DE19757984A1

DE19757984A1 - Regulatory DNA sequences from the 5 'region of the gene of the human catalytic telomerase subunit and their diagnostic and therapeutic use

Info

Publication number: DE19757984A1
Application number: DE1997157984
Authority: DE
Inventors: Gustav Dr Hagen; Maresa Dr Wick; Dmitry Dr Zubov
Original assignee: Bayer AG
Current assignee: Bayer AG
Priority date: 1997-12-24
Filing date: 1997-12-24
Publication date: 1999-07-01
Also published as: WO1999033998A3; AU2272999A; AU742489B2; CA2316282A1; JP2003519462A; WO1999033998A2; EP1040195A2

Abstract

The present invention relates to regulatory DNA sequences containing promotor sequences, in addition to intervening sequences, for the human catalytic telomerase sub-unit gene. The invention also relates to the use of said DNA sequences for pharmaceutical, diagnostic and therapeutic purposes, especially in the treatment of cancer and ageing.

Description

Structure and function of the chromosome ends

Das genetische Material eukaryontischer Zellen ist auf linearen Chromosomen verteilt. Die Enden der Erbanlagen werden, abgeleitet von den griechischen Wörtern telos (Ende) und meros (Teil, Segment), als Telomere bezeichnet. Die meisten Telomere bestehen aus Wiederholungen von kurzen Sequenzen, die überwiegend aus Thymin und Guanin aufgebaut sind (Zakian, 1995). In allen bislang untersuchten Wirbeltieren werden die Telomere aus der Sequenz TTAGGG aufgebaut (Meyne et al., 1989).The genetic material of eukaryotic cells is distributed on linear chromosomes. The ends of the genes are derived from the Greek words telos (End) and meros (part, segment), referred to as telomeres. Most telomeres consist of repetitions of short sequences, mostly of thymine and guanine (Zakian, 1995). In all vertebrates examined so far the telomeres are constructed from the sequence TTAGGG (Meyne et al., 1989).

Die Telomere üben verschiedene wichtige Funktionen aus. Sie verhindern die Fusion von Chromosomen (McClintock, 1941) und damit die Entstehung von dizentrischen Erbanlagen. Solche Chromosomen mit zwei Centromeren können durch Verlust der Heterozygotie bzw. Verdopplung oder Verlust von Genen zur Entwicklung von Krebs führen.The telomeres perform various important functions. They prevent the merger of chromosomes (McClintock, 1941) and thus the emergence of dicentric Inheritance. Such chromosomes with two centromeres can be lost Heterozygosity or duplication or loss of genes for the development of Lead cancer.

Des weiteren dienen Telomere dazu, intakte Erbanlagen von beschädigten zu unter scheiden. So stellten Hefezellen ihre Zellteilung ein, wenn sie ein Chromosom ohne Telomer enthielten (Sandell und Zakian, 1993).Furthermore, telomeres serve to intact hereditary systems of damaged ones divorce. This is how yeast cells stop dividing when they have a chromosome without Telomer included (Sandell and Zakian, 1993).

Eine weitere wichtige Aufgabe erfüllen Telomere bei der DNA-Replikation eukaryon tischer Zellen. Im Gegensatz zu den zirkulären Genomen von Prokaryonten können die linearen Chromosomen der Eukaryonten von dem DNA Polymerase-Komplex nicht vollständig repliziert werden. Zur Initiation der DNA-Replikation sind RNA- Primer notwendig. Nach Abspaltung der RNA-Primer, Verlängerung der Okazaki- Fragmente und anschließender Ligation fehlt dem neu-synthetisierten DNA-Strang das 5'-Ende, denn dort kann der RNA-Primer nicht durch DNA ersetzt werden. Ohne besondere Schutzmechanismen würden daher die Chromosomen mit jeder Zellteilung schrumpfen ("end-replication problem"; Harley et al., 1990). Die nicht-kodierenden Telomersequenzen stellen vermutlich eine Pufferzone dar, um dem Verlust von Genen vorzubeugen (Sandell und Zakian, 1993).Telomeres perform another important task in eukaryon DNA replication table cells. In contrast to the circular genomes of prokaryotes can the linear chromosomes of the eukaryotes from the DNA polymerase complex cannot be fully replicated. To initiate DNA replication, RNA Primer necessary. After the RNA primers have been split off, the okazaki The newly synthesized DNA strand lacks fragments and subsequent ligation the 5 'end, because there the RNA primer cannot be replaced by DNA. Without The chromosomes would therefore have special protective mechanisms with each cell division shrink ("end-replication problem"; Harley et al., 1990). The non-coding Telomer sequences are believed to be a buffer zone against the loss of genes prevent (Sandell and Zakian, 1993).

Darüber hinaus spielen Telomere auch eine wichtige Rolle bei der Regulation der zel lulären Alterung (Olovnikov, 1973). Humane somatische Zellen zeigen in Kultur eine limitierte Replikationskapazität; sie werden nach einer gewissen Zeit seneszent. In diesem Zustand teilen sich die Zellen selbst nach Stimulierung mit Wachstumsfaktoren nicht mehr, sterben aber nicht, sondern bleiben metabolisch aktiv (Goldstein, 1990). Verschiedene Beobachtungen sprechen für die Hypothese, daß eine Zelle anhand der Länge ihrer Telomere bestimmt, wie oft sie sich noch teilen kann (Allsopp et al., 1992).In addition, telomeres also play an important role in the regulation of the cell cellular aging (Olovnikov, 1973). Human somatic cells show one in culture limited replication capacity; after a certain time they become senese. In In this state, the cells divide with growth factors even after stimulation no longer, but do not die, but remain metabolically active (Goldstein, 1990). Various observations support the hypothesis that a cell is based on the The length of their telomeres determines how often they can still divide (Allsopp et al., 1992).

Zusammenfassend besitzen die Telomere somit zentrale Funktionen bei der Alterung von Zellen sowie der Stabilisierung des genetischen Materials und Verhinderung von Krebs.In summary, the telomeres have central functions in aging of cells as well as the stabilization of the genetic material and prevention of Cancer.

The enzyme telomerase synthesizes the telomeres

Wie oben beschrieben können Organismen mit linearen Chromosomen ohne einen speziellen Schutzmechanismus ihr Genom nur unvollständig replizieren. Die meisten Eukaryonten verwenden zur Regeneration der Telomersequenzen ein spezielles En zym, die Telomerase. In den bislang untersuchten Einzellern wird Telomerase konsti tutiv exprimiert. Dagegen wurde in Menschen die Telomerase-Aktivität nur in Keim zellen und Tumorzellen gemessen, wogegen benachbartes somatisches Gewebe keine Telomerase enthielt (Kim et al., 1994).As described above, organisms with linear chromosomes can do without one special protective mechanism only partially replicate their genome. Most Eukaryotes use a special ene to regenerate the telomer sequences zym, the telomerase. In the unicellular organisms examined so far, telomerase becomes constant tutively expressed. In contrast, telomerase activity was only in germ in humans cells and tumor cells measured, whereas neighboring somatic tissue none Contained telomerase (Kim et al., 1994).

Funktionell kann die Telomerase auch als terminale Telomertransferase bezeichnet werden, die als Multiproteinkomplex im Zellkern lokalisiert ist. Während der RNA- Anteil der humanen Telomerase schon seit längerem bekannt ist (Feng et al., 1995), wurde kürzlich die katalytische Untereinheit dieser Enzymgruppe in verschiedenen Organismen identifiziert (Lingner et al., 1997; vgl. unsere Anmeldung DE-Akz. 19726329.1). Diese katalytischen Untereinheiten der Telomerase sind sowohl untereinander als auch zu bisher allen bekannten reversen Transkriptasen auffällig homolog.Functionally, the telomerase can also be referred to as terminal telomer transferase be located in the cell nucleus as a multiprotein complex. During the RNA The proportion of human telomerase has been known for a long time (Feng et al., 1995), the catalytic subunit of this enzyme group has recently been Organisms identified (Lingner et al., 1997; see our application DE-Akz. 19726329.1). These catalytic subunits of telomerase are both noticeable among themselves as well as with all known reverse transcriptases homologous.

