DE19802375A1 - Removal and/or inactivation of virus in blood products - Google Patents

Abstract

Removal and/or inactivation of virus in blood products, comprises running the products over a matrix (M) comprising a filter of particles comprising crosslinked crospovidone iodine and/or crospovidone hydrogen peroxide. Independent claims are also included for: (1) a method for removing and/or inactivating virus in a fluid comprising particles, comprising separating the particles from the fluid and running the fluid at least once over M; (2) virus-free blood products obtained by the methods described above; (3) a device for carrying out the processes described above, comprising a filtering assembly comprising M; (4) a composition for increasing the haematopoietic stem cell and precursor cell content of the peripheral blood, comprising for sequential application two separate components: (a) an antiviral component; and (b) an antiviral component and a haematopoietically active component; and (5) the use of the agents and device above for removing and inactivating virus in a particle-containing fluid.

Description

The present invention relates to a method for Ent removal and / or inactivation of viruses, virus-free Blood components, a device for removal and / or Deactivating viruses from / in a particle and viruses comprehensive fluid, a method for reducing the Vi rustiters in body fluids of an animal organ mus and a means of increasing the content of hematoma poietic stem and progenitor cells in peripheral blood as well as its use.

Viral diseases are still a major threat hunger for human health. In addition to the peri Odd flu waves have recently become a number other and often chronic viral diseases observed. Examples include AIDS, hepatitis C,  Ebola, Hanta and cytomegaly infections noted.

The development of suitable therapeutic methods has led to has undoubtedly been encouraging in the recent past Results, however, it is not justified by one therapeutic controllability of viral diseases speak. These shortcomings lie in the biologi peculiarities of the different viral systems justified and especially in their high adaptability due to the special conditions of their environment, so also the presence of nucleotide analogs or others antiviral agents currently used. Given of these facts it can already be a great therapeuti progress means having funds at your disposal the latter end a reduction in the virus titer in the body effect of the patient, on the one hand the usually di the severity of the crane, which can be correlated with the virus titer reduction and to save time in order to other therapy concepts are still used to let.

This includes blood components that are both more soluble as well as cellular nature, the diseased organism to compensate for possible deficits, and also that soluble or cellular present in the blood in the sense of a therapy positive effectors for the sick Organism. These can be both more allogeneic as well as being autogenous. In any case, however to ensure that appropriate preparations are virus-free are.

Virus-free from blood plasma or other liquids can be achieved by suitable filtration steps.  

It turns out that using Filterma iodine in the form of crospovidone Iodine, as described for example in DE 43 43 236 A1, Viruses can be reliably deactivated.

The present invention is based on the object To provide methods and devices that grant afford that in a fluid comprising viruses and particles the viruses are removed from the fluid or inactivated in the fluid be fourth.

In addition, an object of the invention is virus-free To provide preparations of cellular components that an increased content of hematopoietic stem cells exhibit.

Another object of the invention is a method to reduce virus titer in body fluids to provide an animal organism.

According to the invention the object is achieved by a method for removing and / or inactivating viruses from / in a fluid comprising virus and particles, in which the Fluid over a matrix and particles embedded in it from cross-linked crospovidone iodine and / or crospovidone-what filter containing peroxide.

Furthermore, the object is achieved by a method for Removal and / or inactivation of viruses from / in one Fluid comprising viruses and particles, in which the particles be separated from the fluid and the particle-free fluid at least once over and embedded in a matrix Cross-linked crospovidone iodine and / or particles  Crospovidone hydrogen peroxide comprehensive filter performed becomes.

According to the invention, the object is also achieved by virus free blood components, including these comprehensive Preparations by one of the methods according to the invention are producible.

Furthermore, the object is achieved by a device for removing and / or inactivating viruses from / in a fluid comprising particles and viruses, the pre direction at least one device for separating the par particles of the fluid and includes a filter device, the at least one a matrix and particles embedded therein from cross-linked crospovidone iodine and / or crospovidone-what filter includes.

In addition, the task is accomplished by using the mentioned device according to the invention for reduction virus titer in the body fluids of an animal Organism and by their use in the Invention resolved according to the procedure.

Finally, the object is achieved by a Means to increase the level of hematopoietic Strain and precursor dissolved in peripheral blood, which containing two for sequential administration has agreed components, the first component includes an antiviral compound and the second component a combination of at least one antiviral ver binding and a hematopoietically active compound includes, and through the use of the agent in which he method according to the invention.  

Ultimately, the task is also accomplished through a process for Reduction of virus titer in body fluids animal organism solved, in which one of the aforementioned th inventive method is used.

In a preferred embodiment it is provided that the particles are cellular blood components.

In a particularly preferred embodiment, the cellular blood components selected from the group consisting of hematopoietic stem and progenitor cells, erythrocytes, Platelets, lymphocytes, monocytes / macrophages and com binations thereof.

It is further preferred that the cellular components are differentiated cells and / or stem cells.

Is very particularly preferred if the cellular inventory parts include CD34 positive hematopoietic stem cells.

In another embodiment, the fluid is blood.

It can also be provided that the viruses are selected are from the group that hepatitis B, hepatitis C, cyto megalie, Epstein-Barr viruses and human herpes virus, in particular human herpes virus 6, 7 and 8 and human Immunodeficiency virus includes.

The invention further proposes that before the parti be passed over the filter based on their physical, chemical, phenotypic and / or genotypic characteristics are fractionated.  

It can further be provided that after the particles passed through the filter based on their physical, chemical, phenotypic and / or geno typical features are fractionated.

