DE10239504A1 - Parallel sequencing of nucleic acid fragments, useful e.g. for detecting mutations, comprises sequential single-base extension of immobilized fragment-primer complex - Google Patents

Parallel sequencing of nucleic acid fragments, useful e.g. for detecting mutations, comprises sequential single-base extension of immobilized fragment-primer complex

Info

Publication number
DE10239504A1
DE10239504A1 DE10239504A DE10239504A DE10239504A1 DE 10239504 A1 DE10239504 A1 DE 10239504A1 DE 10239504 A DE10239504 A DE 10239504A DE 10239504 A DE10239504 A DE 10239504A DE 10239504 A1 DE10239504 A1 DE 10239504A1
Authority
DE
Germany
Prior art keywords
nts
primer
nskfs
sequence
primers
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
DE10239504A
Other languages
German (de)
Inventor
Dmitri Tcherkassov
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Genovoxx GmbH
Original Assignee
Genovoxx GmbH
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Genovoxx GmbH filed Critical Genovoxx GmbH
Priority to DE10239504A priority Critical patent/DE10239504A1/en
Publication of DE10239504A1 publication Critical patent/DE10239504A1/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6869Methods for sequencing
    • C12Q1/6874Methods for sequencing involving nucleic acid arrays, e.g. sequencing by hybridisation

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

Method for parallel sequencing analysis of nucleic acids (NA) in which single-stranded fragments (F), of 50-1000 bases, are generated, representing overlapping fragments of a complete sequence. (F) are then attached, as a complex (C) with one or primers, in random fashion to a reaction surface. Method for parallel sequencing analysis of nucleic acids (NA) in which single-stranded fragments (F), or 50-1000 bases, are generated, representing overlapping fragments of a complete sequence. (F) are then attached, as a complex (C) with one or primers, in random fashion to a reaction surface. The complementary strand of (F) is constructed using one or more polymerases in the following cycle: (a) incubating bound (C) with at least one polymerase and 1-4 modified nucleotides (N asterisk ), labeled with a fluorescent dye (FD), different for each N asterisk so that they can be distinguished, and N asterisk are modified at the 3'-end so that the polymerase, after incorporating one N asterisk into the growing complementary chain, can not incorporate another, but both FD and the terminating substance (TS) are cleavable; (b) extending the complementary strand by one N asterisk ; (c) washing to remove unincorporated N asterisk ; (d) detecting individual incorporated N asterisk from the characteristic fluorescence, with simultaneous detection of the relative positions of (C) on the surface; (e) removing FD and TS; (f) washing to eliminate FD and TS released, and optionally repeating the entire cycle. The relative positions of individual (C) and their sequences are determined through specific correlation of the signal detected in (d) in successive cycles. Independent claims are also included for: (a) a similar method for highly parallel analysis of gene expression using single-stranded gene products instead of F; (b) carriers for the new process; and (c) kits for the new process.

Description

Die Erfindung betrifft ein Verfahren zur Analyse von Nukleinsäureketten und der Genexpression. Die Grundlage der Methode ist die Detektion von Fluoreszenzsignalen einzelner mit Farbstoffen markierter Nukleotidmoleküle, die durch eine Polymerase in eine wachsende Nukleinsäurekette eingebaut werden. Die Reaktion verläuft auf einer planen Oberfläche. An diese Oberfläche sind viele einzelne Nukleinsäure-Moleküle gebunden. Alle diese Nukleinsäure-Moleküle sind gleichen Bedingungen ausgesetzt, so dass an allen Nukleinsäure- Molekülen gleichzeitig eine Aufbaureaktion ablaufen kann. The invention relates to a method for analyzing Nucleic acid chains and gene expression. The basis of the The method is the detection of fluorescence signals from individuals nucleotide molecules labeled with dyes which are identified by a Polymerase built into a growing nucleic acid chain become. The reaction takes place on a flat surface. On this surface is made up of many individual nucleic acid molecules bound. All of these nucleic acid molecules are the same Conditions exposed so that at all nucleic acid Molecules can run a build-up reaction at the same time.