Activation of telomerase in human tumors

Eine Aktivität der Telomerase konnte in Menschen ursprünglich nur in Keimbahnzel len, nicht aber in normalen somatischen Zellen (Hastie et al., 1990; Kim et al., 1994) nachgewiesen werden. Nach der Entwicklung eines sensitiveren Nachweisverfahrens (Kim et al., 1994) wurde auch in hematopoietischen Zellen eine geringe Telomerase aktivität detektiert (Broccoli et al., 1995; Counter et al., 1995; Hiyama et al., 1995). Allerdings wiesen diese Zellen trotzdem eine Reduktion der Telomere auf (Vaziri et al., 1994; Counter et al., 1995). Noch ist nicht geklärt, ob die Menge an Enzym in diesen Zellen nicht ausreichend für eine Kompensation des Telomerverlustes ist, oder ob die gemessene Telomerase-Aktivität von einer Subpopulation, z. B. unvollständig ausdifferenzierten CD34⁺38⁺-Vorläuferzellen, herrührt (Hiyama et al., 1995). Zur Klärung wäre ein Nachweis der Telomerase-Aktivität in einer einzelnen Zelle nötig.An activity of telomerase in humans was originally only possible in germline cell len, but not in normal somatic cells (Hastie et al., 1990; Kim et al., 1994) be detected. After developing a more sensitive detection method (Kim et al., 1994) also showed low telomerase in hematopoietic cells activity detected (Broccoli et al., 1995; Counter et al., 1995; Hiyama et al., 1995). However, these cells nevertheless showed a reduction in the telomeres (Vaziri et al., 1994; Counter et al., 1995). It is not yet clear whether the amount of enzyme in these cells are not sufficient to compensate for telomer loss, or whether the measured telomerase activity from a subpopulation, e.g. B. incomplete differentiated CD34⁺38⁺ progenitor cells (Hiyama et al., 1995). For Clarification would require proof of telomerase activity in a single cell.

Interessanterweise wurde jedoch in einer großen Zahl der bislang getesteten Tumor gewebe eine signifikante Telomerase-Aktivität nachgewiesen (1734/2031, 85%; Shay, 1997), während in normalem somatischen Gewebe keine Aktivität gefunden wurde (1/196, <1%, Shay, 1997). Verschiedene Untersuchungen zeigten außerdem, daß in seneszenten Zellen, die mit viralen Oncoproteinen transformiert wurden, die Telomere weiterhin schrumpften und Telomerase nur in der Subpopulation entdeckt werden konnte, die die Wachstumskrise überlebte (Counter et al., 1992). In diesen immortali sierten Zellen waren auch die Telomere stabil (Counter et al., 1992). Ähnliche Befunde aus Untersuchungen an Mäusen (Blasco et al., 1996) stützen die Annahme, daß eine Reaktivierung der Telomerase ein spätes Ereignis in der Tumorgenese ist.Interestingly, however, a large number of the tumors tested so far tissue showed significant telomerase activity (1734/2031, 85%; Shay, 1997), while no activity was found in normal somatic tissue (1/196, <1%, Shay, 1997). Various studies also showed that in senescent cells transformed with viral oncoproteins, the telomeres continued to shrink and telomerase could only be discovered in the subpopulation that survived the growth crisis (Counter et al., 1992). In these immortals cells, the telomeres were also stable (Counter et al., 1992). Similar Findings from studies in mice (Blasco et al., 1996) support the assumption that that reactivation of telomerase is a late event in tumorigenesis.

Basierend auf diesen Ergebnissen wurde eine "Telomerase-Hypothese" entwickelt, die den Verlust von Telomersequenzen und Zellalterung mit der Aktivität von Telomerase und der Entstehung von Krebs verbindet. In langlebigen Spezies wie dem Menschen kann das Schrumpfen der Telomere als ein Mechanismus zur Tumorsuppression ange sehen werden. Ausdifferenzierte Zellen, die keine Telomerase enthalten, stellen bei einer bestimmten Länge der Telomere ihre Zellteilung ein. Mutiert eine solche Zelle, so kann aus ihr nur dann ein Tumor entstehen, wenn die Zelle ihre Telomere verlän gern kann. Ansonsten würde die Zelle weiterhin Telomersequenzen verlieren, bis ihre Chromosomen instabil werden und sie schließlich zugrunde geht. Die Reaktivierung der Telomerase ist vermutlich der Hauptmechanismus von Tumorzellen zur Stabilisation ihrer Telomere.Based on these results, a "telomerase hypothesis" was developed that the loss of telomer sequences and cell aging with the activity of telomerase and the development of cancer. In long-lived species like humans can shrink telomeres as a mechanism for tumor suppression will see. Differentiated cells that do not contain telomerase contribute a certain length of the telomeres enter their cell division. Mutates such a cell, a tumor can only develop from it if the cell extends its telomeres like to. Otherwise the cell would continue to lose telomere sequences until its Chromosomes become unstable and they eventually perish. The reactivation The telomerase is believed to be the main mechanism of tumor cells Stabilization of your telomeres.

Aus diesen Beobachtungen und Überlegungen ergibt sich, daß eine Inhibition der Te lomerase eine Therapie von Tumoren erlauben sollte. Konventionelle Krebstherapien mit Zytostatika oder kurzwelligen Strahlen schädigen nicht nur die Tumorzellen, son dern alle sich teilenden Zellen des Körpers. Da aber außer Tumorzellen nur Keim bahnzellen eine signifikante Telomerase-Aktivität enthalten, würden Telomerase-In hibitoren spezifischer die Tumorzellen angreifen und somit weniger unerwünschte Nebenwirkungen hervorrufen. In allen bislang getesteten Tumorgeweben wurde eine Telomerase-Aktivität nachgewiesen, so daß diese Therapeutika gegen alle Krebsarten eingesetzt werden könnten. Die Wirkung von Telomerase-Inhibitoren würde dann eintreten, wenn die Telomere der Zellen sich soweit verkürzt haben, daß das Genom instabil wird. Da Tumorzellen meist kürzere Telomere aufweisen als normale somati sche Zellen, würden zuerst Krebszellen durch Telomerase-Inhibitoren eliminiert wer den. Zellen mit langen Telomeren, wie die Keimzellen, würden dagegen erst viel spä ter geschädigt werden. Telomerase-Inhibitoren stellen somit einen zukunftsweisenden Weg für die Therapierung von Krebs dar.From these observations and considerations it follows that an inhibition of the Te lomerase should allow therapy for tumors. Conventional cancer therapies with cytostatics or short-wave radiation not only damage the tumor cells, son all the dividing cells of the body. But since only tumor cells apart from tumor cells cells would contain significant telomerase activity, telomerase-in hibitors attack the tumor cells more specifically and therefore less undesirable Cause side effects. One was found in all tumor tissues tested to date Telomerase activity detected, making these therapeutics against all cancers could be used. The effect of telomerase inhibitors would then be occur when the telomeres of the cells have shortened to such an extent that the genome becomes unstable. Since tumor cells usually have shorter telomeres than normal somati cells, cancer cells would first be eliminated by telomerase inhibitors the. Cells with long telomeres, like the germ cells, would only be much late be damaged. Telomerase inhibitors are therefore a pioneering one Way for cancer therapy.

Eindeutige Antworten auf die Frage nach der Art und den Angriffspunkten physiolo gischer Telomerase-Inhibitoren werden möglich sein, wenn auch die Regulation der Genexpression der Telomerase identifiziert ist.Clear answers to the question about the type and the points of attack physiolo of telomerase inhibitors will be possible, although the regulation of Gene expression of telomerase is identified.

Regulation of gene expression in eukaryotes

Die eukaryotische Genexpression, d. h. der zelluläre Informationsfluß von der DNA über die RNA zum Protein, weist vielfältige Ansatzpunkte für regulatorische Mecha nismen auf. Einzelne Kontrollstufen sind z. B. die Gen-Amplifikation, Rekombination von Genloci, Chromatinstruktur, DNA-Methylierung, Transkription, posttranskrip tionelle mRNA-Modifikationen, mRNA-Transport, Translation und post-translatio nale Proteinmodifikationen. Nach bisherigen Studien besitzt die Kontrolle auf der Ebene der Transkriptionsinitiation die größte Bedeutung (Latchnian, 1991).Eukaryotic gene expression, i.e. H. the cellular flow of information from DNA via RNA to protein, has diverse starting points for regulatory mecha nisms. Individual control levels are e.g. B. gene amplification, recombination of gene loci, chromatin structure, DNA methylation, transcription, post-transcription tional mRNA modifications, mRNA transport, translation and post-translatio nale protein modifications. According to previous studies, the control on the Level of transcription initiation of greatest importance (Latchnian, 1991).