In a preferred embodiment it is provided that those obtainable by one of the methods according to the invention Particles are blood cells and these are used for reproduction and / or Differentiation can be stimulated.

An embodiment is very particularly preferred, where the blood cells are CD34 positive stem cells.

Finally, it can be provided that the virus and parti fluid from a mammalian host will keep, and especially in the mammalian host organism before removing the virus and particles fluids send the number of those present in peripheral blood hematopoietic stem and progenitor cells is increased.

In a further embodiment it can be provided that the number of hematoma present in peripheral blood poietic stem cells by administration to the mammal host organism of an agent for increasing the content hematopoietic stem and progenitor cells in peripheral Blood is increased.

In a very particularly preferred embodiment the mammalian host organism is a human organism.

In one embodiment of the method according to the invention to reduce virus titer in body fluids an animal organism can be provided that the  Particles and / or the fluid several times over the filter leads.

Furthermore, it can be provided that after the passage fluid obtained via the filter and / or after the pas tell particles obtained through the filter to an animal Organism.

It is very particularly preferred if the animal Organism can be supplied with CD34-positive stem cells.

Furthermore, it can be provided that zel lular blood components in an animal organism the immune system of the animal organism is destroyed.

The inventive method proposes that the Ver drive to reduce virus titer in body fluid of an animal organism at regular intervals is repeated.

The method according to the invention is particularly preferred when the body fluid is blood.

In another very particularly preferred embodiment the animal organism is a mammal and ins special a person.

An embodiment in which the inventive Advantages inherent in the process are particularly noticeable, is that the animal organism chronically on one Is ill.

In one embodiment of the agent according to the invention  Increase the level of hematopoietic stem and pre Runner cells is the antiviral compound from the group selected, which includes Retrovir®, Ganciclovir and others.

In a further embodiment of the invention It is provided that the hematopoietically effective Compound is selected from the group of cytokines that Granulocyte colony stimulating factor G-CSF and others re includes.

It can further be provided that the first component for administration over a period of 10 to 28 days is provided.

Furthermore, it can be provided that the second component te for administration over a period of 5 to 10 days gene is provided.

In addition, in one embodiment, there is a time span ne of a total of 15 to 38 days for taking the he most and second component provided.

Finally, the agent according to the invention can be used hen be that the two components in one packaging unit is spatially separated and made up, the administration forming the components being units can be removed individually.

It is very particularly preferred if the administration units are daily units.

In a preferred embodiment it is provided that if Retrovir the first component and granulocyte colo  never-stimulating factor G-CSF with Retrovir die second component is, the first component is 9 daily units ten retrovir of 2 g each for oral administration and the wide component 5 daily units each consisting of 2 g Retrovir for oral administration and 5-20 µg / kg body weight important granulocyte colony stimulating factor G-CSF is.

Finally, the invention proposes the use of it Agent according to the invention in the method according to the invention in front.

The method according to the invention thus provides that a fluid comprising viruses and particles removes viruses can be included in a virus and particles send fluid containing viruses can be inactivated. It is possible that both processes at the same time, run consecutively or only individually.

The invention is based on the surprising finding that it is possible by contacting crospovidone iodine and / or crospovidone hydrogen peroxide with a virus fluid containing particles to remove the viruses or to inactivate.

Taking Crospovidone iodine or Crospovidone hydrogen per oxide iodine complexes or hydrogen peroxidkom plexes based on cross-linked PVP (polyvinylpyrroli don) understood. Crospovidone-Iodine or Crospovidone-What Hydrogen peroxide is in the filters used herein a filter matrix in particulate form. Such Filters that are advantageously used as depth filters are are in DE 43 43 226 A1 and WO 95/16511  described, their respective disclosure content is fully incorporated into this.

The filters in question can be used as a filter matrix for fibers materials and the content of the matrix Build Crospovidone can 0.5 to 75 wt .-%, based on the total weight (dry).

It is noteworthy the fact that it is an Ent Removal or inactivation of the viruses, but not too damage to the particles themselves, especially if the particles are cellular blood parts and specifically around lymphocytes or hematopoietic Stem and progenitor cells.

The filter material can have a sufficient pore size be equipped, leading to the enlargement of the filter upper area that leads to contact with the virus and Fluid comprising particles is available.

In particular, blood, but also lymph, is used as the fluid understood liquid. Under blood there should also be full blood, spiked with anticoagulants, or otherwise delt blood, blood plasma, blood plasma fractions, expand understood whole blood and blood plasma and the like become. The term "blood" also includes herein that under the various pathological conditions too observing blood, such pathological conditions both the cellular component (s) of the blood as well its soluble, d. H. include plasma component (s) can.

Furthermore, aqueous fluid should also be used here under fluid  gene and in particular buffer solutions are understood.

Then based on the surprising knowledge whole blood directly after treatment with a particulate res crospovidone iodine and / or crospovidone hydrogen comprehensive filters are supplied and thus a verver allow casual removal and / or inactivation of viruses become light. To that extent, the Ver drive new opportunities in processing full blood, blood plasma containing particles, cellular blood stock rush, blood plasma fractions and the like.

It is within the scope of this invention that the fluid is suitable neter way for the passenger step over the filter kondi is tioned. In the case of blood this can be done by adding suitable anticoagulants, as the expert on the Known area can be prevented, for example by adding ACD or heparin.

However, according to the invention it is also possible for viruses removed from / in a fluid comprising particles and viruses or inactivated, first separating the Particles made by the fluid and then the particles possibly suspended in a fluid, on the one hand and the parti Kel-free fluid on the other hand separated in a suitable manner be treated further, with further treatment also may consist of non-treatment. Typically will have at least one of the two fractions mentioned the cross-linked particulate crospovidone iodine and / or cro Filter material containing spovidone hydrogen peroxide treated to remove and / or inactivate the virus are, preferably the particle-free fluid, for example plasma free of cellular blood components.  

