable domain and a heavy chain/heavy chain variable domain that associate to form an antibody described herein (e.g., an antibody containing the CDR of any of the antibodies Hum231#1, Hum231#2, pab1964, pab1965, pab1966, pab1967, pab1968, pab1969, pab1970, pab1971, pab1972, pab1973, pab1975, pab1976, pab1977, pab1979, pab1980, pab1983, pab1983, pab2-3-3 1-107, or pab2159, pab2160 or pab2161 antibodies) or an antigen-binding fragment thereof.

In certain aspects, instead of using expression vectors that contain a viral origin of replication, host cells can be transformed with DNA driven by appropriate expression regulatory elements (e.g., promoter, enhancer, sequences, transcription terminators, polyadenylation sites, etc.) and a selectable marker . After introducing the foreign DNA/polynucleotide, the engineered cells are left to grow for 1-2 days in an enriched medium, and then the medium is changed to selective. The selectable marker in the recombinant plasmid confers selection resistance and allows cells to stably integrate the plasmid into their chromosomes and grow into foci, which in turn can be cloned and expanded into cell lines. This method is preferably used to construct cell lines that express the anti-GITR antibody described herein, or a fragment thereof. Such engineered cell lines may be particularly useful in screening and evaluating compositions that interact directly or indirectly with an antibody molecule. A wide variety of breeding systems can be used, including, but not limited to, herpes simplex virus thymidine kinase genes (Wigler M et al. (1977) Cell 11(1): 223-32), hypoxanthineguanine phosphoribosyltransferase (Szybalska EH & Szybalski W (1962) PNAS 48(12): 2026-2034) and adenine phosphoribosyltransferase (Lowy I et al. (1980) Cell 22(3): 817-23), which can be used in tk, hgprt or aprt cells, respectively. It is also possible to use antimetabolite resistance as a basis for selection for the following genes: dhfr, which confers resistance to methotrexate (Wigler M et al. (1980) PNAS 77(6): 3567-70; O'Hare K et al. (1981 ) PNAS 78: 1527-31); gpt, which confers resistance to mycophenolic acid (Mulligan RC & Berg P (1981) PNAS 78(4): 2072-6); neo which confers resistance to aminoglycoside G-418 (Wu GY & Wu CH (1991) Biotherapy 3: 87-95; Tolstoshev P (1993) Ann Rev Pharmacol Toxicol 32: 573-596; Mulligan RC (1993) Science 260: 926 -932 and Morgan RA & Anderson WF (1993) Ann Rev Biochem 62: 191-217 Nabel GJ & Feigner PL (1993) Trends Biotechnol 11(5): 211-5); and hygro, which confers resistance to hygromycin (Santerre RF et al. (1984) Gene 30(1-3): 147-56). Conventional methods known in the field of recombinant DNA technology, which can be used to select the desired recombinant clone, are described, for example, in Ausubel FM et al. (eds.), Current Protocols in Molecular Biology, John Wiley & Sons, NY (1993); Kriegler M, Gene Transfer and Expression, A Laboratory Manual, Stockton Press, NY (1990); and in Chapters 12 and 13, Dracopoli NC et al. (eds.), Current Protocols in Human Genetics, John Wiley & Sons, NY (1994); Colbere-Garapin F et al. (1981) J Mol Biol 150: 1-14, which are incorporated herein by reference in their entirety.

Expression levels of an antibody molecule can be increased by vector amplification (for a review, see Bebbington CR & Hentschel CCG, The use of vectors based on gene amplification for the expression of cloned genes in mammalian cells in DNA cloning, Vol. 3 (Academic Press, New York , 1987)). If the marker in the vector system expressing the antibody is amplifiable, increasing the level of inhibitor present in the host cell culture will increase the copy number of the marker gene. Since the amplified region is linked to the antibody gene, antibody production will also be increased (Crouse GF et al. (1983) Mol Cell Biol 3: 257-66). A host cell can be co-transfected with two or more of the expression vectors described herein, wherein the first vector encodes a heavy chain polypeptide and the second vector encodes a light chain polypeptide. The two vectors may contain identical selectable markers that allow for the same expression of the light and heavy chain polypeptides. Host cells can be co-transfected with varying amounts of two or more expression vectors. For example, host cells can be transfected with any of the following ratios between the first expression vector and the second expression vector: 1:1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1: 8, 1:9, 1:10, 1:12, 1:15, 1:20, 1:25, 1:30, 1:35, 1:40, 1:45 or 1:50. Alternatively, a single vector that encodes and is capable of expressing light and heavy chain polypeptides can be used. In such situations, the light chain should be placed before the heavy chain to avoid excess non-toxic heavy chain (Proudfoot NJ (1986) Nature 322: 562-565; and Kohler G (1980) PNAS 77: 2197-2199). The heavy and light chain coding sequences may comprise cDNA or genomic DNA. The expression vector may be monocistronic or multicistronic. A multicistronic nucleic acid construct may encode 2, 3, 4, 5, 6, 7, 8, 9, 10 or more, or in the range of 2-5, 5-10, or 10-20 genes/nucleotide sequences. For example, a bicistronic nucleic acid construct may contain, in the following order: a promoter, a first gene (eg, the heavy chain of an antibody described herein), and a second gene (eg, a light chain of an antibody described herein). In such an expression vector, transcription of both genes may be under the control of a promoter, while translation of mRNA from the first gene may be by a cap-dependent scanning mechanism, and translation of mRNA from the second gene may be by a cap-independent mechanism, for example, by IRES. After

- 130 040077 obtaining the antibody molecule described herein by recombinant expression, it can be purified by any method known in the art for purifying immunoglobulin molecules, for example, by chromatography (for example, ion exchange, affinity, in particular affinity for a specific antigen after protein A, and size exclusion column chromatography), centrifugation, differential solubility, or any other standard protein purification method. In addition, antibodies described herein can be fused with heterologous polypeptide sequences described herein or known in the art to facilitate purification. [00389] In specific embodiments, the antibody described herein, or an antigen-binding fragment thereof, is purified or isolated. In general, an isolated antibody is an antibody that is substantially free of other antibodies with antigenic specificities different from the isolated antibody. For example, in a particular embodiment of the invention, the preparation of an antibody described herein is substantially free of cellular material and/or chemical precursors. The term substantially free of cellular material includes antibody preparations in which the antibody is separated from the cellular components of the cells from which it was isolated or recombinantly produced. Thus, an antibody that is substantially free of cellular material includes antibody preparations containing less than about 30%, 20%, 10%, 5%, 2%, 1%, 0.5%, or 0.1% (by dry weight) of the heterologous protein. (also referred to herein as a contaminant protein), and/or variants of the antibody, eg, different post-translationally modified forms of the antibody, or other different versions of the antibody (eg, antibody fragments). When an antibody is produced recombinantly, it is generally also substantially free from the culture medium, i. e. the culture medium is less than about 20%, 10%, 2%, 1%, 0.5%, or 0.1% of the volume of the protein preparation. When an antibody is chemically synthesized, it is generally substantially free of chemical precursors or other chemicals, i. it is separated from chemical precursors or other chemicals that are involved in protein synthesis. Accordingly, such antibody preparations contain less than about 30%, 20%, 10%, or 5% (by dry weight) of chemical precursors or compounds other than the antibody of interest. In a particular embodiment, the antibodies described herein are isolated or purified.

5.3. Pharmaceutical compositions

This document provides compositions containing the antibody described herein or its antigen-binding fragment having the required degree of purification, in a physiologically acceptable carrier, excipient or stabilizer (Remington's Pharmaceutical Sciences (1990) Mack Publishing Co., Easton, PA). Acceptable carriers, excipients or stabilizers are non-toxic to recipients at the doses and concentrations employed and include buffers such as phosphate, citrate and other organic acids; antioxidants such as ascorbic acid and methionine; preservatives (such as octadecyldimethylbenzyl ammonium chloride; hexamethonium chloride; benzalkonium chloride, benzethonium chloride; phenol, butyl or benzyl alcohol; alkyl parabens such as methyl or propyl paraben; catechol; resorcinol; cyclohexanol; 3-pentanol; and m-cresol); low molecular weight (less than about 10 residues) polypeptides; proteins such as serum albumin, gelatin or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, histidine, arginine or lysine; monosaccharides, disaccharides and other carbohydrates, including glucose, mannose and dextrins; chelating agents such as EDTA; sugars such as sucrose, mannitol, trehalose or sorbitol; salt-forming counterions such as sodium; metal complexes (eg Zn-protein complexes); and/or non-ionic surfactants such as TWEEN™, PLURONICS™ or polyethylene glycol (PEG). In a particular embodiment of the invention, the pharmaceutical compositions comprise an antibody described herein, or an antigen-binding fragment thereof, and, optionally, one or more additional prophylactic or therapeutic agents in a pharmaceutically acceptable carrier. In a particular embodiment, the pharmaceutical compositions comprise an effective amount of an antibody or antigen-binding fragment thereof as described herein and, optionally, one or more additional prophylactic or therapeutic agents in a pharmaceutically acceptable carrier. See section 5.4, below, for examples of prophylactic or therapeutic agents. In some embodiments of the invention, the antibody is the only active ingredient included in the pharmaceutical composition. The pharmaceutical compositions described herein can be used to increase, induce or activate GITR activity and treat a medical condition such as cancer or an infectious disease.

Pharmaceutically acceptable carriers for use in parenteral formulations include aqueous media, non-aqueous media, antimicrobial agents, isotonic agents, buffers, antioxidants, local anesthetics, suspending and dispersing agents, emulsifying agents, complexing or chelating agents, and other pharmaceutically acceptable substances. Examples of aqueous media include sodium chloride injection, Ringer's solution injection, isotonic

- 131 040077 dextrose injection, sterile water injection, dextrose injection and Ringer's lactate solution. Non-aqueous parenteral media include vegetable fatty oils, cottonseed oil, corn oil, sesame oil, and peanut oil. Antimicrobial agents at bacteriostatic or fungistatic concentrations can be added to parenteral preparations found in multi-dose containers, which include phenols or cresols, mercury preparations, benzyl alcohol, chlorobutanol, methyl and propyl p-hydroxybenzoic acid esters, thimerosal, benzalkonium chloride, and benzethonium chloride. Isotonic agents include sodium chloride and dextrose. Buffers include phosphate and citrate. Antioxidants include sodium bisulfate. Local anesthetics include novocaine. Suspension and dispersing agents include sodium carboxymethylcellulose, hydroxypropylmethylcellulose and polyvinylpyrrolidone. Emulsifying agents include polysorbate 80 (TWIN® 80). The metal ion complexing or chelating agent includes EDTA. Pharmaceutical carriers also include ethyl alcohol, polyethylene glycol and propylene glycol for water soluble media; and sodium hydroxide, hydrochloric acid, citric acid or lactic acid to adjust the pH. The pharmaceutical composition can be formulated for any route of administration to a subject. Specific examples of routes of administration include intranasal, oral, inhalation, transdermal, intradermal and parenteral. Parenteral administration, including subcutaneous, intramuscular or intravenous injection, is also contemplated herein. Injectable preparations may be prepared in conventional forms, ie liquid solutions or suspensions, solid forms intended to be dissolved or suspended in a liquid prior to injection, or emulsions. Injectables, solutions and emulsions also contain one or more excipients. Suitable excipients are, for example, water, saline, dextrose, glycerol or ethanol. In addition, if desired, the pharmaceutical compositions intended for use may also contain small amounts of non-toxic excipients, such as wetting or emulsifying agents, pH buffering agents, stabilizers, solubility enhancers and other such agents, such as, for example, sodium acetate, sorbitan monolaurate, triethanolaminoleate and cyclodextrins. Antibody preparations for parenteral administration include sterile injectable solutions, sterile dry soluble products such as lyophilized powders ready to be combined with a solvent immediately before use, including hypodermic tablets, sterile injectable suspensions, sterile dry insoluble products ready to be combined with a carrier directly before use, and sterile emulsions. Solutions can be either aqueous or non-aqueous.

In the case of intravenous administration, suitable carriers include physiological saline or phosphate buffered saline (PBS) and solutions containing thickening and solubilizing agents such as glucose, polyethylene glycol and polypropylene glycol, as well as mixtures thereof. Topical mixtures containing the antibody are prepared as described for topical and systemic administration. The resulting mixture may be in the form of a solution, suspension, emulsions and the like may be prepared as creams, gels, ointments, emulsions, solutions, elixirs, lotions, suspensions, tinctures, pastes, foams, aerosols, sprays, sprays, suppositories, bandages, skin patches or any other dosage form suitable for topical administration. An antibody described herein, or an antigen-binding fragment thereof, can be provided in the form of an aerosol for topical use, such as inhalation (see, for example, US Pat. especially asthma). Such respiratory preparations may be in the form of an aerosol or nebulizer solution, or a fine powder for inhalation, alone or in combination with an inert carrier such as lactose. In this case, the particles of the drug will in one embodiment of the invention have a diameter of less than 50 microns, in one embodiment of the invention - less than 10 microns. The antibody described herein, or an antigen-binding fragment thereof, can be prepared for topical application, for example, for topical application to the skin and mucous membranes such as in the eyes, in the form of gels, creams, and lotions for application to the eyes, or for intracisternal or intraspinal application. Topical administration is expected in the case of transdermal delivery, as well as in the case of application to the eyes or mucous membranes, or in the case of inhalation therapies. Nasal solutions of the antibody alone or in combination with other pharmaceutically acceptable excipients may also be used. Transdermal patches, including iontophoretic and electrophoretic devices, are well known to those skilled in the art and can be used to administer an antibody. For example, such patches are disclosed in US Pat. Nos. 6,267,983; 6,261,595; 6,256,533;

In certain embodiments of the invention, a pharmaceutical composition containing an antibody described herein or an antigen-binding fragment thereof is a lyophilized powder that can be reconstituted for administration in the form of solutions, emulsions, and other mixtures. It can also be reconstituted and obtained in the form of a solid or gel. The lyophilized powder is prepared by dissolving the antibody described herein or

- 132 040077 its antigen-binding fragment, or its pharmaceutically acceptable derivative in a suitable solvent. In some embodiments of the invention, the lyophilized powder is sterile. The solvent may contain an excipient which improves the stability or other pharmacological property of the powder or a reconstituted solution prepared from the powder. Excipients that can be used include, but are not limited to, dextrose, sorbitol, fructose, corn syrup, xylitol, glycerin, glucose, sucrose, or other suitable agent. The solution may also contain a buffer, such as citrate, sodium or potassium phosphate, or other such buffer known to those skilled in the art, at approximately neutral pH in one embodiment. Subsequent sterile filtration of the solution, followed by lyophilization under standard conditions known to those skilled in the art, provides the desired formulation. In one embodiment, the resulting solution is dispensed into lyophilization vials. Each vial contains one dosage or multiple dosages of the compound. The lyophilized powder can be stored under suitable conditions, for example from about 4° C. to room temperature. Reconstitution of such a lyophilized powder with water for injection provides a formulation for parenteral use. For reconstitution, the lyophilized powder is added to sterile water or other suitable vehicle. The exact amount depends on the selected compound. Such an amount can be determined empirically.

The antibodies described herein, or antigen-binding fragments thereof, and other compositions provided herein can also be targeted to a particular tissue, receptor, or body site of the subject to be treated. Many such targeting methods are well known to those skilled in the art. All such targeting methods are contemplated herein for use in the proposed compositions. Неограничивающие примеры методов нацеливания см., например, в патентах США № 6316652, 6274552, 6271359, 6253872, 6139865, 6131570, 6120751, 6071495, 6060082, 6048736, 6039975, 6004534, 5985307, 5972366, 5900252, 5840674, 5759542 и 5709874. В In a specific embodiment, an antibody described herein, or an antigen-binding fragment thereof, is targeted to a tumor.

Compositions for in vivo administration may be sterile. This is easily achieved by filtration, for example through sterile filter membranes.

5.4. Applications and methods 5.4.1. Therapeutic Uses and Methods

In one aspect, provided herein are methods for modulating one or more immune functions or one or more immune responses in a subject, comprising administering to a subject in need thereof an anti-GITR antibody or antigen-binding fragment thereof, or a composition thereof. In a specific aspect, provided herein are methods of activating, enhancing, or inducing one or more immune functions or one or more immune responses in a subject, comprising administering to a subject in need thereof an anti-GITR antibody or an antigen-binding fragment thereof, or a composition thereof. In a particular embodiment, provided herein are methods for preventing and/or treating diseases in which it is necessary to activate or enhance one or more immune functions or one or more immune responses in a subject, comprising administering to a subject in need thereof an anti-GITR described herein. an antibody or antigen-binding fragment thereof, or compositions thereof. In other specific embodiments, the method comprises a combination therapy, wherein the anti-GITR antibody, or antigen-binding fragment thereof, is administered to a subject in combination with another therapy, such as those described below, to activate or enhance one or more immune functions or one or more immune responses. In certain embodiments, the anti-GITR antibody, or antigen-binding fragment thereof, is administered as an adjuvant in combination with an antigenic composition. In certain embodiments, the antigenic composition comprises a cancer or tumor antigen (e.g., leukemia bcr/abl antigen, HPVE6 and E7 antigens of an oncogenic virus associated with cervical cancer, MAGE1 and MZ2-E melanoma antigens or melanoma-associated or MVC-1 antigens and HER-2 breast cancer or associated with breast cancer). In some embodiments, the antigenic composition comprises an antigen derived from a pathogen (eg, a viral antigen, a parasitic antigen, a bacterial antigen, or a fungal antigen). Examples of viral antigens include influenza virus nucleoprotein (NP), HIV antigens (e.g., HIV gag proteins, HIV env protein (e.g., gp120 and/or gp41), HIV Nef protein, HIV Pol proteins, HIV reverse transcriptase, or HIV protease), antigens Ebola virus (EBOV) antigens (e.g. NP or EBOV glycoprotein), blackpox antigens, hepatitis A, B or C virus antigens, human rhinovirus antigens, herpes simplex virus antigens, poliovirus antigens, foot-and-mouth disease virus (FMDV) antigens, rabies virus antigens, rotavirus antigens, Coxsackie virus antigens, and human papillomavirus (HPV) antigens. Examples of bacterial antigens include Bordetella pertussis antigens (e.g., P69 protein and filamentous hemagglutinin (FHA) antigens), Vibrio cholerae, Bacillus anthracis, and E. coli, such as the B subunit of heat-labile toxin.

- 133 040077 (LT-B) E. coli, E. coli K88 antigens and enterotoxigenic E. coli antigens.

As used herein, the term in combination refers to the use of more than one therapeutic agent (eg, one or more prophylactic and/or therapeutic agents). The use of the term in combination does not impose restrictions on the order in which the therapeutic agents are administered to a subject with a disease or disorder, or the route of administration. The first therapeutic agent (e.g., prophylactic or therapeutic agent) can be administered before (e.g., 5, 15, 30, 45 minutes, 1 hour, 2, 4, 6, 12, 24, 48, 72, 96 hours, 1 week, 2, 3, 4, 5, 6, 8, or 12 weeks), either at the same time or after (eg, 5, 15, 30, 45 min, 1 h, 2, 4, 6, 12, 24, 48, 72, 96 h, 1 week, 2, 3, 4, 5, 6, 8 or 12 weeks) administration of a second therapeutic agent (eg, a prophylactic or therapeutic agent) to a subject with a disease or disorder or a symptom thereof. In certain embodiments, the therapeutic agent (eg, agent) is administered to a subject in combination with an anti-GITR antibody or antigen-binding fragment thereof in a single composition (eg, pharmaceutical composition). In other embodiments, the therapeutic agent (eg, agent) is administered to the subject in combination with an anti-GITR antibody or antigen-binding fragment thereof in different compositions (eg, two or more pharmaceutical compositions). The two compositions may be administered at the same or different times and/or by the same or different routes. In a particular embodiment, an anti-GITR antibody, or antigen-binding fragment thereof, as described herein, is administered to a subject in combination with a vaccine composition to induce, activate, or enhance the immune response elicited by the vaccine composition. In one embodiment, the vaccine composition is a cancer vaccine. A cancer vaccine is an agent, molecule, or immunogen that stimulates or induces in an individual or subject an endogenous immune response against one or more cancer antigens. A cancer antigen can be a tumor-associated peptide or protein that induces or enhances an immune response and is derived from tumor-associated genes and their encoded proteins, e.g. MAGE-A1, MAGE-A2, MAGE-A3, MAGE-A4, MAGE-A5, MAGE-A6 , MAGE-A7, MAGE-A8, MAGE-A9, MAGE-A10, MAGE-A11, MAGE-A12, MAGE-A13, GAGE-1, GAGE-2, GAGE-3, GAGE-4, GAGE-5, GAGE -6, GAGE-7, GAGE-8, BAGE-1, RAGE-1, LB33/MUM-1, PRAME, NAG, MAGE-Xp2 (MAGE-B2), MAGEXp3 (MAGE-B3), MAGE-Xp4 (AGE -B4), tyrosinase, brain glycogen phosphorylase, Melan-A, MAGE-C1, MAGE-C2, NY-ESO-1, LAGE-1, SSX-1, SSX-2(HOM-MEL-40), SSX-1 , SSX-4, SSX-5, SCP-1, CT-7, alpha-actinin-4, Bcr-Abl fusion protein, Casp-8, beta-catenin, cdc27, cdk4, cdkn2a, coa-1, dek fusion protein -can, EF2, ETV6-AML1 fusion protein, LDLRfucosyltransferase-AS fusion protein, HLA-A2, HLA-A11, hsp70-2, KIAAO205, Mart2, Mum-2 and 3, neo-PAP, myosin class I, OS-9 , pml-RARa fusion protein, PTPRK, K-ras, N-ras, triose phosphate isomerase, GnTV, Herv-Kmel, Lage-1, Ma ge-C2, NA-88, /Lage-2, SP17 and TRP2-Int2, (MART-I), gp100 (Pmel 17), TRP-1, TRP-2, MAGE-1, MAGE-3, p15(58 ), CEA, NY-ESO (LAGE), SCP-1, Hom/Mel-40, p53, H-Ras, HER-2/neu, BCRABL, E2A-PRL, H4-RET, IGH-IGK, MYL-RAR , Epstein-Barr virus antigens, EBNA, human papillomavirus (HPV) antigens E6 and E7, TSP-180, MAGE-4, MAGE-5, MAGE-6, p185erbB2, p180erbB-3, c-met, nm-23H1, PSA, TAG-72-4, CA 19-9, CA 72-4, CAM 17.1, NuMa, K-ras, beta-catenin, CDK4, Mum1, p16, TAGE, PSMA, PSCA, CT7, telomerase, 43-9F , 5T4, 791Tgp72, AFP, 13HCG, BCA225, BTAA, CA 125, CA 15-3 (CA 27.29/BCAA), CA 195, CA 242, CA-50, CAM43, CD68\KP1, CO029, F-5 , G250, Ga733 (EpCAM), HTgp-175, M344, MA-50, MG7-Ag, MOV18, NB\170K, NYCO-1, RCAS1, SDCCAG16, TA-90 associated protein), TAAL6, TAG72, TLP and TPS. Cancer vaccines are useful both to increase the recognition of cancer cells by the immune system and to increase the antitumor response through the activation of lymphocytes. Effector T cells have been successfully generated by immunization with intact tumor cells or extract, purified antigens, peptides optimized for binding to both MHC and RTK, immune dominant peptides, DNA encoding tumor antigens, recombinant viruses encoding tumor antigens, or antigen-irradiated antigen-presenting cells. In some embodiments, the enhancement of immune recognition and cell expansion can be improved by the use of costimulators and cytokines, injection of cytokine expression vectors, in vitro antigen irradiated and activated autologous cells, and by blocking negative modulators (e.g., using agents that target immune checkpoints) and by depleting T-regulatory cells.

In a particular embodiment, the anti-GITR antibody described herein, or an antigen-binding fragment thereof, is administered to a subject in combination with a heat shock protein antitumor vaccine or a heat shock protein antipathogenic vaccine. See sections 5.4.1.1 and 5.4.1.2 for heat shock protein antitumor vaccines or antipathogenic heat shock protein vaccines for use in combination with an anti-GITR antibody or antigen-binding fragment thereof described herein.

In a particular embodiment, the anti-GITR antibody described herein, or an antigen-binding fragment thereof, is administered to a subject in combination with an adjuvant to induce, activate, or enhance the agonist action of the anti-GITR antibody. Depending on the medical

- 134 040077 different adjuvants can be used. Non-limiting examples of suitable adjuvants include, for example, Complete Freund's Adjuvant (CFA), Incomplete Freund's Adjuvant (IFA), Montanide ISA (Incomplete seppic Adjuvant), Ribi's Adjuvant System (RAS), Titer Max, Muramyl Peptides, Syntex Composition Adjuvant (SAF), Alum (aluminum hydroxide and/or aluminum phosphate), aluminum salt adjuvants, Gerbu® adjuvants, nitrocellulose captured antigen, encapsulated or integral antigen, immunostimulatory complexes such as saponins, Quil A, QS-21 and others. Other adjuvants include CpG oligonucleotides and double stranded RNA molecules such as poly(A), poly(C). Combinations of the above adjuvants can also be used. In some embodiments, the one or more adjuvants are a saponin such as QS-21, QS-21, and 3 De-O-alkylated monophosphoryl lipid A (3 D-MPL), and the immunostimulatory oligonucleotides and saponin-based adjuvants disclosed US Pat. No. 6,645,495; 7029678 and 7858589 respectively. In certain embodiments, provided herein are methods for enhancing stimulation of GITR responsive cells (e.g., T cells, such as effector T cells) comprising ex vivo incubation of GITR responsive cells (e.g., T cells) with document with an antibody or antigen-binding fragment thereof. In some embodiments, GITR-responsive cells are incubated with a stimulatory agent (e.g., phytohemagglutinin (PHA) and/or phorbol myristacetate (PMA), or an antibody that stimulates the PTK complex, such as an anti-CD3 antibody and an anti-CD28 antibody) until, simultaneously or after incubation with an anti-GITR antibody or antigen-binding fragment thereof. In certain embodiments of the invention, GITR-susceptible cells (eg, T cells) have been isolated from the body of a subject (eg, human). In some embodiments, following stimulation with an anti-GITR antibody or antigen-binding fragment thereof, GITR-responsive cells are administered to a subject (eg, a human). GITR-responsive cells (eg, T cells) can be administered to the same or a different subject from which the cells were previously isolated.