Unmittelbar stromaufwärts vom Transkriptionsstart eines von der RNA-Polymerase II transkribierten Gens liegt eine Region, die für die Steuerung der Transkription ver antwortlich ist und als Promotorregion bezeichnet wird. Ein Vergleich der Nukleo tidsequenzen von Promotorregionen vieler bekannter Gene zeigt, daß bestimmte Sequenzmotive in dieser Region häufig vorkommen. Zu diesen Elementen gehören unter anderem die TATA-Box, die CCAAT-Box und die GC-Box, die von spezifi schen Proteinen erkannt werden. Die TATA-Box, die etwa 30 Nukleotide stromauf wärts vom Transkriptionsstart entfernt positioniert ist, wird z. B. von der TFIID- Untereinheit TBP ("TATA-box binding protein") erkannt, wogegen bestimmte GC-reiche Sequenzabschnitte vom Transkriptionsfaktor Sp1 ("specificity protein1") spe zifisch gebunden werden.Immediately upstream of the start of transcription of one of RNA polymerase II transcribed gene lies a region that ver for controlling the transcription is responsible and is referred to as the promoter region. A comparison of the nucleo tid sequences of promoter regions of many known genes shows that certain Sequence motifs are common in this region. These elements include among others the TATA-Box, the CCAAT-Box and the GC-Box, which by specifi proteins are recognized. The TATA box, which is about 30 nucleotides upstream is positioned away from the transcription start, z. B. from the TFIID Subunit TBP ("TATA-box binding protein") recognized, whereas certain GC-rich Sequence sections of the transcription factor Sp1 ("specificity protein1") spe be bound specifically.

Funktionell kann man den Promotor in einen regulativen und einen konstitutiven Ab schnitt unterteilen (Latchman, 1991). Der konstitutive Kontrollbereich umfaßt den sogenannten Kernpromotor ("corepromoter"), der die korrekte Initiation der Trans kription ermöglicht. Er enthält die als UPE's (upstream promoter elements") beschrie benen Sequenzelemente, die für eine effiziente Transkription notwendig sind. Die regulativen Kontrollabschnitte, die mit den UPE's verflochten sein können, weisen Sequenzelemente auf, die an der signalabhängigen Regulation der Transkription durch Hormone, Wachstumsfaktoren usw. beteiligt sein können. Sie vermitteln gewebs- oder zellspezifische Promotoreigenschaften.Functionally, the promoter can be divided into a regulatory and a constitutive Ab cut into sections (Latchman, 1991). The constitutive control area includes the So-called core promoter ("core promoter"), which ensures the correct initiation of the trans enables. It contains those described as UPE's (upstream promoter elements ") The sequence elements that are necessary for efficient transcription. The regulatory control sections that may be intertwined with the UPE's Sequence elements that are involved in the signal-dependent regulation of transcription Hormones, growth factors, etc. may be involved. They mediate tissue or cell-specific promoter properties.

Ein charakteristisches Merkmal eukaryotischer Gene sind DNA-Abschnitte, die über vergleichsweise große Distanzen hinweg Einfluß auf die Genexpression nehmen kön nen. Diese Elemente können stromaufwärts, stromabwärts oder innerhalb einer Transkriptionseinheit lokalisiert sein und unabhängig von ihrer Orientierung ihre Funktion wahrnehmen. Diese Sequenzabschnitte können die Promotoraktivität ver stärken (Enhancer) oder ab schwächen (Silencer). Ähnlich wie die Promotorregionen beherbergen auch Enhancer und Silencer mehrere Bindungsstellen für Transkriptions faktoren.A characteristic feature of eukaryotic genes are DNA segments that cross over comparatively large distances can influence gene expression nen. These elements can be upstream, downstream or within one Transcription unit and be localized regardless of their orientation Perform function. These sequence sections can ver the promoter activity strengthen (enhancer) or weaken (silencer). Similar to the promoter regions Enhancer and Silencer also harbor several binding sites for transcription factors.

Die Erfindung betrifft die DNA-Sequenzen aus der 5'-flankierenden Region des Gens der katalytisch aktiven humanen Telomerase-Untereinheit.The invention relates to the DNA sequences from the 5'-flanking region of the gene the catalytically active human telomerase subunit.

Die Erfindung betrifft weiterhin die 5'-flankierende regulatorische DNA-Sequenz, enthaltend die Promotor-DNA-Sequenz für das Gen der humanen katalytischen Telomerase Untereinheit gemäß Fig. 4.The invention further relates to the 5'-flanking regulatory DNA sequence containing the promoter DNA sequence for the gene of the human catalytic telomerase subunit according to FIG. 4.

Die Erfindung betrifft weiterhin regulatorisch wirksame Teilbereiche der 5'-flankie renden regulatorischen DNA-Sequenz gemäß Fig. 4.The invention further relates to regulatory regions of the 5'-flanking regulatory DNA sequence according to FIG. 4.

Die Erfindung betrifft weiterhin ein rekombinantes Konstrukt, das die 5'-flankierende DNA-Sequenz des Gens der humanen katalytischen Telomerase Untereinheit oder Teilbereiche davon beinhaltet.The invention further relates to a recombinant construct which is the 5'-flanking DNA sequence of the human catalytic telomerase subunit or gene Part of it includes.

Bevorzugt sind rekombinante Konstrukte, die neben der 5'-flankierenden DNA- Sequenz des Gens der humanen katalytischen Telomerase Untereinheit oder Teilberei chen davon eine oder mehrere weitere DNA-Sequenzen, die für Polypeptide oder Pro teine kodieren, enthalten.Recombinant constructs are preferred which, in addition to the 5'-flanking DNA Sequence of the human catalytic telomerase subunit or partial gene gene Chen one or more other DNA sequences, which are for polypeptides or Pro encode teine.

Gemäß einer besonders bevorzugten Ausführungsform kodieren diese weiteren DNA- Sequenzen für antitumorale Proteine.According to a particularly preferred embodiment, these further DNA Sequences for antitumor proteins.

Besonders bevorzugte antitumorale Proteine sind solche, die die Angiogenese direkt oder indirekt inhibieren. Zu diesen Proteinen zählen beispielsweise:
Plasminogenaktivatorinhibitor (PAI-1), PAI-2, PM-3, Angiostatin, Endostatin, Platelet factor 4, TIMP-1, TIMP-2, TIMP-3, Leukemia Inhibitory Factor (LIF).Particularly preferred antitumor proteins are those which directly or indirectly inhibit angiogenesis. These proteins include, for example:
Plasminogen activator inhibitor (PAI-1), PAI-2, PM-3, angiostatin, endostatin, platelet factor 4, TIMP-1, TIMP-2, TIMP-3, leukemia inhibitory factor (LIF).

Ebenfalls besonders bevorzugt sind antitumorale Proteine, welche direkt oder indirekt eine zytostatische Wirkung auf Tumoren aufweisen. Hierzu zählen im besonderen:
Perforin, Granzym, IL-2, IL-4, IL-12, Interferone, wie beispielsweise IFN-α, IFN-β, IFN-γ, TNF, TNF-α, TNF-β, Oncostatin M; Tumorsuppressorgene, wie z. B. p53, Retinoblastoma.Antitumor proteins which have a cytostatic effect on tumors directly or indirectly are also particularly preferred. These include in particular:
Perforin, granzyme, IL-2, IL-4, IL-12, interferons, such as, for example, IFN-α, IFN-β, IFN-γ, TNF, TNF-α, TNF-β, Oncostatin M; Tumor suppressor genes, such as B. p53, retinoblastoma.

Weiterhin besonders bevorzugt sind antitumorale Proteine, welche gegebenenfalls zusätzlich zur antitumoralen Wirkung Entzündungen stimulieren und hierdurch zur Elimination von Tumorzellen beitragen. Hierzu zählen beispielsweise:
RANTES, Monocyte chemotactic and activating factor (MCAF), IL-8, Macrophage inflammatory protein (MIP-1α, -β), Neutrophil activating protein-2 (NAP-2), IL-3, IL-5, human leukemia inhibitory factor (LIF), IL-7, IL-11, IL-13, GM-CSF, G-CSF, M-CSF.Also particularly preferred are antitumor proteins, which optionally stimulate inflammation in addition to the antitumor effect and thereby contribute to the elimination of tumor cells. These include, for example:
RANTES, Monocyte chemotactic and activating factor (MCAF), IL-8, Macrophage inflammatory protein (MIP-1α, -β), Neutrophil activating protein-2 (NAP-2), IL-3, IL-5, human leukemia inhibitory factor (LIF), IL-7, IL-11, IL-13, GM-CSF, G-CSF, M-CSF.