Das Verfahren umfaßt im wesentlichen folgende Schritte:

  • 1. Bindung der Nukleinsäurekettenfragmenten (NSKFs) auf einer planen Oberfläche mit anschließender Hybridisierung von Primern, alternativ Bindung von Primern mit anschließender Hybridisierung von NSKFs, so dass NSKF-Primer-Komplexe gebildet werden.
  • 2. Durchführen einer zyklischen Aufbaureaktion, wobei jeder Zyklus aus folgenden Schritten besteht:
    • a) Zugabe einer Lösung mit markierten Nukleotiden (NTs*) und Polymerase zu den gebundenen NSKF-Primer- Komplexen,
    • b) Inkubation der gebundenen NSKF-Primer-Komplexe mit dieser Lösung unter Bedingungen, die zur Verlängerung der komplementären Stränge um ein NT geeignet sind,
    • c) Waschen,
    • d) Detektion der Signale von einzelnen Molekülen,
    • e) Entfernung der Markierung von den eingebauten Nukleotiden,
    • f) Waschen.
    Gegebenenfalls erfolgen mehrfache Wiederholungen des Zyklus.
  • 3. Analyse der detektierten Signale der einzelnen Moleküle. 4) Rekonstruktion der Sequenzen aus den Einzeldaten.
1. Abkürzungen und Begriffserläuterungen DNA - Desoxyribonukleinsäure verschiedenen Ursprungs und unterschiedlicher Länge (genomische DNA, cDNA, ssDNA, dsDNA)
RNA - Ribonukleinsäure (meist mRNA)
Polymerasen - Enzyme, die komplementäre Nukleotide in einen wachsenden DNA- oder RNA-Strang einbauen können (z. B. DNA- Polymerasen, Reverse-Transkriptasen, RNA-Polymerasen)
dNTP - 2'-deoxi-Nucleosid-Triphosphate, Substrate für DNA- Polymerasen und Reverse-Transkriptasen
NTP - Nukleosid-Triphosphate, Substrate für RNA-Polymerasen
NT - natürliches Nukleotid, meist dNTP, wenn nicht ausdrücklich anders gekennzeichnet.
Abkürzung "NT" wird auch bei der Längenangabe einer Nukleinsäuresequenz verwendet, z. B. 1.000 NT. In diesem Fall steht "NT" für Nukleosid-Monophosphate.
Im Text wird bei Abkürzungen die Mehrzahl durch Verwendung des Suffixes "s" gebildet, "NT" steht zum Beispiel für "Nukleotid", "NTs" steht für mehrere Nukleotide.
NT' - modifiziertes Nukleotid, meist dNTP, wenn nicht ausdrücklich anders gekennzeichnet. NTs* bedeutet: modifizierte Nukleotide
NSK - Nukleinsäurekette. DNA oder RNA in ihrer ursprünglichen Länge
NSKF - Nukleinsäurekettenfragment (DNA oder RNA), das einem Teil der Gesamtsequenz entspricht, NSKFs - Nukleinsäurekettenfragmente. Die Summe der NSKFs bildet ein Äquivalent zur Gesamtsequenz. Die NSKFs können beispielsweise Fragmente von DNA- oder RNA-Gesamtsequenz sein, die nach einem Fragmentierungsschritt entstehen.
Gesamtsequenz - die in der Sequenzierungsreaktion eingesetzte Sequenz oder die eingesetzten Sequenzen, meistens in NSKFs überführt. Sie kann ursprünglich aus einer oder mehreren NSKs bestehen. Dabei kann die Gesamtsequenz Teile oder Äquivalente einer anderen Sequenz oder von Sequenz-Populationen darstellen (z. B. mRNA, cDNA, Plasmid-DNA mit Insert, BAC, YAC) und aus einer oder unterschiedlichen Spezies stammen.
Primerbindungstelle (PBS) - Teil der Sequenz in der NSK oder NSKF, an den der Primer bindet.
Referenzsequenz - eine bereits bekannte Sequenz, zu der die Abweichungen in der zu untersuchenden Sequenz bzw. in den zu untersuchenden Sequenzen (Gesamtsequenz) ermittelt werden. Als Referenzsequenzen können in Datenbanken zugängliche Sequenzen verwendet werden, wie z. B. aus der NCBI-Datenbank.
Tm - Schmelztemperatur
Plane Oberfläche - Oberfläche, die vorzugsweise folgende Merkmale aufweist: 1) Sie erlaubt, mehrere einzelne Moleküle, vorzugsweise mehr als. 100, noch besser mehr als 1000, mit dem jeweiligen gegebenen Objektiv-Oberfläche-Abstand bei einer Objektivposition gleichzeitig zu detektieren. 2) Die immobilisierten einzelnen Moleküle befinden sich in derselben Fokusebene, die reproduzierbar eingestellt werden kann.