Particles and fluids are typically separated by means of differential centrifugation. In the event that the particles are blood cells that are typically pre directions such as apheresis centrifuges and the like det, especially since they are able to handle large quantities to remove nucleated cells from peripheral blood and enrich if necessary. Regarding the passage of the fluid or the particles via the particulate crospovidone iodine and / or filters comprising crospovidone hydrogen peroxide it is obvious to the person skilled in the art that this corresponds This passage is repeated until the desired one Virus titer reduction or inactivation rate is reached, if necessary using other appropriate filters.

"Virus-free" is meant here to mean the physical absence of Vi include as well as the absence of biologically active Viruses, d. that is, for example, the virus capsid or parts thereof also after the implementation of the invention Procedures still exist, but the virus no longer is biologically active. The term also includes the fact that no virus or no viral activity is more detectable, or at least below a defi titer or level of biological, i.e. H. viral, There is reduced activity.

The methods according to the invention are in the case of Treating blood, not on immediately from a tie particle and viruses obtained from the organism of the fluid, but can of course also applied to made-up (blood) preparations so that the fluid is generally a liquid phase such as buffer solutions and the particles can only represent a single cell type  as well as a mixture of two or more cell types.

CD34-positive hematopoietic are of great importance Stem and progenitor cells as cellular components, because these are able, due to differentiation and ver largely a functional immune system to build. Accordingly, in the therapy of lymphotro pen viruses after destruction of the diffe carrying the viruses delimited cells in the patient's body through implanta appropriate hematopoietic stem cells or derivatives derived from this the patient's immune system be rebuilt. Especially in the case of AIDS are the special stem and progenitor cells from zentra of importance because this is for a specific interac responsible for the HI virus with the cell surface Not have molecule CD4.

Although in many advantageous versions of the Erfin If the fluid is blood, this is not limited to this. It can also be processed differently blood or products derived therefrom or equivalent Trade preparations that still have a virus content. The methods according to the invention can also accordingly for subsequent treatment of such preparations are used, for example, after the process Proof has been furnished that the preparations are virus are positive.

The methods according to the invention are basically based on apply all forms of virus, d. H. DNA as well as RNA Vi viruses, enveloped as well as enveloped viruses, virions, priorities and similar biological systems. The ones mentioned herein Viruses also close their various vario and seroty  pen a.

With regard to the removal method according to the invention Viruses can be provided and / or deactivated be that the particles contained in a fluid before or after passage through a particulate crospovidone iodine or a filter containing crospovidone hydrogen peroxide be fractionated, of course a station wagon nation of both steps within the scope of the invention can. The fractionation can be different most characteristics of the particles are based.

Among physical features, among other things the size, surface charge and shape are understood, under chemical characteristics u. a. the composition of the Cytoplasmic membrane or layers based thereon and associated or connected molecules that both occur naturally on a pathological pro zeß or on a technical processing or Modification step can be based. Under phenotypic In the broadest sense, features are also the phy understand physical and chemical characteristics, as well such as those in the specific biological and bio chemical equipment of the particles, especially if it is cellular blood components are. These include various surfaces markers, enzymatic activities or on the surfaces marker coupled detection systems. Phenotypic characteristics are also intended to include immunological features herein. There with regard to the genotypic characteristics, such are to be compared stand in the genetic makeup of each Cells are justified. In particular, this includes the De detection and labeling of certain cell populations using  directly or indirectly labeled nucleic acid probes. On the basis of the features mentioned are all for this purpose known separation method can be used in principle, a finally centrifugation, chromatography and fluorescence zenz-activated cell sorting (FACS).

The using the methods described herein Lymphocytes can be propagated ex vivo or diffe be differentiated using the well-known cultural as well as differentiation techniques. This can be used if necessary tuned cell populations selectively over the normal Distribution in the blood that is expanded therapeutically are beneficial. It is particularly beneficial if it is hematopoietic stem and progenitor cells, such as for example CD34-positive hematopoietic stem cells, acts. In the case of AIDS in particular, CD34 is hematoma poietic stem cells of central importance as a result a reconstitution of the lymphotrophic behavior of the virus of the immune system ultimately only on a non-in basis defected cells is possible because of the multiplication the HI virus cycles this even when the Viruses would be further excreted from the plasma. For the ingestion of HI viruses, this essentially distinguishes Responsible molecule CD4, which on the surface CD34 positive stem cells is not expressed. Corresponding can these hematopoietic stem cells multiply and differentiated if necessary, the basis for a reconstitution of the A patient's immune system form after the virus is out the body, for example using the inventions process according to the invention is removed and also tra lymphatic cells are removed or destroyed.

It should be noted that there are special  Benefits can be connected, the body already diffe limited cells, e.g. B. lymphocytes, and thus the difficulty in producing lymph cells bypassing from CD34 positive stem cells. So it would be also in the sense of the invention, the organism lymphocytes which were ex vivo propagated.

From the above-mentioned aspect and with general appreciation my principles for cleaning particles or molecules len from mixtures it can be seen that a high (Aus titer) of the desired particle fraction or Mo. leküls in the respective fluid is desirable. In correspond The investigations were carried out by the inventors found that the number of peripheral blood existing hematopoietic stem and progenitor cells, in particular CD34-positive stem cells, through which herein can also increase disclosed means that a salary on two compos intended for sequential administration has elements, the first component being an antivira le connection comprises and the second a combination of at least one antiviral compound and one hematoma includes poetically active compound.