Weiterhin besonders bevorzugt sind antitumorale Proteine, welche aufgrund ihrer Wirkung als Enzyme in der Lage sind, Vorstufen eines antitumoralen Wirkstoffes in einen antitumoralen Wirkstoff zu überführen. Zu diesen Enzymen zählen beispiels weise:
Herpes Simplex Virus Thymidinkinase, Varizella Zoster Virus Thymidinkinase, bak terielle Nitroreductase, bakterielle β-Glukuronidase, pflanzliche β-Glukuronidase aus Secale careale, humane Glukuronidase, humane Carboxypeptidase, bakterielle Car boxypeptidase, bakterielle β-Lactamase, bakterielle Cytosindeaminidase, humane Katalase bzw. Phosphatase, humane alkalische Phosphatase, Typ 5 saure Phosphatase, humane Lysooxidase, humane saure D-Aminooxidase, humane Glutathion Peroxidase, humane Eosinophilen Peroxidase, humane Schilddrüsen Peroxidase.Also particularly preferred are antitumor proteins which, because of their action as enzymes, are able to convert precursors of an antitumor agent into an antitumor agent. These enzymes include, for example:
Herpes simplex virus thymidine kinase, varicella zoster virus thymidine kinase, bacterial nitroreductase, bacterial β-glucuronidase, plant β-glucuronidase from Secale careale, human glucuronidase, human carboxypeptidase, bacterial car boxypeptidase, bacterial β-aminasease, bacterial β-aminasease, bacterial β-leaminase , human alkaline phosphatase, type 5 acid phosphatase, human lysooxidase, human acid D-aminooxidase, human glutathione peroxidase, human eosinophil peroxidase, human thyroid peroxidase.

Die obengenannten rekombinanten Konstrukte können auch DNA-Sequenzen enthal ten, die für ein Reporterprotein kodieren. Zu diesen Reporterproteinen zählen bei spielsweise:
Chloramphenicolacetyltransferase (CAT), Glühwürmchen Luziferase (LUC), β-Galak tosidase (β-Gal), Sezernierte alkalische Phosphatase (SEAP), Humanes Wachstums hormon (hGH), β-Glukuronidase (GUS), Grün-fluoreszierendes Protein (GFP) und alle davon abgeleiteten Varianten, Aquarin, Obelin.The recombinant constructs mentioned above can also contain DNA sequences which code for a reporter protein. These reporter proteins include, for example:
Chloramphenicol acetyl transferase (CAT), firefly luciferase (LUC), β-galactosidase (β-Gal), secreted alkaline phosphatase (SEAP), human growth hormone (hGH), β-glucuronidase (GUS), green fluorescent protein (GFP) and all derived variants, aquarin, obelin.

Die rekombinanten Konstrukte können neben der DNA, kodierend für die humane katalytische Telomerase Untereinheit, sowie deren Varianten und Fragmente auch andere Protein-Untereinheiten der humanen Telomerase und die Telomerase-RNA- Komponente enthalten.The recombinant constructs can, in addition to the DNA, code for the human Catalytic telomerase subunit, as well as their variants and fragments other protein subunits of human telomerase and the telomerase RNA Component included.

Erfindungsgemäße rekombinante Konstrukte können auch DNA kodierend für die humane katalytische Telomerase Untereinheit und deren Varianten und Fragmente in antisense Orientierung enthalten. Gegebenenfalls können diese Konstrukte auch andere Protein-Untereinheiten der humanen Telomerase und die Telomerase-RNA- Komponente in antisense Orientierung enthalten.Recombinant constructs according to the invention can also encode the DNA human catalytic telomerase subunit and its variants and fragments in antisense orientation included. If necessary, these constructs can also other protein subunits of human telomerase and the telomerase RNA Component in antisense orientation included.

Die Erfindung betrifft weiterhin einen Vektor, enthaltend die oben genannten 5'-flan kierenden DNA-Sequenzen, sowie eine oder mehrere der oben genannten DNA- Sequenzen.The invention further relates to a vector containing the above 5'-flan DNA sequences, as well as one or more of the above-mentioned DNA Sequences.

Bevorzugter Vektor für solche Konstrukte ist ein Virus, beispielsweise ein Retrovirus, Adenovirus, adeno-assoziiertes Virus, Herpes Simplex Virus, Vaccina Virus, len tivirales Virus, Sindbis Virus und ein Semliki Forest Virus.The preferred vector for such constructs is a virus, for example a retrovirus, Adenovirus, adeno-associated virus, herpes simplex virus, vaccina virus, len tiviral virus, Sindbis virus and a Semliki Forest virus.

Ebenfalls bevorzugt sind Plasmide als Vektoren.Plasmids are also preferred as vectors.

Pharmazeutische Präparate, enthaltend erfindungsgemäße rekombinante Konstrukte bzw. Vektoren; beispielsweise eine Zubereitung in einem kolloidalen Dispersions system.Pharmaceutical preparations containing recombinant constructs according to the invention or vectors; for example a preparation in a colloidal dispersion system.

Geeignete kolloidale Dispersionssysteme sind beispielsweise Liposome oder Polyly sin-Liganden. Suitable colloidal dispersion systems are, for example, liposomes or polylys sin ligands.

Die Zubereitungen der erfindungsgemäßen Konstrukte bzw. Vektoren in kolloidalen Dispersionssystemen können um einen Liganden ergänzt sein, der an Membranstruk turen von Tumorzellen bindet. Ein solcher Ligand kann z. B. an das Konstrukt bzw. den Vektor angeknüpft sein oder auch Bestandteil der Liposomenstruktur sein.The preparations of the constructs or vectors according to the invention in colloidal Dispersion systems can be supplemented by a ligand that is attached to membrane structure tures of tumor cells binds. Such a ligand can e.g. B. the construct or the vector be attached or also be part of the liposome structure.

Geeignete Liganden sind insbesondere polyklonale oder monoklonale Antikörper oder Antikörperfragmente hiervon, die mit ihren variablen Domänen an Membranstruktu ren von Tumorzellen binden, oder endständige Mannose-tragende Substanzen, Zyto kine, Wachstumsfaktoren oder Fragmente bzw. Teilsequenzen hiervon, die an Rezep toren auf Tumorzellen binden.Suitable ligands are, in particular, polyclonal or monoclonal antibodies or Antibody fragments thereof, which with their variable domains on membrane structure bind tumor cells, or terminal mannose-bearing substances, cyto kine, growth factors or fragments or partial sequences thereof which are linked to recipe bind gates to tumor cells.

Entsprechende Membranstrukturen sind beispielsweise Rezeptoren für ein Zytokin oder einen Wachstumsfaktor, wie z. B. IL-1, EGF, PDGF, VEGF, TGF β, Insulin oder Insulin-like Growth Factor (ILGF), oder Adhäsionsmoleküle, wie z. B. SLeX, LFA-1, MAC-1, LECAM-1 oder VLA-4, oder der Mannose-6-Phosphat-Rezeptor.Corresponding membrane structures are, for example, receptors for a cytokine or a growth factor such as B. IL-1, EGF, PDGF, VEGF, TGF β, insulin or Insulin-like growth factor (ILGF), or adhesion molecules, such as e.g. B. SLeX, LFA-1, MAC-1, LECAM-1 or VLA-4, or the mannose 6 phosphate receptor.

Zur vorliegenden Erfindung gehören pharmazeutische Zubereitungen, die neben den erfindungsgemäßen Vektorkonstrukten auch nichttoxische, inerte, pharmazeutisch geeignete Trägerstoffe enthalten können. Vorstellbar sind die Applikation (z. B. intra venös, intraarteriell, intramuskulär, subkutan, intradermal, anal, vaginal, nasal, trans dermal, intraperitonal, als Aerosol oder oral) am Ort eines Tumors oder die syste mische Applikation dieser Zubereitungen.The present invention includes pharmaceutical preparations which in addition to Vector constructs according to the invention also non-toxic, inert, pharmaceutical can contain suitable carriers. The application is conceivable (e.g. intra venous, intraarterial, intramuscular, subcutaneous, intradermal, anal, vaginal, nasal, trans dermal, intraperitoneal, as aerosol or oral) at the site of a tumor or the syste mix application of these preparations.