In some embodiments, provided herein are methods for activating GITR-responsive cells (eg, T cells) comprising incubating GITR-responsive cells (eg, T cells) with an antibody or antigen-binding fragment thereof as described herein. In certain embodiments, GITR-responsive cells are incubated with a stimulatory agent (e.g., an agent that stimulates the T cell receptor complex, such as, for example, phytohemagglutinin (PHA) and/or phorbol myristacetate (PMA), or an antibody that stimulates the PTK complex, such as an anti-CD3 antibody and an anti-CD28 antibody) before, simultaneously with, or after incubation with an anti-GITR antibody or antigen-binding fragment thereof. In some embodiments of the invention, GITR-susceptible cells (eg, T cells) have been isolated from the body of a subject (eg, human). In certain embodiments of the invention, after activation by an anti-GITR antibody or antigen-binding fragment thereof, GITR-susceptible cells are administered to a subject (eg, a human). GITR-susceptible cells (eg, T cells) can be administered to the same or a different subject from which the cells were previously isolated. In some embodiments, cells susceptible to GITR (i.e., GITR-susceptible cells) are incubated in cell culture with an anti-GITR antibody or antigen-binding fragment described herein and administered to a subject to enhance immune function (e.g., to increase the expansion /proliferation of GITR-susceptible cells, such as T cells, and/or increase the effector function of T cells) and/or treatment of cancer, and/or prevention or treatment of an infectious disease. Examples of cancers and infectious diseases are given in this document. See, for example, Example 7 below for exemplary methods. In specific embodiments, the GITR-responsive cells are effector T cells (eg, CD4+ and CD8+). In some embodiments of the invention, GITR-susceptible cells are isolated from the body of the subject. In some embodiments, GITR-responsive cells are evaluated for GITR expression prior to incubation with an anti-GITR antibody or antigen-binding fragment thereof as described herein. In certain embodiments, GITR-responsive cells are incubated with a mitogen (e.g., a T cell mitogen, such as, for example, phytohemagglutinin (PHA) and/or phorbol myristacetate (PMA), or an antibody that stimulates the PTK complex, such as anti-CD3 antibody and anti-CD28 antibody) before, simultaneously with, or after incubation with an anti-GITR antibody or antigen-binding fragment described herein. GITR susceptible cells can be incubated with the anti-GITR antibody described herein or an antigen-binding fragment thereof, for example, for 5, 10, 15, 30, 45 minutes, 1 hour, 2, 3, 4, 5, 6, 8, 12, 18, 24 hours or more. In certain embodiments of the invention, GITR-responsive cells that are administered to a subject were obtained from the subject (ie, GITR-responsive cells are autologous). In other embodiments of the invention, GITR-susceptible cells that are administered to a subject were obtained from another subject. After incubation with an anti-GITR antibody or antigen-binding fragment thereof, GITR-susceptible cells can be administered topically or systemically to a subject by any route known to those skilled in the art (e.g.,

- 135 040077 parenteral administration, such as subcutaneous, intravenous or intramuscular administration, or intratumoral administration). In certain embodiments of the invention, a suitable dose of GITR-susceptible cells administered to a subject after incubation with an anti-GITR antibody or antigen-binding fragment thereof is 100, 200, 300, 400, 500, 700, 1000, 5000, 10000, 25000, 50000, 100000, 1x10 ⁶ , 1x10 ⁷ or 1x10 ⁸ cells. After incubation with an anti-GITR antibody or antigen-binding fragment thereof, GITR-responsive cells can be injected 1, 2, 3, 4, 5, 6, 7, 8 or more times. The frequency and dose of GITR susceptible cells following incubation with an anti-GITR antibody or antigen-binding fragment thereof administered to a subject will vary depending on several factors including, for example, the condition of the patient. In another embodiment, provided herein is a method for increasing the expansion of T cells (e.g., CD4+ and/or CD8+ T cells) in a subject, comprising administering to the subject an effective amount of an antibody described herein, or an antigen-binding fragment thereof, or a pharmaceutical formulation described herein. compositions. In another embodiment, provided herein is a method for increasing the expansion of CD8+ T cells in a subject, comprising administering to the subject an effective amount of an antibody or antigen-binding fragment thereof described herein, or a pharmaceutical composition described herein. In another embodiment, provided herein is a method for increasing the expansion of CD4+ T cells in a subject, comprising administering to the subject an effective amount of an antibody or antigen-binding fragment thereof described herein, or a pharmaceutical composition described herein. In a specific embodiment of the invention, the subject is a human.

In another embodiment, provided herein is a method for increasing T cell (e.g., CD4+ and/or CD8+ T cell) expansion and/or T cell effector function in a subject, comprising administering to the subject an effective amount of an antibody described herein, or an antibody thereof. an antigen-binding fragment; or a pharmaceutical composition as described herein. In another embodiment, provided herein is a method of increasing CD8+ T cell expansion and/or T cell effector function in a subject, comprising administering to the subject an effective amount of an antibody or antigen-binding fragment thereof described herein, or a pharmaceutical composition described herein. In another embodiment, provided herein is a method of increasing CD4+ T cell expansion and/or T cell effector function in a subject, comprising administering to the subject an effective amount of an antibody or antigen-binding fragment thereof described herein, or a pharmaceutical composition described herein. In a specific embodiment of the invention, the subject is a human. In another embodiment, provided herein is a method for preferentially expanding effector T cells over regulatory T cells, comprising ex vivo incubation of T cells with an antibody or antigen-binding fragment thereof as described herein. In certain embodiments, the anti-GITR antibody, or antigen-binding fragment thereof, causes effector T cells to expand over regulatory T cells by 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75 , 80 or more. In some embodiments, the anti-GITR antibody or antigen-binding fragment thereof results in expansion of effector T cells over regulatory T cells by 10 to 20%, 15 to 25%, 25 to 50%, 30 to 60%, from 50 to 75% or 65 to 85%. Effector T cells and regulatory T cells can be distinguished from each other by cell surface markers such as those disclosed in the examples below. In some embodiments of the invention, T cells have been isolated from the body of a subject (eg, human). In certain embodiments of the invention, after expansion, the T cells are administered to a subject (eg, a human).

In another embodiment, provided herein is a method for preferentially expanding effector T cells over regulatory T cells in a subject, comprising administering to the subject an effective amount of an antibody described herein, or an antigen-binding fragment thereof, or a composition thereof. In certain embodiments, the antiGITR antibody, or antigen-binding fragment thereof, causes effector T cells to expand over regulatory T cells by 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75 , 80% or more. In some embodiments, the anti-GITR antibody or antigen-binding fragment thereof results in expansion of effector T cells over regulatory T cells by 10 to 20%, 15 to 25%, 25 to 50%, 30 to 60%, from 50 to 75% or 65 to 85%. Effector T cells and regulatory T cells can be distinguished from each other by cell surface and/or intracellular markers such as those disclosed in the examples below. In a specific embodiment of the invention, the subject is a human.

In certain embodiments, treatment of a subject with an anti-GITR antibody described herein, or an antigen-binding fragment thereof, or a composition thereof results in one, two, three, four or more of the following: (i) reducing or alleviating the severity of a disease or associated symptom; (ii) reducing the duration of a symptom associated with the disease; (iii) inhibiting the progression of the disease or associated symptom; (iv) reg

- 136 040077 remission of a disease or symptom associated with it; (v) preventing the development of a symptom associated with a disease that the patient has; (vi) inhibiting the reappearance of a symptom associated with the disease; (vii) reducing the subject's hospitalization; (viii) reducing the subject's hospitalization time; (ix) improving the survival of the subject with the disease; (x) reducing the number of symptoms associated with the disease; and (xi) enhancing, improving, supplementing, or extending the therapeutic effect(s) of the other therapy. In an alternative embodiment of the invention, an antiGITR antibody, or antigen-binding fragment thereof, is used to prevent a disease, such as an infectious disease. In some embodiments, the anti-GITR antibody or antigen-binding fragment or composition thereof is administered to a subject in combination with an immunotherapeutic agent. Immunotherapeutic agents disclosed herein for use in combination therapy include, but are not limited to, an anti-Her2/neu receptor antibody such as trastuzumab (under the brand name Herceptin®), an anti-CD52 antibody such as alemtuzumab (under the brand name Campat®, MabCampath ® or Campat-1H), an anti-CD33 antibody such as gemtuzumab linked to calicheamicin (brand name Mylotarg®), an anti-CD20 antibody such as rituximab (brand name Rituxan® and MabTepa®), ibritutomab tiuxetan (brand name Zevalin ®), anti-TNFa antibodies such as infliximab (branded as Remicad®) or adalimumab (branded as Humira®), a soluble TNF2 molecule such as etanercept (branded as Enbrel®), an antibody to the CD25 IL-2 receptor chain, such as basiliximab (under the brand name Simulect®), an anti-CD40/CD40L antibody such as humanized IgG1 anti-human CD40 antibody (SGN-40), Toll-like receptor agonists such as monophosphoryl lipid A (MPL®), CpG, single-stranded RNA, nucleotides, nucleotide a taxes, CL087 (TLR7 specific ligand), loxoribin, polyinosine polycytidylic acid, flagellin, resiquimod, imiquimod, gardiquimod, NOD ligands such as muramyl dipeptide, murabutide, peptidoglycan and muramyl dipeptide, CD1d agonists such as α-galactosylceramide (α-GalCer) and treitolceramide ( ThrCer), an antibody such as frezolimumab® (GC1008), an antibody that targets and inhibits TGFbeta 1, 2, or 3 isoforms, an Fc fusion product, dalantercept (Alk-Fc), and small molecule LY2157299 (a receptor kinase inhibitor). Diseases that can be treated by boosting immune function include cancer and infectious diseases. The various types of cancer and infectious diseases are described below. In a specific embodiment, the anti-GITR antibody described herein, or an antigen-binding fragment thereof, can be used to treat a condition associated with cancer or a condition that results from anti-cancer therapy (such as, for example, chemotherapy or radiation). In a particular embodiment, an anti-GITR antibody, or antigen-binding fragment thereof, can be used to treat or control the development of lymphopenia. In another embodiment, an anti-GITR antibody, or antigen-binding fragment thereof, is administered to a patient diagnosed with cancer to increase the proliferation and/or effector function of one or more immune cell populations (e.g., effector T cells such as CD4+ and CD8+ T cells). ) in the patient.

In a particular embodiment, the anti-GITR antibody described herein, or an antigen-binding fragment thereof, activates or enhances or induces one or more immune functions or one or more immune responses in a patient by at least 99%, at least 98%, at least 95%, at least 90%, at least 85%, at least 80%, at least 75%, at least 70%, at least 60%, at least 50%, at least 45%, at least 40%, at least 45%, at least 35%, at least 30%, at least 25%, at least at least 20%, or at least 10%, or in the range of 10 to 25%, 25 to 50%, 50 to 75%, or 75 to 95%, compared to immune function in a subject who did not receive the described herein, an antiGITR antibody or antigen-binding fragment thereof, according to an assay well known in the art, e.g., ELISPOT, ELISA and analysis of cell proliferation. In a specific embodiment, the immune function is the production of cytokines (eg, the production of interferon-gamma, IL-2, IL-5, IL-10, IL-12, or transforming growth factor (TGF) alpha). In another embodiment of the invention, immune function is T cell proliferation/expansion, which can be assessed, for example, by flow cytometry, to determine the number of cells expressing T cell markers (eg, CD3, CD4, or CD8). In another embodiment of the invention, the immune function is the production of antibodies, which can be assessed, for example, by ELISA. In some embodiments of the invention, the immune function is an effector function that can be assessed, for example, by a cytotoxicity assay or other methods well known in the art. In another embodiment of the invention, the immune function is a Th1 response. In another embodiment, the immune function is a Th2 response. In another embodiment of the invention, the immune function is a secondary immune response. In specific embodiments, non-limiting examples of immune functions that can be elevated or induced by an antiGITR antibody or antigen-binding fragment thereof are proliferation/expansion effects.

- 137 040077 effector lymphocytes (eg, increase in the number of effector T-lymphocytes), inhibition of apoptosis of effector lymphocytes (eg, effector T-lymphocytes), and suppression of Treg. In specific embodiments, the immune function promoted or induced by the anti-GITR antibody or antigen-binding fragment thereof described herein is the proliferation/expansion or activation of CD4+ T cells (e.g., Th1 and Th2 helper T cells), CD8+ T cells ( e.g., cytotoxic T lymphocytes, alpha/beta T cells and gamma/delta T cells), B cells (e.g., plasma cells), memory T cells, memory B cells, tumor-settled T cells, T cells CD122+, natural killer (NK) cells, macrophages, monocytes, dendritic cells, mast cells, eosinophils, basophils, or polymorphonuclear leukocytes. In one embodiment, an anti-GITR antibody or antigen-binding fragment thereof, as described herein, activates or enhances the proliferation/expansion of lymphocyte progenitors. In some embodiments, the anti-GITR antibody described herein, or an antigen-binding fragment thereof, increases the number of CD4+ T cells (e.g., Th1 and Th2 helper T cells), CD8+ T cells (e.g., cytotoxic T lymphocytes, alpha/beta T cells and gamma/delta T cells), B cells (e.g. plasma cells), memory T cells, memory B cells, tumor-settled T cells, CD122+ T cells, natural killer (NK) cells, macrophages, monocytes, dendritic cells, mast cells, eosinophils, basophils or polymorphonuclear leukocytes by at least 99%, at least 98%, at least 95%, at least 90%, at least 85%, at least 80%, at least 75%, at least 70%, at least 60%, at least 50%, at least 45%, at least 40%, at least 45%, at least 35%, at least 30%, at least 25%, at least 20%, and whether at least 10%, or in the range of 10% to 25%, 25% to 50%, 50% to 75%, or 75% to 95% compared to the negative control (e.g., the number of corresponding cells that were not treated, not cultured or brought into contact with the anti-GITR antibody described herein or its antigen-binding fragment).

In specific embodiments, an antibody described herein that immunospecifically binds to GITR (eg, human GITR) induces, activates, or enhances human GITR activity, regardless of RTK initiation. In specific embodiments, an antibody described herein that immunospecifically binds to GITR (eg, human GITR) induces, activates, or enhances NF-kB activity, regardless of RTK initiation. In certain embodiments of the invention, NF-kB activity can be assessed, for example, in an assay comprising the following steps: (a) incubating T cells (e.g., Jurkat cells) expressing an NF-kB luciferase reporter construct (e.g., a GloResponse NF- kB-1uc2P) and GITR (e.g. human GITR), with the antibody described herein or an isotype control antibody at an antibody concentration of e.g. in the absence of anti-CD3 antibodies; and (b) reading the luciferase signal, e.g., after 2, 5, 6, 8, or 18 hours of incubation, e.g., using the EnVision 2100 multilabel reader, wherein a positive luciferase signal compared to an isotype control antibody is indicative of NF-κB activity. In a specific embodiment of the invention, the luciferase signal is read after 5 hours of incubation.

In another embodiment of the invention, this document provides a method of activating T cells, regardless of the initiation of RTK, including bringing T cells into contact with the antibody described herein or its antigen-binding fragment. In specific embodiments of the invention, this document provides a method of inducing, activating or increasing the activity of NF-κB, regardless of the initiation of RTK, including bringing T cells into contact with the antibody described herein or its antigen-binding fragment. In certain embodiments, NF-kB activity can be assessed, for example, in an assay comprising the following steps: (a) incubation of T cells (e.g., Jurkat cells) expressing an NF-kB luciferase reporter construct (e.g., GloResponse NF- kB-1uc2P) and GITR (e.g. human GITR), with an antibody described herein or an isotype control antibody at an antibody concentration of e.g. in the absence of anti-CD3 antibodies; and (b) reading the luciferase signal, e.g., after 2, 5, 6, 8, or 18 hours of incubation, e.g., using the EnVision 2100 multi-label reader, wherein a positive luciferase signal compared to an isotype control antibody is indicative of NF-κB activity. In a specific embodiment of the invention, the luciferase signal is read after 5 hours of incubation. In specific embodiments of the invention, this document provides a method for increasing the percentage of polyfunctional (IFNu+ TNFa+) T cells, including bringing the T cells into contact with the antibody described herein or its antigen-binding fragment. The increase in the percentage of polyfunctional (IFNy + TNFa +) T cells can be assessed, for example, in an assay that includes the following steps: (a) incubation, for example, of human MCGI, for example, with

- 138 040077 aHTu-CD3 antibody at various suboptimal concentrations (eg 0.3-5 µg/ml); and, for example, an antibody described herein that immunospecifically binds to GITR (e.g., human GITR) at, for example, 5 μg/ml or an isotype control antibody for, for example, 3-4 days at 37°C and 5% CO2 (b) treating the cells with, for example, brefeldin A for, for example, 6 hours at 37° C. and 5% CO2; (c) staining the cell surface with, for example, an anti-CD3 antibody, an anti-CD4 antibody, and an anti-CD8α antibody; (d) intracellular staining with, for example, an anti-IFNy antibody and an anti-TNFa antibody; and (e) determining the percentage of polyfunctional (IFNy+ TNFa+) T cells compared to an isotype control antibody. In particular embodiments, the polyfunctional (IFNu+ TNFa+) T cells are selected from the group consisting of polyfunctional (IFNu+ TNFa+) CD4+ T cells and polyfunctional (IFNu+ TNFa+) CD8+ T cells.

In specific embodiments of the invention, this document provides a method for increasing the surface expression of OX40 and PD-1 in activated T cells, including bringing the T cells into contact with the antibody described herein or its antigen-binding fragment. Surface expression of OX40 and PD-1 in activated T cells can be increased by at least about 1.2, 1.3, 1.4, 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900 or 1000 times as assessed by the methods described herein and/or known to those skilled in the art compared to surface expression of OX40 and PD-1 in activated T cells without the antibody described herein.

5.4.1.1. Cancer

In a specific aspect, provided herein are methods of treating cancer comprising administering to a subject in need thereof an effective amount of an antiGITR antibody or antigen-binding fragment thereof or composition thereof as described herein. In a specific embodiment, the anti-GITR antibody described herein, or an antigen-binding fragment or composition thereof, is the sole active agent administered to a subject.

The effect of an anti-GITR antibody or antigen-binding fragment thereof on cancer cell proliferation as described herein can be determined by conventional assay methods, such as those that measure the uptake of radiolabeled thymidine. Alternatively, cell viability can be determined by assays that detect lactate dehydrogenase (LDH), a stable cytosolic enzyme that is released after cell lysis, or by [ ⁵¹ Cr] release after cell lysis. In one embodiment, necrosis is determined by the ability or inability of a cell to take up a dye such as neutral red, trypan blue, or ALAMAR™ blue (Page B et al. (1993) Intl J Oncology 3: 473-6). In such an assay, cells are incubated in a medium containing a dye, then the cells are washed, and the remaining dye, indicative of cellular dye uptake, is determined by spectrophotometry. In another embodiment, the dye is sulforodamine B (SRB), whose protein binding can be used as a measure of cytotoxicity (Skehan P et al. (1990) J Nat Cancer Inst 82: 1107-12). In another embodiment, a tetrazolium salt, such as MTT, is used in a quantitative colorimetric assay of mammalian cell survival and proliferation by detecting live but not dead cells (see e.g. Mosmann T (1983) J Immunol Methods 65:55-63) .

In other embodiments of the invention, apoptotic cells are determined in attached and wandering compartments of cultures. Both kinds of compartments are harvested by removing the supernatant, trypsinizing the attached cells and mixing both preparations after a centrifugation and washing step (10 min, 2000 rpm). A protocol for treating cancer cell cultures with sulindac and related compounds to produce a significant degree of apoptosis has been described in the literature (see, for example, Piazza GA et al. (1995) Cancer Res 55: 3110-6). Features of this method include collecting both wandering and attached cells, determining the optimal treatment time and dosage range to observe apoptosis, and determining optimal cell culture conditions. In another embodiment of the invention, apoptosis is quantified by determining DNA fragmentation. Commercial photometric methods are available to quantify in vitro DNA fragmentation. Examples of such assays, including the TUNEL assay (which determines the incorporation of labeled nucleotides into fragmented DNA) and ELISA, are described in Biochemica, (1999) 2: 34 37 (Roche Molecular Biochemicals). In another embodiment of the invention, apoptosis can be observed morphologically.

Cancer cell lines for which such an assay can be performed are well known to those skilled in the art. Analysis of apoptosis, necrosis and proliferation can also be performed on primary cells, such as tissue explant.

In specific embodiments, administration of an antiGITR antibody described herein, or an antigen-binding fragment thereof, or composition thereof, to a subject with cancer (in some embodiments, an animal model of cancer) results in at least one,

- 139 040077 two, three, four or more of the following effects: (i) reduction or alleviation of the severity of one or more symptoms of cancer; (ii) reducing the duration of one or more of the symptoms associated with the cancer; (iii) preventing the recurrence of a symptom associated with cancer; (iv) reducing the subject's hospitalization; (v) reduced hospitalization time; (vi) improving the survival of the subject; (vii) enhance or improve the therapeutic effect of another type of therapy; (viii) inhibiting the development or onset of one or more symptoms associated with cancer; (ix) reducing the number of symptoms associated with cancer; (x) improving the quality of life as assessed by methods known in the art; (x) inhibition of tumor recurrence; (xi) regression of tumors and/or one or more associated symptoms; (xii) inhibition of tumor progression and/or one or more associated symptoms; (xiii) reduce tumor growth; (xiv) reduction in tumor size (eg, volume or diameter); (xv) reducing the formation of newly formed tumors; (xvi) destruction, elimination or control of primary, regional and/or metastatic tumors; (xvii) reduce the number or size of metastases; (xviii) reduce mortality; (xix) improved disease-free survival; (xx) the size of the tumor is maintained and does not increase or increases less than the tumor after the application of standard therapy, as determined by conventional methods available to a person skilled in the art, such as magnetic resonance imaging (MRI), dynamic contrast-enhanced MRI (MRI-DCE) , x-ray and computed tomography (CT) or positron emission tomography (PET); and/or (xxi) increasing remission time in patients.

In certain embodiments of the invention, two or more of the anti-GITR antibodies or antigen-binding fragments described herein are administered to the subject. In some embodiments, the anti-GITR antibody described herein, or an antigen-binding fragment thereof, is administered to a subject in combination with one or more other therapies, such as anticancer agents, cytokines, cellular vaccines, or antihormonal agents, to treat cancer.

In a particular embodiment, the anti-GITR antibody described herein, or an antigen-binding fragment thereof, is administered in combination with radiation therapy, including, for example, the use of x-rays, gamma rays, and other radiation sources to destroy cancer cells. In specific embodiments of the invention, radiation therapy is carried out in the form of external radiation therapy or teletherapy, when the radiation comes from a distant source. In other embodiments of the invention, radiation therapy is carried out in the form of internal therapy or brachytherapy, when the radiation source is placed inside the body near cancer cells or tumor mass. In one aspect, an anti-GITR antibody, or antigen-binding fragment thereof, as described herein, can activate or enhance immune function or an immune response in a cancer patient with a compromised immune system due to cancer therapy.

In another embodiment, the anti-GITR antibody described herein, or an antigen-binding fragment thereof, is administered to a subject in combination with chemotherapy. In one embodiment, the anti-GITR antibody described herein, or an antigen-binding fragment thereof, can be used before, during, or after radiation therapy or chemotherapy. Examples of chemotherapeutic agents include cyclophosphamide, methotrexate, cyclosporine A, leflunomide, cisplatin, ifosfamide, taxanes such as taxol and paclitaxel, topoisomerase I inhibitors (eg, CPT 11, topotecan, 9 AC and GG 211), gemcitabine, vinorelbine, oxaliplatin, 5 -fluorouracil (5-FU), leucovorin, vinorelbine, temodal, cytochalasin B, gramicidin D, emetine, mitomycin, etoposide, tenoposide, vincristine, vinblastine, colchicine, doxorubicin, daunorubicin, dihydroxyanthracindione, mitoxantrone, mithramycin, actinomycin D, 1 dehydrotestosterone, glucocorticoids, procaine, tetracaine, lidocaine, propranolol and puromycin homologues, and cytoxan. In one embodiment, the anti-GITR antibody described herein, or an antigen-binding fragment thereof, is administered to a subject in combination with cyclophosphamide, eg, a low dose of cyclophosphamide. Cyclophosphamide (Elostan, Cytoxan) is a chemotherapeutic agent that has an immunomodulatory function when used at low doses (eg, up to 300 mg/m ² , 300 mg/m ² or about 300 mg/m ² when administered intravenously). In particular, low doses of cyclophosphamide can reduce the number and proliferating ability of regulatory T cells (Treg) (eg, CD4+CD25+FoxP3+ cells or alternatively CD45+CD3+CD4+CD8-FOXP3+CD25hiCD127low cells) and modulate immunosuppressive networks. In some embodiments, the dosage of cyclophosphamide administered is about 50, 100, 200, 300, 500 mg/m ² or more. In some embodiments, the dosage of cyclophosphamide administered is in the range of 10 to 100 mg/m ² , 50 to 200 mg/m ² , 50 to 300 mg/m ² , 50 to 500 mg/m ² . In some embodiments, cyclophosphamide is administered to the subject for 1, 2, 3, 4, 8, 12 hours, 1 day, 5 days or more before or after the initial administration of the anti-GITR antibody described herein, or an antigen-binding fragment thereof. In some embodiments, the anti-GITR antibody described herein, or an antigen-binding fragment thereof, is used in combination with cyclophosphamide, eg, low dose cyclophosphamide, to treat metastatic renal cell carcinoma (RCC). In one

An anti-GITR antibody or antigen-binding fragment thereof described herein is administered to a subject in combination with a Treg inhibitory agent. Examples of Treg inhibitory agents include Zenapax® (daclizumab) (Roche), which is a human anti-CD25 monoclonal antibody used, for example, to induce immune suppression in organ transplantation. Daclizumab blocks the binding of IL-2 to CD25, which is also a signal to maintain Treg. Another agent that inhibits Treg is Sutent® (Sunitinib) (Pfizer), which is a small molecule, multi-target tyrosine kinase inhibitor approved for the treatment of renal cell carcinoma (RCC) and other cancers. Another agent that can inhibit Treg is 1-methyl-D-tryptophan (1-MT), a competitive inhibitor of indolamine 2,3-dioxygenase (IDO). IDO is an immunosuppressive agent expressed in some normal and neoplastic cells and may be associated with increased Tregs in cancer patients. Additional Treg inhibitors include agents that block the transfer of Treg into the tumor microenvironment. Such agents may include antibodies against certain chemokines and chemokine receptors such as CCL17, CCL22 and CCR4.

Additional examples of Treg inhibitory agents that can be used in accordance with the methods described herein are disclosed in the following patent applications, which are incorporated herein by reference in their entirety and in all senses: US Patent Publications No. US 2009/0214533, US 2012/0142750, US 2011/0305713, US 2009/0004213, US 2012/0219559, US 2010/0278844, US 2013/0323283 and US 2008/0152665.

In another embodiment, the anti-GITR antibody described herein, or an antigen-binding fragment thereof, may be administered to a subject before, during, or after surgery.

In certain embodiments, the anti-GITR antibody described herein, or an antigen-binding fragment thereof, is administered to a subject in combination with an immune modulator or antibody. Immune modulators or antibodies can be, but are not limited to, adjuvants, antigens, anti-CD3 (eg OKT3), checkpoint targeting agents or modulators or interleukins. The terms checkpoint-targeting agent or checkpoint modulator may be used interchangeably and refer to an agent that selectively modulates the expression or activity of a regulatory molecule (e.g., a co-inhibitory checkpoint molecule (e.g., a protein) or a co-stimulatory checkpoint molecule (e.g., a protein) that can be, for example, an immune system checkpoint receptor or ligand The checkpoint targeting agents can be selected from the group consisting of a checkpoint molecule agonist, a checkpoint molecule antagonist, a polypeptide (e.g., a peptide ligand, an antibody, or an antibody fragment) that selectively targets the checkpoint molecule, a small molecule that selectively targets the checkpoint molecule, and a regulatory nucleic acid (e.g., siRNA, miRNA) that selectively modulates the expression or activity of the checkpoint molecule. The checkpoint targeting agent can be selected from the group consisting of a PD-1 antagonist, a PD-L1 antagonist, a PD-L2 antagonist, a CTLA-4 antagonist, a TIM-3 antagonist, a LAG-3 antagonist, aroHncraGITR, and an OX40 agonist. Thus, in some embodiments, an anti-GITR agonist antibody (e.g., Hum231#1, Hum231#2, or Hum231#2w) or an antigen-binding fragment thereof may be administered in combination with, for example, an anti-CTLA-4 antagonist antibody or antigen-binding fragment thereof, or another checkpoint targeting agent, either in the same pharmaceutical composition or in separate pharmaceutical compositions administered together or separately. In some embodiments, provided herein are methods of treating cancer in a subject, comprising administering to the subject an anti-GITR antibody or antigen-binding fragment thereof and an OX40 agonist and/or antagonist(s) of LAG-3, TIM-3, PD-1 and/or CTLA-4. In some embodiments, the cancer is selected from glioblastoma multiforme, metastatic melanoma, resistant metastatic melanoma, metastatic ovarian cancer, metastatic renal cell carcinoma, head and neck cancer, gastric cancer, esophageal cancer, non-small cell lung cancer, pediatric brain tumors, well-differentiated astrocytoma , ependymoma and medulloblastoma. In a particular embodiment, the anti-GITR antibody described herein, or an antigen-binding fragment thereof, is administered to a subject in combination with an agent that inhibits (partially or completely) CTLA-4 signaling, such as an antibody that specifically binds to human CTLA-4 ( for example, tremelimumab (Pfizer); ipilimumab (Yervoy®, Bristol-Myers Squibb)) or CTLA-4-Ig fusion protein. In some embodiments, an anti-GITR antibody, or antigen-binding fragment thereof, is used in combination with a CTLA-4 antagonist (eg, tremelimumab or ipilimumab) to treat metastatic ovarian cancer. In some embodiments, an anti-GITR antibody or antigen-binding fragment thereof is used in combination with a CTLA-4 antagonist (eg, tremelimumab or ipilimumab) to treat metastatic ovarian cancer that is resistant to the antagonist.