Weitfeld-Optik-Detektionssystem - Detektionssystem, das gleichzeitig Fluoreszenzsignale von einzelnen, auf einer Fläche verteilten Molekülen detektieren kann, wobei die Fläche ca. 100 µm2 und größer ist. Ein Beispiel für Weitfeld- Detektionsoptik stellt Fluoreszenzmikroskop Axiovert 200 oder Axioplan 2e (Zeiss) mit einem Planneofluar-Objektiv 100x NA 1.4 Ölimmersion (Zeiss), oder einem Planapochromat-Objektiv 100x NA 1.4 Ölimmersion (Zeiss); die Anregung der Fluoreszenz kann dabei mit einer Lampe, z. B. Quecksilberdampflampe, oder einem Laser oder Dioden erfolgen. Sowohl Epifluoreszenzmdus als auch im Totalreflexions-Fluoreszenzmikroskopie-Modus (total internal reflection fluorescence microscopy, TIRF- Microscopy) oder Laser-Scanning-Mikroskopie-Modus können verwendet werden. In dieser Anmeldung wird Gebrauch von dieser Weitfeld-Detektionsoptik gemacht
Definition der Termination: Als Termination wird in dieser Anmeldung der reversible Stop des Einbaus der modifizierten ungespalteten NTs* bezeichnet.
Dieser Begriff ist von dem üblichen Gebrauch des Wortes "Termination" durch Dideoxy-NTP bei einer konventionellen Sequenzierung zu trennen.
Die Termination kommt nach dem Einbau eines modifizierten NT* zustande. Ein zur Termination führender Substituent- bzw. eine Modifikation der 3'-OH-Position an der Desoxyribose eines Nukleotides, die zur Termination führt. Der Substituent kann unter milden Bedingungen abgespalten werden, so daß 3'- OH Funktion wieder für den Einbau eines NT* zur Verfügung steht. An diesen Substituenten ist ein Fluoreszenzfarbstoff gekoppelt.
Genprodukte - Bei den Genprodukten handelt es sich um die primären Genprodukte der Gene. Im wesentlichen handelt es sich dabei um RNA-Transkripte der genannten Gene, welche auch als Target-Sequenzen (oder Target-Nukleinsäuresequenzen) bezeichnet werden. Diese Target-Sequenzen schließen neben mRNA auch davon abgeleitete einzelsträngige und doppelsträngige cDNA, von cDNA abgeleitete RNA oder von cDNA amplifizierte DNA ein.
Einzelnukleotidpolymorphismen (single nucleotide polymorphisms, SNPs) - Veränderungen in den Sequenzen, die als Substitution (Transition oder Transversion) oder als Deletion oder Insertion einzelner NT auftreten können. The process essentially comprises the following steps:
  • 1. Binding of the nucleic acid chain fragments (NSKFs) on a flat surface with subsequent hybridization of primers, alternatively binding of primers with subsequent hybridization of NSKFs, so that NSKF-primer complexes are formed.
  • 2. Perform a cyclical build-up reaction, each cycle consisting of the following steps:
    • a) adding a solution with labeled nucleotides (NTs *) and polymerase to the bound NSKF-primer complexes,
    • b) incubation of the bound NSKF primer complexes with this solution under conditions which are suitable for extending the complementary strands by one NT,
    • c) washing,
    • d) detection of signals from individual molecules,
    • e) removing the label from the incorporated nucleotides,
    • f) washing.
    If necessary, the cycle is repeated several times.
  • 3. Analysis of the detected signals of the individual molecules. 4) Reconstruction of the sequences from the individual data.
1. Abbreviations and Explanations of Terms DNA - Deoxyribonucleic Acid of Different Origin and Different Length (Genomic DNA, cDNA, ssDNA, dsDNA)
RNA - ribonucleic acid (mostly mRNA)
Polymerases - enzymes that can incorporate complementary nucleotides into a growing strand of DNA or RNA (e.g. DNA polymerases, reverse transcriptases, RNA polymerases)
dNTP - 2'-deoxi nucleoside triphosphates, substrates for DNA polymerases and reverse transcriptases
NTP - nucleoside triphosphates, substrates for RNA polymerases
NT - natural nucleotide, usually dNTP, unless expressly stated otherwise.
Abbreviation "NT" is also used when specifying the length of a nucleic acid sequence, e.g. B. 1,000 NT. In this case, "NT" stands for nucleoside monophosphates.