Die erfindungsgemäßen Vektorkonstrukte können in der Gentherapie eingesetzt wer den.The vector constructs according to the invention can be used in gene therapy the.

Die Erfindung betrifft weiterhin eine rekombinante Wirtszelle, insbesondere eine rekombinante eukaryotische Wirtszelle, enthaltend die vorstehend beschriebenen Kon strukte bzw. Vektoren.The invention further relates to a recombinant host cell, in particular one recombinant eukaryotic host cell containing the Kon described above structures or vectors.

Die Erfindung betrifft weiterhin ein Verfahren zur Identifizierung von Substanzen, die die Promotor-, Silencer- oder Enhanceraktivität der katalytischen Telomerase Unter einheit beeinflussen, wobei diese Methode beihaltet:
The invention further relates to a method for identifying substances which influence the promoter, silencer or enhancer activity of the catalytic telomerase subunit, this method comprising:

A. Add a candidate substance to a host cell containing the 5'-flankie regulatory DNA sequence for the human catalytic gene Telomerase subunit or a regulatory sub-area of which, functionally linked to a reporter gene,
B. Measurement of the substance effect on reporter gene expression.

Das Verfahren kann eingesetzt werden zur Identifizierung von Substanzen, die die Promotor-, Silencer- oder Enhanceraktivität der katalytischen Telomerase Unterein heit verstärken.The method can be used to identify substances that are Promoter, silencer or enhancer activity of catalytic telomerase reinforce.

Das Verfahren kann weiterhin eingesetzt werden zur Identifizierung von Substanzen, die die Promotor-, Silencer- oder Enhanceraktivität der katalytischen Telomerase Untereinheit inhibieren.The method can also be used to identify substances which are the promoter, silencer or enhancer activity of catalytic telomerase Inhibit subunit.

Die Erfindung betrifft weiterhin ein Verfahren zur Identifizierung von Faktoren, die spezifisch an Fragmente der 5'-flankierenden regulatorischen DNA-Sequenz der kata lytischen Telomerase Untereinheit binden. Diese Methode beinhaltet ein Screening einer Expressions-cDNA-Bibliothek mit der vorstehend beschriebenen DNA-Sequenz oder Teilfragmenten unterschiedlichster Länge als Sonde.The invention further relates to a method for identifying factors that specifically on fragments of the 5'-flanking regulatory DNA sequence of the kata bind lytic telomerase subunit. This method involves screening an expression cDNA library with the DNA sequence described above or partial fragments of different lengths as a probe.

Die vorstehend beschriebenen Konstrukte bzw. Vektoren können auch zur Her stellung transgener Tiere verwendet werden.The constructs or vectors described above can also be used position of transgenic animals can be used.

Die Erfindung betrifft weiterhin ein Verfahren zur Detektion Telomerase-assoziierter Zustände in einem Patienten, das folgende Schritte umfaßt:
The invention further relates to a method for detecting telomerase-associated conditions in a patient, which comprises the following steps:

A. Incubation of a construct or vector containing the 5 'flanking regulatory DNA sequence for the human catalytic telo gene merase subunit or a regulatory sub-range thereof as well as a reporter gene with body fluids or cellular samples,
B. detection of reporter gene activity to obtain a diagnostic value;
C. Comparison of diagnostic value with standard values for the reporter gene constructed in standardized normal cells or body fluids of the same type as the test sample;
D. Detection of diagnostic values that are higher or lower than standard comparison values indicate a telomerase-associated state, which in turn is pathogenic indicated condition.

Explanation of the pictures

Fig. 1: Southern Blot-Analyse mit genomischer DNA verschiedener Spezies, Fig. 1: Southern blot analysis of genomic DNA of different species,

Abb. 1: Foto eines Ethidiumbromid gefärbten 0,7%igen Agarosegels mit etwa 4 µg Eco RI geschnittener genomischer DNA. Die Spur 1 enthält Hind III geschnittene λ-DNA als Größenmarker (23,5, 9,4, 6,7, 4,4, 2,3, 2,0, und 0,6 kb). Die Spuren 2 bis 10 enthalten genomische DNA von Mensch, Rhesusaffe, Spraque Dawley Ratte, BALB/c Maus, Hund, Rind, Kaninchen, Huhn und Hefe (Saccharomyces cerevisiae). Fig. 1: Photo of an ethidium bromide stained 0.7% agarose gel with about 4 µg Eco RI cut genomic DNA. Lane 1 contains Hind III cut λ DNA as size markers (23.5, 9.4, 6.7, 4.4, 2.3, 2.0, and 0.6 kb). Lanes 2 to 10 contain genomic DNA from human, rhesus monkey, Spraque Dawley rat, BALB / c mouse, dog, cattle, rabbit, chicken and yeast (Saccharomyces cerevisiae).

Abb. 2: Zu Fig. 1, Abb. 1 korrespondierendes Autoradiogramm einer Southern- Blot-Analyse, hybridisiert mit einer radioaktiv-markierten 1233 bp langen hTC-cDNA Sonde. Fig. 2: Autoradiogram of a Southern blot analysis corresponding to Fig. 1, Fig. 1, hybridized with a radioactive-labeled 1233 bp long hTC cDNA probe.

Fig. 2: Restriktionsanalyse der rekombinanten B-DNA des Phagenklons, der mit einer Sonde aus dem 5'-Bereich der hTC-cDNA hybridisiert. Fig. 2: Restriction analysis of the recombinant B-DNA of the phage clone that hybridizes with a probe from the 5 'region of the hTC cDNA.

Die Abbildung zeigt ein Foto eines Ethidiumbromid gefärbten 0,4%igen Agarosegels. Die Spuren 1 und 2 enthalten Eco RI/Hind III geschnittene λ- DNA bzw. eine 1 kb Leiter der Firma Gibco als Größenmarker. Die Spuren 3-7 enthalten 250 ng mit Bam HI (Spur 3), Eco RI (Spur 4), Sal I (Spur 5), Xho I (Spur 6) und Sac I (Spur 7) geschnittene DNA des rekombinanten Phagens. Die Pfeile kennzeichnen die zwei λ-Arme des Vektors EMBL3 Sp6/T7.The picture shows a photo of an ethidium bromide stained 0.4% agarose gel. Lanes 1 and 2 contain Eco RI / Hind III cut λ-DNA or a 1 kb ladder from Gibco as a size marker. Lanes 3-7 contain 250 ng of recombinant phage DNA cut with Bam HI (lane 3 ), Eco RI (lane 4 ), Sal I (lane 5 ), Xho I (lane 6 ) and Sac I (lane 7 ). The arrows indicate the two λ arms of the vector EMBL3 Sp6 / T7.

Fig. 3: Restriktionsanalyse und Southern Blot-Analyse der rekombinanten B-DNA des Phagenklons, der mit einer Sonde aus dem 5'-Bereich der hTC-cDNA hybri disiert. Fig. 3: Restriction analysis and Southern blot analysis of the recombinant B-DNA of the phage clone, which hybridizes with a probe from the 5 'region of the hTC cDNA.

Abb. 1: Die Abbildung zeigt ein Foto eines Ethidiumbromid gefärbten 0,8%igen Agarosegels. Die Spuren 1 und 15 enthalten eine 1 kb Leiter der Firma Gibco als Größenmarker. Die Spuren 2 bis 14 enthalten 250 ng geschnittene λ-DNA vom rekombinanten Phagenklon. Als Enzyme wurden eingesetzt: Spur 2: Sac I, Spur 3: Xho I, Spur 4: Xho I, Xba I, Spur 5: Sac I, Xho I, Spur 6: Sal I, Xho I, Xba I, Spur 7: Sac I, Xho I, Xba I, Spur 8: Sac I, Sal I, Xba I, Spur 9: Sac I, Sal I, BamH I, Spur 10: Sac I, Sal I, Xho I, Spur 11: Not I, Spur 12: Sma I, Spur 13: leer, Spur 14: nicht verdaut. Fig. 1: The picture shows a photo of an ethidium bromide stained 0.8% agarose gel. Lanes 1 and 15 contain a 1 kb ladder from Gibco as a size marker. Lanes 2 to 14 contain 250 ng cut λ-DNA from the recombinant phage clone. Enzymes were used: Lane 2 : Sac I, Lane 3 : Xho I, Lane 4 : Xho I, Xba I, Lane 5 : Sac I, Xho I, Lane 6 : Sal I, Xho I, Xba I, Lane 7 : Sac I, Xho I, Xba I, lane 8 : Sac I, Sal I, Xba I, lane 9 : Sac I, Sal I, BamH I, lane 10 : Sac I, Sal I, Xho I, lane 11 : Not I , Track 12 : Sma I, track 13 : empty, track 14 : not digested.