- 141 040077

CTLA-4 (eg, tremelimumab or ipilimumab). In some embodiments, an anti-GITR antibody, or antigen-binding fragment thereof, and a CTLA-4 antagonist (eg, tremelimumab or ipilimumab) are used to treat glioblastoma multiforme. In some embodiments of the invention, glioblastoma multiforme has recurred. In some embodiments of the invention, glioblastoma multiforme is diagnosed for the first time. In some embodiments, glioblastoma multiforme occurs in a subject having unmethylated MGMT promoters. In some embodiments of the invention, glioblastoma multiforme is resistant to bevacizumab therapy. In some embodiments, glioblastoma multiforme occurs in a subject who has not received bevacizumab therapy. Examples of anti-CTLA-4 antibodies that can be used in the treatments disclosed herein are disclosed in the following patents and patent applications, which are incorporated herein by reference in their entirety and in all senses: International Publication No. WO 00/037504 , WO 01/014424 and WO 09/100140; U.S. Patent Nos. 6,207,156 and 7,034,121. Additional examples of anti-CTLA4 antibodies that can be used in accordance with the methods described herein are disclosed in the following patents and patent applications, which are incorporated herein by reference in their entirety and in all senses: patents US #7465446 8263073; 8142778 and 8226946; and US Patent Application Nos. US 2003/086930, US 2005/226875, US 2007/243184, US 2009/123477 and US 2011/044953. In another embodiment, the anti-GITR antibody described herein, or an antigen-binding fragment thereof, is administered in combination with an agent that inhibits (partially or completely) LAG-3 signaling, such as an antibody that specifically binds to human LAG-3. Examples of anti-LAG-3 antibodies or fragments thereof that can be used in the treatments described herein are disclosed in the following patents and patent applications, which are incorporated herein by reference in their entirety and in all senses: US Pat. No. 6,143,273 and 6197524; US Patent Publication Nos. US 2011/0150892, US 2010/0233183 and US 2010/196394.

In another embodiment, the anti-GITR antibody described herein, or an antigen-binding fragment thereof, is administered in combination with an agent that inhibits (partially or completely) TIM-3 signaling, such as an antibody that specifically binds to human TIM-3. Examples of anti-TIM-3 antibodies or fragments thereof that can be used in the treatments described herein are disclosed in the following patents and patent applications, which are incorporated herein by reference in their entirety and in all senses: US Patent No. 7,470,428 and 8101176; US Publication Nos. US 2013/0022623, US 2010/0100131, US 2010/0100131 and US 2010/061992.

In another embodiment, the anti-GITR antibody described herein, or an antigen-binding fragment thereof, is administered in combination with an agent that inhibits (partially or completely) PD-1 signaling, such as an antibody that specifically binds to human PD-1. In some embodiments, an anti-PD-1 antibody or fragment thereof is administered to a subject as described herein. In some embodiments, the anti-PD-1 antibody is nivolumab (BMS-936558 or MDX1106) or lambrolizumab (MK-3475) or pidilizumab (CT-011). Additional non-limiting examples of anti-PD-1 antibodies that can be used in the treatments disclosed herein are disclosed in the following patents and patent applications, which are incorporated herein by reference in their entirety and in all senses: US patent No. 6808710; 7488802; 8008449; 8114845 and 8168757, US Publication No. US 2013/0202623 and PCT Publication No. WO 2013/033091. In another embodiment, the anti-GITR antibody described herein, or an antigen-binding fragment thereof, is administered in combination with an agent that inhibits (partially or completely) PD-L1 activity, such as an antibody that specifically binds to human PD-L1. In some embodiments, the anti-PD-L1 antibody is BMS-936559, MPDL3280A, MEDI4736, or MSB0010718C. Additional non-limiting examples of anti-PD-L1 antibodies that can be used in the treatments disclosed herein are disclosed in the following patents and patent applications, which are incorporated herein by reference in their entirety and in all senses: US patent No. 8168179 and U.S. Publication Nos. US 2010/0203056 and US 2003/0232323. In another embodiment, the anti-GITR antibody described herein, or an antigen-binding fragment thereof, is administered in combination with an agent that inhibits (partially or completely) PD-L2 activity, such as an antibody that specifically binds to human PD-L2.

In another embodiment, the anti-GITR antibody described herein, or an antigen-binding fragment thereof, is administered in combination with an agent that activates or enhances OX-40 signaling, such as an antibody that specifically binds to human OX-40. Examples of anti-OX40 antibodies or fragments thereof that can be used in the treatments described herein are disclosed in the following patents and patent applications, which are incorporated herein by reference in their entirety and in all senses: US Pat. Nos. 7,550,140; 7807156; 8283450; 8614295 and 7531170; US Publication No. US 2010/0196359, US 2010/0136030 and US

- 142 040077

2013/0183315.

In another embodiment, the anti-GITR antibody described herein, or an antigen-binding fragment thereof, is administered to a subject in combination with a vaccine such as that described herein, including section 5.4.1 above. In a particular embodiment, the anti-GITR antibody, or antigen-binding fragment thereof, is administered to a subject in combination with a heat shock protein-based antitumor vaccine. Heat shock proteins (HSPs) are a family of highly conserved proteins found ubiquitously in all species. Their expression can be strongly induced to much higher levels by heat shock or other forms of stress, including exposure to toxins, oxidative stress, or glucose deprivation. Five families were classified according to molecular weight: HSP-110, -90, -70, -60 and -28. HSPs deliver immunogenic peptides via a cross-presenting pathway to antigen presenting cells (APCs) such as macrophages and dendritic cells (DCs), resulting in T cell activation. HSPs act as chaperone carriers for tumor-associated antigenic peptides, forming complexes capable of inducing tumor-specific immunity. After being released from dying tumor cells, the HSP-antigen complexes are taken up by antigen-presenting cells (APCs), while the antigens are processed into peptides that bind MHC class I and class II molecules, which leads to the activation of CD8+ and CD4+ antitumor T cells. Immunity elicited by tumor-derived HSP complexes is specifically directed against the unique repertoire of antigenic peptides expressed by each subject's cancer.

The heat shock protein peptide complex (HSPPC) is a protein-peptide complex consisting of a heat shock protein non-covalently complexed with antigenic peptides. HSPPC elicits both innate and adaptive immune responses. In a specific embodiment of the invention, the antigenic(s) peptide(s) demonstrate(s) antigenicity against the cancer being treated. HSPPCs are efficiently taken up by APCs via membrane receptors (mainly CD91) or via binding to Toll-like receptors. Internalization of HSPPC leads to the functional maturation of APC with the production of chemokines and cytokines, which leads to the activation of natural killer (NK) cells, monocytes, and Th1 and Th-2-mediated immune responses. In some embodiments, the HSPPCs used in the methods disclosed herein comprise one or more heat shock proteins from the hsp60, hsp70, or hsp90 family of stress proteins complexed with antigenic peptides. In some embodiments, the HSPPCs include hsc70, hsp70, hsp90, hsp110, grp170, gp96, calreticulin, or combinations of two or more proteins. In a particular embodiment, an anti-GITR antibody, or antigen-binding fragment thereof, is administered to a subject in combination with a heat shock protein peptide complex (HSPPC), e.g. . HSPPC-96 contains a 96 kDa heat shock protein (Hsp), gp96, complexed with antigenic peptides. HSPPC-96 is an anti-cancer immunodrug derived from a subject's tumor and contains cancer antigen fingerprints. In some embodiments, these fingerprints contain unique antigens that are present only on specific cancer cells in a particular subject, and the vaccine injection is designed to stimulate the subject's immune system to recognize and attack any cells with specific cancer fingerprints. In some embodiments of the invention HSPPC, such as HSPPC-96, is obtained from the tumor tissue of the subject. In a particular embodiment, the HSPPC (eg, HSPPC-96) is derived from a tumor or its metastasis of the type of cancer being treated. In another specific embodiment, the HSPPC (eg, HSPPC-96) is autologous to the subject being treated. In some embodiments, the tumor tissue is non-necrotic tumor tissue. In some embodiments of the invention, at least 1 g (for example, at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least at least 8, at least 9, or at least 10 g) of non-necrotic tumor tissue is used to prepare the vaccine course. In some embodiments of the invention, after surgery, non-necrotic tumor tissue is frozen prior to use in vaccine preparation. In some embodiments of the invention HSPPC, for example HSPPC-96, isolated from tumor tissue through purification, filtered and prepared for an injectable vaccine. In some embodiments of the invention, the subject is administered 6-12 doses of HSPPC, for example, HSPCC-96. In such embodiments of the invention HSPPC, such as HSPPC-96, the first 4 doses can be administered weekly, and 2-8 additional doses every other week.

In some embodiments, an anti-GITR antibody or antigen-binding fragment thereof is used in combination with HSPPC-96 to treat metastatic melanoma (eg, resistant metastatic melanoma), metastatic ovarian cancer, or metastatic renal cell carcinoma. In some embodiments, an anti-GITR antibody, or antigen-binding fragment thereof, is used in combination with HSPPC-96 to treat glioblastoma multiforme. In some embodiments, an anti-GITR antibody or antigen-binding fragment thereof and a CTLA-4 antagonist are used in combination with HSPPC-96 to treat glioblastoma multiforme. In some embodiments, the subject to be treated is immunocompromised (eg, due to an infection, such as HIV, or due to undergoing anti-cancer therapy (eg, chemotherapy or radiation) prior to HSPPC administration.

Additional examples of HSPPCs that can be used in accordance with the methods described herein are disclosed in the following patents and patent applications, which are incorporated herein by reference in their entirety and in all senses: US Pat. , 6436404, 6447780, 6447781 and 6610659.

In some embodiments, the anti-GITR antibody described herein, or an antigen-binding fragment thereof, is administered to a subject in combination with a compound that targets immunomodulatory enzymes such as IDO (indolamine-(2,3)-dioxygenase) and TDO (tryptophan-2 ,3-dioxygenase). In particular embodiments, such a compound is selected from the group consisting of epacadostat (Incyte Corporation), F001287 (Flexus Biosciences), indoxymod (NewLink Genetics), and NLG919 (NewLink Genetics). In one embodiment, the compound is epacadostat. In another embodiment, the compound is F001287. In another embodiment, the compound is indoxymod. In another embodiment, the compound is NLG919.

Elevated levels of CD4+CD25+ Treg in cancer patients prevent an effective antitumor immune response in the host. In addition, a high incidence of Treg is associated with reduced patient survival (Curiel TJ et al. (2004) Nat Medicine 10(9): 942-9; Woo EY et al. (2002) J Immunol 168: 4272-6). However, after a decrease in the number of regulatory T cells in PBMCs of cancer patients, an increase in immune activity was observed (Dannull J et al. (2005) J Clin Invest 115(12): 3623-33). The number of Tregs expressing high levels of GITR on their surface can be reduced by the anti-GITR antibody DTA-1 (Coe D et al. (2010) Cancer Immunol Immunother 59: 1367-77). In one embodiment of the invention, the immune strategy may include ex vivo or in vivo reduction in the number of Tregs with an anti-GITR antibody, or antigen-binding fragment thereof, resulting in a reduction in the number of GITR-positive Treg cells.

In certain embodiments, the anti-GITR antibody described herein, or an antigen-binding fragment thereof, is administered to a subject in combination with an oncolytic virus such as Talimogene laherparepvec (OncoVEX GM-CSF) and CGTG-102 (Ad5/3-D24-GMCSF).

In certain embodiments, the anti-GITR antibody described herein, or an antigen-binding fragment thereof, is administered to a subject in combination with cytokines that are effective in inhibiting tumor growth/metastasis. Such cytokines, lymphokines, or other hematopoietic factors include, but are not limited to, M-CSF, GM-CSF, TNF, IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL -7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-13, IL-14, IL-15, IL-16, IL-17, IL-18, IFN, TNFa , TNF1, TNF2, G-CSF, Meg-CSF, GM-CSF, thrombopoietin, stem cell factor and erythropoietin.

In certain embodiments, the anti-GITR antibody described herein, or an antigen-binding fragment thereof, is administered to a subject in combination with receptor tyrosine kinase inhibitors such as imatinib mesylate (marketed under the brand name Glivec® or Glivac®), erlotinib (an EGF receptor inhibitor) currently available under the brand name Tarceva, or sunitinib (manufactured under the brand name Sutent®).

In certain embodiments, the anti-GITR antibody described herein, or an antigen-binding fragment thereof, is administered to a subject in combination with an anti-TGF-beta antagonist antibody such as Fresolimumab® (GC1008), an antibody that targets and inhibits TGF-beta 1, 2 isoforms. or 3. In some embodiments, an anti-GITR antibody described herein, or an antigen-binding fragment or composition thereof, is administered to a subject who has or has been diagnosed with cancer. In a specific embodiment, the anti-GITR antibody or composition thereof is administered to a subject who has or has been diagnosed with glioblastoma multiforme. In some embodiments of the invention, glioblastoma multiforme has recurred. In some embodiments of the invention, glioblastoma multiforme is diagnosed for the first time. In some embodiments, glioblastoma multiforme occurs in a subject having unmethylated MGMT promoters. In some embodiments of the invention, glioblastoma multiforme has recurred. In some embodiments of the invention, glioblastoma multiforme is diagnosed for the first time. In some embodiments, glioblastoma multiforme occurs in a subject having unmethylated MGMT promoters. In some embodiments of the invention, glioblastoma multiforme is resistant to bevacizumab therapy. In some embodiments, glioblastoma multiforme occurs in a subject who has not received bevacizumab therapy.

In certain embodiments of the invention, patients undergoing treatment in accordance with

- 144 040077 with the methods described herein, were previously treated with antibiotics, anticancer agents or other biological therapy/immunotherapy. These patients include refractory patients, patients who are too small for conventional therapy, and patients with recurrent viral infections despite care or existing therapies. In some embodiments, the subject receiving the anti-GITR antibody described herein, or an antigen-binding fragment thereof, or composition thereof, was not receiving therapy prior to administration of the antibody or composition thereof. In other embodiments, the anti-GITR antibody described herein, or an antigen-binding fragment thereof, or composition thereof, is administered to a subject who was undergoing therapy prior to administration of the antibody or composition thereof. In certain embodiments of the invention, an anti-GITR antibody or antigen-binding fragment or composition thereof is administered to a subject undergoing or recovering from immunosuppressive therapy. In certain embodiments of the invention, an anti-GITR antibody or antigen-binding fragment or composition thereof is administered to a subject with cancer, wherein the cancer cells express GITRL. In some embodiments of the invention, the subject to be treated in accordance with the methods disclosed herein is immunocompromised (for example, due to an infection, such as HIV, or due to the passage of anti-cancer therapy (for example, chemotherapy or radiation). As described herein , anti-GITR antibodies affect the surface expression of proteins including OX40, CD25, and PD-1 Accordingly, in certain embodiments, the anti-GITR antibody or antigen-binding fragment or composition thereof is administered prior to the antibody or antigen-binding fragment thereof that binds with OX40, CD25, or PD-1 The anti-PD-1 antagonist antibody, or antigen-binding fragment thereof, can be administered at a time when the GITR agonist antibody, or antigen-binding fragment thereof, increases the surface expression of PD-1 in the subject compared to the expression of PD-1 in subject at the time of administration.For example, an anti-PD-1 antagonist antibody or an antigen-binding fragment thereof can be administered at least 12 hours later, at least 1 day later, at least 2 days later, at least 3 days later, at least 4 days later, at least 5 days later, at least at least 6 days or at least 7 days after administration of the anti-GITR agonist antibody. The anti-PD-1 antagonist antibody or antigen-binding fragment thereof can be administered 12 hours to two weeks, 1 day to two weeks, 2 days to two weeks, or 3 days to two weeks after administration of the GITR agonist antibody or antigen-binding fragment thereof. The anti-PD-1 antagonist antibody or antigen-binding fragment thereof can be administered 12 hours to one week, 1 day to one week, 2 days to one week, or 3 days to one week after administration of the GITR agonist antibody or antigen-binding fragment thereof.

The OX40 agonist antibody, or antigen-binding fragment thereof, can be administered at a time when the GITR agonist antibody, or antigen-binding fragment thereof, increases the subject's surface expression of OX40 relative to the subject's OX40 expression at the time of administration. For example, the OX40 agonist antibody, or antigen-binding fragment thereof, can be administered at least 12 hours later, at least 1 day later, at least 2 days later, at least 3 days later, at least 4 days later, at least 5 days, at least 6 days, or at least 7 days after administration of the anti-GITR agonist antibody. The anti-OX40 agonist antibody or antigen-binding fragment thereof can be administered 12 hours to two weeks, 1 day to two weeks, 2 days to two weeks, or 3 days to two weeks after administration of the GITR agonist antibody or antigen-binding fragment thereof. The OX40 agonist antibody or antigen-binding fragment thereof may be administered 12 hours to one week, 1 day to one week, 2 days to one week, or 3 days to one week after administration of the GITR agonist antibody or antigen-binding fragment thereof.

The Ahtu-CD25 antibody, or antigen-binding fragment thereof, can be administered at a time when the GITR agonist antibody, or antigen-binding fragment thereof, increases the surface expression of CD25 in the subject relative to the expression of CD25 in the subject at the time of administration. For example, the anti-CD25 antibody or antigen-binding fragment thereof can be administered at least 12 hours later, at least 1 day later, at least 2 days later, at least 3 days later, at least 4 days later, at least 5 days, at least 6 days, or at least 7 days after administration of the anti-GITR agonist antibody. The Ahtu-CD25 antibody or antigen-binding fragment thereof may be administered 12 hours to two weeks, 1 day to two weeks, 2 days to two weeks, or 3 days to two weeks after administration of the anti-GITR agonist antibody or antigen-binding fragment thereof. The Ahtu-CD25 antibody or antigen-binding fragment thereof can be administered 12 hours to one week, 1 day to one week, 2 days to one week, or 3 days to one week after administration of the anti-GITR agonist antibody or antigen-binding fragment thereof.

The anti-CTLA-4 antagonist antibody, or antigen-binding fragment thereof, can be administered at a time when the GITR agonist antibody, or antigen-binding fragment thereof, increases surface expression of CTLA-4 in the subject relative to the expression of CTLA-4 in the subject at the time of administration. For example, an anti-CTLA-4 antagonist antibody, or antigen-binding fragment thereof, can be

- 145 040077 administer at least 12 hours later, at least 1 day later, at least 2 days later, at least 3 days later, at least 4 days later, at least 5 days later, at least 6 days or at least 7 days after administration of the anti-GITR agonist antibody. The anti-CTLA-4 antagonist antibody or antigen-binding fragment thereof can be administered 12 hours to two weeks, 1 day to two weeks, 2 days to two weeks, or 3 days to two weeks after administration of the GITR agonist antibody or antigen-binding fragment thereof. The anti-CTLA-4 antagonist antibody or antigen-binding fragment thereof can be administered 12 hours to one week, 1 day to one week, 2 days to one week, or 3 days to one week after administration of the GITR agonist antibody or antigen-binding fragment thereof.

Examples of cancers that can be treated according to the methods described herein include, but are not limited to, B-cell lymphomas (e.g., B-cell lymphocytic leukemia, B-cell non-Hodgkin's lymphoma, B-cell skin lymphoma, diffuse large B-cell -cell lymphoma), basal cell carcinoma, bladder cancer, blastoma, brain metastases, breast cancer, Burkitt's lymphoma, carcinoma (eg, adenocarcinoma (eg, esophagogastric junction)), cervical cancer, colon cancer, colorectal cancer (cancer of the colon and rectum), endometrial carcinoma, esophageal cancer, Ewing's sarcoma, follicular lymphoma, gastric cancer, esophageal junction carcinoma, gastrointestinal cancer, glioblastoma (eg, glioblastoma multiforme, eg, newly diagnosed or recurrent ), glioma, head and neck cancer (eg, squamous cell carcinoma of the head and neck), liver metastases, Hodgkin's and non-Hodgkin's lung cancer lymphoma, kidney cancer (eg, renal cell carcinoma and Wilms' tumors), laryngeal cancer, leukemia (eg, chronic myelocytic leukemia, hairy cell leukemia), liver cancer (eg, hepatocarcinoma and hepatoma), lung cancer (eg, non-small cell lung cancer and small cell lung cancer), lymphoblastic lymphoma, lymphoma, mantle cell lymphoma, metastatic brain cancer, metastatic cancer, myeloma (eg, multiple myeloma), neuroblastoma, ocular melanoma, oropharyngeal cancer, osteosarcoma, ovarian cancer, pancreatic cancer (eg, ductal pancreatic adenocarcinoma), prostate cancer (eg, hormone-resistant (eg, castration-resistant), metastatic, metastatic hormone-resistant (eg, castration-resistant, androgen-independent)), renal cell carcinoma (eg, metastatic), salivary gland carcinoma, sarcoma (eg, rhabdomyosarcoma), skin cancer (eg, melanoma (eg, metastatic melanoma y)), soft tissue sarcoma, solid tumor, squamous cell carcinoma, synovial sarcoma, testicular cancer, thyroid cancer, transitional cell carcinoma (urothelial cell cancer), uveal melanoma (eg, metastatic), verrucous carcinoma, vulvar cancer, and Waldenstrom's macroglobulinemia .

In some embodiments, the cancer being treated according to the methods described herein is a human sarcoma or carcinoma, e.g., fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteosarcoma, chordoma, angiosarcoma, endotheliosarcoma, lymphangiosarcoma, lymphangioendotheliosarcoma, synovioma, mesothelioma, Ewing's tumor, leiomyosarcoma, rhabdomyosarcoma, colon carcinoma, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, squamous basal cell carcinoma, adenocarcinoma, sweat gland carcinoma, sebaceous carcinoma, papillary carcinoma, papillary adenocarcinomas, cystadenocarcinoma, medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma (eg, metastatic), hepatoma, bile duct carcinoma, choriocarcinoma, seminoma, fetal carcinoma, Wilms tumor, cervical cancer, testicular tumor, lung carcinoma, small cell carcinoma l lung, bladder carcinoma, epithelial carcinoma, glioma, glioblastoma multiforme, astrocytoma, medulloblastoma, craniopharyngioma, ependymoma, pinealoma, hemangioblastoma, acoustic neuroma, oligodendroglioma, meningioma, melanoma, neuroblastoma, retinoblastoma. In certain embodiments, the cancer being treated according to the methods described herein is acute lymphocytic leukemia or acute myelocytic leukemia (eg, myeloblastic, promyelocytic, myelomonocytic, monocytic, and erythroleukemia); chronic leukemia (chronic myelocytic (granulocytic) leukemia or chronic lymphocytic leukemia); Hodgkin's disease; non-Hodgkin's disease; acute myeloid leukemia; B-cell lymphoma; T-cell lymphoma; anaplastic large cell lymphoma; intraocular lymphoma; follicular lymphoma; lymphoma of the small intestine; or lymphoma of the marginal zone of the spleen. In certain embodiments, the cancer being treated according to the methods described herein is multiple myeloma, Waldenström macroglobulinemia, heavy chain disease, gastrointestinal stromal tumors, head and/or neck cancer (e.g., larynopharyngeal squamous cell carcinoma, laryngeal squamous cell carcinoma , cell carcinoma of the oropharynx or verrucous carcinoma of the larynx), endometrial stromal sarcoma, mast cell sarcoma, adult soft tissue sarcoma, uterine sarcoma, Merkel cell carcinoma, urothelial carcinoma, melanoma with stasis in the brain, uveal melanoma, uveal

- 146 040077 melanoma with liver metastases, non-small cell lung cancer, rectal cancer or myelodysplastic syndrome. In some embodiments, the cancer being treated according to the methods is metastatic. In certain embodiments, cancers treated according to the methods described herein include prostate cancer, breast cancer, lung cancer, colorectal cancer, melanoma, bronchial cancer, bladder cancer, brain or central nervous system cancer, cancer peripheral nervous system, uterine or endometrial cancer, oral or pharyngeal cancer, non-Hodgkin's lymphoma, thyroid cancer, kidney cancer, bile duct cancer, small intestine or appendix cancer, salivary gland cancer, thyroid cancer, adrenal cancer, squamous cell carcinoma, mesothelioma , osteocarcinoma, thioma/carcinoma of the thymus, glioblastoma, myelodysplastic syndrome, soft tissue sarcoma, DIPG (diffuse brain stem cell tumor), adenocarcinoma, osteosarcoma, chondrosarcoma, leukemia, or pancreatic cancer. In some embodiments, the cancer being treated according to the methods described herein includes carcinoma (eg, adenocarcinoma), lymphoma, blastoma, melanoma, sarcoma, or leukemia. In certain embodiments, cancers treated according to the methods described herein include squamous cell carcinoma, small cell lung cancer, non-small cell lung cancer, gastrointestinal cancer, Hodgkin's lymphoma, non-Hodgkin's lymphoma, pancreatic cancer, glioblastoma, glioma, cervical cancer, ovarian cancer, liver cancer (eg, hepatocarcinoma and hepatoma), bladder cancer, breast cancer, inflammatory breast cancer, Merkel cell carcinoma, colon cancer, colorectal cancer, gastric cancer, bladder cancer, carcinoma endometrium, myeloma (eg, multiple myeloma), salivary gland carcinoma, kidney cancer (eg, renal cell carcinoma and Wilms' tumors), basal cell carcinoma, melanoma, prostate cancer, vulvar cancer, thyroid cancer, testicular cancer, esophageal cancer, serous adenocarcinoma, or various types of head and neck cancer. In certain embodiments, cancers treated according to the methods described herein include desmoplastic melanoma, inflammatory breast cancer, thymoma, rectal cancer, anal cancer, or resectable or unresectable brainstem glioma. In a particular embodiment, the cancer is a solid tumor. In another specific embodiment of the invention, the cancer is glioblastoma multiforme. In some embodiments of the invention, glioblastoma multiforme has recurred. In some embodiments of the invention, glioblastoma multiforme is diagnosed for the first time. In some embodiments, glioblastoma multiforme occurs in a subject having unmethylated MGMT promoters. In some embodiments of the invention, glioblastoma multiforme is resistant to bevacizumab therapy. In some embodiments, glioblastoma multiforme occurs in a subject who has not received bevacizumab therapy. In some embodiments, the cancer being treated according to the methods described herein is metastatic melanoma (eg, resistant metastatic melanoma), metastatic ovarian cancer, or metastatic renal cell carcinoma. In certain embodiments, the cancer being treated according to the methods described herein is melanoma that is resistant to ipilimumab. In some embodiments, the cancer being treated according to the methods described herein is a melanoma that is resistant to nivolumab. In some embodiments, the cancer being treated according to the methods described herein is melanoma that is resistant to ipilimumab and nivolumab.

5.4.1.2. Infectious diseases

In a specific aspect, provided herein are methods for preventing and/or treating an infectious disease comprising administering to a patient in need thereof an effective amount of an anti-GITR antibody or antigen-binding fragment thereof or composition thereof as described herein. In one embodiment of the invention, provided herein are methods for preventing and/or treating an infection (eg, a viral infection, a bacterial infection, a fungal infection, a protozoan infection, or a parasitic infection). The infection that is prevented and/or treated in accordance with the methods may be caused by an infectious agent as defined herein. In a specific embodiment, the anti-GITR antibody described herein, or an antigen-binding fragment or composition thereof, is the sole active agent administered to the subject. In some embodiments, the anti-GITR antibody described herein, or an antigen-binding fragment thereof, or composition thereof, is used in combination with anti-infective treatments (eg, antiviral, antibacterial, antifungal, or anthelmintic) to treat infectious diseases.