Admittedly, the application had a hematopoietic effect seed compound with an increase in the content of zel components, but the com a combination of the two components mentioned surprising synergy effect, especially with a view to the content of hematopoietic stem cells in the peripheral Blood.

Although for administration reasons the administration Units for the components of the enhancer  the content of hematopoietic stem cells in peripheral Rem blood are preferably daily units, the se also cover other periods. For example be remembered that in a certain time stood several administration units per day by the Patients are to be taken and a corresponding gestal administration of the administration units is based on the teaching disclosed herein within the capabilities of the Expert in this field. The latter measure can be taken be justified in all things, if possible uniform level of pharmacologically active sub punching is desired and at the same time with a ver equally short biological half-life of used connections must be expected.

Basically, it is particularly advantageous if the mentioned components provided for oral application are, but other forms of application are also conceivable, so z. B. parenteral and transdermal forms of administration, as they are known in the art.

Although typically among the mammals listed herein host organism or animal organism a human organism is understood, this can also be another bigger than the human organism, and in particular also transgenic animals and preferably transgenic mammals animals.

With regard to the removal device according to the invention Detection and / or inactivation of viruses from / in a party Fluid containing viruses and viruses can be recorded that, after the expert once from the invention Teaching has acquired knowledge of the design of the device  is within its capabilities. Then accordingly to add appropriate facilities to the device be to the aforementioned methods of the invention realize, for example pumps and their Steuerein directions, hose systems and the like. This also applies in the event that the Vorrich invention to reduce virus titer in body fluids animal organism is used. In this Ball, the device also includes means to virus-free fluid, in whole or in part, with or without particles, this or another organism - possibly again - to feed.

Finally, in another aspect the the invention, the aforementioned method and method to reduce virus titer in body fluids an animal organism, and especially a human Chen organism. In particular, it can be seen that get from the above procedure virus-free preparations, d. H. Particles, particle fraction nen, fluid, fluid fractions, cellular blood components or blood plasma and blood plasma fractions, which are then an animal organism and especially a human be fed.

It can be the case with the preparations supplied to the body both autologous and allogeneic preparations act.

In other words, the method according to the invention for Reduction of virus titer in body fluids animal, and especially human organism provide that in a first step the blood in his  Plasma fraction and particulate fraction is separated, the blood plasma being filtered by means of a cross Filter comprising povidone iodine or hydrogen is thrown and the viruses contained therein are removed or be inactivated, and the particulate fraction optional is treated separately.

The treatment of the particulate fraction can shape the individual cell populations selectively due to their phenotypic, chemical, physical and biological properties are removed and then expan be differentiated or differentiated. Then it is possible Lich parts of these cells or cell populations and / or Parts of the plasma, if necessary both components completely dig, again the animal, d. H. especially humans organism.

It is also possible that using the The percentage of stem cells described herein increased and thus in the first steps of the above outlined the process of the invention the yield Stem cells and / or differentiated specifically increased can be.

According to the method according to the invention, furthermore be provided that a certain amount of blood to the taken from a patient suffering from a viral disease and is treated as described above before the ses, or parts thereof, is fed again.

Alternatively, it is possible that the Ver drive continuously, d. H. the one to be treated Organism to the inventive device for removal  Detection and / or inactivation of viruses from / in a party fluid and virus and is connected in which the procedure described above takes place and the blood thus treated, optionally in Form of components or parts, the body directly is fed again.

Especially with a view to the chronic course of various viral diseases may be necessary that the inventive method for reducing the Virus titers must be repeated at intervals, where frequency and extent depend essentially on the disease course and influenced by the type of viral disease become.

If the Ver driving can be drawn from the plasmatic Compartment on the non-plasmatic compartments of the with patients suffering from a viral disease the consequence that it leads to a therapeutically positive ver strong flushing of viruses from the non-plasmati compartment and for the adjustment of an equilibrium weight between the virus titer in the plasma and in the non-plasmatic compartment at a lower level is coming.

This seems particularly advantageous u. a. in the case of Be act of hepatitis, being a corresponding one Sucked to the liver due to repeated use of the is practiced method according to the invention.

Similar to the advantageous We already described above products containing a high content of CD34-po  have hematopoietic stem cells, this applies also very particularly for the method according to the invention Reduction in virus titer, being in a further relevant sub-step can be provided that before Administration of the virus-free blood components the immune system of the animal organism destroyed or conditio is renated in such a way that starting from the supplied hematopoietic stem and progenitor cells rebuild of the immune system, or parts of it, is possible without that this is affected by viral activity.

In the following the invention with reference to Ausführungsbei play and the accompanying Fig. 1, which is a schematic representation of the device for removing and / or inactivating viruses from / in a fluid comprising particles and viruses, are further explained, from which further Advantages and features of the underlying invention result.

EXAMPLE 1

Although the removal methods described herein and / or inactivation of viruses in principle for all Viruses and virus-like biological systems applied can be, and even those that are chronic virus cause illnesses, the following are the inventions inventive method and Vorrich invention example using the human immunodeficiency virus (HIV) as Representatives of lymphotrophic viruses are presented.

Separation of blood plasma and cellular blood components

In a first step, the plasma and the cellular  ren components of the blood separated. In the present case an apheresis centrifuge was used in which the Blood cell separation on differential centrifugation based and which allows large amounts of nucleated cells accumulate from the peripheral blood. Suitable Vorrich Examples are Fenwal CS 3000 (Baxter) or Haemonetics model V50 (Haemonetics) or COBE Spectra (company COBE). Such devices allow the Processing of 10 to 25 l blood volume in 1 to 3 hours the. The blood introduced into the apheresis device was de treated with anticoagulants to coagulate the To prevent blood during apheresis. After graduation Apheresis can include the plasmatic components as well the cellular components are further processed separately become.