The majority of abbreviations in the text are formed by using the suffix "s", "NT" stands for "nucleotide", for example, "NTs" stands for several nucleotides.
NT '- modified nucleotide, usually dNTP, unless expressly stated otherwise. NTs * means: modified nucleotides
NSK - nucleic acid chain. DNA or RNA in their original length
NSKF - nucleic acid chain fragment (DNA or RNA), which corresponds to a part of the total sequence, NSKFs - nucleic acid chain fragments. The sum of the NSKFs is equivalent to the overall sequence. The NSKFs can, for example, be fragments of the entire DNA or RNA sequence that arise after a fragmentation step.
Total sequence - the sequence or sequences used in the sequencing reaction, mostly converted into NSKFs. It can originally consist of one or more NSKs. The total sequence can represent parts or equivalents of another sequence or of sequence populations (e.g. mRNA, cDNA, plasmid DNA with insert, BAC, YAC) and originate from one or different species.
Primer binding site (PBS) - part of the sequence in the NSK or NSKF to which the primer binds.
Reference sequence - a sequence already known, for which the deviations in the sequence to be examined or in the sequences to be examined (overall sequence) are determined. Sequences accessible in databases can be used as reference sequences, e.g. B. from the NCBI database.
Tm - melting temperature
Flat surface - surface which preferably has the following features: 1) It allows several individual molecules, preferably more than one. 100, even better more than 1000, to be detected simultaneously with the given lens-surface distance at a lens position. 2) The immobilized individual molecules are in the same focal plane, which can be adjusted reproducibly.
Wide-field optical detection system - detection system which can simultaneously detect fluorescence signals from individual molecules distributed over an area, the area being approximately 100 μm 2 and larger. An example of wide-field detection optics is provided by the Axiovert 200 or Axioplan 2e (Zeiss) fluorescence microscope with a Planeofluar objective 100x NA 1.4 oil immersion (Zeiss), or a planapochromatic objective 100x NA 1.4 oil immersion (Zeiss); the excitation of fluorescence can be done with a lamp, e.g. B. mercury vapor lamp, or a laser or diodes. Both epifluorescence mode and total internal reflection fluorescence microscopy (TIRF microscopy) mode or laser scanning microscopy mode can be used. In this application use is made of this wide field detection optics
Definition of termination: In this application, termination is the reversible stop in the installation of the modified, uncleaved NTs *.
This term is to be separated from the usual use of the word "termination" by dideoxy-NTP in conventional sequencing.
The termination comes after the installation of a modified NT *. A substituent leading to the termination or a modification of the 3'-OH position on the deoxyribose of a nucleotide which leads to the termination. The substituent can be split off under mild conditions, so that 3'-OH function is available again for the installation of an NT *. A fluorescent dye is coupled to these substituents.
Gene products - The gene products are the primary gene products of the genes. Essentially, these are RNA transcripts of the genes mentioned, which are also referred to as target sequences (or target nucleic acid sequences). In addition to mRNA, these target sequences also include single-stranded and double-stranded cDNA derived therefrom, RNA derived from cDNA or DNA amplified from cDNA.
Single nucleotide polymorphisms (SNPs) - changes in the sequences that can occur as a substitution (transition or transversion) or as a deletion or insertion of individual NT.