Abb. 2: Zu Fig. 3, Abb. 1 korrespondierendes Autoradiogramm einer Southern- Blot-Analyse. Als Sonde für die Hybridisierung wurde ein 434 bp langes 5'-hTC-cDNA Fragment eingesetzt. Fig. 2: Autoradiogram of a Southern blot analysis corresponding to Fig. 3, Fig. 1. A 434 bp 5'-hTC cDNA fragment was used as a probe for the hybridization.

Fig. 4: DNA-Sequenz der 5'-flankierenden Region und des Promotors vom Gen der humanen katalytischen Telomerase-Untereinheit. Das ATG-Startcodon ist in der Sequenz fett hervorgehoben. Fig. 4: DNA sequence of the 5 'flanking region and the promoter of the gene of the human catalytic telomerase subunit. The ATG start codon is highlighted in bold in the sequence.

Fig. 5: Identifizierung des Transkriptionsstarts durch Primer Extension-Analyse. Fig. 5: Identification of the transcription start by primer extension analysis.

Die Abbildung zeigt ein Autoradiogramm eines denaturierenden Polyacryl amidgels, welches zur Darstellung einer Primer Extension-Analyse gewählt wurde. Als Primer wurde ein Oligonukleotid mit der Sequenz 5'GTTAAGTTGTAGCTTACACTGGTTCTC 3' benutzt. In der Spur 1 wurde die Primer Extension Reaktion aufgetragen. Die Spuren G, A, T, C, stellen die Sequenzreaktionen mit dem gleichen Primer und den entsprechen den Dideoxynukleotiden dar. Der fette Pfeil kennzeichnet den Haupt-Trans kriptionsstart, die dünnen Pfeile weisen auf drei Neben-Transkriptionsstart punkte hin.The figure shows an autoradiogram of a denaturing polyacrylic amide gel, which was chosen to display a primer extension analysis. An oligonucleotide with the sequence 5 'GTTAAGTTGTAGCTTACACTGGTTCTC 3' was used as primer. The primer extension reaction was plotted in lane 1. Lanes G, A, T, C, represent the sequence reactions with the same primer and the corresponding dideoxynucleotides. The bold arrow indicates the main transcription start, the thin arrows indicate three secondary transcription start points.

Examples

Die 5'-flankierende Sequenz des menschlichen Gens für die katalytische Telomerase Untereinheit (ghTC) wurde kloniert, der Startpunkt der Transkription bestimmt und potentielle Bindungsstellen für DNA-bindende Proteine identifiziert.The 5 'flanking sequence of the human gene for catalytic telomerase Subunit (ghTC) was cloned, the starting point of the transcription was determined and potential binding sites for DNA-binding proteins have been identified.

example 1

Durch eine genomische Southern Blot-Analyse wurde bestimmt, ob ghTC im mensch lichen Genom ein Einzelgen darstellt oder mehrere Loci für das hTC-Gen bzw. even tuell auch ghTC-Pseudogene existieren.A genomic Southern blot analysis determined whether ghTC in humans genome is a single gene or multiple loci for the hTC gene or even ghTC pseudogenes also currently exist.

Hierzu wurde ein kommerziell erhältlicher Zoo-Blot der Firma Clontech einer Southern Blot-Analyse unterzogen. Dieser Blot enthält 4 µg Eco RI geschnittene genomische DNA von neun verschiedenen Spezies (Mensch, Affe, Ratte, Maus, Hund, Rind, Kaninchen, Huhn und Hefe). Mit Ausnahme von Hefe, Huhn und Mensch wurde die DNA aus Nierengewebe isoliert. Die humane genomische DNA wurde aus Plazenta isoliert und die genomische DNA aus Huhn wurde aus Leberge webe aufgereinigt. Im Autoradiogramm in Fig. 1 wurde als radioaktiv-markierte Sonde ein 1233 bp langes hTC-cDNA Fragment eingesetzt. Die experimentellen Bedingungen für die Hybridisierung und die Waschschritte des Blots erfolgten in Anlehnung an Ausubel et al. (1987).For this purpose, a commercially available zoo blot from Clontech was subjected to a Southern blot analysis. This blot contains 4 µg Eco RI cut genomic DNA from nine different species (human, monkey, rat, mouse, dog, cattle, rabbit, chicken and yeast). With the exception of yeast, chicken and human, DNA was isolated from kidney tissue. The human genomic DNA was isolated from placenta and the chicken genomic DNA was purified from liver tissue. In the autoradiogram in FIG. 1, a 1233 bp long hTC cDNA fragment was used as the radio-labeled probe. The experimental conditions for the hybridization and the washing steps of the blot were based on Ausubel et al. (1987).

Im Fall der humanen DNA erkennt die Sonde zwei spezifische DNA-Fragmente. Das kleinere, etwa 1,5 bis 1,8 kb lange Eco RI-Fragment geht wahrscheinlich auf zwei Eco RI-Schnittstellen in einem Intron der ghTC-DNA zurück. Aufgrund dieses Ergebnisses ist davon auszugehen, daß nur ein singuläres ghTC-Gen im menschlichen Genom vorliegt.In the case of human DNA, the probe recognizes two specific DNA fragments. The the smaller, about 1.5 to 1.8 kb long Eco RI fragment is probably two Eco RI cleavage sites in an intron of ghTC DNA. Because of this The result can be assumed that only a singular ghTC gene in the human Genome is present.

Example 2

Zur Isolierung der 5'flankierenden hTC-Gensequenz wurden ca. 1,5 × 10⁶ Phagen einer humanen genomischen Plazenta-Genbibliothek mit einem radioaktiv markierten, 506 bp langen 5'-hTC-cDNA Fragment hybridisiert. Die experimentellen Bedingun gen für Hybridisierung und Waschen der Filter erfolgten in Anlehnung an Ausubel et al. (1987).To isolate the 5'-flanking hTC gene sequence, approximately 1.5 × 10 ⁶ phages of a human genomic placenta gene library were hybridized with a radioactively labeled, 506 bp long 5'-hTC cDNA fragment. The experimental conditions for hybridization and washing of the filters were based on Ausubel et al. (1987).

Die in dieser Primäruntersuchung identifizierten Phagenklone wurden aufgereinigt. In weitergehenden Analysen stellte sich ein Phagenklon als potentiell positiv heraus. Eine λ-DNA Präparation dieses Phagens und der nachfolgende Restriktionsverdau mit Enzymen, die das genomische Insert in Fragmenten freisetzen, zeigte, daß dieser Pha genklon ein ca. 15 kb Insert im Vektor enthält (Fig. 2).The phage clones identified in this primary study were purified. In further analyzes, a phage clone turned out to be potentially positive. A λ-DNA preparation of this phage and the subsequent restriction digestion with enzymes which release the genomic insert in fragments showed that this phage gene clone contains an approximately 15 kb insert in the vector ( FIG. 2).

Example 3

Um zu untersuchen, ob auch das 5'-Ende der hTC-cDNA im Insert des rekombinan ten Phagenklons vorliegt, wurde λ-DNA des positiven Klons in einer Southern Blot Analyse mit einem radioaktiv markierten 434 bp langen hTC-cDNA Fragment aus dem extremen 5'-Bereich hybridisiert (Fig. 3).To investigate whether the 5 'end of the hTC cDNA is also present in the insert of the recombinant phage clone, λ-DNA of the positive clone was analyzed in a Southern blot with a radioactively labeled 434 bp long hTC cDNA fragment from the extreme 5 'Area hybridized ( Fig. 3).

Da die isolierte λ-DNA des positiven Klons auch mit dem extremen 5'-Ende der hTC-cDNA hybridisiert, enthält dieser Phage wahrscheinlich auch den das ATG-Startco don flankierenden 5'-Sequenzbereich.Since the isolated λ DNA of the positive clone also has the extreme 5 'end of the hTC cDNA hybridized, this phage probably also contains the ATG startco don flanking 5 'sequence area.