Use the exact boundary conditions for cell extraction centrifugation equipment must be individually adapted to the respective blood batch can be adjusted and hang next to the to be obtained from the respective cell population rheological properties of those to be treated specifically Blood batch off. The setting of the said boundary conditions However, practice is daily practice for those on this Specialist.

Inactivating virions in plasma

The blood plasma obtained from the apheresis is then fed to a treatment with a depth filter, which is shown schematically in FIG. 1.

In biocidal filtration, plasma is replaced by a biocide Filter layer or alternatively through a biocidal filter  layer and a directly downstream, excess Filtered iodine adsorbing layer. The filter layers typically consist of suitable carrier materials such as cellulose or polyolefins or other suitable Substances or a mixture thereof as well as auxiliaries and additives substitutes. Is inertly incorporated into the carrier matrix PVPP iodine, which acts as an active agent.

The viruses are inactivated when they pass through the filter system, while the blood plasma passes through the filter without damage. The functional diagram of a typical biocidal filtration is shown in FIG. 1 using the example of a filtration with two layers.

As can be seen from FIG. 1, virus-containing plasma enters the filter with layers 2 and 3 at the entry point 1 before it emerges again at the exit point 4 as virus-inactivated plasma.

The layers can be in their thickness and their diameter be adapted to the respective application, so that the capacity required for the plasma volume to be filtered is present. The layers are suitable in a holder neter way arranged and can be fixed to a to enable optimal filtration process. This funk tional part can then be encased in a ge suitable, usually for storage or funding of plastic used in blood plasma the, such as used in bags for storing Blood plasma or in dialysis tubes. The sheathing will additionally with connecting hoses and at the end with a suitable coupling for connection to cannulas, Provide collecting container etc. Through this sheathing  thus on the one hand the flow direction of the filtration process given, and on the other hand sterility and corresponding End connection options of the device guaranteed.

In the specific case, this was in a ratio of 24: 1 with ACD anticoagulated plasma, which is still 3000 A. units of heparin per 500 ml of ACD-A anticoagulated plasma were added directly using an electric pump passed over the sterilized filtration apparatus. The Volume flow in the present case was 100 ml plasma / - Min. However, there are also flow rates from 50 to 220 ml Plas ma / min. suitable. Before and after the filtration was carried out in a plasma sample at regular intervals visually the quality of the coagulation factors by means of partial thromboplastin time (PTT) and the quick value and the quantitative concentration of coagulation factor VIII and activated fibrinogen cleavage products examined. Furthermore, the virus concentration, in the present Trap HIV, before and after filtration quantitative and qualitatively with the standard procedures described below examined.

With the aforementioned process step, they were successful HIV virions are removed from the plasma.

In a further step of the application described here Example in the first step were separated cellular plasma components another inactivator step.

The cells obtained by apheresis were washed once with phosphate-buffered saline (PBS) with 0.5% human serum albumin and 5 mM ethylenediaminotetraacetic acid (EDTA) before they were freed from cell aggregates through a sterile 30 μm nylon filter. The cells were then resuspended in 300 μl of this buffer solution per 10 ⁸ white blood cells and subjected to treatment with the filter apparatus, the layer thickness and the filter base area depending on the cell type to be filtered (lymphocytes: approximate diameter 9 to 12 μm and monocytes / macrophages: approximate Diameter 12 to 16 µm) was selected.

For the detection of HI viruses or their replication carried out the following tests:

HIV detection through cocultures

7 days after the removal of the drugs from the culture medium were co-cultivated for 10 ⁷ cells expanded with an identical number of negative PHA-stimulated mononuclear cells of an HIV donor. The culture supernatant was examined twice a week for the presence of HIV by means of the p24 antigen test and the branched DNA test. Fresh PHA stimulated donor cells were added to the cultures once a week. A culture was recognized as positive if the p24 antigen <30 pg / ml or more than 500 virus equivalents / ml was detectable in two consecutive supernatants.

Detection of HIV-DNA using PCR

An aliquot of 10 ⁶ cells from the cell culture was centrifuged in a microcentrifuge and their total cellular DNA was isolated. Non-infected H9 cells and stem cells from a healthy donor produced in the same way were used as negative controls. The samples were used undiluted (60,000 cells per reaction mixture) and in dilutions of 1:10 and 1: 100. HIV-DNA was detected using conserved gag primers using a nested PCR reaction (nested PCR). The HCH2 cell line, which contains one HIV genome per cell, served as a positive control. The following primers were used:

5'gag687: AGAACCAAGGGGAAGTGACATAGCA and
3'gag992: TTACAATCTGGGTTCGCATTTTGG and
3'gag1047: TGCTGTCATCATTTCTTCTAGTGT and
5'LTR768: GCGGAGGCTAGAAGGAGAGAG.

The 5'LTR768 and 3'gag1047 were used for the primary amplification under the following reaction conditions:
2 minutes at 94 ° C (1 cycle), 50 ° C for 2 minutes and 72 ° C for 2 minutes (each cycle). Then 39 cycles of 1 minute at 94 ° C, 1 minute at 50 ° C and 1 minute at 72 ° C were connected. An amplificate of 1068 base pairs was found. The secondary reaction was carried out with 10 μl of the DNA (template) of the first reaction formed using the primers 5'gag687 and 3'gag992. The individual cycles were identical to those described above, the total number of cycles was 30. The analysis of the DNA fragments was carried out in a 1% agarose gel by means of ethyl bromide staining.