Infectious diseases that can be treated and/or prevented with the anti-GITR antibody or antigen-binding fragment thereof described herein are caused by infectious agents, including, but not limited to, bacteria, parasites, fungi, protozoa, and viruses.

- 147 040077

In a specific embodiment, the infectious diseases that are treated and/or prevented by the anti-GITR antibody or antigen-binding fragment described herein are caused by a virus. Viral diseases or viral infections that can be prevented and/or treated according to the methods described herein include, but are not limited to, those caused by hepatitis A, hepatitis B, hepatitis C, influenza (e.g., influenza A or influenza B), chickenpox, adenovirus, herpes simplex virus type I (HSV-I), herpes simplex type II (HSV-II), plague, rhinovirus, echovirus, rotavirus, respiratory syncytial virus, papillomavirus, papovavirus, cytomegalovirus, echinovirus , arbovirus, hantavirus, coxsackie virus, mumps virus, measles virus, rubella virus, poliovirus, black pox virus, Epstein-Barr virus, human immunodeficiency virus type I (HIV-I), human immunodeficiency virus type II (HIV-II) and agents of viral diseases such as viral meningitis, encephalitis, dengue fever or black pox. Bacterial infections that can be prevented and/or treated include those caused by Escherichia coli, Klebsiella pneumoniae, Staphylococcus aureus, Enterococcus faecalis, Proteus vulgaris, Staphylococcus viridans, and Pseudomonas aeruginosa. Bacterial diseases caused by bacteria (eg, Escherichia coli, Klebsiella pneumoniae, Staphylococcus aureus, Enterococcus faecalis, Proteus vulgaris, Staphylococcus viridans, and Pseudomonas aeruginosa) that can be prevented and/or treated according to the methods described herein include, but are not limited to these, Mycobacteria rickettsia, Mycoplasma, Neisseria, S. pneumonia, Borrelia burgdorferi (Lyme disease), Bacillus anthracis (anthrax), tetanus, Streptococcus, Staphylococcus, mycobacterium, whooping cough, cholera, plague, diphtheria, chlamydia, S. aureus and legionella.

Protozoal diseases or protozoal infections that can be prevented and/or treated according to the methods described herein include, but are not limited to, leishmania, coccidiosis, trypanosome, schistosome, or malaria. Parasitic diseases or parasitic infections caused by parasites that can be prevented and/or treated in accordance with the methods described herein include, but are not limited to, diseases caused by chlamydia and rickettsiae.

Fungal diseases or fungal infections that can be prevented and/or treated in accordance with the methods described herein include, but are not limited to, Candida infections, zygomycosis, Candida mastitis, progressive disseminated trichosporonosis with latent trichosporonemia, disseminated candidiasis, pulmonary paracoccidioidomycosis , легочного аспергиллеза, пневмонии Pneumocystis carinii, криптококкового менингита, менингоэнцефалита coccidioidal и цереброспинального васкулита, инфекции Aspergillus niger, Fusarium keratitis, микоза околоносовых пазух, эндокардита Aspergillus fumigatus, большеберцовой дисхондроплазии, вагинита Candida glabrata, орофарингеального кандидоза, Х-сцепленной хронической гранулематозной болезни, дермофитии foot, cutaneous candidiasis, mycotic placentitis, disseminated trichosporonosis, allergic bronchopulmonary aspergillosis, mycotic keratitis, Cryptococcus neoformans infection, fungal peritonitis, infections Curvularia geniculata, staphylococcal endophthalmitis, sporotrichosis and dermatophytosis.

In certain embodiments of the invention, administration to a subject (in some embodiments, an animal model) of an anti-GITR antibody described herein, or an antigen-binding fragment thereof, or composition thereof, results in one, two, three, four or more of the following effects: (i) reduction or alleviating the severity of an infectious disease, infection, or associated symptom; (ii) reducing the duration of the infectious disease, infection, or associated symptom; (iii) inhibiting the progression of the infectious disease, infection, or associated symptom; (iv) regression of the infectious disease, infection, or associated symptom; (v) inhibiting the development or onset of an infectious disease, infection, or associated symptom; (vi) inhibiting the reappearance of the infectious disease or associated symptom; (vii) reducing or inhibiting the spread of an infectious agent from one cell to another cell, one tissue to another tissue, or one organ to another organ; (viii) inhibiting or reducing the spread/transmission of an infectious agent from one subject to another subject; (ix) reduce organ failure associated with infectious disease; (x) reducing the subject's hospitalization; (xi) reducing the duration of hospitalization; (xii) improving the survival of a subject with an infectious disease or infection; (xiii) elimination of the infectious disease or infection; (xiii) inhibiting or reducing the replication of an infectious agent or infection; (xiv) inhibiting or reducing entry of the infectious agent into the cell(s); (xv) inhibiting or reducing the replication of the infectious agent's genome; (xvi) inhibition or reduction of protein synthesis of the infectious agent; (xvii) inhibiting or reducing the assembly of infectious agents; (xviii) inhibiting or reducing the release of infectious agents from the cell(s); (xviii) reduction in the number or titer of infectious agents; (xix) reduction in the number of symptoms associated with the infectious disease or infection; (xx) enhancing, improving, supplementing or extending the prophylactic or therapeutic effect of another type of therapy;

- 148 040077 and/or (xxi) preventing the onset or progression of a secondary infection associated with an infectious disease. In certain embodiments of the invention, two or more of the anti-GITR antibodies or antigen-binding fragments described herein are administered to the subject. In some embodiments, the anti-GITR antibody described herein, or an antigen-binding fragment thereof, is administered to a subject in combination with one or more other therapies. In one embodiment, the anti-GITR antibody described herein, or an antigen-binding fragment thereof, is administered in combination with one or more antifungal agents.

In a specific embodiment, the anti-GITR antibody described herein, or an antigen-binding fragment thereof, is administered to a subject in combination with one or more antibiotics. Examples of antibiotics that can be used in combination with the anti-GITR antibody or antigen-binding fragment described herein include aminoglycoside antibiotics, glycopeptides, amphenicol antibiotics, ansamycin antibiotics, cephalosporins, cephamycins, oxazolidinones, penicillins, quinolones, streptogramins, tetracyclines, and their analogs. .

In another embodiment, the anti-GITR antibody described herein, or an antigen-binding fragment thereof, is administered in combination with one or more antiviral agents. Examples of antiviral agents that can be used in combination with an anti-GITR antibody or antigen-binding fragment thereof as described herein include non-nucleoside reverse transcriptase inhibitors, nucleoside reverse transcriptase inhibitors, protease inhibitors, and fusion inhibitors. In one embodiment, the antiviral agent is amantadine, oseltamivir phosphate, rimantadine, and zanamivir. In another embodiment, the antiviral agent is a non-nucleoside reverse transcriptase inhibitor such as delavirdine, efavirenz, or nevirapine. In another embodiment, the antiviral agent is a nucleoside reverse transcriptase inhibitor such as abacavir, didanosine, emtricitabine, emtricitabine, lamivudine, stavudine, tenofovir DF, zalcitabine, or zidovudine. In another embodiment, the antiviral agent is a protease inhibitor such as amprenavir, atazanavir, fosamprenavir, indinavir, lopinavir, nelfinavir, ritonavir, or saquinavir. In another embodiment, the antiviral agent is a fusion inhibitor such as enfuvirtide. In another embodiment, the antiviral agent is oseltamivir phosphate, amphotericin B, or palivizumab.

In a particular embodiment, the anti-GITR antibody described herein, or an antigen-binding fragment thereof, is administered to a subject in combination with a vaccine that is a heat shock protein preparation containing a heat shock protein complexed with antigenic peptides containing an antigen from a pathogen (e.g., a virus , bacteria, fungus, etc.). In some embodiments, the anti-GITR antibody described herein, or an antigen-binding fragment thereof, is administered to a subject in combination with a vaccine that is a heat shock protein preparation containing heat shock proteins complexed with antigenic peptides containing viral antigens (e.g., HIV antigens). -1 or HIV-2). In some embodiments, a heat shock protein preparation comprising heat shock proteins complexed with antigenic peptides containing viral antigens (eg, HIV-1 or HIV-2 antigens) is combined with an adjuvant such as QS-21. In some embodiments, the vaccine is HerpV (Agenus Inc.), which is a vaccine for the treatment of herpes infections. A non-limiting example of a suitable vaccine is disclosed in Mo A., et al. (2011), Vaccine 29: 8530-8541, the contents of which are incorporated herein by reference in their entirety. Additional non-limiting examples are disclosed in US Pat. No. 8,541,002, the contents of which are incorporated herein by reference in their entirety. In some embodiments, an anti-GITR antibody described herein, or an antigen-binding fragment or composition thereof, is administered to a subject suffering from an infectious disease caused by infectious agents, including, but not limited to, bacteria, fungi, protozoa, and viruses. In certain embodiments, an anti-GITR antibody described herein, or an antigen-binding fragment or composition thereof, is administered to a subject who has been diagnosed with an infectious disease caused by infectious agents, including, but not limited to, bacteria, fungi, protozoa, and viruses. In some embodiments, an anti-GITR antibody described herein, or an antigen-binding fragment or composition thereof, is administered to a subject with an infection. In some embodiments of the invention, the subject who is treated in accordance with the method described herein has reduced or weakened immunity. In certain embodiments of the invention, the subject being treated in accordance with the methods described herein has received, is undergoing, or will receive another type of therapy (eg, an antiviral agent, an antibiotic, or an antifungal agent).

- 149 040077

5.4.1.3. Routes of administration and dosage

An antibody described herein, or an antigen-binding fragment or composition thereof, can be delivered to a subject in a variety of ways. These include, but are not limited to, parenteral, intranasal, intratracheal, oral, intradermal, topical, intramuscular, intraperitoneal, transdermal, intravenous, intratumoral, conjunctival, and subcutaneous routes. It is also possible to use inhalation administration, for example, using an inhaler or nebulizer and a dosage form with an aerosolized agent for use as a spray.

The amount of an antibody or antigen-binding fragment or composition thereof that will be effective in treating and/or preventing a pathological condition depends on the nature of the disease and can be determined using standard clinical methods.

The exact dose used in the composition also depends on the route of administration and the severity of the infection or disease caused by it, and should be administered in accordance with the opinion of the attending physician and the circumstances relating to each subject. For example, effective doses may also vary depending on the means of administration, the target site, the physiological state of the patient (including age, body weight and health status), whether the patient is a human or animal, other medications taken, or whether the treatment is prophylactic. or therapeutic. Typically, the patient is a human, but non-human mammals, including transgenic mammals, can also be treated. Therapeutic dosages are optimally titrated to optimize safety and efficacy.

In certain embodiments of the invention, an in vitro assay is used to determine optimal dosage ranges. Effective doses can be extrapolated from dose-response curves obtained from in vitro or animal model systems.

For passive immunization with an antibody (or antigen-binding fragment thereof), the dosage range is from about 0.0001 to 100 mg/kg, and more typically from 0.01 to 15 mg/kg of the patient's body weight. For example, dosages may be 1 mg/kg body weight, 10 mg/kg body weight, or in the range of 1-10 mg/kg, or, in other words, 70 mg or 700 mg or in the range of 70-700 mg, respectively, for 70 kg patient. In some embodiments, the dosage administered to the patient is from about 1 mg/kg to about 20 mg/kg of the patient's body weight. In general, human antibodies have a longer lifetime in the human body than antibodies from other species due to the immune response to foreign polypeptides. Thus, lower dosages of human antibodies and less frequent administration are often possible. A typical treatment regimen includes administration once every two weeks or once a month, or once every 3 or 6 months for a period of one year or several years, or at intervals of several years. In some methods, two or more antibodies or antigen-binding fragments thereof with different binding specificities are simultaneously administered to a subject. Typically, the antibody, or antigen-binding fragment thereof, is administered multiple times. The intervals between single dosages can be a week, a month, 3 months, 6 months or a year.

5.4.2. Detection and diagnostic applications

The anti-GITR antibody described herein, or an antigen-binding fragment thereof (see, for example, section 5.1), can be used to analyze GITR protein levels in a biological sample using classical immunohistological methods known to those skilled in the art, including immunoassay methods such as enzyme immunosorbent assay (ELISA), immunoprecipitation or Western blotting. Suitable assay labels for antibodies are known in the art and include enzyme labels such as glucose oxidase; radioisotopes such as iodine ( ¹²⁵ I, ¹²¹ I), carbon ( ¹⁴ C), sulfur ( ³⁵ S), tritium ( ³ H), indium ( ¹²¹ In) and technetium ( ⁹⁹ Tc); luminescent labels such as luminol; and fluorescent labels such as fluorescein and rhodamine, and biotin. Such labels can be used to label an antibody as described herein, or an antigen-binding fragment thereof. Alternatively, a second antibody that recognizes an anti-GITR antibody or antigen-binding fragment thereof as described herein can be labeled and used in combination with an anti-GITR antibody or antigen-binding fragment thereof to determine GITR protein levels. Analysis of the level of GITR protein expression refers to a qualitative or quantitative change or assessment of the level of GITR protein in a first biological sample either directly (for example, by determining or assessing the absolute level of the protein) or relatively (for example, by comparison with the disease-associated protein level in the second biological sample). sample). The expression level of a GITR polypeptide in a first biological sample can be measured or assessed and compared to a standard GITR protein level, with a second biological sample derived from an undisturbed individual or determined from average levels of a population of undisturbed individuals as the standard. As is known in the art, once a standard level of GITR polypeptide is known, it can be reused as a standard for comparison. As used herein, a biological sample refers to any biological sample obtained from a subject, cell line, tissue, or other source of cells that effectively expresses GITR. Methods for obtaining tissue and body fluid biopsy specimens from animals (eg, humans) are well known in the art. Biological samples include peripheral blood mononuclear cells.

The anti-GITR antibody or antigen-binding fragment described herein can be used for prognosis, diagnosis, monitoring, and screening, including in vitro and in vivo applications well known and standard to those skilled in the art and based on the present disclosure. Prognostic, diagnostic, monitoring, and screening assays, as well as in vitro immune status and/or immune response kits, can be used to predict, diagnose, and monitor specimens from patients, including those who have or are likely to have immune system disorders , or taking into account the intended or desired response of the immune system, response to an antigen, or response to a vaccine. Evaluation of immune system status and/or immune response is also useful in determining a patient's compliance with a clinical drug trial or administration of a particular chemotherapeutic agent or antibody or antigen-binding fragment, including combinations thereof, as compared to another agent or antibody or antigen-binding fragment thereof. This type of prognostic and diagnostic monitoring and evaluation is already practiced using antibodies against the HER2 protein in breast cancer (HercepTest™, Dako) and this assay is also used to evaluate patients for antibody therapy using Herceptin®. In vivo applications include targeted cell therapy and modulation of the immune system, and radioimaging of immune responses.

In one embodiment, the anti-GITR antibody, or antigen-binding fragment thereof, can be used in the immunohistochemistry of biopsy specimens.

In another embodiment, an anti-GITR antibody or antigen-binding fragment thereof can be used to determine levels of GITR or levels of cells that contain GITR on the surface of membranes, and these levels can then be associated with certain symptoms of the disease. The anti-GITR antibodies described herein, or antigen-binding fragments thereof, may carry a detectable or functional label. When using fluorescent labels to identify and quantify specific binding representatives, currently available microscopy and fluorescent activated cell sorting (FACS) or a combination of both methods known in the art can be used. The anti-GITR antibodies described herein, or antigen-binding fragments thereof, may carry a fluorescent label. Exemplary fluorescent labels include, for example, reactive and conjugated probes such as aminocoumarin, fluorescein, and Texas red, Alexa Fluor dyes, Cy dyes, and DyLight dyes. The antiGITR antibody or antigen-binding fragment thereof may be radioactively labeled, such as the isotopes ³ H, ¹⁴ C, ³² P, ³⁵ S, ³⁶ Cl, ⁵¹ Cr, ⁵⁷ Co, ⁵⁸ Co, ⁵⁹ Fe, ⁶⁷ Cu, ⁹⁰ Y, ⁹⁹ Tc, ⁿ¹ In, ¹¹⁷ Lu, ¹²¹ I, ¹²⁴ I, ¹²⁵ I, ¹³¹ I, ¹⁹⁸ Au, ²¹¹ At, ²¹³ Bi, ²²⁵ Ac, and ¹⁸⁶ Re. When using radioactive labels to detect and quantify the specific binding of an anti-GITR antibody or antigen-binding fragment to GITR (eg, human GITR), currently available scoring procedures known in the art can be used. In the case where the label is an enzyme, the detection can be carried out using any currently used methods of colorimetry, spectrophotometry, fluorospectrophotometry, amperometry or gasometry, as known in the art. It can be performed by bringing the sample or control sample into contact with an anti-GITR antibody or antigen-binding fragment under conditions that promote the formation of a complex between the antibody or antigen-binding fragment and GITR. Any complexes formed between the antibody or its antigen-binding fragment and GITR are detected and compared for sample and control. In light of the specific binding of the antibodies described herein to GITR, the antibodies, or antigen-binding fragments thereof, can be used to specifically detect expression of GITR on the surface of cells. The antibodies described herein, or antigen-binding fragments thereof, can also be used to purify GITR by immunoaffinity purification.

Also included in this document is an assay system, which can be obtained in the form of a test kit for quantitative analysis of the degree of content, for example, GITR or GITR/GITRL complexes. The system or test kit contains a labeled component, such as a labeled antibody, and one or more additional immunochemical reagents. See, for example, section 5.5 below for sets.

5.5. Sets

Provided herein are kits containing one or more of the antibodies described herein, or antigen-binding fragments thereof, or conjugates thereof. In a specific embodiment of the invention, provided herein is a pharmaceutical kit or kit containing one or more containers filled with one or more ingredients of a pharmaceutical composition described herein, for example, one or more antibodies or antigen-binding fragments provided herein. In some embodiments of the invention

- 151 040077 kits contain the pharmaceutical composition described herein and any prophylactic or therapeutic agent such as those described herein. In certain embodiments, the kits may contain a T cell mitogen, such as, for example, phytohemagglutinin (PHA) and/or phorbol myristacetate (PMA), or an antibody that stimulates the PTK complex, such as an anti-CD3 antibody and an anti-CD28 antibody. Optionally, such containers may be accompanied by a notice in the form prescribed by the government agency that regulates the manufacture, use or sale of pharmaceuticals or biological products, which reflects the approval of the authority that controls the production, use or sale for use in humans.

Also provided herein are kits that can be used in the above methods. In one embodiment, the kit contains an antibody described herein, preferably a purified antibody, in one or more containers. In a specific embodiment, the kits described herein contain a substantially purified GITR antigen (eg, human GITR) as a control. In another specific embodiment, the kits described herein further comprise a control antibody that does not react with the GITR antigen. In another specific embodiment of the invention, the kits described herein contain one or more elements for detecting binding of an antibody to a GITR antigen (for example, the antibody can be conjugated to a detectable substrate, such as a fluorescent compound, an enzyme substrate, a radioactive compound, or a luminescent compound, or the second an antibody that recognizes the first antibody may be conjugated to a detectable substrate). In specific embodiments, the kit provided herein may contain a recombinantly produced or chemically synthesized GITR antigen. The GITR antigen provided in the kit can also be attached to a solid support. In a more specific embodiment, the detection means of the kits described above comprise a solid support to which the GITR antigen is attached. Such a kit may also contain an unattached, reporter-labeled anti-human antibody or an anti-mouse/anti-rat antibody. In this embodiment, binding of an antibody to a GITR antigen can be detected by binding of said reporter-labeled antibody.

The following examples are offered by way of illustration and not by way of limitation.

6. Examples

The examples in this section (ie, section 6) are provided by way of illustration and not limitation.

6.1. Example 1: Preparation of new antibodies against human GITR

This example describes the production and characterization of mouse antibodies that bind to human GITR. In particular, this example describes the generation of mouse antibodies that specifically bind to human GITR and exhibit a co-stimulatory effect on CD4+ T cells.

To obtain new antibodies to GITR, murine CMS5a cells transfected with human GITR were used as an immunogen in combination with an adjuvant (monophosphoryl lipid A (MPL), trehalose dimycolate (DMT), muramyl dipeptide (MDP) and Freund's adjuvant (AF)) on mice BALB/ c. Spleen cells from immunized mice were fused with the mouse myeloma cell line SP2/0. The supernatants of the resulting clones were screened using a mixed haemadsorption assay for hGITR-transfected CMS5a cells and wild-type CMS5a cells. The selected supernatants were further examined by ELISA on the recombinant hGITR protein (HGITR-Fc, Sigma). Fusion #231 generated four hybridomas (231-32-15, 231-1039-45, 231-1042-7, and 2311333-21) with selective reactivity for human GITR (sometimes referred to herein as hGITR or huGITR) according to MHA and ELISA. Antibodies (all IgG1) were purified by protein G affinity chromatography for further analysis.

The specificity of anti-GITR antibodies was examined by Western blotting against purified recombinant human GITR, recombinant mouse GITR, human GITR-transfected CMS5a cells, wild-type CMS5a cells, activated CD4+ T cells, and untreated CD4+ T cells. Western blotting under non-reducing conditions is illustrated in FIG. 1. Anti-GITR antibodies reacted with purified recombinant human GITR, did not react with recombinant mouse GITR, reacted with recombinant human GITR in CMS5a cells, and reacted with natural human GITR in activated CD4+ T cells.

Binding analysis of ligand (GITR-L) and monoclonal antibody with immobilized huGITR was performed by surface plasmon resonance, and measurements were performed on BIAcore®. GITR (~1100 EO) was immobilized on a CM5 sensor chip using a standard amine conjugation. Analytes were injected over the immobilized GITR for 15 min at a flow rate of 5 μl/min followed by a 10 min dissociation period. After performing kinetic experiments, the affinity and dissociation constants were simultaneously calculated using the BiaEvaluation® software (Biacore Life Sciences). Human GITR-L binding was analyzed over a concentration range of 12.5-200 nM, and mouse anti-GITR monoclonal antibodies were analyzed over a concentration range of 6.25-100 nM. The antibodies did not bind to immobilized mouse GITR. Affinity and dissociation constants for antibodies are given below in table. 9.

Table 9

analyte Ka(1/M) Kd(M) huGITR-L ^1.81x108 5.54 x ΙΟ' ⁹ mAb 231-1039-45 ^4.20x108 2.38 x ΙΟ' ⁹ mAb 231-32-15 ^4.04x108 2.47 χ ΙΟ' ⁹ mAb 231-1333-21 ^4.19x108 2.39 χ ΙΟ' ⁹ mAb 231-1042-07 ^4.30x108 2.33 x ΙΟ' ⁹

Hybridomas 231-32-15, 231-1039-45, 231-1042-7 and 231-1333-21 were sequenced and found to have the same cDNA and protein sequences. The protein sequences of VH and VL were confirmed by N-terminal protein sequencing and mass spectrometry (MS) of tryptic digests. The sequence of the variable region of the heavy chain of anti-GITR antibodies is SEQ ID NO: 201, and the sequence of the variable region of the light chain of anti-GITR antibodies is SEQ ID NO: 202. Sequences of the hypervariable regions (CDR) of the variable region of the heavy chain (VH) VH CDR1 .

Competitive binding of the novel 231-GITR antibodies was compared with a commercially available anti-GITR monoclonal antibody (R&D Systems mAb689 clone 110416). GITR-transfected CMS5a cells were used, which were incubated with unlabeled anti-GITR mAb, followed by addition of PE-conjugated R&D mAb or Alexa 488-conjugated antibody 231-1039-45 or 213-133321 (data not shown for Alexa 488-conjugated 213- 1333-21) and the results were evaluated by FACS analysis. Anti-GITR mAb blocking studies from R&D systems are illustrated in FIG. 2A, and blocking studies of antibody 231 (1039-45) are illustrated in FIG. 2B. In these studies, no antibody was added at first, R&D antibody or unlabeled test antibodies (antibodies 1042-7, 1039-45, 1331-21, or 32-15) were added and incubated with M5Sa-GITR transfected cells. R&D labeled antibody (FIG. 2A) or 231-anti-GITR labeled 1039-45 antibody (FIG. 2B) was then added. The new antibodies 231 (1042-7, 1039-45, 1333-21 or 32-15) only partially blocked binding of the R&D antibody, possibly due to steric mismatch (FIG. 2A). Fig. 2B illustrates that the R&D antibody does not block binding of the 231-1039-45 antibody. Binding of 1039-45 was inhibited by any of the antibodies 231 (ie 1042-7, 1039-45, 1333-21 or 32-15). The binding characteristics of the 231-GITR antibodies were analyzed by FACS and the results are shown in FIG. FOR-S. Fig. 3A illustrates staining of CMS5a-GITR cells with anti-human GITR IgGl 1333-21 antibody from two different lots (1 and 2) and an antibody from R&D Systems. In FIG. ER shows the ex vivo fluorescence intensity of PBMC-derived POPs-CD 19-GITR+ and CD4+CD25+ GITR+ stained with antibodies 1042-7, 32-15, 1039-45, 1333-21 and antibody from R&D Systems. FACS analysis of these in vivo PBMC-derived cells following binding of 1333-21 or an antibody from R&D systems (mAb689 clone 110416) is shown in FIG. ZS. Thereafter, studies were conducted to evaluate the co-stimulatory effect of an anti-GITR antibody on CD4+ T cells in combination with an anti-COP (OCTS) antibody. The most significant relative costimulatory effect was observed when anti-GITR antibodies (231-1042-7, 231-32-15, 231-1039-45, 231-1333-21) were combined with a suboptimal concentration (0.2 μg/ml) of OCTZ. Anti-GITR antibody (5 μg/ml) and OKT-3 antibody at various concentrations were bound to tissue culture plates and then incubated with CSFE-labeled CD4+ cells. IL-2 (10 U/ml) was added to the medium, and the cells and antibodies were incubated for another 5 days. At the end of 5 days, CFSE intensity was assessed, with divided cells having low CFSE intensity. The level of ΠΦΗγ was also measured. The results for anti-GITR antibodies are shown in FIG. 4. At a suboptimal concentration of OCTP antibody (0.2 μg/ml), anti-GITR antibodies had a significant relative effect on CD4+ cell proliferation. An increase in ΠΦΗγ levels compared to controls was observed in the presence of anti-GITR antibody in combination with all levels of OCTZ tested, with the strongest effects observed at 0.2 μg/mL and 0.04 μg/mL. The reason for the difference between the studied antibodies may be the variability in the results of one analysis and the natural variability between each preparation of antibodies (for example, a single preparation). It should be noted that in the absence of OCTZ, no stimulation with anti-GITR antibodies was observed. The co-stimulatory effect of anti-GITR antibodies with OCTZ depended on the amount of anti-GITR antibodies (data not shown). In conclusion, anti-GITR antibodies have been isolated that are specific for human GITR and recognize recombinant and native GITR. These antibodies bind hGITR expressed on hGITR-transfected CMS5a cells at 2.5-5 ng/ml and show good binding in the FACS assay. Antibodies have also been associated with human

PBMCs, including T cells expressing native hGITR. Their affinity for GITR, as determined by BIAcore®, corresponds to K _A (1/m) approximately 4.2x108, Kd (m) 2.4x10-9 (compared to K _A 1.8x108 and Kd 5.5x10-9 for GITRL (ligand)).

The antibodies bind to a different site on the hGITR compared to the commercially available GITR mAb (R&D).

A costimulatory effect of anti-GITR monoclonal antibody at suboptimal concentrations (0.2 μg/ml and 0.04 μg/ml) of anti-CD3 mAb (OKT3) on CD4+ T cells was demonstrated. Despite the presence of regulatory T cells in the population of enriched CD4+ T cells, anti-GITR antibodies enhanced the activity of CD4 T cells.