Example 4

Um das gesamte 15 kb lange Insert des positiven Phagenklons in Teilfragmenten um zuklonieren und anschließend zu sequenzieren, wurden zum DNA-Verdau Restrik tionsendonukleasen ausgewählt, die zum einem das gesamte Insert aus EMBL3 Sp3/T7 freisetzen (vgl. Beispiel 2) und zusätzlich im Insert schneiden.Around the entire 15 kb insert of the positive phage clone in partial fragments cloning and then sequencing became restriction for DNA digestion tion endonucleases selected, the one the entire insert from EMBL3 Release Sp3 / T7 (see example 2) and cut in the insert.

Insgesamt wurden ein etwa 8,3 und ein etwa 6,5 kb langes Xho 1-Subfragment sowie ein etwa 8,5, ein etwa 3,5 und ein etwa 3 kb langes Sac I-Teilfragment in den Vektor pBluescript umkloniert. In total, an approximately 8.3 and an approximately 6.5 kb long Xho 1 subfragment as well an approximately 8.5, an approximately 3.5 and an approximately 3 kb Sac I partial fragment into the vector pBluescript cloned.

Durch Sequenzanalyse dieser Fragmente wurde die Nukleotidsequenz von 6123 bp 5'-flankierenden des ghTC-Genbereichs, ausgehend vom ATG-Startcodon bestimmt (Fig. 4).The nucleotide sequence of 6123 bp 5 'flanking the ghTC gene region was determined by sequence analysis of these fragments, starting from the ATG start codon ( FIG. 4).

Example 5

Um den oder die Startpunkt(e) der Transkriptionsinitiation zu ermitteln, wurde das 5'- Ende der hTC-mRNA durch Primer-Extension-Analyse (Ausubel et al., 1987) bestimmt. Hierzu wurden 2 µg PolyA⁺-RNA aus HL-60-Zellen mit 5 pmol radioaktiv markiertem Primer inkubiert und anschließend eine Reverse Transkriptase Reaktion durchgeführt. Das Produkt der Primerverlängerung wurde nach Aufarbeitung gelelek trophoretisch aufgetrennt und im Autoradiogramm dargestellt (Fig. 5).In order to determine the starting point (s) of the transcription initiation, the 5 'end of the hTC mRNA was determined by primer extension analysis (Ausubel et al., 1987). For this purpose, 2 µg of PolyA⁺-RNA from HL-60 cells were incubated with 5 pmol of radioactively labeled primer and then a reverse transcriptase reaction was carried out. The product of the primer extension was gelelek trophoretically separated after working up and shown in the autoradiogram ( FIG. 5).

Hierbei wurde eine Haupt-Transkriptionsstartstelle identifiziert, die 1767 bp 5' vom ATG-Startcodon der hTC-cDNA Sequenz lokalisiert ist (Nukleotidposition 3346 in Fig. 4). Die Nukleotidsequenz um diesen Haupttranskriptionsstart (TTA₊₁TTGT) repräsentiert darüber hinaus ein Initiator-Element (Inr), das in 6 von 7 Nukleotiden mit dem Konsensusmotiv (PyPyA₊₁Na/tPyPy) (Smale, 1997) eines Initiator-Elementes übereinstimmt.A main transcription start site was identified which is located 1767 bp 5 'from the ATG start codon of the hTC cDNA sequence (nucleotide position 3346 in FIG. 4). The nucleotide sequence around this main transcription start (TTA ₊₁ TTGT) also represents an initiator element (Inr), which in 6 of 7 nucleotides corresponds to the consensus motif (PyPyA ₊₁ Na / tPyPy) (Smale, 1997) of an initiator element.

In unmittelbarer Nähe des experimentell identifizierten Haupt-Transkriptionsstartes konnte keine eindeutige TATA-Box identifiziert werden, so daß der hTC-Promoter wahrscheinlich in die Familie der TATA-losen Promotoren (Smale, 1997) einzuordnen ist. Allerdings wurde durch bioinformatorische Analysen eine potentielle TATA-Box von Nukleotidposition 1306 bis 1311 gefunden. Die zusätzlich um den Haupt-Trans kriptionsstart beobachteten Neben-Transkriptionsstarts wurden auch bei anderen TATA-losen Promotoren beschrieben (Geng and Johnson, 1993), wie z. B. in den stark regulierten Promotoren einiger Zellzyklusgene (Wick et al., 1995).In the immediate vicinity of the experimentally identified main transcription start no clear TATA box could be identified, so that the hTC promoter probably in the family of TATA-less promoters (Smale, 1997) is. However, a potential TATA box was found through bioinformatic analyzes found from nucleotide position 1306 to 1311. The additional around the main trans Post-transcriptional start-ups were also observed in others TATA-less promoters described (Geng and Johnson, 1993), such as. Tie highly regulated promoters of some cell cycle genes (Wick et al., 1995).