Detection of HIV replication using RT-PCR

Sections of the HIV-1 reverse transcriptase gene were from mononuclear cells before treatment in cell culture and amplifi at different times during the culture  adorns to the sensitivity of the reverse transcriptase un ter the selection pressure of the antiretrovirals used To track medication. For this, the RT-PCR was under Use of the following primers used: 5'2536: CACTT TAAATTTTCCCAT and 3'3388: ACATAATTGCCTTACTTTAATC. In the reverse transcriptase PCR, however, was a magnesium con concentration of 1.25 mM and 50 cycles under the above reac conditions used. Here was an 825 bases few pieces of DNA amplified and using the T7 polymerase method sequenced to detect any mutations in the right to recognize transcriptase.

EXAMPLE 2

The following is a method for obtaining a prep rates of CD34-positive stem cells from HIV-positive Described whole blood.

To have the largest possible initial titer of CD34-positive To achieve hematopoietic stem cells, HIV-Pa exposed to a conditioning scheme which from 2 g retrovir per os for 14 days before apheresis treatment and 10 µg / kg body weight granulocyte colony stimulating factor G-CSF for the last 5 days before Apheresis treatment exists. As a result of the surprising Effect of the combination for sequential administration of the compounds mentioned, the number of haemas increased topoietic stem cells in peripheral blood drastically.

The HIV-positive blood thus obtained was as in Example 1 described in blood plasma and cellular blood components separated and the viruses removed or inactivated fourth.  

The CD34-positive stem cells were then selectively isolated from the mixture of white blood cells of the peripheral blood obtained by specific antigen-antibody-mediated immune reactions on the surface of the cells. For this purpose, a commercially available monoclonal antibody (eg clone UBEND / 10 or HPIOA-2) was used, which he knows an epitope of the 115 kDa transmembrane glycoprotein (CD34). This is expressed on 2-4% of the cells present in the bone marrow and has been identified as the earliest marker of the hematopoietic stem cells. This method is also known as positive selection. For this purpose, the population of white blood cells (shown below for <2 × 10 ⁹ mononuclear cells) was mixed with 100 μl of a block reagent (eg F _c fragment of the immunoglobulin G; concentration 1 mg / ml). This blocks the unspecific binding of the monoclonal antibody to be used below against the CD34 antigen to the F _c receptor, which is also expressed on many other than the hematopoietic stem cells. In a second step, the cells were mixed by adding 100 .mu.l of the CD34 antibody, which was coupled to paramagnetic microbeads, and incubated at 4-6 ° C. for 30 minutes. The cell suspension was then placed on the prepared MiniMacs column in a magnetic cell separator. The cells were placed on the column in a concentration of 5 × 10 ⁸ white blood cells and separated from the run by means of pregnancy. The column was then washed four times with 500 ul PBS with 0.5% human serum albumin and 5 mM EDTA. The column was then removed from the magnetic separator and placed in a small sterile tube under a sterile workbench and eluted with 1 ml of the above buffer. This process was repeated once more with a further prepared column in order to achieve a further enrichment of the CD34-positive cells. The cell filtrate from the first run, which contained all leukocytes except CD34-positive stem cells, can in principle be (re) infused into the patient.

That after treatment with the CD34 antibody column he The eluate held was then in the sense of a negative selek tion with a monoclonal antibody (GK1.5) against the Incubated CD4 antigen, which with paramagnetic Micro beads was coupled and over the magnetic column of CD4 positive cells separated. This was necessary to all early progenitor cells carrying the CD4 antigen to remove the cell mixture, since CD4 as the main che receptor molecule for HIV acts.

The purified CD34-positive stem cells thus obtained were then centrifuged for 5 minutes at 1500 rpm and in RPMI 1640 / IMDM 10% (250 ml ISCOVE's modified Dulbec co's medium; 250 ml RPMI 1640; 50 ml 10% human AB serum; 5 ml of a 1M sodium pyruvate solution, 5 ml of a 2 mM L-glutamic acid solution; 5 ml of a 100 U / ml penicillin solution and 0.1 mg / ml streptomycin; 500 µl of a 5 × 10 ⁵ -molar solution of 2-mercaptoethanol) . These cells were propagated in the above-mentioned cell culture medium with the addition of stem cell factor, IL-1, IL-3 and IL-6 in plastic culture bottles with 0.3% agar.

The CD34 positive hematopoietic thus obtained Stem cell-containing preparation was by means of the in HIV detection tests listed in game 1 regarding the Effectiveness of removing or inactivating the HI virus examined and no more HIV viruses could be detected  will be.

EXAMPLE 3

Starting from the CD34-positive described in Example 2 ve preparation containing stem cells, these became expan dated and then differentiated to check whether the ability to differentiate as a result of treatment and thus to build a functional immune system after introduction into a suitable host organism as before.

Expansion of CD34 positive stem cells

For expansion of the stem cells in the various cells 1 µmol zidovudine (AZT Glaxo Wel come), 10 µmol didanosine (DDI, Bristol-Myers Squibb) and 0.6 µmol indinavir (Crixivan, Merck, Sharp & Dohme) added puts. These concentrations were above the IC95 for HIV-stimulated in phytohemagglutinin (PHA) (0.1 µg / ml) mononuclear cells of peripheral blood. The antiretro Viral drugs were used in this concentra tration non-toxic.