6.2. Example 2 Humanization of Mouse Monoclonal Antibody 231-32-15

This example describes the humanization of the mouse antibody 231-32-15 and the characteristics of the humanized antibodies.

6.2.1. Humanization of mouse antibody 231-32-15

This example describes the humanization of the anti-human mouse anti-GITR antibody 231-32-15, including the selection of human acceptor frameworks.

6.2.2. Chimerization of mouse antibody 231-32-15

Mouse VH and VL (kappa) variable regions from mouse 231-32-15 having the sequences of SEQ ID NOs: 201 and 202, respectively, were synthesized using GeneArt® (Life Technologies™). Natural leader sequences from the original mouse variable domains were included along with restriction site adapters to allow these variable regions to be cloned directly into a standard in-house human IgG1 Vh vector (CH1-2-3 domains) and a Vk (Ck1) vector to create chimeric genes with mouse Vh or Vk and human constant regions. The chimeric heavy and light chain expression vectors were then co-transfected into CHO cells in suspension to generate the chimeric antibody protein for use in the assays below. This chimeric antibody is referred to in the examples in section 6 as the chimeric parent antibody 231-32-15. This chimeric parental antibody 231-32-15 contains a T109S substitution (i.e. a threonine-to-serine substitution at position 109 compared to the wild-type Fc sequence) according to Kabat numbering in the light chain constant region, which facilitates in-frame cloning of the variable region with the constant region . This mutation is a conservative modification that does not affect antibody binding or function.

To select human framework regions for grafting the CDRs of antibody 231-32-15, a homologous matching method was used. Databases can be used, for example, a database of germline variable genes from human and mouse immunoglobulin loci (IMGT database (International Information System ImMunoGeneTics®; Lefranc MP et al. (1999) Nucleic Acids Res 27(1): 209-12; Ruiz M et al (2000) Nucleic Acids Res 28(1): 219-21 Lefranc MP (2001) Nucleic Acids Res 29(1): 207-9 Lefranc MP (2003) Nucleic Acids Res 31(1): 307-10; Lefranc MP et al. (2005) Dev Compo Immunol 29(3): 185-203; Kaas Q et al. (2007) Briefings in Functional Genomics & Proteomics 6(4): 253-64) or VBASE2 ( Retter I et al. (2005) Nucleic Acids Res 33, Database issue D671-D674), or the Kabat database (Johnson G et al. (2000) Nucleic Acids Res 28: 214-218)), or publications (e.g., Kabat EA et al., supra) to identify the human subfamilies to which the mouse heavy and light chain variable regions belong and to determine the most appropriate human germline framework for use as acceptor molecule. The choice of heavy and light chain variable region (VH and VL) sequences within these families to be used as an acceptor may be based on sequence homology and/or overlap in the structure of the CDR1 and CDR2 regions to help maintain the appropriate relative order of the CDRs after grafting.

A search of the IMGT database using IgBLAST (available from the NCBI web page) showed good homology between the heavy chain variable region framework 231-32-15 and members of the human heavy chain variable region subfamilies 1 and 7. The highest homology and sequence identity for CDRs and framework region was observed for the germline sequence: IGHV1-2*02 (also known as DP75; SEQ ID NO: 601) (59.2% identity; 58 amino acid residues out of 98), IGHV1-3*01 (SEQ ID NO: 602 ) (58.2% identity; 57/98), IGHV1-46*01 (SEQ ID NO: 603) (57.1% identity; 56/98), IGHV1-18*01 (SEQ ID NO: 604) and IGHV1-69*01 (SEQ ID NO: 605) (for both 56.1% identity; 55/98) and IGHV7-4-1*02 (SEQ ID NO: 606) (54.1% identity; 53/98 ). Using the same approach, the light chain variable domain sequence 231-32-15 showed good homology with members of the kappa 3 and 4 human light chain variable region subfamilies. 01 (SEQ ID NO: 607) (79.2% identity; 80 amino acid residues out of 101) and IGKV3-7*02

- 154 040077 (SEQ ID NO: 608) (64.4% identity; 65/101).

As a starting point for the humanization process, a grafted version of VH with murine 231-32-15 CDRs was created using human IGHV1-2*02 as the human framework acceptor. A number of backmutations have been made at residue positions that may affect CDR conformations or packaging within the variable domain and therefore may be of structural importance in maintaining full antibody activity. In framework region 1, Kabat's H24 residue was kept murine, as it is the canonical CDR1 residue (5 amino acid length loop as defined by Kabat). It is Gly in the mouse sequence and Ala in the human germline. In frame region 2, the Kabat H48 residue was kept murine, as it is known as a vernier residue (ie, located near the CDR). It is He in the mouse sequence and Met in the human germline. In frame 3, Kabat residues H67 and 73, which are vernier residues, were left as murine. H67 is Ala in the mouse sequence and Val in human germline IGHV1-2*02. H73 is a Lys in the mouse sequence and Thr in the human germline IGHV1-2*02. Residue H71, which is the critical canonical CDR2 residue, was left murine (it is Arg in the human germline and Val in the murine sequence). The Kabat H94 residue, which is the canonical CDR1 residue, was left murine (it is Arg in the human germline and Lys in the murine sequence). The final humanized sequence was named the VH A version (SEQ ID NO: 206) and had 79.6% identity (78 amino acid residues out of 98) with human germline IGHV1-2*02.

A first version of VL grafted with mouse 231-32-15 CDRs was generated using human IGKV3-7*02 as the human framework acceptor. Backmutations were taken into account at various positions of the residues, and as a result, in framework region 3, Kabat's L87 residue was left murine, as it may play a critical role at the VH/VL interface. L87 is His in the mouse sequence and Tyr in human germline IGKV3-7*02. The final humanized sequence was named the VK A1 version (SEQ ID NO: 207) a and had 81.2% identity (82 amino acid residues out of 101) with human germline IGKV3-7*02.

A second version of VL grafted with mouse 231-32-15 CDRs was generated using human IGKV4-1*01 as the human framework acceptor. Backmutations were taken into account at various positions of the residues, and as a result, in framework region 3, Kabat's L87 residue was left murine, as it may play a critical role at the VH/VL interface. L87 is His in the mouse sequence and Tyr in human germline IGKV4-1*01.

The final humanized sequence was named the VK A2 version (SEQ ID NO: 208) and had 91.1% identity (92 amino acid residues out of 101) with human germline IGKV4-1*01.

In table. 10 shows the residues (according to Kabat numbering) that differ in the framework regions of the mouse and human antibodies in the VH and VL versions grafted with mouse 231-32-15 CDRs described above.

Table 10

Comparison of 231-32-15 and human heavy chain acceptor variable region IGHV1-2*02 and human acceptor light chain variable region IGKV4-1*01 and framework region IGKV3-7*02

Heavy chain variable region Position by Kabatu 231-32-15 IGHV1-2*O2 24 gly Ala 48 Not Met 67 Ala Val 71 Val Arg 73 Lys Thr 94 Lys Arg Light chain variable region Position by Kabatu 231-32-15 IGKV4-l*01 / IGKV3-7*02 87 His Tyr

- 155 040077

6.2.3. Expression of Humanized Variants

The variable regions of IGHV1-2*02, IGK4-1*01 and IGK3-7*02 were synthesized using Life Technologies™ and cloned into standard expression vectors (pPEP) as described below. Thereafter, these constructs were used to transfect CHO cells and expressed antibodies were examined using suspension matrix technology (Luminex® 200 system, Millipore) and surface plasmon resonance (BIAcore®, GE Healthcare) as described below. The term variable region in this Example means rearranged VDJ genes for IGHV1-2*02 heavy chains and rearranged VJ genes for IGK4-1*01 and IGK3-7*02 light chains.

The expression vector contained a CMV promoter, an immunoglobulin constant region, a WPRE element (post-transcriptional response element), and a BGH polyadenylation signal. Three different variants of the expression vector were used to clone the IGHV1-2*02 variable region. Two variants of the expression vector contained different IGHG1 and IGHG4 immunoglobulin constant regions, and a third expression vector variant contained an IGHG1 fragment to generate antibody Fab fragments. The IGK4-1*01 and IGK3-7*02 light chain variable regions were cloned into an expression vector containing the IGKC immunoglobulin constant region.

6.2.3.1. Cloning into expression vectors for transfection of CHO cells

The synthesized variable regions were cloned into the pPEP expression vector containing the appropriate immunoglobulin constant region. For cloning of IGHV1-2*02 heavy chain variable regions of construct 3592 (pPEP-InsX-Cg(iso3), 4192 (pPEP-InsX-IgG4) and 4215 (pPEP-InsXFab-Xa-6xHis) (6xHis disclosed as SEQ ID NO: 36) were digested with HindIII/Eco47III at 37° C. for 4 h. cleanup). 4474 bp The synthesized variable regions of the antibody were digested with HindIII/Eco47III at 37°C for 4 h and the bands were gel-purified with a size of 422 bp (IGHV1-2*02) and 411 bp (IGK4- 1*01 and IGK3-7*02).

Digested and purified antibody variable regions (IGHV1-2*02, IGK4-1*01, IGK3-7*02) were ligated in frame to pPEP vectors (50 ng) containing the appropriate immunoglobulin constant regions. Ligation was performed overnight at 16° C. with a 1:3 ratio of the vector to be inserted. Thereafter, 1 μl of the ligation reaction was electroporated into DH10B cells (E. coli ElectroMax DH10B electrocompetent cells, Invitrogen) (1900 V/5 ms). Then 5-50 μl of electroporated bacteria were plated on LB-agar + 100 μg/ml ampicillin plates. 2-3 colonies were obtained from each construct and grown overnight.

A DNA plasmid preparation (Macherey & Nagel, NucleoSpin Plasmid) was prepared on a small scale from each clone. HindIII/Eco47III (H/E) digestion was performed to confirm the presence and correct size of the cloned insert, and ApaLI (A) digestion was used to confirm the correct vector backbone. The integrity of the vector was examined by separating uncut plasmid DNA. For each positive clone and DNA, preparation scaling, control digestion, and sequencing with primer 892-Je (sequence: 5' gaccaatagaaactgggcttgtc 3'; SEQ ID NO: 705) were performed. Each construct was assigned a unique identification number and a glycerol stock solution was prepared.

Table 11

Characteristics of constructs in expression vectors

Design number Characteristics of cog Insert structs Constant domains immunoglobulin 4260 IGHV1-2*O2 IGHG1 4261 IGK3-7*02 IGKC 4262 IGK4-l*01 IGKC 4379 IGHV1-2*O2 IGHG4 4336 IGHV1-2*O2 IGHGl-Fab

6.2.3.2. Cloning into retroviral expression vectors

Variable regions IGHV1-2*02, IGK3-7*02 and IGK4-1*01 were synthesized using Life Technologeis™ and cloned into retroviral expression vectors (pCMA). These constructs were then used to transduce preB cells and express antibodies on their surface using Retrocyte Display® technology. The retroviral expression vector contained MSCV-based 5' and 3' LTR, an immunoglobulin constant region (IGHG1 or IGKC) containing a portion of the membrane anchor (IGHG1), and the CD8 surface marker gene.

The synthesized variable regions were cloned into a retroviral expression vector containing the appropriate immunoglobulin constant region. To clone the heavy chain variable region, construct 3956 (pCMA-InsX Cg(iso3) loxP2-I-tr_huCD8-loxP) was digested with Hin-156 040077 dIII/Eco47III at 37°C for 4 h and gel-purified the 7616 bp band. .O. To clone the light chain variable regions, kappa construct 3957 (pCMA-InsX Ck-I-tr_huCD8) was digested with HindIII/Eco47III at 37°C for 4 h and gel-purified the 6718 bp band.

The synthesized antibody variable regions were digested as described in section 6.2.1 above.

The digested and purified antibody variable regions were ligated in frame into retroviral expression vectors (50 ng) containing the appropriate immunoglobulin constant regions. Ligation, transformation and confirmation of clones were performed as described in section 6.2.3.1 above. Scaled DNA plasmid preparations were sequenced using primer 327-Je (Sequence: 5' ctcgatcctccctttatccag 3'; SEQ ID NO: 706). Each construct was assigned a unique identification number and a glycerol stock solution was prepared.

Table 12 Characteristics of constructs in retroviral expression vectors

Design number Structural characteristics Insert Immunoglobulin constant regions surface marker 4257 IGHV1-2*O2 IGHG1 CD8 4258 IGK3-7*02 IGKC CD8 4259 IGK4-l*01 IGKC CD8

6.2.4. Expression of recombinant antibodies

Recombinant antibodies were expressed by transient transfection of FreeStyleCHO-S cells (Invitrogen, R800-07) in suspension. Briefly, cell density was adjusted to 8 x 10 ⁶ cells/ml in PowerCHO2 medium (Lonza, 12-771Q) supplemented with 4 mM L-glutamine (Biochrom, K 0283) and supplemented with 1X HT (GIBCO, 11067-030). DNA corresponding to the light chain (2.5 μg/ml) and heavy chain (2.5 μg/ml) of the antibody was added to the cell suspension with gentle agitation. After DNA addition, the cell suspension was supplemented with 10 μl/ml TransIT-Pro transfection reagent (MIRUS, MIR5700) and 0.5 mM (final concentration) valproic acid (Sigma-Aldrich, P4543). The cell suspension was incubated for 6 days at 31°C, 8% CO ₂ with stirring (200 rpm).

The culture supernatant was collected by centrifugation (9000g, 10 min at 10°C) and filtered through a 0.45 µm filter. A Vivaspin 20 ultrafiltration device (Sartorius, VS2032, HOMM 50 kDa) was used to concentrate the supernatant to a final volume of 0.6 ml at 1000g, 10°C for approximately 60 min. To purify the recombinant antibody, an HP Spin Trap Protein A column (GE Healthcare, 28-9031-32) was equilibrated with binding buffer (20 mM phosphate buffer, pH 7.0) and loaded with 0.6 ml of concentrate. The column was capped and incubated in a vertical mixer at room temperature. After 30 min, the column was washed 2x with 600 µl of binding buffer and then centrifuged at 100g for 1 min. Bound recombinant antibody was eluted from the spin column by adding 400 µl of elution buffer (100 mM glycine, pH 2.0) and centrifuged at 100 g for 1 min. The eluates were immediately neutralized with 40 μl of neutralization buffer (1 M Tris-HCl, pH 9.0). The purified recombinant antibody was stored in LoBind protein tubes (Eppendorf, 0030 108.116) at 4°C until further processing for characterization.

For quantification, cell culture supernatants and purified samples containing human IgG were diluted in assay buffer (Roche, 11112589001) and the diluted samples were evaluated in duplicate in a 96 half-well plate (Corning, 3884). Briefly, 25 µl samples were incubated in the dark (20°C, 650 rpm) for 1 h with 5 µl 1200 Luminex-COOH beads loaded by amine coupling with goat anti-human IgG specific for the F(ab') ₂ fragment (Jackson ImmunoResearch, 109-006-09). Standard curves were generated using duplicate 25 μl serial 1:3 dilutions (0.08-60 ng/ml) of whole molecule human IgG ChromPure (Jackson ImmunoResearch, 009-000-003). Detection was performed by adding 30 μl of anti-human IgG, Fc-specific labeled R-PE (5 μg/ml; Jackson ImmunoResearch, 109-116-098), and incubated for an additional 1 hour. Plates were read and analyzed using a Luminex® 200 instrument (Millipore) using the following settings: 100 beads, sample volume 50 µl.

The quality control of the purified samples included analysis by SDS-PAGE and size exclusion chromatography (SEC) on HPLC. SDS-PAGE analysis was performed under reducing and non-reducing conditions on 12% and 8% polyacrylamide gels, respectively, following the protocol of Laemmli (Laemmli UK (1970) Nature, 227(5259): 680-5). Polyacrylamide gels were stained with Coomassie Brilliant Blue for visualization. SEC was performed using an Agilent Infinity 1260 system (Agilent Technologies) equipped with a two-component mixture pump, a degassing unit, an automatic sampling unit, and a UV diode array detector. A Zenix-C 300 column (particle size 3 µm, 4.5x300 mm, Sepax, 233300-4630) was used for separation. 3 μg of each sample was loaded into 100 mM phosphate buffer, pH 7.0 (supplemented with 150 mM NaCl) at 0.35 ml/minute for 15 minutes, and detection was performed at 220 nm.

- 157 040077

6.2.5. Characteristics of humanized variants

Binding properties of both humanized variants (Hum231#1: IGHV1-2*02 and IGK3-7*02;

Hum231#2: IGHV1-2*02 and IGK4-1*01) and chimeric parent antibody 231-32-15 were examined by several assays as described below.

6.2.5.1. Binding Quantification and Analysis with Suspension Matrix Technology

Purified material of both humanized variants and chimeric parent antibody 231-32-15 was diluted in assay buffer (Roche 11112589001) 1:10000 and 1:100000. Briefly, 25 μl of each dilution was incubated in the dark (20° C., 650 rpm) with 1500 Luminex® beads (in 5 μl assay buffer) for 1 hour in 96 half-well filter plates (Millipore, MABVN1250). Luminex® beads (Luminex Corp, # 5 LC10005-01 and # 14 LC10014-01) were coupled to anti-human IgG (F(ab) ₂ -specific, JIR, 105-006-097) or GITR antigen (R&D systems, disulfide- bound homodimer; 689-GR) via amine conjugation with COOH on the surface of the granules. Standard curves for IgG1 versions were generated using 25 µl of ChromPure whole molecule IgG (JIR, 009-000-003) in duplicate at 1:3 serial dilutions (0.08-540 ng/ml). For antibodies in IgG4 format, another standard curve, purified immunoglobulin (Sigma, 14639), was used. Detection was performed using 60 µl of goat anti-human IgG F(ab) ₂ labeled with R-PE (2.5 µg/ml; JIR 109-116-098, AbDSerotec Rapid RPE antibody conjugation kit, LNK022RPE), and 1 hour incubation time (20°C, 650 rpm). The plates were analyzed using the Luminex® 200 system (Millipore). The calculated number of beads per well was 100 in a 48 μl sample. Relative affinity was calculated relative to the CIF values for the chimeric parent antibody 231-32-15 (taken as 100% binding) and according to the IgG values present in the sample. Both humanized variants showed a relative affinity close to 100%.

6.2.5.2. Ligand blocking activity using suspension matrix technology

To determine if anti-GITR antibodies block ligand (GITRL) binding to GITR, a ranking was performed using suspension matrix technology. 1200 Luminex® beads in 5 μl assay buffer (Luminex Corp, #14 LC10014-01) were added to each well of 96-well half-well plates (Corning, Inc., 3884). The beads were coupled to the GITR antigen (R&D systems, disulfide-linked homodimer; 689-GR) via amine conjugation with COOH on the surface of the beads. The coupling reaction was performed using 50 μg/ml of GITR antigen and 1 x 10 ⁷ Luminex beads per ml. A standard NHS ester (Luminex Xmap cookbook, chapter 3) was used to form carbodiimide bonds between the primary amine groups of the antigen and the carboxyl groups on the surface of the bead.

Antigen-protein conjugation is a simple two-step procedure involving carbodiimide, during which the carboxyl groups on the microspheres are first activated with an EDA reagent (1-ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride) in the presence of sulfo-NHS (Nhydroxysulfosuccinimide) to form an intermediate product sulfo-NHS-ether. The reactive intermediate is then displaced by reaction with the primary amine of the target molecule (antibody, protein, or peptide) to form a covalent amide bond. Conjugated beads were incubated with various concentrations of anti-GITR antibodies (concentrations ranging from 9000 to 12 ng/ml in 25 μl of assay buffer per well) for 1 hour at 20° C. and 650 rpm. Thereafter, 30 µl of R-PE labeled GITR ligand (1 nM concentration; monomeric, R&D systems 694-GF/CF) was added to each well, resulting in a total well volume of 60 µl (1200 beads per well and a final concentration of 0.5 nM labeled GITRL). Ligand labeling was performed in the laboratory using R-PE labeling kits (AbDSerotec, LYNX Rapid RPE Antibody Conjugation Kit, LNK023RPE) according to the manufacturer's protocol. The plates were analyzed using the Luminex® 200 system (Millipore). The calculated number of pellets per well was 100 in a 50 µl sample. The ligand-blocking potential was calculated using the SIF values of the non-competitive signal (100% binding) containing only the ligand control. The detected PE signal indicated the binding of the ligand to the antigen.

The first assay examined anti-GITR antibodies, the chimeric parent 231-32-15 and m6C8 (WO 06/105021), as well as a control antibody recognizing IL-1b (SK48E26; International Publication No. WO 95/001997). The m6C8 antibody was an IgG1 antibody derived from the variable regions of the 6C8 antibody given in WO 06/105021 (incorporated herein by reference). The m6C8 heavy chain contains the amino acid sequence of SEQ ID NO: 585. The m6C8 light chain contains the amino acid sequence of SEQ ID NO: 586. The results of this analysis are shown in FIG. 5, which shows that at concentrations of the 6C8 antibody above 333 ng/ml, no PE signal was detected and therefore no binding of GITRL to GITR occurred. In contrast, the chimeric parent antibody 231-32-15 showed a PE signal at all concentrations tested, indicating that GITRL was able to bind to GITR when the chimeric parent antibody 231-32-15 was also bound to GITR.

The data shown in FIG. 5 obtained from four replicates of this assay conducted in two

- 158 040077 repetitions, and the standard deviation is calculated for n=8. The second assay investigated the binding

GITRL-PE with GITR in the presence of the chimeric parent anti-GITR antibody 231-32-15 and humanized variants of Hum231#1 and Hum231#2. Fig. 6 illustrates that binding of these three anti-GITR antibodies to GITR still allows binding of GITRL to GITR and all three antibodies show comparable ligand-blocking activity.

6.2.5.3. Kinetic analysis by surface plasma resonance

Surface plasmon resonance was used to determine the affinity of the humanized variants and the chimeric parent antibody 231-32-15 (BIAcore® T100/T200 High Sensitivity System (GE Healthcare) and Fab capture assay). All interactions were analyzed at 25°C using 1xDPBS (PAA, H15-002) plus P20 (0.05%, Pierce, 28320) as running buffer. Capture of anti-GITR antibodies (8 µg/mL in running buffer) was performed on the surface of a CM5 sensor chip (GE Healthcare, Series S CM5, BR-1005-30) with an immobilized anti-human anti-Fab antibody (GE Healthcare, Fab Capture Kit). , 28958325). To detect non-specific GITR antigen interactions, antibody capture was performed in flow cell 2 only, while only capture antibody was immobilized in flow cell 1. In addition, an unrelated antibody (anti-IL-1b; SK48E26; International Publication No. WO 95/001997) was used to evaluate the specificity of GITR binding. Following capture of anti-GITR antibodies, GITR antigen (R&D systems, disulfide-linked homodimer; 689-GR) was passed through both flow cells at different amounts (40, 10, and 2.5 nM) for each antibody. A background curve was also included in each experiment (running buffer only). Association was carried out for 90 s and dissociation for 600 s at a flow rate of 10 μl/min. After each experiment, a reduction step was performed with 10 mM glycine, pH 2.0 (GE Healthcare, BR-1003-55) for 60 s at 30 μl/min. Binding curves were evaluated using BIAcore® T200 software version 2.0.1 using a 1:1 Langmuir model with a global approximation of _Rmax .

From these values, the affinity value (Kd (M)) was calculated, and the values themselves are given in Table. 13 below. Humanized variants of Hum231#1 and Hum123#2 showed an improved association rate but a reduced dissociation rate, as reflected in Kd values of 0.7 and 0.6 nM, respectively. The chimeric parental antibody 231-32-15 had an affinity of 2 nM.

Table 13 Summary results for association and dissociation rates and calculated Kd (M)

anti-GITR antibody Cass (1/Ms) Kdiss (1/s) Kd(M) Chimeric parent 231-32-15 3.52E+05 7D2E-04 2.02E-09 Hum231#l 3.55E+06 2.49Е-03 7.02E-10 Hum231#2 2.83E+06 1.78E-03 6.29E-10

6.2.5.4. Ligand Blocking Analysis by Surface Plasmon Resonance

Both humanized variants, Hum231#1 and Hum231#2, were expected to exhibit the same ligand blocking kinetics as the chimeric parent antibody 231-32-15. This was confirmed by surface plasmon resonance ligand blocking analyte (BIAcore® T100/T200 high sensitivity system (GE Healthcare)).

In the first experiment, the binding of the GITR ligand to the immobilized GITR antigen was evaluated. The GITR antigen (R&D systems, disulfide-linked homodimer; 689-GR) was immobilized at high density (4371 EO) on a CM5 sensor chip (GE Healthcare, Series S CM5, BR-1005-30). Ovalbumin (1289 EO, Pierce ThermoFisher 77120) was immobilized in another flow cell for comparison. Immobilization was performed according to the manufacturer's (GE Healthcare) standard protocol for amine coupling (surface activation with 0.4 M EDA and 0.1 M NHS, GE Healthcare amine coupling kit, BR-1000-50). Unreacted groups were inactivated with 1M ethanolamine-HCl, pH 8.5. After that, two GITR ligands (monomer R&D, 694-GL and non-covalently bound homotrimer R&D, 6987) were passed through the surface of the chip in different amounts (500 nM, 250 nM and 125 nM) to determine saturation conditions. An association time of 240 s and a dissociation time of 300 s were used with a flow rate of 5 μl/min. Chip surface repair was performed using 10 mM glycine, pH 2.0 (GE Healthcare, BR-1003-55) for 60 s at 10 μl/min. The most favorable saturation conditions were achieved with the trimeric GITR ligand at 125 nM and therefore this scheme was used with the same amount of anti-GITR antibodies. In another experiment, a reverse design was used such that anti-GITR antibodies (125 nM) were first bound to the GITR antigen on the chip and then the GITR ligand (non-covalently bound trimer at 125 nM) was added.

As shown in FIG. 7, when the GITR antigen was immobilized on the chip and GITRL was added in the presence of anti-GITR antibodies, chimeric antibody 231-32-15, Hum231#1 and Hum231#2, GITRL binding was observed. In contrast, GITRL binding was not observed in the presence of the m6C8 anti-GITR antibody. These data indicate that the chimeric antibody 231-32-15, Hum231#1 and

Hum231#2 does not inhibit the binding of human GITR to GITRL.

6.3. Example 3: Performance Characteristics of Humanized Antibodies

This example demonstrates the ability of humanized anti-GITR antibodies prepared by the methods described above to function as GITR agonists. The Hum231#2 anti-GITR antibody contains a heavy chain containing the amino acid sequence of SEQ ID NO: 567 and a light chain containing the amino acid sequence of SEQ ID NO: 587. The Hum231#2 antibody is a human IgG1 antibody containing the T109S substitution (i.e. replacement of threonine with serine at position 109 compared to the wild-type Fc sequence) according to Kabat numbering in the light chain constant domain, which facilitates in-frame cloning of the variable region with the constant region. This mutation is a conservative modification that does not affect antibody binding or function. A wild-type analogue called Hum231#2w was also prepared which contains a threonine at position 109 according to Kabat numbering. The Hum231#2w antibody is a human IgG1 antibody containing the heavy chain of SEQ ID NO: 567 and the light chain of SEQ ID NO: 576.

These anti-GITR antibodies were also analyzed to determine their ability to co-stimulate primary human CD4+ or CD8+ T cells. This work, as described in sections 6.3.1 to 6.3.3 and 3.7 below, was performed with materials from multiple donors. The human leukocytes used in screening and testing of candidate antibodies were purchased from the New York Blood Center (New York City). The functional activity of anti-GITR antibodies has been demonstrated on enriched CD4 positive (or CD4+) T cells, CD8 positive (or CD8+) T cells and PBMCs. For human T cell proliferation studies, freshly prepared donor packed leukocytes were harvested and processed using sterile tissue culture techniques. Leukocytes were processed to harvest mononuclear immune cells (PBMCs) in a density gradient (lymphocyte separation medium, Corning). PBMCs are found in the buffy coat of the Ficoll density gradient.