Bibliography

Allsopp, R.C., Vazire, H., Pattersson, C., Goldstein, S., Younglai, E.V., Futcher, A.B., Greider, C.W. und Harley, C.B. (1992). Telomere length predicts replicative capacity of human fibroblasts. Proc. Natl. Acad. Sci. 89, 10114-10118.
Ausubel, F.M., Brent, R., Kingston, R.E., Moore, D.D., Seidman, J.G., Smith, J.A., Struhl, K. (1987). Current protocols in molecular biology. Greene Publishing Associates and Whiley- Intersciences, New York.
Blasco, M.A., Rizen, M., Greider, C.W. und Hanahan, D. (1996). Differential regulation of telomerase activity and telomerase RNA during multistage tumorigenesis. Nature Genetics 12, 200-204.
Broccoli, D., Young, J.W. und deLange, T. (1995). Telomerase activity in normal and malignant hematopoietic cells. Proc. Natl. Acad. Sci. 92, 9082-9086.
Counter, C.M., Avilion, A.A., LeFeuvre, C.E., Stewart, N.G. Greider, C.W. Harley, C.B. und Bacchetti S. (1992). Telomere shortening associated with chromosome instabilily is arrested in immortal cells which express telomerase activity. EMBO J. 11 1921-1929.
Feng, J., Funk, W.D., Wang, S.-S., Weinrich, S.L., Avilion, A.A., Chiu, C.-P., Adams, R.R., Chang, E., Allsopp, R.C., Yu, J., Le, S., West, M.D., Harley, C.B., Andrews, W.H., Greider, C.W. und Villeponteau, B. (1995). The RNA component of human telomerase. Science 269, 1236-1241.
Geng, Y., and Johnson, L.F. (1993). Lack of an initiator element is responsible for multiple transcriptional initiation sites of the TATA less mouse thymidine synthasse promoter. Mol. Cell. Biol 14: 4894.
Goldstein, S. (1990). Replicative senescence: The human fibroblast comes of age. Science 249, 1129-1133.
Hastie, N.D., Dempster, M., Dunlop, M.G., Thompson, A.M., Green, D.K. und Allshire, R.C. (1990). Telomere reduction in human colorectal carcinoma and with ageing. Nature 346, 866-868.
Hiyama, K., Hirai, Y., Kyoizumi, S., Akiyama, M., Hiyama, E., Piatyszek, M.A., Shay, J.W., Ishioka, S. und Yamakido, M. (1995). Activation of telomerase in human lymphocytes and hematopoietic progenitor cells. J. Immunol. 155, 3711-3715.
Kim, N.W., Piatyszek, M.A., Prowse, K.R., Harley, C.B., West, M.D., Ho, P.L.C., Coviello, G.M., Wright, W.E., Weinrich, S.L. und Shay, J.W. (1994). Specific association of human telomerase activity with immortal cells and cancer. Science 266, 2011-2015.
Latchman, D.S. (1991). Eukaryotic transcription factors. Academic Press Limited, London.
Lingner, J., Hughes, T.R., Shevchenko, A., Mann, M., Lundblad, V. und Cech T.R. (1997). Reverse transcriptase motifs in the catalytic subunit of telomerase. Science 276: 561-567.
Lundblad, V. und Szostak, J.W. (1989). A mutant with a defect in telomere elongation leads to senescence in yeast. Cell 57, 633-643.
McClintock, B. (1941). The stability of broken ends of chromosomes in Zea mays. Genetics 26, 234-282.
Meyne, J., Ratliff, R.L. und Moyzis, r.K. (1989). Conservation of the human telomere sequence (TTAGGG)_n Allsopp, RC, Vazire, H., Pattersson, C., Goldstein, S., Younglai, EV, Futcher, AB, Greider, CW and Harley, CB (1992). Telomere length predicts replicative capacity of human fibroblasts. Proc. Natl. Acad. Sci. 89, 10114-10118.
Ausubel, FM, Brent, R., Kingston, RE, Moore, DD, Seidman, JG, Smith, JA, Struhl, K. (1987). Current protocols in molecular biology. Greene Publishing Associates and Whiley-Intersciences, New York.
Blasco, MA, Rizen, M., Greider, CW and Hanahan, D. (1996). Differential regulation of telomerase activity and telomerase RNA during multistage tumorigenesis. Nature Genetics 12, 200-204.
Broccoli, D., Young, JW and deLange, T. (1995). Telomerase activity in normal and malignant hematopoietic cells. Proc. Natl. Acad. Sci. 92, 9082-9086.
Counter, CM, Avilion, AA, LeFeuvre, CE, Stewart, NG Greider, CW Harley, CB and Bacchetti S. (1992). Telomere shortening associated with chromosome instabilily is arrested in immortal cells which express telomerase activity. EMBO J. 11 1921-1929.
Feng, J., Funk, WD, Wang, S.-S., Weinrich, SL, Avilion, AA, Chiu, C.-P., Adams, RR, Chang, E., Allsopp, RC, Yu, J. , Le, S., West, MD, Harley, CB, Andrews, WH, Greider, CW and Villeponteau, B. (1995). The RNA component of human telomerase. Science 269, 1236-1241.
Geng, Y. and Johnson, LF (1993). Lack of an initiator element is responsible for multiple transcriptional initiation sites of the TATA less mouse thymidine synthasse promoter. Mol. Cell. Biol 14: 4894.
Goldstein, S. (1990). Replicative senescence: The human fibroblast comes of age. Science 249, 1129-1133.
Hastie, ND, Dempster, M., Dunlop, MG, Thompson, AM, Green, DK and Allshire, RC (1990). Telomeric reduction in human colorectal carcinoma and with aging. Nature 346, 866-868.
Hiyama, K., Hirai, Y., Kyoizumi, S., Akiyama, M., Hiyama, E., Piatyszek, MA, Shay, JW, Ishioka, S. and Yamakido, M. (1995). Activation of telomerase in human lymphocytes and hematopoietic progenitor cells. J. Immunol. 155, 3711-3715.
Kim, NW, Piatyszek, MA, Prowse, KR, Harley, CB, West, MD, Ho, PLC, Coviello, GM, Wright, WE, Weinrich, SL and Shay, JW (1994). Specific association of human telomerase activity with immortal cells and cancer. Science 266, 2011-2015.
Latchman, DS (1991). Eukaryotic transcription factors. Academic Press Limited, London.
Lingner, J., Hughes, TR, Shevchenko, A., Mann, M., Lundblad, V. and Cech TR (1997). Reverse transcriptase motifs in the catalytic subunit of telomerase. Science 276: 561-567.
Lundblad, V. and Szostak, JW (1989). A mutant with a defect in telomere elongation leads to senescence in yeast. Cell 57, 633-643.
McClintock, B. (1941). The stability of broken ends of chromosomes in Zea mays. Genetics 26, 234-282.
Meyne, J., Ratliff, RL and Moyzis, rK (1989). Conservation of the human telomere sequence (TTAGGG) _n

among vertebrates. Proc. Natl. Acad. Sci. 86, 7049-7053.
Olovnikov, A.M. (1973). A theory of marginotomy. J. Theor. Biol. 41, 181-190.
Sandell, L.L. und Zakian, V.A. (1993). Loss of a yeast telomere: Arrest, recovery and chromosome loss. Cell 75, 729-739.
Smale, S.T. and Baltimore, D. (1989). The "initiator" as a transcription control element. Cell 57: 103-113.
Smale, S.T. (1997). Transcription initation from TATA-less promoters within eukaryotic protein coding genes. Biochimica et Biophysica Acta 1351, 73-88.
Shay, J.W. (1997). Telomerae and Cancer. Ciba Foundation Meeting: Telomeres and Telomerase. London.
Vaziri, H., Dragowska, W., Allsopp, R.C., Thomas, T.E., Harley, C.B. und Landsdorp, P.M. (1994). Evidence for a mitotic clock in human hematopoietic stem cells: Loss of telomeric DNA with age. Proc. Natl. Acad. Sci. 91, 9857-9860.
Wick, M., Härönen, R., Mumberg, D., Bürger, C., Olsen, B.R., Budarf, M.L., Apte, S.S. and Müller, R. (1995). Structure of the human TIMP-3 gene and its cell-cycle-regulated promoter. Biochemical Journal 311, 549-554.
Zakian, V.A. (1995). Telomeres: Beginning to understand the end. Science 270, 1601-1607.among vertebrates. Proc. Natl. Acad. Sci. 86, 7049-7053.
Olovnikov, AM (1973). A theory of marginotomy. J. Theor. Biol. 41, 181-190.
Sandell, LL and Zakian, VA (1993). Loss of a yeast telomere: Arrest, recovery and chromosome loss. Cell 75, 729-739.
Smale, ST and Baltimore, D. (1989). The "initiator" as a transcription control element. Cell 57: 103-113.
Smale, ST (1997). Transcription initation from TATA-less promoters within eukaryotic protein coding genes. Biochimica et Biophysica Acta 1351, 73-88.
Shay, JW (1997). Telomerae and Cancer. Ciba Foundation Meeting: Telomeres and Telomerase. London.
Vaziri, H., Dragowska, W., Allsopp, RC, Thomas, TE, Harley, CB and Landsdorp, PM (1994). Evidence for a mitotic clock in human hematopoietic stem cells: Loss of telomeric DNA with age. Proc. Natl. Acad. Sci. 91, 9857-9860.
Wick, M., Härönen, R., Mumberg, D., Bürger, C., Olsen, BR, Budarf, ML, Apte, SS and Müller, R. (1995). Structure of the human TIMP-3 gene and its cell-cycle-regulated promoter. Biochemical Journal 311, 549-554.
Zakian, VA (1995). Telomeres: Beginning to understand the end. Science 270, 1601-1607.

Claims

1. 5'-flanking regulatory DNA sequence for the gene of the human catalytic telomerase subunit according to FIG. 4 and regulatory-effective fragments of this DNA sequence.

2. Recombinant construct containing a DNA sequence according to claim 1.

3. Recombinant construct according to claim 2, characterized in that it further contains one or more DNA sequences, which are for polypeptides or Encode proteins.

4. Recombinant construct according to claim 3, characterized in that it contains a DNA sequence encoding an antitumeral protein.

5. Recombinant construct according to claim 2 to 4, characterized in that it contains one or more DNA sequences necessary for a reporter protein encode.

6. vector containing a recombinant construct according to claims 2 to 5.

7. Vector according to claim 6, characterized in that the vector is a virus is.

8. Vector according to claim 6, characterized in that the vector is a Is plasmid.

9. Use of recombinant constructs or vectors according to claims Chen 2 to 8 for the manufacture of drugs.

10. Recombinant host cells containing recombinant constructs or Vectors according to claims 2 to 8.

11. A method of identifying substances that affect the promoter, silencer or enhancer activity of the human catalytic telomerase subunit, comprising the steps of:

A. adding a candidate substance to a host cell containing DNA sequences according to claim 1, functionally linked to a reporter tergen,
B. Measurement of the substance effect on reporter gene expression.

12. A method of identifying factors specific to the DNA Binding claim 1 or to fragments thereof, characterized in that an expression cDNA library with a DNA sequence according to Claim 1 or partial fragments of different lengths as a probe.

13. Transgenic animals containing recombinant constructs or vectors according to Claims 2 to 8.

14. A method for detecting telomerase-associated conditions in a patient, comprising the following steps:

A. Incubation of a recombinant construct or vector according to claims 5 to 8 with body fluids or cellular samples,
B. detection of reporter gene activity to obtain a diagnostic value,
C. Comparison of the diagnostic value with standard values for the reporter gene construct in standardized normal cells or body fluids of the same type as the test sample.