After about 2 weeks of cell culture, the number of CD34-positive cells used could be increased by a factor of 30 to 50 (typically to 5 × 10 ⁸ - 5 × 10 ¹⁰ ). After this period, a comprehensive FACS analysis (fluorescence-activated cell sorting) was carried out on an aliquot of the cells. For this purpose, 2 × 10 ⁵ CD34-positive cells with the corresponding antibody, which was conjugated with fluorescein isothiocyanate (FITC) or phyco-erythrin (PE), were used. Antibodies against the following cellular antigens of hematopoietic differentiation were used: CD5, CD7, CD10, CD19, CD20, CD13, CD14, CD15, CD16, CD33, CD38, CD4SRA, CD45R0, CD71 and HLADR. Either clone 12.8 (IgM isotype) or clone ICH3 (isotype IgG2a) was used on CD34 antibodies. The corresponding isotypic controls were carried out as negative controls. After 20 minutes of incubation at 4 ° C., the cells were washed with PBS 1% bovine serum albumin and 50,000 cell events were evaluated.

Progenitor cell examinations

In order to be able to estimate the development of hematopoietic cell lines from the enriched CD34-positive cells, hematopoietic progenitor tests were carried out. For this purpose, 3000 or 10,000 CD34-positive cells / ml were incubated in ISCOVE's methyl cellulose medium with 2 IU erythropoietin / ml and 50 μl PHA-stimulated human conditioned medium with 1% fetal calf serum. 250 µl of this solution were incubated in 24 perforated plates for 14 days at 37 ° C and 5% CO ₂ . The colony forming units of the erythroid line (CFU-E) and the granulocyte / macrophages (CFU-GM) were microscopically reported as the number of colonies / 3000 cells. An individual examination of some methyl cellulose colonies was carried out and these were removed with a micropipette and subjected to the PCR analysis for HIV contamination. Colonies with more than 50 cells were counted as CFU-GM, and more than 3 clones of hemoglobin-containing red blood cells were counted as CFU-E.

Lymphocyte function and proliferation

The lymphocyte function was tested in vitro on functional tests of the hematopoietic CD34-positive stem cells obtained from HIV-containing blood. For this purpose, 10 ⁶ cells / ml in 2 ml of R10 medium in 24 perforated plates were stimulated with either anti-CD3 (clone 12F6) in the concentration of 0.1 μg / ml or PHA (5.0 μg / ml). After 6-48 hours of incubation, the supernatant was examined for cytokines in the interferon-γ and interleukin 4 ELISA according to the manufacturer's instructions.

Lymphocyte proliferation was observed at least 10 days after the last stimulation. In the mixed Lymphocyte reactions were allogeneic, irradiated with 30 Gγ peripheral blood mononuclear cells of HIV negati ven donors in RPMI-1640 medium with 10% human AB serum used in a cell density of 106 cells / ml.

Each 0.1 ml was in the wells of a 96 hole plate with round bottom and 0.1 ml to be tested cultured lymphocytes (106 cells / ml) or with medium moved alone. For mitogen-induced proliferation PHA (10 µg / ml) was added to the cultured lymphocytes in the medium described above (RPMI-1640/10% human AB- Serum) added. The cells were incubated for 5 days and with radiolabelled thymidine (1 µCi / well) incubated overnight. Represent the stimulation indices the ratio of counts in stimulated cultures divided by the counts in unstimulated cultures.  

Cytotoxicity tests

The HIV-specific cytotoxic T cell response was like investigated as follows: B-lymphocyte cell lines were from Pa patient blood by immortalization with the Epstein-Barr Virus established. These were made with recombinant vaccinia viruses infected either the E. coli Lac Z gene or the HIV genes (gag, pol and env) of HIV-1 IIIB express ren. About the natural killer function or the lymphokine To investigate activated killer function, K562 and Daudi cells used as target cells. The target cells were marked with sodium chromate, which radioactive Chromium-51 contained. The effector cells were either auto log mononuclear cells of peripheral blood or the cultured and propagated lymphocytes (especially CD8- Lymphocytes) and became the microtiter plates in one Ratio of 50: 1, 25: 1, 12.5: 1 and 6.25: 1 added. The Controls included medium and target cells alone to control the spontaneous release of the radioactive chromium without speci lysis. The maximum lysis was determined by the Treatment of target cells with detergents was determined. To The cell supernatants were incubated for 4-5 hours at 37 ° C harvested and the number of counts in a γ-counter Right. The relative lysis of the target cells was as follows calculated: percent lysis = ([experimental counts / min. spontaneous counts / min.]: [Maximum release of detergent treatment counts / min. spontaneous release counts / min.]) × 100.

In summary, it can be said that the CD34-positive stem cells obtained in this way visibly their differentiability due to the applied th method according to the invention was not damaged  have and also, as outlined above, according to the invention can be applied.

The in the above description and in the claims Chen disclosed features of the invention can be both as well as in any combination for the tangling chung of the invention in its various embodiments be essential.