Enriched CD4 cells were negatively selected from PBMCs using RosetteSep® human CD4+ T cell enrichment cocktail (Stemcell Technologies, Vancouver, BC Canada). Enriched preparations of CD4+ T cells were separated from red blood cells by density gradient centrifugation of lymphocyte separation medium (Corning). The collected cells were washed and aliquoted for storage in liquid nitrogen. To account for variability in donor response to stimulation, varying concentrations of anti-CD3 were used to adjust for donor-specific responsiveness. Therefore, before screening for anti-GITR antibodies, buffy coats were assessed for their ability to release cytokines and proliferate in response to CD3 stimulation with titrated levels of anti-CD3 (clone SP34; BD Pharmingen; concentration range 31.5 to 250 ng/mL) with or without standard anti-GITR chimeric parental antibody 23132-15 to establish a baseline for T cell proliferation and cytokine production and to determine the appropriate stimulation conditions for each donor buffy coat.

6.3.1. Effect of anti-GITR agonist antibodies on anti-CD3 stimulated CD4+ T cell proliferation

Anti-GITR antibodies were evaluated for agonistic activity by costimulation of CD4+ T cells. The agonist activity of the chimeric parent antibody 231-32-15 was compared to two humanized versions, Hum231#1 and Hum231#2. The costimulation assay was performed as follows: for plate-bound antibody stimulation conditions, anti-CD3 antibodies, anti-GITR antibodies and, where indicated, isotype controls were applied to flat-bottomed or round-bottomed sterile tissue culture plates for 2 h, and excess antibodies were removed by washing. In the case of stimulation conditions with soluble anti-CD3 antibody, the antibody was applied to the plate, while costimulation with anti-GITR antibodies was carried out in solution. Anti-GITR antibodies tested were Hum231#1 and Hum231#2, chimeric parent antibody 231-32-15 (or REF-231) or negative isotype controls (pAB1915). In addition, in the case of stimulation conditions with plate-bound and soluble anti-CD28 antibody (125 ng/ml; BD Pharmingen) and 10U IL-2 were also in solution. Cell proliferation was determined by monitoring the dissolution of the carboxyfluorescein succinimidyl ester (CFSE) dye in divided cells (Quah BJ et al. (2007) Nat Protoc, 2(9): 2049-56). Enriched CD4+ T cells were labeled with 1-2 μM CFSE. CFSE-labeled enriched CD4+ T cells were washed and then stimulated with plate-bound anti-CD3 (125 ng/mL), soluble anti-CD28 (125 ng/mL), and 10 U IL-2 along with 5 μg/mL or 10 μg/ml plate-bound anti-GITR antibody or no antibody. Cells were allowed to divide for 3-6 days in culture at 37° C. depending on the optimal activation of each donor cell when culture supernatants and cells were harvested from the plate.

Fig. 8A and 8B illustrate a typical FACS analysis of CD4+ T cell proliferation induced by costimulation with anti-GITR antibodies, performed in triplicate with buffy coat 6 and buffy coat 8, respectively. These figures show the number of cells (y-axis) and the level

- 160 040077 fluorescence (X-axis) emitted by CFSE-labeled CD4+ T cells. 10 μg/ml anti-GITR antibodies (chimeric parent 231-32-15 (REF 231-32-15), Hum231#1 and Hum231#2) were used. Increased proliferation of CD4+ T cells is displayed by an increased percentage of cells with reduced levels of fluorescence emitted by CFSE (low CFSE). Fig. 8A and 8B illustrate that anti-GITR antibodies (chimeric parent 231-32-15 (REF 231-32-15), Hum231#1 and Hum231#2) show agonist activity when added to cells activated with suboptimal concentrations of anti-CD3 antibody in the case of both high response cells (buffy coat 6, FIG. 8A) and low response cells (buffy coat 8; FIG. 8B).

In FIG. 9A and 9B are bar graphs from typical results from the above study for plate-bound anti-GITR antibodies (chimeric parent antibody 231-32-15, Hum231#1, Hum231#2, and m6C8) at 10 μg/mL. In the example illustrated in FIG. 9A, costimulation with Hum231#1 or Hum231#2 induced CD4+ T cell proliferation at 10 μg/ml. Approximately more than 50% of CD4+ T cells (cells with low CFSE) proliferated when co-stimulated with 10 μg/ml Hum231#1 or Hum231#2. In contrast, after anti-CD3/antiCD28 stimulation without anti-GITR antibody-mediated costimulation, only approximately 35% of CD4+ T cells (cells with low CFSE) proliferated. Fig. 9B illustrates that the addition of antiGITR costimulation to anti-CD3/anti-CD28-mediated stimulation also resulted in an increase in the absolute number of CD4+ T cells in culture after 5 days compared to anti-CD3/antiCD28 stimulation alone. For example, stimulation with anti-CD3/anti-CD28 in combination with 10 μg/ml of chimeric parental antibody 231-32-15 (REF 231) resulted in costimulation of GITR induced by an expansion in the number of CD4+ T cells from 7.5x104 to 12.0x104. In addition, Hum231#1-mediated costimulation at 10 μg/ml also induced expansion of CD4+ T cells from 7.5x104 to 11.5x104. At an antibody concentration of 10 μg/ml, Hum231#2 costimulation also induced CD4+ T cell proliferation from 7.5x104 to 10.6x104. It should be noted that costimulation of CD4+ T cells with 10 μg/ml m6C8 (International Publication No: WO 06/105021) did not lead to an additional increase in the absolute number of cells after 5 days of cultivation, exceeding that observed with stimulation with anti-CD3/anti-CD28 alone.

6.3.2. Effect of Agonistic Anti-GITR Antibodies on aHTu-CD3-Induced Cytokine Production by CD4+ T Cells

As additional evidence for the agonistic co-stimulatory activity of antiGITR antibodies, the level of cytokines (IFNy, IL-6, TNFa, and IL-10) released by CD4+ T cells was determined using a multiplex ELISA assay (Flowcytomix, FACS bead-based cytokine ELISA assay, eBioscience). Supernatants collected from the proliferation assay were used for cytokine assay. Fig. 1OA-1OD illustrate the effect of 10 μg/ml or 5 μg/ml chimeric parental 231-32-15, Hum231#1, or Hum231#2 anti-GITR antibodies on cytokine production by human CD4+ T cells. Addition of 10 μg/mL or 5 μg/mL of chimeric parent antibody 231-32-15, Hum231#1 or Hum231#2 to stimulated anti-CD3/anti-CD28 T cells significantly increased the production of IFN-a, TNFa, IL-10 and IL -6 vs. anti-CD3/anti-CD28 stimulation alone.

For anti-GITR agonist antibodies, no agonistic activity was observed in the absence of anti-CD3/anti-CD28 stimulation.

6.3.3. Titration of humanized clones 231-32-15

To evaluate the range of anti-GITR antibody concentrations that induce T cell proliferation and cytokine production, enriched CD4+ T cells were stimulated with 125 ng/mL anti-CD3/antiCD28 and costimulated with plate-titrated chimeric parent 231-32-15, Hum231# 1 or Hum231#2 anti-GITR antibodies. The results shown in FIG. 11 indicate that stimulation with chimeric parent 231-32-15, Hum231#1 and Hum231#2 at 10 μg/mL, 5 μg/mL, or 2.5 μg/mL induces T cell proliferation as measured by CFSE dilution. Furthermore, in the absence of any anti-CD3/anti-CD28 stimulation, anti-GITR antibodies did not stimulate CD4+ T cell proliferation. Fig. 12A illustrates that anti-CD3/anti-CD28 stimulation and costimulation with anti-GITR antibodies (chimeric parent 231-32-15, Hum231#1, or Hum231#2) over a specific concentration range (10, 5, or 2.5 μg/ml ) increased the production of CD4+ T-cells IFNy. Of note, in the absence of anti-CD3/anti-CD28 stimulation, anti-GITR antibodies (chimeric parent 231-32-15, Hum231#1 or Hum231#2) did not induce IFN-y production.

To further explore the functional activity of the chimeric parental 231-32-15, Hum231#1, or Hum231#2 anti-GITR antibodies in solution, enriched CD4+ T cells were stimulated with 125 ng/mL anti-CD3/anti-CD28 and co-stimulated with titrated soluble anti- GITR antibodies. Soluble Hum231#1 or Hum231#2 anti-GITR antibodies also co-stimulated CD4+ T cells to produce IFN-γ, as shown in FIG. 12V.

- 161 040077

6.3.4. Effect of an agonist anti-GITR antibody on aHTU-CD3-induced cytokine production in PBMC

In this example, cytokine production induced by costimulation with anti-GITR antibody Hum231#2 was examined using PBMC. PBMCs isolated using a ficoll gradient from buffy coats from healthy donors (Research Blood Components, LLC) were stored in liquid nitrogen and thawed on the day of the experiment. Cells were resuspended in cell culture medium (RPMI + 10% FBS + 20 U/mL IL-2) and added to 96-well culture plates containing plate-bound anti-CD3 antibody at various suboptimal concentrations (0.3-5 μg /ml) and 5 μg/ml plate-bound anti-GITR antibody or IgG1 isotype control antibody. Samples were incubated for 4 days at 37°C and 5% CO ₂ and cell culture supernatants were collected on day 2 and day 4. To measure the levels of secreted cytokines (IFNy, IL-2, TNFa, IL-10, IL-13, and IL-4), samples were examined using the V-PLEX Proinflammatory Panel1 (Human) Kit (Meso Scale Discovery), according to with manufacturer's instructions. As illustrated in FIG. 13, costimulation with plate-bound anti-GITR antibody Hum231#2 induced secretion of different cytokines in PBMCs from two different donors.

6.3.5. Effect of Agonistic Anti-GITR Antibodies on Cytokine Production Evaluated by Intracellular Cytokine Staining

The agonistic effect of Hum231#2 on cytokine production was further analyzed by intracellular cytokine staining. PBMCs isolated using a ficoll gradient from buffy coats from healthy donors (Research Blood Components, LLC) were stored in liquid nitrogen and thawed on the day of the experiment. Cells were resuspended in cell culture medium (RPMI + 10% FBS + 20 U/mL IL-2) and added to 96-well culture plates containing plate-bound anti-CD3 antibody at various suboptimal concentrations (0.3-5 μg /ml) and 5 μg/ml plate-bound anti-GITR antibody or IgG1 isotype control antibody. Samples were incubated for 3-4 days at 37°C and 5% CO ₂ . After activation to inhibit intracellular protein transport, cells were treated with brefeldin A (BD Biosciences) according to manufacturer's instructions and samples were incubated for 6 h at 37° C. and 5% CO ₂ . After incubation, cells were stained with amine-active FITC dye (Life technologies) to stain dead cells. After washing with chilled FACS buffer (1xPBS+2% FBS, pH 7.2), an antibody cocktail containing antibodies against CD3 (APC Cy7, SP34.2), CD4 (PercP Cy5.5, L200) and CD8a (PE Cy7, SK1 ) diluted in chilled FACS buffer was added to each sample and incubated for 10 min at 4°C. Cells were fixed and permeabilized with Cytofix-Cytoperm (BD Biosciences) for intracellular staining according to the manufacturer's instructions. PBMCs were stained with antibodies against IFNy (Alexa647, B27) and TNFa (PE, Mab11) and incubated at room temperature for 10 min. Samples were washed using 1x Perm wash buffer (BD Biosciences) and detected using a FACScanto flow cytometer (BD Biosciences). Flow cytometry data were analyzed using Flojo software. Flow cytometry data and plots are representative of PBMC experiments from six different donors.

The anti-GITR antibody Hum231#2 exhibited co-stimulatory activity on human T cells, inducing IFN-a+ monofunctional T cells, TNFa+ mono-functional T cells, and IFN-a+ TNFa+ polyfunctional T cells in a range of suboptimal anti-CD3 antibody concentrations (Figures 14A and 14B). ). Further, Hum231#2w, which is a human IgG1 antibody, was converted into a human IgG4 antibody named pab1989. The pab1989 antibody has the same heavy chain variable region and the same light chain as Hum231#2w, but contains the human IgG4 constant region. The pab1989 antibody contains the heavy chain sequence of SEQ ID NO: 554 and the light chain sequence of SEQ ID NO: 576.

The IgG4 antibody pab1989 was tested in parallel with the IgG1 antibody Hum231#2w in the intracellular cytokine staining experiment described above. The anti-CD3 antibody was used at 0.7, 0.8 and 0.9 µg/ml and the anti-GITR antibody at 5 µg/ml. Samples were incubated for 3-4 days at 37°C and 5% CO2. As shown in FIG. 14C, pab1989 showed the same agonist activity as Hum231#2w, inducing IFNy+ TNFa+ polyfunctional CD4+ T cells and TNFa+ monofunctional CD4+ T cells. Graphs are representative of PBMC experiments from four different donors.

6.3.6. Effect of cross-linking on the agonist activity of an anti-GITR antibody

The effect of cross-linking on the functional activity of the anti-GITR antibody Hum231#2 was investigated using stimulated anti-CD3 PBMCs. Plate-bound or soluble Hum231#2 was tested for induction of IFNy+ TNFa+ polyfunctional T cells in a CD3 suboptimal stimulation assay, as described in section 6.3.5. As shown in FIG. 15A, only plate-bound but insoluble Hum231#2 increased the percentage of IFNy+ TNFa+ polyfunctional CD8+ T cells compared to isotype control.

- 162 040077

The PBMC cytokine secretion assay described in section 6.3.4 was repeated for plate bound Hum231#2 or Hum231#2 crosslinked with anti-Fc antibody. The culture supernatant was collected on day 4 to measure the level of secreted cytokines (IFNy, IL-2, TNFa, IL-10, IL13 and IL-4). Costimulation with plate-bound (FIG. 15B) or anti-Fc cross-linked (FIG. 15C) Hum231#2 induced cytokine secretion.

6.3.7. Effect of humanized clones 231-32-15 on buffy coat 8 (BC8) and measurement of effector T cells or regulatory T cells

In this example, the effect of anti-GITR agonist antibodies on CD4+ effector T cells or CD4+ regulatory T cells was determined by their proliferation. Enriched CD4+ T cells were labeled with CFSE and stimulated with 125 ng/ml plate-bound anti-CD3 antibody. Proliferation of enriched CD4+ T cells was monitored by dilution with CFSE after 5 days of culture.

The CD4+ effector or regulatory T cell population in the CD4+ enriched T cell population shown in Figures 16A and 16B was determined by flow cytometry using staining for cell surface markers. Activated CD4+ effector cells were defined as CD25+, CD45RA-, CDH? ⁰³ ^™ and Foxp3 ^Negative/Low . CD4+ regulatory T cells were defined as CD4+, CD25+, CD45RA-, CD127 ^Low and Foxp3 ^High . FACS staining was carried out in accordance with the table. 14.

Table 14

FACS stain panel

Channel Laser Standard fluorochrome Antigen/fluorochrome 1 Blue 488 nm FITC, AF488, ZFB CFSE 2 Blue 488 nm RE CD 127 6 Blue 488 nm Re-Su7 CD45RA 7 Red 633 nm ARS GITR ARS 9 Red 633 nm ARS-Su-7, ARS-N7 CD25-APC-H7 10 Violet 405 nm DAPI, Ras Blue, V450 FoxP3 e450 eleven Violet 405 nm AF430, AmCyan, V500 L/D

The results of the stimulation analysis are shown in the FACS plots in FIG. 16A and 16B. Gating on CD4+ Treg (CD4+, CD25+, CD45RA-, CD127 ^Low and Foxp3 ^High ) or activated CD4+ effector cells (CD25+, CD45RA-, CD127 ^Medium/Low and Foxp3 ^Negative / ^Low ) indicates that stimulation with a single 125 ng/ml antiCD3/ anti-CD28 and, in combination with anti-GITR costimulation, increases GITR expression on both effector T cells and regulatory T cells.

Fig. 16A illustrates FACS analysis for effector T cells and regulatory T cells. Both cell types expressed GITR on their surface after stimulation with anti-CD3 alone or in combination with anti-GITR antibodies. At the same time, costimulation with anti-GITR antibodies led to a preferential expansion of effector T cells over regulatory T cells, which led to an increase in the Teff/Treg ratio (Fig. 16B).

As additional evidence for the agonistic effect of anti-GITR antibodies on T cells in the context of cellular immunity, T cell responses after PBMC stimulation were evaluated.

PBMC stimulation was titrated by adjusting for anti-CD3-induced proliferation against PBMC. In FIG. 17A and 17B illustrate CFSE-labeled PBMCs stimulated with 31.25 ng/mL plate-bound anti-CD3/anti-CD28 in combination with plate-bound anti-GITR antibodies or isotype control. As a positive control for anti-GITR antibody activity, the same stimulation conditions were used to stimulate enriched CD4+ T cells (data not shown).

CD4+ or CD8+ T cells in the PBMC population were identified by anti-CD3 and anti-CD4 or anti-CD3 and anti-CD8 staining. FloJo (Tree Star, Inc.) analysis of derived FACS samples gated on CD4+CD3+ T cells or CD8+CD3+ T cells showed that the anti-GITR chimeric parent antibody 231-32-15 (REF 231) and the Hum231 antibody #1 and Hum231#2 stimulated T cell proliferation (% low CFSE). In particular, the experiment illustrated in Fig. 17B revealed that the anti-GITR chimeric parental antibody 231-32-15 (REF 231) and antibodies Hum231#1 and Hum231#2 had an effect on CD8+ T cells.

6.3.8. Effect of agonistic anti-GITR antibodies on the reporter cell line GITR NF-kD-luciferase

A human GITR NF-kB luciferase (Promega) reporter cell line was constructed to investigate the co-stimulatory activity of anti-GITR agonist antibodies. Activation of GITR by an anti-GITR agonist antibody or GITR ligand has been reported to activate NF-κB (Snell LM et al. (2010) J Immunol 185: 7223-7234; Bulliard Y et al. (2013) J Exp Med 210: 1685-1693 ; YuKY et al.

- 163 040077 (2003) Biochem Biophys Res Commun 310: 433-438). Therefore, Jurkat cells were genetically modified to stably express the GloResponse NF-kB-1uc2P construct and human GITR. Reporter cells were resuspended in assay medium (RPMI + 1% PBS) and incubated with various concentrations (12.5, 10, 5, 2.5, 1.25, and 0.625 µg/mL) of anti-GITR antibody Hum231#2w plate bound , m6C8, or isotype control IgG1 in the absence or presence of 0.3 μg/ml plate-bound anti-CD3 antibody (clone SP34). Plates that were incubated with anti-CD3 antibody were read after 6 or 18 hours of incubation. Plates without anti-CD3 antibodies were read after 2, 5, 6, 8 or 18 hours of incubation. After incubation, the plates were equilibrated at room temperature and then an equivalent volume of Bio-Glo reagent (Promega) was added at room temperature. Luminescence was read using an EnVision 2100 multilabel reader. In the case of an anti-CD3 antibody assay, luciferase ECE was plotted for each antibody concentration tested 18 hours after stimulation (FIG. 18A). Similarly, in the case of the assay without anti-CD3 antibody in FIG. 18B is a graph illustrating relative light units (RFU) for luciferase 5 hours post-stimulation for various antibody concentrations tested. In FIG. 18C shows the highest ratios of luciferase expression (GITR Ab/isotype control) without anti-CD3 antibody for several antibody concentrations tested at 0, 2, 5, 6, 8, and 18 hours post-stimulation. Data shown are representative of four experiments with anti-CD3 antibody and two experiments without anti-CD3 antibody.

In the presence of anti-CD3 antibodies, although m6C8 showed greater agonistic activity at 6 h (data not shown), 18 h after stimulation with Hum231#2w and m6C8 induced the same activation of the GITR reporter cell line (FIG. 18A). However, in the absence of anti-CD3 antibody, only Hum231#2w, but not m6C8, induced activation of the GITR reporter cell line (FIG. 18B).

6.3.9. Effect of an agonistic anti-GITR antibody on the reporter cell line Fc gamma receptor IIIA (CD16)

In this example, the expression of human GITR by activated nTreg cells and effector T cells was examined. PBMCs obtained from healthy donors were enriched in CD3+ T cells (Teff) or CD4+CD25+CD45RA+ T cells (nTreg) using magnetic field separation. The T lymphocytes were then activated with CD3-CD28 expansion beads with 500 U g-IL-2 for 4 days and 50 U g-IL-2 for an additional 5 days. GITR receptors were quantified by flow cytometry with gating for CD4+ and CD8+ Teff against nTreg. Simultaneously, an experiment was performed with Quantibrite beads (BD Biosciences), which were used to evaluate the surface density of GITR receptors.

As shown in FIG. 19A, surface expression of human GITR on activated nTreg cells at day 9 (and at all time points assessed) was higher than on activated CD4+ or CD8+ effector T cells. Next, the ability of the anti-GITR antibody Hum231#2w to co-engineer GITR and Fc-gamma receptor signaling was evaluated using a reporter cell line expressing the Fc-gamma receptor IIIA (CD16) together with activated effector T cells (Teff) or cells nTreg obtained as described. Expanded Teff or nTreg cells were incubated with different doses of Hum231#2w or isotype control IgG1. Jurkat NFAT-luciferase reporter cells overexpressing CD16 (158 V/V polymorphism) were added to the samples. Binding of the antibody/antigen complex, when the antigen is located on the cell surface, to CD16 signals the promoter/reporter construct and results in transcription of the luciferase gene. The plates were incubated for 20 h at 37°C and 5% CO ₂ . After incubation, the Bio-Glo Luciferase Assay Reagent (Promega) was thawed at room temperature and 75 µl was added to each well of 96-well white assay plates. The luminescence was measured for 5–10 min. Background luminescence was subtracted from the readings for each sample and the corrected relative light units (RFU) were recorded. A OSE represents OCE anti-GITR antibodies minus isotype control data.

Consistent with the different surface expression of GITR for activated nTreg and activated CD4+ or CD8+ effector T cells (FIG. 19A), the anti-GITR antibody Hum231#2w preferentially activates CD16 when bound to activated nTreg cells (FIG. 19B).

To assess whether GITR overexpression was a hallmark of regulatory T cells found in the tumor microenvironment, GITR expression was compared on T cells derived from healthy human donors (Fig. 19C, a-c, n=3) or from tumor tissues from patients with non-small cell lung cancer (NSCLC) (Fig. 19C, d-f, n=3). To exclude background binding of antibodies to immune cell populations, all cells were incubated with purified anti-CD16/32 antibody (10 μg/ml, 20 min at room temperature) before cell surface and intracellular antibodies were added. After FcR blockade, all samples were incubated with APC-conjugated anti-GITR antibody (clone 110416, R&D systems) or an isotype control and a cocktail of cell surface antibody lineages (CD3-FITC, CD25-PECy7, CD4-BV650 and CD8a-PE) for 45 min on ice (1 μg/ml each), washed three times with FACS buffer (PBS, EDTA and 0.5% BSA), after

- 164 040077 which were fixed/permeabilized and incubated with Pacific Blue-conjugated FOXP3 (fix/perm and incubated every 45 min on ice, 1 μg/ml). The stained samples were then analyzed using an LSRFortessa flow cytometer (BD Biosciences). The cell populations in Fig. 19C were defined as follows: Tconv (CD3+, CD4+, CD8a-, CD25hu3k, FOXP3-) or Treg (CD3+,

CD4+, CD8a-, CD25 high, FOXP3+).

As shown in FIG. 19C, GITR surface expression was highest on regulatory T cells isolated from tumor tissues of NSCLC patients, and was low or undetectable on Treg cells or traditional T cells from healthy donors.

6.3.10. Effect of an agonist anti-GITR antibody on cytokine production by African green monkey T cells

To investigate cross-species cross-reactivity, Hum231#2 was evaluated for binding to GITR from the African green monkey (AZM). Briefly, AZM PBMCs (Worldwide Primates) were thawed and counted. PBMCs were resuspended in cell culture medium (RPMI + 10% PBS) and stimulated with anti-CD3 antibody (clone SP34.2, BD) or ConA (Sigma) plus IL2 (20 U/ml) for 3 days at 37°C and 5 % CO ₂ . After activation, cells were stained with amine-active FITC (Life technologies) for 15 min at room temperature. Cells were washed with chilled FACS buffer (1X PBS + 2% FBS, pH 7.2), an antibody cocktail diluted in chilled FACS buffer containing antibodies against CD3 (APC Cy7, SP34.2), CD4 (PercP, L200) was added , CD8 (PE Cy7, SK1) and PD-1 (PE, EH12.2H7), and incubated for 10 min at 4°C. Cells were washed and incubated with 2.5 μg per well of Hum231#2 or isotype control IgG1 for 10 min at 4°C. Cells were washed and then stained with a secondary anti-Fc F(ab') ₂ antibody conjugated to Alexa647 for 10 min at 4°C. Cells were washed and fixed with 1.6% paraformaldehyde prior to analysis on a FACSCanto flow pytometer (BD Biosciences). FACS data were analyzed using FACS DIVA software.

As shown in FIG. 20A, the anti-GITR antibody Hum231#2 binds to activated CD4+ and CD8+ AZM T cells. Unstimulated T cells from AZM do not express baseline levels of GITR, and cell surface GITR levels rise after T cell activation. The graphs shown in Fig. 20A are representative of experiments with PBMCs from three different AZMs.

Next, a CD3 substimulation assay was performed with African green monkey (AGM) PBMC to investigate the agonistic activity of Hum231#2w. Human PBMCs (Research Blood Components, LLC) or AZM (Worldwide Primates) were obtained from healthy donors using a ficoll gradient and stored in liquid nitrogen and thawed on the day of the experiment. Cells were resuspended in cell culture medium (RPMI + 10% FBS + 20 U/mL IL-2) and added to 96-well culture plates that contained plate-bound anti-CD3 antibody (0.8 μg/mL) and various concentrations (2, 4, 5, 6, and 9 µg/mL) plate-bound anti-GITR antibody or IgG1 isotype control antibody. Samples were incubated for 4 days at 37°C and 5% CO2. After activation to inhibit intracellular protein transport, cells were treated with brefeldin A (BD Biosciences) according to manufacturer's instructions and samples were incubated for 6 h at 37°C and 5% CO2. After incubation, cells were stained with amine-active FITC dye (Life technologies) to stain dead cells. After washing with cold FACS buffer (1xPBS + 2% FBS, pH 7.2), an antibody cocktail containing antibodies against CD3 (APC Cy7, SP34.2), CD4 (PercP Cy5.5, L200) and CD8a (PE Cy7, SK1 ) diluted in chilled FACS buffer was added to each sample and incubated for 10 min at 4°C. Cells were fixed and permeabilized with Cytofix-Cytoperm (BD Biosciences) for intracellular staining according to the manufacturer's instructions. PBMCs were stained with antibodies against IFNy (Alexa647, B27) and TNFa (PE, Mab11, for human PBMCs only) and incubated at room temperature for 10 min. Samples were washed using 1x Perm wash buffer (BD Biosciences) and detected using a FACScanto flow cytometer (BD Biosciences). Flow cytometry data were analyzed using Flojo software.

As shown in FIG. 20B and 20C, costimulation with anti-GITR antibody Hum231#2w induces production of IFNy by CD8+ ASM T cells. The flow cytometry data and plots are representative of experiments with PBMCs from two AZMs.