Claims (39)

1. A method for removing and / or inactivating viruses from / in a fluid comprising viruses and particles, characterized in that the fluid comprises the filter via a matrix and particles of crosslinked crospovido ne-iodine and / or crospovidone hydrogen peroxide embedded therein to be led. 2. Procedure for removing and / or inactivating Viruses from / in a fluid comprising viruses and particles, characterized in that the particles abge from the fluid be separated and the particle-free fluid at least one times over a matrix and particles embedded in it  cross-linked crospovidone iodine and / or crospovidone water peroxide filter is performed. 3. The method according to claim 1 or 2, characterized net that the particles are cellular blood components. 4. The method according to any one of claims 1 to 3, characterized characterized in that the cellular blood components out are selected from the group that hematopoietic stem and Progenitor cells, erythrocytes, platelets, lymphocytes, Monocytes / macrophages and combinations thereof. 5. The method according to claim 4, characterized in that the cellular components differentiated cells and / or Are stem cells. 6. The method according to claim 5, characterized in that the cellular components are CD34 positive hematopoietic Include stem cells. 7. The method according to any one of claims 1 to 6, characterized characterized in that the fluid is blood. 8. The method according to any one of claims 1 to 7, characterized characterized in that the viruses are selected from the Group who have hepatitis B, hepatitis c, cytomegalic, ep Stein-Barr viruses and human herpes virus, in particular human herpes virus 6, 7 and 8, and human immunodeficiency ciency virus. 9. The method according to any one of claims 1 to 8, characterized characterized that before the particles over the filter based on their physical,  chemical, phenotypic and / or genotypic characteristics len be fractionated. 10. The method according to any one of claims 1 to 9, characterized characterized in that after the particles over the filter based on their physical, chemical, phenotypic and / or genotypic characteristics len be further fractionated. 11. The method according to any one of claims 1 to 10, characterized characterized in that according to one of the methods according to one of the preceding claims obtainable particles Blood cells are and these for multiplication and / or differences stimulation. 12. The method according to claim 11, characterized in that that the blood cells are CD34 positive stem cells. 13. The method according to any one of claims 1 to 12, characterized characterized that the virus and particle comprehensive Fluid is obtained from a mammalian host, and where especially in the mammalian host organism before Ent the fluid containing the viruses and particles Number of hematopoietic cells present in peripheral blood Precursor and stem cells are increased. 14. The method according to claim 13, characterized in that the number of hematopoies present in peripheral blood table precursor and stem cells by administration the mammalian host organism of an agent for increasing the Hematopoietic stem and progenitor cell content in peripheral blood is increased.   15. The method according to any one of claims 1 to 14, characterized characterized in that the mammalian host organism is a human organism. 16. The method according to any one of the preceding claims Production of virus-free blood components from virus blood. 17. Virus-free blood components, including these Comprehensive preparations that can be manufactured according to one of the above the procedure. 18. Device for removing and / or inactivating Viruses from / in a fluid comprising particles and viruses, characterized in that the device at least means for separating the particles from the fluid and a filter device comprising at least one Matrix and embedded particles of cross-linked Crospovidone iodine and / or Crospovidone hydrogen peroxide comprehensive filter includes. 19. The apparatus of claim 18 for use in one Method according to one of the preceding claims. 20. Method of reducing virus titer in body liquids of an animal organism, characterized thereby records that a method according to one of the preceding Claims is used. 21. The method according to claim 20, characterized in that the particles and / or the fluid several times over the Fil ter are performed.   22. The method according to claim 20 or 21, characterized shows that after the passage through the filter tene fluid and / or after passage through the filter obtained particles fed to an animal organism become. 23. The method according to claim 22, characterized in that that the animal organism CD34-positive stem cells be fed. 24. The method according to any one of claims 20 to 23, characterized characterized in that before the supply of cellular blood components in an animal organism the immune system of the animal organism is destroyed. 25. The method according to any one of claims 20 to 24, characterized characterized in that the method for reducing the Virus titers in body fluids of an animal organ nism is repeated at intervals. 26. The method according to any one of claims 20 to 25, characterized characterized that the body fluid is blood. 27. The method according to any one of claims 20 to 26, characterized characterized in that the animal organism is a suckle animal, and especially a human being. 28. The method according to any one of claims 20 to 27, characterized characterized that the animal organism chronically has a viral disease. 29. Means for increasing the content of hematopoietic Stem and progenitor cells in peripheral blood, known  characterized by a content of two for sequential ver submission of certain components, the first compo an antiviral compound and the second Component a combination of at least one antivira len connection and a hematopoietically effective compound includes. 30. Composition according to claim 29, characterized in that the antiviral compound is selected from the group which includes Retrovir®, Ganciclovir and others. 31. A composition according to claim 29 or 30, characterized net that the hematopoietically active compound out is from the group that selects the granulocyte colony includes stimulating factor G-CSF and others. 32. Agent according to one of claims 29 to 31, characterized characterized in that the first component for administration over a period of 10 to 28 days. 33. Agent according to one of claims 29 to 32, characterized characterized in that the second component for administration over a period of 5 to 10 days is. 34. Agent according to one of claims 29 to 33, characterized characterized in that a total of 15 to 38 days for taking the first and second components te is provided. 35. Agent according to one of claims 29 to 34, characterized characterized in that the two components in a ver packing unit spatially separated and assembled  lie, the administration forming the components units can be removed individually. 36. Composition according to claim 35, characterized in that the administration units are daily units. 37. Agent according to one of claims 29 to 36, characterized characterized in that when Retrovir® is the first component and granulocyte colony stimulating factor G-CSF together with Retrovir® is the second component, the first Component 9 daily units of Retrovir, 2 g each for oral use Administration and the second component 5 daily units each consisting of 2 g retrovir for oral administration and 5-20 µg / kg body weight stimulate granulocyte colony is the factor G-CSF. 38. Use of an agent according to one of the preceding Claims in a removal and / or in process activation of viruses from / in a virus and particles around comprehensive fluid and in particular in a process any of the preceding claims. 39. Use of a device for removal and / or Deactivating viruses from / in a particle and viruses comprehensive fluid, in particular according to one of the preceding the claims in a process for reducing the Virus titers in body fluids of an animal organ nism, in particular in a method according to one of the preceding claims.