6.3.11. Effect of Co-Binding of Recombinant Human GITR Ligand and Humanized Clones 231-32-15 on Anti-CD3 Stimulated CD4+ T Cells

An anti-GITR agonist antibody that does not prevent GITR from binding to the GITR ligand (GITRL) can lead to an enhanced immune response characterized by increased proliferation and/or effector function of effector T cells and/or decreased suppressive function of regulatory T cells. Anti-GITR antibodies, either alone or in combination with recombinant human GITRL, are being investigated for agonistic effects on CD4+ T cells. Enriched CD4+ T cells are labeled with 1-2 µM CFSE, washed, and then stimulated with plate-bound anti-CD3 (125 ng/mL), soluble anti-CD28 (125 ng/mL), and 10 U IL-2 along with 10 µg /ml chimeric parent

- 165 040077 antibody 231-32-15, 10 µg/ml Hum231#1, 10 µg/ml Hum231#2, 10 µg/ml GITRL, combination of 10 µg/ml chimeric parent antibody 231-32-15 with 10 µg/ ml GITRL, a combination of 10 µg/ml Hum231#1 with 10 µg/ml GITRL, or a combination of 10 µg/ml Hum231#2 with 10 µg/ml GITRL at 37°C for 3-6 days. The culture supernatants and cells are then harvested from the plates. Cell proliferation and cytokine release are examined as described in sections 6.3.1 and 6.3.2, respectively. The effect of co-binding of anti-GITR antibodies and GITRL on CD4+ effector T cells or CD4+ regulatory T cells can be further investigated as described in section 6.3.7. This study may demonstrate a synergistic or additive effect of GITRL and anti-GITR antibodies (chimeric parent 231-32-15, Hum231#1 and Hum231#2) in enhancing immune responses.

As an alternative to using soluble recombinant human GITRL to test co-agonist activity in combination with the anti-GITR antibodies described herein, antigen-presenting cells that are induced to express GITRL can be used. Such induced APCs can be cultured with CD4+ effector T cells or CD4+ regulatory T cells as described above, in the presence or absence of anti-GITR antibodies, and evaluate T cell function. To induce GITRL expression, antigen-presenting cells, such as macrophages or dendritic cells, are incubated with a TLR4 ligand (eg, LPS) for 1, 2, 4, 6, or 12 hours, as described, for example, in Tone M et al. (2003) PNAS 100: 1505915064; or with whole P-glycan particles (WGP) isolated from the cell wall of Saccharomyces cerevisiae for 6, 12, 24, 48, or 72 hours, as described, for example, in Tian J et al. (2012) PLoS One, 7(10): e46936.

6.3.12. Effect of an agonistic anti-GITR antibody on surface expression of OX40 and PD-1 on T cells

In this example, an anti-GITR agonist antibody was evaluated for its effect on surface expression of OX40 and PD-1 on T cells. PBMCs obtained with a ficoll gradient from buffy coats from healthy donors (Research Blood Components, LLC) and stored in liquid nitrogen and thawed on the day of the experiment. Cells were resuspended in cell culture medium (RPMI + 10% FBS + 20 U/ml IL-2) and added to 96-well culture plates containing plate-bound anti-CD3 antibody (clone SP34) at various suboptimal concentrations (0. 0.7, 0.8, and 0.9 µg/mL) and 5 µg/mL plate-bound Hum231#2 anti-GITR antibody or IgG1 isotype control antibody. Samples were incubated for 4 days at 37°C and 5% CO ₂ . After incubation, cells were stained with amine-active FITC dye (Life technologies) to stain dead cells. After washing with chilled FACS buffer (1xPBS + 2% FBS, pH 7.2), anti-OX40 antibody was added and incubated for 10 min at 4°C. Cells were washed, anti-human Fc F(ab') ₂ Alexa647 was added and incubated for 10 min at 4°C. After a centrifugation and washing step, an antibody cocktail containing antibodies against CD3 (APC Cy7, SP34.2), CD4 (PercP Cy5.5, L200), CD8a (PE Cy7, SK1) and PD-1 (PE, EH12.2H7) , diluted in chilled FACS buffer, was added to each sample and incubated for 10 min at 4°C. Samples were washed and resuspended in 200 µl 1.6% paraformaldehyde prior to analysis on a FACSCanto flow cytometer (BD Biosciences). FACS data was analyzed using Flojo software. The flow cytometry data and plots are representative of experiments with MCGI from a single donor.

As shown in FIG. 21, costimulation with anti-GITR antibody Hum231#2 increases surface expression of OX40 and PD-1 on human CD4+ and CD8+ T cells.

6.4. Example 4: modification of a humanized variant at the germline level

This example describes the production of humanized germline variants.

6.4.1. Library Design

A library approach was used to generate humanized human germline enriched variants by introducing site-directed mutations via degenerate codons in the heavy and light chain variable regions. The variable region of the VH chain was mutated by substituting 17 amino acid positions with 2-4 amino acids, resulting in a final variability of 1.3E+06. The light chain variable region was mutated at 9 amino acid positions (2-3 amino acids per position), resulting in a final variability of 7.7E+02. The various frame positions and CDRs included in the library are shown in FIG. 22. Libraries were generated using human germline IGHV1-2*02 VH (FIG. 22A) and human germline IGKV4-1*01 VL (FIG. 22B).

6.4.2. Creating a Library

The mutated humanized variable regions were cloned into retroviral expression vectors (rCMA). These constructs were then used to transduce preB cells and express antibodies on the surface using Retrocyte Display® technology. The retroviral expression vector contained MSCV-based 5' and 3' LTR, an immunoglobulin constant region (IGHG1 or IGKC) containing a portion of the membrane anchor (IGHG1), and a CD4 surface marker gene. Surface

- 166 040077 the marker and the immunoglobulin are coupled via IRES (internal ribosome entry site). The term variable region in this example means rearranged VDJ genes in the case of a heavy chain and rearranged VJ genes in the case of light chains.

6.4.2.1. Creation of the Humanized Heavy Chain Library

The synthesized humanized heavy chain variable regions (Eurofins MWG GmbH) were cloned into a retroviral expression vector containing an immunoglobulin constant region (IGHG1) containing a portion of the membrane anchor. Cleavage and ligation were performed in one step and in one tube using the restriction enzyme type IIS LguI and T4-DNA ligase at 37°C for 1 h. vector rSMA (1 μg) with a vector-insert ratio of 1:3. The ligation reaction was then precipitated and concentrated (8.3-fold) to a final DNA concentration of 94 ng/µl. The entire (3x4 μl) concentrated ligation reaction was electroporated into 80 μl of DH10B cells (E. coli ElectroMax DH10B electrocompetent cells, Invitrogen, Cat. No. 12033015) (1900 V/5 ms). 1000 µl of SOC medium (Invitrogen, Cat. No. 15544-034) was added and transformed DH10B cells were reconstituted at 37° C. for 1 hour. A 1:1000 dilution was made to determine library complexity. Complete transformation reactions were plated on LB-agar plates +100 μg/ml ampicillin and incubated overnight at 37°C. The determined complexity of the humanized VH chain library was 7.3E+07 and therefore the variability of the entire library was restored.

All electroporated bacteria were scraped off the plates and 2 glycerol stock solutions were prepared for long term storage at -80°C. Large-scale production of DNA plasmids was carried out (Macherey & Nagel, NucleoBond Xtra Maxi Plus Kit). Cleavage to confirm the presence and correct size of the cloned humanized VH chain library material insert was performed with HindIII/Eco47III (H/E). KpnI/BsrGI (K/B) splitting was used to validate the vector backbone. As a control, the library plasmid DNA of the humanized VH chain was also digested with LguI to confirm the amount of the vector without humanized VH chain inserts, and the integrity of the vector was examined by uncut plasmid DNA separation.

96 individual clones were obtained and sent for sequencing to determine the final library variability of 89-AL (sequence: 5' gcctccgcctcctcttcctccatcc 3'; SEQ ID NO: 707). No excess sequences were found during quality control. The theoretical variability is 1.3E+06 different variants, so each unique sequence overlaps about 50 times. 35% of the library clones had the required combination of mutations (=2.5E+07), and the library contained all the required variants.

6.4.2.2. Creation of the Humanized Light Chain Library

The synthesized humanized light chain variable regions (Eurofins MWG GmbH) were cloned into a retroviral expression vector containing an immunoglobulin constant region (IGKC). Cleavage and ligation was performed as described in section 6.4.2.1. The synthesized humanized light chain library material (227.9 ng) was ligated in frame into the pCMA retroviral expression vector (0.5 μg) at a vector-insert ratio of 1:10. The ligation reaction was then precipitated and concentrated 3.6-fold to a final DNA concentration of 52 ng/µl.

Transformation was performed as described in section 6.4.2.1 above. 2x4 µl of the concentrated ligation reaction was electroporated into 80 µl of DH10B cells (E. coli ElectroMax DH10B electrocompetent cells, Invitrogen, Cat. No. 12033-015) (1900 V/5 ms). The determined library complexity of the humanized VL chain was 4.6E+07 and therefore the variability of the entire library was restored. Preparation of library plasmid DNA and confirmation of plasmid DNA were performed as described in section 6.4.2.1. Only one redundant sequence was found during quality control. The theoretical variability is 7.7E+02 different variants, so each unique sequence overlaps about 60,000 times. 65% of the library clones had the required combination of mutations, and the library contained all the required variants.

6.4.3. Recovery of germline-modified heavy and light chains from pre-selected preB cell clones

The humanized library material prepared as described above (sections 6.4.2.1 and 6.4.2.2) was used in the Retrocyte Display® affinity maturation study to detect antibodies with high germline gene content and improved biological and biochemical properties. Heavy and light chains were reconstituted from two 96-well plates containing 80 and 96 pre-selected preB cell clones. Cells were lysed (Phusion Human Sample Direct PCR Kit, Thermo Scientific/Finnzymes Cat. No. F-150) and variable regions were amplified directly by PCR (see Table 15). PCR was performed with a specific 5' forward and 3' reverse primer (see Table 16). 2 µl of preB cell lysate was used as a template for PCR. The amplified variable regions were purified (NucleoFast 96 PCR (Macherey Nagel)) and cloned into CHO expression vectors (pPEP) containing the immunoglobulin constant region (IGHG1, IGKC).

Table 15 _____________________PCR programs .__________________

1. Initial denaturation 98°С 5 minutes 34 cycles 2. Denaturation 98°С 1 s 3. Annealing/Elongation 72°C 15 s 11. End elongation 72°С 1 min 12. Cooling 10°С Stabilization Total number of cycles 35

Table 16

Primers for amplification of variable regions of heavy and light kappa chain

Forward PCR primers (5') Name Subsequence SEQID NO: 5'hum231-32-15 Vh Lgui (1192-Je) 5' tctgctcttctaccatggattggacttggcgcattctgttc 3' 708 5' hum231-32-15 Vk Lgui (1193-Je) 5' cttgctcttctatggtgttacagactcaggtgttc 3' 709 Reverse PCR primers (3') 3'H Lgui Cg (1060-Je) 5' tacgctcttcaagctgctggagggcacgg 3' 710 3' To LguI Ck (1065-Je) 5' cttgctcttcgctcagcgtcagggtgct 3' 711

In order to clone preselected germline-modified heavy and light chain variable regions, digestion and ligation were performed in one step and in one tube with restriction enzyme type IIS LguI and T4-DNA ligase at 37°C for 1 h with a final step at 80°C for 10 min, and pre-selected germline-modified heavy and light chain variable regions (~60 ng) were ligated in frame into pPEP expression vectors (50 μg). A vector-to-insert ratio of 1:12 was used.

µl of preselected germline modified heavy chain ligation reactions and 6 µl of preselected germline modified kappa light chain ligation reactions were co-transformed into chemically competent DH10B cells (30 µl) by heat shock transformation. 1000 µl of SOC medium (Invitrogen, Cat. No. 15544-034) was added and transformed DH10B cells were reconstituted at 37°C for 1 h. transformed E. coli cells overnight at 37°C. Small scale DNA plasmid preparation (Macherey & Nagel, NucleoSpin 96 Plasmid) was performed and digestion to confirm the presence and correct size of cloned variable regions was performed with HindIII/NotI (VH chain) and NcoI (VK chain). The integrity of the vector was examined by separation of uncut plasmid DNA. After that, DNA-plasmid preparations were used to transfect CHO cells, and expressed antibodies were analyzed using suspension matrix technology and Octet kinetic analysis. The antibody sequences were confirmed by PCR.

6.4.4. Selection of germline variants

Several hundred germline-modified antibodies were selected based on binding kinetics determined using Octet (Octet RED 96 system; ForteBio™ Inc., Menlo Park, CA). The experimental process was set up in accordance with the instructions for the instrument. Biotin-GITR was bound to the streptavidin biosensor (SA) and PBS (pH 7.4) was used as a blank control. Briefly, interaction analysis was performed at 30° C. in running buffer (PBS, 0.05% Tween, pH 7.4). The sensor tips were pre-wetted in running buffer for 10 minutes immediately prior to use, and microplates used in Octet were filled with 200 µl per well of sample or buffer and mixed at 800 rpm. Commercially available SA pre-coated tips were used in the experiments. Biotinylated GITR was loaded into ForteBio SA fibers in PBS, pH 7.4 for 10 min and washed for 4 min. For the association phase, prior to measurements, ligand-coated SA tips were immersed for 5 min in cell culture supernatant that had been diluted 1:10 in running buffer. The dissociation of the antibody-antigen complex was examined in wells containing only Octet buffer for 5 min. After each experiment, the tips were reconstituted with glycine (10 mM, pH 2.0). Affinity, K _acc and K _diss were determined using Octet v6.3 software using a 1:1 binding model with full local fit. In table. 17 lists the compositions of the heavy chain variable regions and the light chain variable regions of 56 selected germline-modified variants and

- 168 040077 their affinity values, Kacc and K _diss according to Octet data.

Table 17

Kinetic analysis of germline-modified variants

ID antibodies Heavy chain variable region (SEQ III NO:) Light chain variable region (SEQ III NO:) Affinity (M) Cass (1/Ms) Kdiss (1/s) 1 H1916A01 (215) K1916A01 (400) 7.44Е-10 4.68E+05 3.48E-04 2 H1916A03 (217) K1916A03 (401) 4.23E-09 5.53E+05 2.34Е-03 4 H1916A05 (219) K1916A05 (403) 1.43Е-09 3.51E+05 5.01Е-04 5 H1916A06 (220) K1916A06 (404) 1.63Е-09 5.91E+05 9.66Е-04 6 H1916A07 (221) K1916A07 (405) 2.70E-09 2D4E+05 5.79Е-04 9 H1916A10 (224) K1916A10 (408) 2.68Е-09 2.93E+05 7.84Е-04 10 H1916A11 (225) K1916A11 (409) 9D1E-10 6D5E+05 5.60E-04 eleven H1916A12 (226) K1916A12 (410) 2D0E-09 4.03E+05 8.47Е-04 15 H1916B05 (230) K1916V05 (415) 2.22E-09 2.78E+05 6D6E-04 16 H1916B06 (231) K1916V06 (416) 1.47Е-09 3.56E+05 5.23E-04 18 H1916B09 (233) K1916V09 (419) 3.77Е-09 2D9E+05 8.24Е-04 20 H1916V12 (236) K1916V12 (421) 1.35Е-09 2.83E+05 3.80E-04 21 H1916S03 (237) K1916S03 (423) 8.44Е-09 3.09E+05 2.61E-03 25 H1916S07 (241) K1916S07 (427) 1.69Е-09 3.74E+05 6.32E-04 29 H1916S11 (245) K1916S11 (431) 1.06E-09 2.95E+05 3.1 SE-04 31 H1916D01(247) K1916D01 (433) 4D8E-10 5.05E+05 2D1E-04 33 H1916D03(249) K1916D03 (435) 9.01Е-11 1D2E+07 1.01E-03 34 H1916D04 (250) K1916D04 (436) 4.58E-10 5.57E+05 2.55Е-04 35 H1916D05(251) K1916D05 (437) 1.87E-10 1.29E+06 2.40E-04 36 H1916D06(252) K1916D06 (438) 4.40E-10 6.38E+05 2.80E-04 37 H1916D07(253) K1916D07 (439) ZD7E-11 7.64E+06 2.42E-04 38 H1916D08(254) K1916D08 (440) 8.75E-11 8.57E+06 7.50E-04 39 H1916D09(255) K1916D09 (441) 2.55Е-10 3.91E+06 9.97Е-04 42 H1916E01 (259) K1916E01 (444) 3.77E-10 4D7E+05 1.57Е-04 43 H1916E03 (261) K1916E03 (445) 1.28E-09 3.73E+05 4.77Е-04 45 H1916E05 (263) K1916E05 (447) 5.62E-10 4.55E+05 2.55Е-04 46 H1916E06 (264) K1916E06 (448) 6D9E-10 4.00E+05 2.48Е-04 47 H1916E08 (265) K1916E08 (450) 2.06Е-09 3.91E+05 8.04Е-04 49 H1916E11 (268) K1916E11 (452) 2.09Е-09 3.38E+05 7.07Е-04 50 H1916F03(270) K1916F03 (454) 1.01Е-09 2.52E+05 2.54Е-04

- 169 040077

52 H1916F05(272) K1916F05 (456) 1.07Е-09 3.97E+05 4.26E-04 54 H1916F09(276) K1916F09 (458) 1.26E-09 5.48E+05 6.88Е-04 55 H1916F10(277) K1916F10 (459) 1.27Е-09 4.35E+05 5.50E-04 58 H1916G04(283) K1916G04 (462) 1.58Е-09 2.63E+05 4D5E-04 59 H1916G05(284) K1916G05 (463) 1.04Е-09 2.99E+05 ZD2E-04 61 H1917A02 (287) K1917A02 (467) 1.83Е-09 7.72E+05 1.41Е-03 68 H1917B01 (298) K1917V01 (474) 1.55Е-09 2.89E+05 4.47Е-04 70 H1917B04 (301) K1917V04 (476) 2.01Е-09 4.37E+05 8.79Е-04 71 H1917B07 (304) K1917V07 (477) 2.41Е-10 1.05E+06 2.52E-04 75 H1917S09 (313) K1917S09 (484) 2.92E-09 ZD7E+05 9.25Е-04 76 H1917S10 (314) K1917S10 (485) 2.72Е-09 3.86E+05 1.05Е-03 78 H1917D01(316) K1917D01 (488) 1.00Е-09 3.25E+05 3.27E-04 79 H1917D04 (319) K1917D04 (489) 2.87Е-09 4.50E+05 1.29Е-03 80 H1917D07(320) K1917D07 (490) 6.96E-10 6.52E+05 4.54Е-04 85 H1917E02 (327) K1917E02 (495) 1.28E-09 2.89E+05 3.70E-04 86 H1917E03 (328) K1917E03 (496) 7.50E-10 5.77E+05 4D2E-04 91 H1917F03(340) K1917F03(501) 3.07Е-09 5.20E+05 1.59Е-03 92 H1917F05(342) K1917F05 (502) 1.01Е-09 3.57E+05 3.61E-04 94 H1917G01(350) K1917G01(504) 1D8E-09 3.72E+05 4.40E-04 95 H1917G05(354) K1917G05(505) 2.21E-09 3.05E+05 6.72E-04 96 H1917G06(355) K1917G06(506) 1.09Е-09 3.44E+05 3.73E-04 97 H1917G07(356) K1917G07(507) 1.43Е-09 5.34E+05 7.61Е-04 101 H1917H01 (362) K1917H01 (511) 3.54Е-10 9.36E+05 ZD2E-04 102 H1917H02 (363) K1917H02 (512) 1.97Е-09 3.21E+05 6.32E-04 105 H1917H07 (366) K1917H07 (516) 1.38E-09 3.51E+05 4.86E-04 107 H1917H09 (368) K1917H09 (518) 2.21E-09 2.98E+05 6.57Е-04

A number of these antibodies were selected for further analysis based on additional Octet values and germline homology. Those antibodies that showed agonist properties in the T cell assay (data not shown) were examined in more detail as described below. Fig. 23 illustrates in detail the composition of the heavy and light chain variable regions of these germline-modified variants. Fig. 24A, 24B and 24C illustrate in detail the composition of the heavy and light chain regions of other selected actual or predicted germline modified variants.

6.4.5. Kinetic analysis of germline-modified variants

Anti-GITR germline antibody variants were quantitated and analyzed using suspension matrix technology as described in section 6.2.5.1. The average relative affinity of the germline variants compared to the chimeric parent antibody 231-32-15 is shown in FIG. 23.

In addition, using suspension matrix technology, ligand blocking was evaluated according to the method described in Example 6.2.5.2.

As seen in FIG. 25A and 25B, binding of GITRL-ΡΕ to GITR in the presence of a selection of variant germline antibodies has a very similar profile for the tested antibodies.

These variant germline antibodies were further tested in a functional assay as described in Example 5 below.

6.5. Example 5: functional activity of germline variants 6.5.1. Effect of germline variants on anti-SDR-stimulated CD4+ T cell proliferation and cytokine production

To evaluate the activity of novel germline variants as described in Example 4, these variants were compared with the humanized antibodies Hish231#1 and Hish231#2 and the chimeric parental antibody 231-32-15 on enriched CD4 T cells from four buffy coat preparations BC4, BC9 , BC 13 and BC 18. Suboptimal CD3 stimulation assay was performed as described in section 6.3.1 above, and intracellular cytokine staining (BC 13 and BC 18), cytokine release (BC4 and BC9), and CFSE dilution (BC4 and BC9) was determined 5 days after the stimulation assay. Plate-bound anti-POP and soluble anti-CO28 antibodies were used with plate-bound anti-GITR antibodies, no antibody (CD3 only) and isotype control (MSC8 antibody). Anti-GITR antibodies were used at a concentration of 10 μg/ml. In the case of buffy coats 4 and 9, anti-COP antibody was used at a concentration of 125 ng/ml, anti-CO28 antibody at a concentration of 125 ng/ml and 10 U of IL-2. In the case of buffy coat 13, the anti-POP antibody was used at a concentration of 500 ng/ml and the anti-CO28 antibody at a concentration of 100 ng/ml. In the case of buffy coat 18 anti

- 170040077

The CD3 antibody was used at a concentration of 31.25 ng/ml and the aHTu-CD28 antibody at a concentration of 100 ng/ml.

In the case of BC4 and BC9 buffy coat preparations, supernatants and cells were harvested from the plate after 5 days in culture. Cell proliferation was determined and shown as a percentage of CFSE low. (FIGS. 26A and 26B) and supernatants were used for cytokine analysis (IFNy and IL-10). Fig. 27A and 27B illustrate the release of cytokines for BC4, and FIG. 28A and 28B illustrate the release of cytokines for BC9.

In the case of BC13 and BC18 buffy coat preparations, after 5 days in culture, monensin (eBioscience) was added to all samples for 6 hours to allow intracellular retention of IFNy. Samples were then intracellularly stained for IFNu-PE (eBioscience) using the BD Cytofix/Cytoperm kit (BD Biosciences) followed by flow cytometry detection on BD FACSAria I (BD Biosciences) and analyzed using FlowJo software (Tree Star). The results of the effect of germline variants on the percentage of IFNy positive CD4 T cells from BC13 and BC18 are shown in FIG. 29A and 29B, respectively. After exposure to germline variants, chimeric parent antibody 231-32-15, or humanized variants Hum231#1 and Hum231#2, the percentage of IFNy positive CD4 T cells induced by these anti-GITR antibodies was comparable. However, as expected, there is little variation between donors.

6.5.2. Effect of germline variants on the reporter cell line GITR NF-kBluciferase

In this example, germline variants prepared as described in Example 4 were examined using the NF-kB-luciferase reporter cell line GITR (Promega) described in section 6.3.8.

The reporter cell line (Promega) was maintained in culture according to the manufacturer's instructions. On the day of the experiment, cells were resuspended in assay medium (RPMI + 1% PBS). Cells (100,000 cells/well) were added to a 96-well plate which contained plate-bound anti-CD3 antibody (clone SP34, 0.3 μg/mL) and various concentrations (12.5, 10, 5, 2.5, 1.25, 0.625, and 0 µg/mL) plate-bound anti-GITR antibodies. Reporter cells were incubated for 18 h at 37°C and 5% CO ₂ . After incubation, luciferase expression was determined using Bio-Glo (Promega) and an EnVision 2100 multilabel reader.

Anti-GITR antibodies tested in this assay were Hum231#2w and 20 germline variants: pab1964, pab1965, pab1966, pab1967, pab1968, pab1969, pab1970, pab1971, pab1972, pab1973, pab1975, pab1976, pab1978, pab1978 pab1983, pab2159, pab2160 and pab2161. As shown in FIG. 30A-C, all germline variants showed agonistic activity in the NF-KB-luciferase GITR reporter assay.

Germline variants were also tested for agonist activity in the absence of anti-CD3 antibody. On the day of the experiment, GITR NF-KB-luciferase (Promega) reporter cells were resuspended in assay medium (RPMI + 1% PBS). Cells (100,000 cells per well) were added to a 96-well plate which contained various concentrations (12.5, 10, 5, 2.5, 1.25 and 0.625 μg/ml) of plate-bound anti-GITR antibodies. Reporter cells were incubated for 6 h at 37°C and 5% CO ₂ . After incubation, luciferase expression was determined using Bio-Glo (Promega) and an EnVision 2100 multilabel reader.

The anti-GITR antibodies tested in this assay were m6C8, Hum231#2w and 20 germline variants: pab1964, pab1965, pab1966, pab1967, pab1968, pab1969, pab1970, pab1971, pab1972, pab1973, pab1975, pab1978, pab1978, pab1976 pab1981, pab1983, pab2159, pab2160 and pab2161. All germline variants induced dose-dependent reporter cell line activation in the absence of anti-CD3 antibody (Fig. 30D-F).

6.6. Example 6 Epitope Characterization of Anti-GITR Antibodies

To characterize an epitope on human GITR that recognizes the chimeric parent antibody 231-32-15 and humanized anti-GITR antibodies, additional studies were performed as described below.

6.6.1. Epitope Competition - Cell Binding Assay

To confirm that the humanized variant antibodies retain the epitope specificity of the parent 231-32-15 chimeric antibody, a cell binding assay was performed. 1624-5 pre-B cells expressing the chimeric parent antibody 231-32-15 were harvested and resuspended 1x106 cells in 200 µl of FACS buffer plus: i) biotinylated GITR (GITR-bio) (1:1000) which had been pre-incubated for 15 min with 2 µg of chimeric parent antibody 231-32-15; ii) GITR-bio (1:1000) which was pre-incubated for 15 min with 2 μg Hum231#1; iii) GITRbio (1:1000), and Hum231#2; or iv) GITR-bio (1:1000). Cells were incubated for 20 min at 4°C, then washed with 4 ml of FACS buffer and centrifuged for 5 min at 300g at 4°C. The cell pellet was resuspended in 200 μl of FACS buffer plus streptavidin-PE (1:1000) and then incubated and washed as before. The cells were then resuspended in 200 μl of FACS buffer for analysis with FACS-AriaII (BD Biosciences).

- 171 040077

Fig. 31 illustrates that the humanized variant antibodies retained the epitope specificity of the chimeric parent antibody 231-32-15. The right side shows GITRbio binding to 1624-5 pre-B cells expressing the chimeric parent antibody 231-32-15. However, when GITR-bio was pre-incubated with the chimeric parent antibody 231-32-15, Hum231#1 or Hum231#2 antibodies, reduced binding of GITR-bio to 1624-5 cells was observed (left side). The overlapping FACS profiles indicate that the humanized variants also exhibit similar binding properties to each other and to the chimeric parent antibody 231-32-15GITR.

6.6.2. Epitope Competition - Suspension Matrix Technology

Anti-GITR antibodies (25 µl) were diluted to 2 µg/ml in assay buffer (Roche 11112589001) and incubated with 1500 Luminex® beads (5 µl, Luminex Corp, without 5 LC10005-01) coupled to anti-human IgG (F(ab )2-specific, JIR, 105-006-097), overnight in 0.5 ml LoBind tubes (Eppendorf, 0030108.116) under shaking conditions in the dark. This mixture was then transferred to pre-wetted 96-well filter plates (Millipore, MABVN1250). The plates were washed twice with 200 μl/well PBS to remove unbound antibody. At the same time, 20 μg/ml of the same anti-GITR antibody, other anti-GITR antibody, or assay buffer was incubated with 20 μl (1 μg/ml) of R-PE labeled GITR antigen (R&D systems, disulfide-linked homodimer; 689- GR; intralab-labeled AbDSerotec LYNX Kit, LNK022RPE) for 1 h in the dark at 650 rpm. The mixture of beads and the mixture of antigen/antibody were mixed 1:1 (20 μl each) and incubated for an additional hour under shaking conditions (20°C, 650 rpm). Immediately prior to measurement, 40 μl of assay buffer was added to each well and analysis was performed using the Luminex® 200 system (Millipore) to obtain data from 100 beads in 48 μl of sample volume. Binding was determined using SIF values for the non-competitive control (100% binding, assay buffer only as competitor).

When the chimeric parent antibody 231-32-15 was used as the capture antibody, full competition for binding was observed with both humanized variants. When anti-GITR antibody m6C8 was used as the capture antibody, competition for binding with the chimeric parent antibody 231-32-15 or the two humanized variants was not observed (data not shown). These results indicate that m6C8 and the anti-GITR antibodies described herein recognize different epitopes on human GITR.

6.6.3. Epitope Competition - Surface Plasma Resonance

For epitope-specific sorting using surface plasmon resonance, a tandem approach was used (Abdiche YN et al. (2009) Analytical Biochemistry, 386: 172-180). To this end, different surfaces (GE Healthcare, Series S CM5, BR-100530) were generated on the CM5 sensor chip by immobilizing different densities of the GITR antigen (R&D systems, disulfide-linked homodimer; 689-GR). Flow cell 2 contained the GITR antigen at low density (667 EU), medium density was recorded in flow cell 3 (1595 EU), and flow cell 4 achieved high density (4371 EU). Ovalbumin was immobilized in flow cell 1 (1289 EO, Pierce ThermoFisher 77120) for comparison. Immobilization was performed according to the manufacturer's (GE Healthcare) standard protocol for amine coupling (surface activation with 0.4 M EDA and 0.1 M NHS, GE Healthcare amine coupling kit, BR-1000-50). Unreacted groups were inactivated with 1 M ethanol-amine-HCl, pH 8.5. Thereafter, anti-GITR antibodies were passed through different surfaces at a concentration of 300 nM (45 μg/ml) for 240 at 5 μl/min. Under these conditions, saturation of the GITR surface should be achieved. Before the addition of competitive antibody (300 nM, 5 µl/min), a dissociation time of 60 s was included. Restoration of the chip surface was performed with 10 mM glycine, pH 2.0 (GE Healthcare, BR-1003-55) for 60 s at 10 μl/min. Sorting was performed using response units (RU) non-competitive control (100% binding, saturation conditions).

As shown in FIG. 32, if the chimeric parent antibody 231-32-15 is first bound to GITR, no additional binding of this antibody is observed. However, if the chimeric parent antibody 231-32-15 is first bound to the GITR and the m6C8 antibody is used, the antibody is able to bind to the GITR.

6.6.4. Epitope mapping of anti-GITR antibodies

To map the epitope to GITR to which the anti-GITR antibodies described herein bind, error-corrected PCR was used to generate variants of the human GITR antigen. Variant GITR proteins were expressed on the surface of cells from the cell library and these cells were screened for anti-GITR antibody binding. A polyclonal anti-GITR antibody was used as a positive control to confirm correct folding of the GITR protein. For variants of the human GITR antigen to which reduced or no binding was observed, alanine-scanning mutagenesis was performed to determine the exact epitope residues that were required for binding by the anti-GITRs described herein.

- 172 040077 antibodies.

6.6.4.1. Obtaining human variants of GITR

Error-corrected PCR mutagenesis was used to generate human GITR variants with random mutations in the extracellular domain. Error-corrected PCR was performed using the GeneMorphII random mutagenesis kit (Stratagene) according to the manufacturer's instructions. Briefly, 20 PCR cycles were performed in a volume of 50 µl, using as template an in-house construct (13 ng, construct number 4377 pMA-T-huGITR), 0.05 U/µl Mutazyme II DNA polymerase, 1x Mutazyme II reaction buffer, 0.2 μM of each primer (1152-Je (sequence 5' gagctcctcgaggccaccatg 3'; SEQ ID NO: 712) and 1204-Je (sequence 5' cgcggccgcgaattctta 3'; SEQ ID NO: 713)) and 0.2 mM of each deoxynucleoside triphosphate (dATP, dCTP, dGTP and dTTP). Samples were amplified by PCR (Eppendorf, Germany) according to the following program: 95°C for 2 min; 20 cycles of 95°C for 30 s, 56°C for 30 s, 72°C for 1 min; and a final elongation step at 72° C. for 10 min. Gel purification of the PCR product was performed using a 1% agarose gel, a DNA band corresponding to the expected size of 720 bp was excised, and gel extraction was performed using NucleoSpin Gel and a PCR purification kit from Macherey & Nagel according to the manual. Purified DNA was ligated into an intralaboratory expression vector via XhoI/EcoRI sites using T4 DNA ligase and a 1:3 ratio (vector:insert). Ligation (25°C) was terminated after 2 h by a heat denaturation step for 10 min at 65°C. Conducted EtOH precipitation of DNA from the ligation reaction using yeast tRNA. Standard splitting and ligation methods were used. The ligation reaction was electroporated into DH10B cells (E. coli ElectroMax DH10B electrocompetent cells, Invitrogen; 1900 V/5 ms). The electroporated bacteria were plated on LB-agar plates +100 μg/ml ampicillin and colonies of approximately 1.9x10 ⁸ cells were obtained.

All electroporated bacteria were then scraped off the plates and used for large scale DNA plasmid preparation (Macherey&Nagel, NucleoBond Xtra Maxi Plus Kit) according to manufacturer's instructions for DNA library preparation. To control the quality of the library, the restriction enzymes XhoI/EcoRI and BsrGI/EcoRI were digested. Individual clones were selected and sent for sequencing to determine endpoint library variability using primer 1155-Je (straight; sequence 5'ccttgaacctcctcgttcg 3'; SEQ ID NO: 714).

6.6.4.2. Creation of a cell library with human GITR variants

For expression of human GITR mutants on the surface of 1624-5 cells, standard transfection techniques followed by transduction were used. To obtain retroviral particles, the DNA library and vectors expressing the retroviral proteins Gag, Pol, and Env were transfected into a retroviral packaging cell line (HEK cells) using XtremeGENE 9 DNA transfection reagent (Roche Diagnostics GmbH, Germany). The resulting retroviral particles accumulated in the culture supernatant of the retroviral packaging cells. Two days after transfection, supernatants containing no cells but containing viral vector particles were collected and spin-infected with 1624-5 cells. A transduction efficiency (% of cells expressing human GITR) of about 4% was obtained. After continuous culture for at least one additional day, cells were selected using puromycin (1.5 μg/ml). Non-transduced cells served as a negative control (OK). After antibiotic selection, most of the cells stably expressed the human GITR antigen on the cell surface. Non-viable cells were removed at the stage of Ficoll separation.

The FACS method was used to select cells expressing correctly folded human GITR mutants using a polyclonal anti-GITR and to subsequently select single cells expressing human GITR variants that do not bind to the anti-GITR chimeric parent antibody 231-32-15. Briefly, antibody-binding cells were analyzed by FACS, and cells that exhibited specific antibody binding were separated from the population of non-binding cells by preparative high-speed FACS (FACSAriaII, BD Biosciences). Pools of antibody-reactive and non-reactive cells were expanded again in tissue culture and, due to the stable expression phenotype of retrovirus-transduced cells, cycles of antibody-directed cell sorting and tissue culture expansion were repeated until a clearly detectable population of anti-GITR antibody non-reactive (chimeric parent 231-32-15) cells. This population of anti-GITR antibody non-reactive (chimeric parent 231-32-15) cells was subjected to final single cell sorting. After several days of cell expansion, the sorted cells were again examined for lack of binding to the anti-GITR chimeric parent antibody 231-32-15 and binding to the polyclonal anti-GITR antibody using a FACSCalibur 96-well plate assay (BD Biosciences).

- 173 040077

6.6.4.3. Epitope analysis

To link the phenotype (polyclonal aHTu-GITR+, chimeric parent 231-32-15-) to the genotype, sorted huGITR variants were sequenced. In FIG. 33 illustrates the sequence alignment of these variants. The amino acid residues in Fig. 33 are numbered according to the immature human GITR amino acid sequence (SEQ ID NO: 701). Sequencing identified regions with increased mutations or hotspots (eg, P62 and G63), providing identification of an epitope on human GITR recognized by the anti-GITR chimeric parental antibody 231-32-15. To confirm the exact amino acid residues of human GITR involved in binding to anti-GITR antibodies, alanine substitution of amino acids at the hot spots was performed. The following positions (numbered according to SEQ ID NO: 701) were individually mutated to alanine: P28A, T29A, G30A, G31A, P32A, T54A, T55A, R56A, C57A, C58A, R59A, D60A, Y61A, P62A, G63A, E64A , E65A, C66A, C67A, S68A, E69A, W70A, D71A, C72A, M73A, C74A, V75A and Q76A. Standard transfection followed by transduction techniques were used to express these human GITR alanine mutants on the surface of 1624-5 cells.

Finally, alanine mutants expressed on 1624-5 cells were analyzed by flow cytometry (FACSCalibur; BD Biosciences) for binding of the anti-GITR humanized Hum231#2 variant, three germline variants (pab1967, pab1975 and pab1979) and the m6C8 standard antibody. . Briefly, 1624-5 cells expressing individual human GITR alanine mutants were incubated with 2 μg/ml of Hum231#2 monoclonal anti-GITR antibody, three germline variants (pab1967, pab1975 and pab1979) or m6C8 antibody; or polyclonal anti-GITR antibody (AF689, R&D systems) conjugated to APC and Fc receptor blocker (1:200; BD Cat. No. 553142) diluted in 100 µl FACS buffer (PBS + 2% FCS) for 20 min at 4°C. After washing, if necessary for detection, cells were incubated with a secondary anti-IgG antibody (APC conjugated; BD Cat. No. 109-136-097) diluted in 100 µl of FACS buffer (PBS + 2% FCS) for 20 min at 4 °C The cells were then washed and analyzed using a flow cytometer (BD Biosciences). The mean fluorescence intensity (MFI) value of the monoclonal antibody under study was divided by the MIF value of the polyclonal antibody to give the MIF (monoclonal antibody/polyclonal antibody) ratio for individual GITR alanine mutants. The average SIF ratio (SSIF ratio) was calculated from the individual SIF ratios for all mutants. In FIG. 34A is a table summarizing the binding of Hum231#2, three germline variants (pab1967, pab1975 and pab1979) and the standard m6C8 antibody to 1624-5 cells expressing human GITR alanine mutants. A single SIF ratio greater than 60% of the SIF ratio after normalization was considered to indicate the same binding to the polyclonal antibody and is shown in FIG. 34A sign +. A separate SIF ratio of 30 to 60% of the SIF ratio is shown in FIG. 34A sign +/-. A single SIF ratio less than 30% of the SIF ratio is shown in FIG. 34A sign -.

As shown in FIG. 34A, the D60A mutant and the G63A mutant, numbered according to SEQ ID NO: 701, specifically disrupted or attenuated binding of the anti-GITR humanized variant Hum231#2 and three germline variants (pab1967, pab1975 and pab1979), but not the m6C8 standard antibody. . The C58A mutant disrupted the binding of all five antibodies and is likely a structural mutation rather than an epitope-specific one. The C74A mutant was weakly expressed and could not be used for binding comparisons. In addition, the anti-GITR antibodies 231-32-15, Hum231#2 and m6C8 were compared with respect to their binding to wild type GITR and mutant human GITR. Briefly, wild-type human GITR and two alanine GITR mutants (D60A mutant and G63A mutant, numbered according to SEQ ID NO: 701) were expressed on the surface of 1624-5 cells as described above and analyzed by flow cytometry as described above, the cells were first stained with 2 μg/ml of monoclonal antibodies 231-32-15, Hum231#2 and m6C8 or a polyclonal antibody conjugated to APC, and then, if necessary for detection, stained using a secondary anti-IgG antibody (APC- conjugated, 1:1000; BD Cat. No. 109136-097). All mean fluorescence intensity (MFI) values were calculated as the average of two measurements. The CIF value of the studied monoclonal antibody for a particular cell type was divided by the CIF value of the polyclonal antibody for the same cell type, giving a total of nine CIF (monoclonal antibody/polyclonal antibody) ratios: CIF2 ₃₁ ratio. _{3 2-15} , _WT , CIF ratio _Hum 2 ₃₁ #2, _WT , CIF ratio _r6C8 , _WT , CIF ratio ₂₃₁ . _{3 2-15} , _d60 a, CIFn ratio um231#2, D60A, CIFm6C8 ratio, D60A, CIF231-32-15 ratio, G63A, CIFnum231#2 ratio, _G63A , and _CIFnum231 #2 ratio, _G63A . The percentage binding of the antibody to GITR alanine mutants compared to wild-type GITR was calculated by dividing the specific CIF ratio for GITR alanine mutants by the corresponding wild-type CIF ratio (e.g., dividing the ratio of CIF _Hum 2 ₃₁ #2, _D60A by the ratio of CIF _Hum 2 ₃₁ #2, d _T ). Percent binding reduction was determined by calculating, for example, 100%x(1-( _Hum 2 ₃₁ #2 CIF ratio, _D60A / _Hum 2 ₃₁ #2 CIF ratio, _dT ))- As shown in FIG. 34B, the D60A mutant and the G63A mutant specifically disrupted or attenuated the binding of 231-32-15 and Hum231#2, but not m6C8. The percentages in Fig. 34B represent percentages

- 174 040077

GITR-positive cells on each graph. When tested with cells expressing

GITR D60A, antibody binding was reduced by 82% and 88% for 231-32-15 and Hum231#2, respectively, compared to a 10% decrease for m6C8. Similarly, when tested with cells expressing GITR G63A, 231-32-15 and Hum231#2 binding was reduced by 37% and 59%, respectively, while m6C8 binding was increased by 62%.

To further characterize the binding of anti-GITR antibodies, antibody binding was compared to cynomolgus monkey GITR. The immature cynomolgus monkey GITR protein contains the amino acid sequence of SEQ ID NO: 704. To increase protein expression, the first residue of the cynomolgus monkey GITR signal peptide was substituted with methionine to give the cynomolgus monkey V1M GITR. A mutant cynomolgus monkey GITR V1M/Q62P/S63G was then prepared in which the amino acid residues at positions 62 and 63 (GlnSer) numbered according to SEQ ID NO: 704 were replaced with the corresponding residues of human GITR (ProGly). In FIG. 35A shows sequence alignments between human GITR, V1M cynomolgus GITR, and V1M/Q62P/S63G cynomolgus GITR. The three proteins shown in Fig. 35A were expressed on the surface of 1624-5 cells as described above and examined by flow cytometry as described above, the cells being first stained with 2 μg/ml of monoclonal antibodies 231-32-15, Hum231#2 and m6C8 or polyclonal antibody, conjugated to APC and then stained using a secondary anti-IgG antibody (APC conjugated; 1:1000; BD Cat. No. 109-136-097).

As shown in FIG. 35B, anti-GITR antibodies 231-32-15 and Hum231#2 showed binding only to cells expressing cynomolgus macaque V1M/Q62P/S63G GITR, but not cells expressing cynomolgus V1M GITR.

6.7. Example 7 In Vitro Treatment of T Cells with Anti-GITR Agonist Antibodies followed by T Cell Infusion

GITR expressing T cells, indicating an activated status, can be further activated to kill target cells such as tumor cells when cultured with an anti-GITR agonist antibody such as Hum231#1, Hum231#2, Hum231#2w or another an anti-GITR agonist antibody described herein prior to infusion into a subject, eg, a human subject with cancer.

The expression level of GITR on T cells isolated from a subject, eg a human subject, is assessed by standard methods, eg FACS. The source of T cells is, for example, peripheral blood, a biopsy sample/surgical sample of a lymph node at the site of a tumor, or a biopsy sample/surgical sample of the tumor itself, in which T cell infiltration may be observed. T cells are isolated, for example, from PBMC, lymphatic tissue or tumor tissue by standard methods. If GITR expression is observed on the surface of T cells, the cells can be incubated with an anti-GITR agonist antibody, e.g. 1 µg/mL to 1 mg/mL, over, for example, 30 minutes, 1 hour, 2, 3, 4, 6, 12, 24, 36, 48, or 72 hours, followed by, for example, intravenous infusion of T- cells to the subject.

If no expression of GITR is observed on T cells isolated from the subject, it can be induced by co-incubation of the T cells and an agent that stimulates the PTK complex, such as, for example, phytohemagglutinin (PHA) and/or phorbol myristacetate (PMA), or an antibody that stimulates the RTK complex, such as an anti-CD3 antibody and an anti-CD28 antibody (at concentrations in the range, for example, from 1 μg/ml to 1 mg/ml, for, for example, 30 min, 1 h, 2, 3, 4, 6, 12, 24, 36, 48 or 72 hours). Alternatively, it may be preferable to first incubate T cells with anti-CD3 antibody only, followed by addition of anti-GITR agonist antibody at 30 min, 1 h, 2, 3, 4, 6, 12, 24, 36, 48, or 72 h. it may be necessary to stimulate T cells with a tumor antigen, eg in the form of peptides or proteins, in the presence of antigen presenting cells in order to activate and increase the number of tumor specific T cells. Following antigen challenge, T cells can be cultured with an anti-GITR agonist antibody to increase their activation status prior to infusion.

T cells can be infused into a subject for, for example, 30 minutes, 1 hour, 2, 3, 4, 6, 12, or 24 hours, and can be infused into the subject one, two, three, four or more times, for example, at intervals of 1, 2, 3 or 4 weeks or 1, 2, 3, 4, 5 or 6 months. The number of T cells infused can be determined by standard experimental methods and may be, for example, 1x10 ⁶ cells, 1x10 ⁷ cells, 1x10 8 cells, 1x10 ⁹ cells or more.

In some embodiments, T cells can be contacted with an agent such as a mitogen (eg, PHA) or a cytokine (eg, IL-2) to non-specifically expand the T cell population before, during, or after treatment with an agonist antibody. to GITR.

In some embodiments, T cells can be contacted with another agonist in addition to an anti-GITR agonist antibody, such as an anti-OX40 agonist antibody.

- 175 040077

The invention is not limited to the specific embodiments described herein. Indeed, on the basis of the foregoing description and the accompanying figures, it will become apparent to those skilled in the art that there are various modifications of the invention beyond those described.

Such modifications are intended to be within the scope of the appended claims.

All references (for example, publications or patents or patent applications) listed in this document are incorporated herein by reference in their entirety and in all senses, as if each individual reference (for example, publication or patent or patent application) ) has been expressly and separately, in its entirety and in every sense, incorporated by reference. Other embodiments of the invention are within the scope of the following claims.

Claims (32)

CLAIM 1. An isolated antibody that specifically binds to the human glucocorticoid-induced TNFR-like protein (GITR), containing: (a) a heavy chain variable region (VH) hypervariable region (CDR) 1 containing the amino acid sequence X1YX2MX3 (SEQ ID NO: 7), where Xi is D, E or G; X2 is A or V; And X ₃ represents Y or H; (b) VH CDR2 containing the amino acid sequence X1IX2TX3SGX4X5X6YNQKFX7X8 (SEQ ID NO: 8), in which X1 is V or L; X ₂ represents R, K or Q; X ₃ is Y or F; X ₄ is D, E or G; X ₅ is V or L; X ₆ is T or S; X ₇ is K, R or Q; And X8 is D, E or G; (c) VH CDR3 containing the amino acid sequence of SEQ ID NO: 9; (d) A light chain variable region (VL) CDR1 containing the amino acid sequence KSSQSLLNSX1NQKNYLX2 (SEQ ID NO: 10) wherein X1 is O or S; And X2 is T or S; (e) VL CDR2 containing the amino acid sequence of SEQ ID NO: 11; and (f) a VL CDR3 containing the amino acid sequence QNX1YSX2PYT (SEQ ID NO: 12) in which X1 is D or E; And X ₂ is Y, F or S. 2. An antibody according to claim 1, containing: (a) VH CDR1 containing the amino acid sequence of SEQ ID NO: 13, VH CDR2 containing the amino acid sequence of SEQ ID NO: 14, and VH CDR3 containing the amino acid sequence of SEQ ID NO: 15; And VL CDR1 containing the amino acid sequence of SEQ ID NO: 16, VL CDR2 containing the amino acid sequence of SEQ ID NO: 17, and VL CDR3 containing the amino acid sequence of SEQ ID NO: 18; (b) VH CDR1 containing the amino acid sequence of SEQ ID NO: 20, VH CDR2 containing the amino acid sequence of SEQ ID NO: 27, and VH CDR3 containing the amino acid sequence of SEQ ID NO: 34; And VL CDR1 containing the amino acid sequence of SEQ ID NO: 103, VL CDR2 containing the amino acid sequence of SEQ ID NO: 105, and VL CDR3 containing the amino acid sequence of SEQ ID NO: 108; (c) VH CDR1 containing the amino acid sequence of SEQ ID NO: 22, VH CDR2 containing the amino acid sequence of SEQ ID NO: 29, and VH CDR3 containing the amino acid sequence of SEQ ID NO: 34; And VL CDR1 containing the amino acid sequence of SEQ ID NO: 102, VL CDR2 containing the amino acid sequence of SEQ ID NO: 105, and VL CDR3 containing the amino acid sequence of SEQ ID NO: 107; or (d) VH CDR1 containing the amino acid sequence of SEQ ID NO: 22, VH CDR2 containing the amino acid sequence of SEQ ID NO: 33, and VH CDR3 containing the amino acid sequence of SEQ ID NO: 34; And - 176 040077 VL CDR1 containing the amino acid sequence of SEQ ID NO: 102, VL CDR2 containing the amino acid sequence of SEQ ID NO: 105, and VL CDR3 containing the amino acid sequence of SEQ ID NO: 107. 3. The antibody according to claim 1 or 2, wherein the antibody contains a VH sequence containing the amino acid sequence of SEQ ID NO: 203, and/or the antibody contains a VL sequence containing the amino acid sequence of SEQ ID NO: 204 or SEQ ID NO: 205. 4. The antibody according to claim 1, where the antibody contains a VH sequence with at least 98% identity with the amino acid sequence of SEQ ID NO: 206, and/or the antibody contains a VL sequence with at least 98% identity with the amino acid sequence of SEQ ID NO: 208. 5. The antibody according to claim 4, where the antibody contains a VL sequence containing the amino acid sequence of SEQ ID NO: 208. 6. An antibody according to claim 4 or 5, wherein the antibody comprises a VH containing a VH CDR1 containing the amino acid sequence of SEQ ID NO: 13, a VH CDR2 containing the amino acid sequence of SEQ ID NO: 14, and a VH CDR3 containing the amino acid sequence of SEQ ID NO: : 15. 7. The antibody according to claim 4, where the antibody contains a VH sequence containing the amino acid sequence of SEQ ID NO: 206. 8. The antibody according to claim 4 or 7, where the antibody contains a VL containing VL CDR1 containing the amino acid sequence of SEQ ID NO: 16, VL CDR2 containing the amino acid sequence of SEQ ID NO: 17, and VL CDR3 containing the amino acid sequence of SEQ ID NO: 18. 9. An antibody according to claim 1 containing a VH containing the amino acid sequence of SEQ ID NO: 206; and VL containing the amino acid sequence of SEQ ID NO: 208. 10. Antibody according to claim 1, containing: (a) VH containing the amino acid sequence of SEQ ID NO: 255 and VL containing the amino acid sequence of SEQ ID NO: 441; (b) VH containing the amino acid sequence of SEQ ID NO: 276 and VL containing the amino acid sequence of SEQ ID NO: 440; or (c) a VH containing the amino acid sequence of SEQ ID NO: 345 and a VL containing the amino acid sequence of SEQ ID NO: 440. 11. An antibody according to any one of claims 1 to 10, characterized in that it additionally contains a heavy chain constant region, which is a human immunoglobulin IgG1. 12. An antibody according to any one of claims 1 to 10, wherein the antibody further comprises a heavy chain constant region, wherein the heavy chain constant region is a human IgG4 immunoglobulin. 13. An antibody according to any one of claims 1 to 10, characterized in that the antibody further comprises a heavy chain constant region, which is a human IgG1 immunoglobulin containing the N297A mutation. 14. The antibody according to claim 1, characterized in that it contains a heavy chain containing the amino acid sequence of SEQ ID NO: 567; and a light chain containing the amino acid sequence of SEQ ID NO: 576. 15. An antibody according to any one of claims 1-12 or 14, characterized in that it induces, activates or increases the activity of human GITR, optionally in the cell, regardless of the initiation of RTK. 16. An antibody according to any one of claims 1-12, 14 or 15, characterized in that: (a) induces, activates or increases the activity of NF-kB in the cell, regardless of the initiation of RTK, (b) increases the percentage of polyfunctional (IFNy + TNFa +) T cells, (c) when bound to activated regulatory T cells, binds to activating Fc-gamma receptors selected from the group consisting of CD16, CD32A and CD64, to a greater extent than the antibody, when bound to activated effector T cells, binds to activating Fc-gamma receptors selected from the group consisting of CD16, CD32A and CD64, wherein optionally the activating Fc-gamma receptor is expressed on a cell selected from the group consisting of myeloid effector cells and lymphocytic effector cells, and/or (d) increases the surface expression of OX40, PD-1, or a combination thereof in activated T cells. 17. An antibody according to any one of claims 1 to 16, characterized in that it is a humanized antibody, a mouse antibody, or a chimeric antibody. 18. An isolated nucleic acid molecule encoding a VH antibody according to any one of claims 1-17. 19. An isolated nucleic acid molecule encoding the VL of an antibody according to any one of claims 1-17. 20. An isolated nucleic acid molecule encoding an antibody heavy chain according to any one of claims 1-17. - 177 040077 21. An isolated nucleic acid molecule encoding an antibody light chain according to any one of claims 1-17. 22. A pharmaceutical composition for inducing, activating or enhancing GITR activity, comprising an antibody according to any one of claims 1 to 17 or nucleic acid molecules according to claims 18 and 19 or 20 and 21 and a pharmaceutically acceptable carrier or excipient. 23. The use of an antibody according to any one of claims 1 to 17 for the treatment of cancer, where the cancer is treatable by inducing, activating or increasing GITR activity. 24. The use of an antibody according to any one of claims 1-17 in combination with another therapeutic agent for the treatment of cancer, where the cancer is treatable by inducing, activating or increasing GITR activity. 25. Use according to claim 24, wherein the other therapeutic agent is an indoleamine-2,3-dioxygenase (IDO) inhibitor and the antibody and the IDO inhibitor are in different pharmaceutical compositions and in separate dosage forms. 26. Use according to claim 25, wherein the IDO inhibitor is selected from epacadostat, F001287, indoxymod and NLG919. 27. The use of claim 24 wherein the other therapeutic agent is a checkpoint targeting agent. 28. Use according to claim 27, wherein the checkpoint targeting agent is selected from the group consisting of anti-PD-1 antagonist antibody, anti-RP-Y antagonist antibody, anti-PD-L2 antagonist antibody, anti-CTIA-4 antagonist an antibody, an anti-TIM-3 antagonist antibody, an anti-LAG-3 antagonist antibody, and an anti-OX40 agonist antibody. 29. Use according to claim 24, wherein the other therapeutic agent is a vaccine. 30. Use according to claim 29, wherein the vaccine comprises a heat shock protein peptide complex (HSPPC) containing a heat shock protein complexed with an antigenic peptide. 31. Use according to any one of claims 23-30, wherein the cancer is endometrial cancer, gastric cancer, gastric cancer, esophageal cancer, esophagogastric junction carcinoma, head and neck squamous cell carcinoma, melanoma, non-small cell lung cancer, or renal cell carcinoma. carcinoma. 32. The use of an antibody according to any one of claims 1 to 17 for the treatment of a viral infection, wherein the viral infection is treatable by inducing, activating or increasing GITR activity.