2. Stand der Technik2. State of the art

Die Nukleinsäurenketten-Sequenzanalyse und Genexpressionsanalyse sind in vielen Bereichen der Wissenschaft, Medizin und Industrie zu einem wichtigen Werkzeug geworden. Zur Analyse wurden mehrere Verfahren entwickelt. Nucleic acid chain sequence analysis and Gene expression analysis are common in many areas Science, medicine and industry become an important one Become a tool. Several methods were used for analysis developed.

Die bekanntesten Verfahren sind die Ketten-Terminations- Sequenzierung nach Sanger (F. Sanger et al. PNAS 1977 v.74 S. 5463), die auf dem Einbau von Kettenterminatoren basiert, und die Maxam-Gilbert-Methode, die auf Basen-spezifischer Modifikation und Spaltung von Nukleinsäureketten beruht (A.M. Maxam and W. Gilbert PNAS 1977, v.74 S. 560). Beide Methoden liefern eine Anzahl von Nukleinsäurekettenfragmenten verschiedener Längen. Diese Fragmente werden der Länge nach in einem Gel aufgetrennt. Dabei müssen alle Nachteile der Elektrophorese (wie z. B. lange Laufzeit, relativ kurze Strecken von Sequenzen, die in einem Ansatz bestimmt werden können, begrenzte Anzahl der parallelen Ansätze sowie relativ große Mengen an DNA) in Kauf genommen werden. Diese Methoden sind sehr arbeitsintensiv und langsam. The best known methods are chain termination Sanger sequencing (F. Sanger et al. PNAS 1977 v.74 p. 5463), which is based on the installation of chain terminators, and the Maxam-Gilbert method, which is base-specific Modification and cleavage of nucleic acid chains is based (A.M. Maxam and W. Gilbert PNAS 1977, v.74 p. 560). Both methods provide a number of nucleic acid chain fragments of different lengths. These fragments are lengthwise in separated on a gel. All the disadvantages of Electrophoresis (such as long run time, relatively short Stretching sequences that are determined in one approach can, limited number of parallel approaches as well as relative large amounts of DNA) are accepted. These methods are very labor intensive and slow.

Ein weiteres Verfahren zur Sequenzierung basiert auf der Hybridisierung von Nukleinsäureketten mit kurzen Oligonukleotiden. Dabei wird mit mathematischen Methoden berechnet, wie viele Oligonukleotide einer bestimmten Länge vorhanden sein müssen, um eine komplette Sequenz zu ermitteln (Z.T. Strezoska et al. PNAS 1991 v.88 S. 10089, R.S. Drmanac et al. Science 1993 v.260 S. 1649). Auch dieses Verfahren ist mit Problemen behaftet: Es kann nur eine Sequenz in einem Ansatz bestimmt werden, sekundäre Strukturen stören die Hybridisierung und Sequenzwiederholungen verhindern die korrekte Analyse. Another sequencing method is based on the Hybridization of nucleic acid chains with short Oligonucleotides. This is done using mathematical methods calculates how many oligonucleotides of a certain length must be present to determine a complete sequence (Z.T. Strezoska et al. PNAS 1991 v.88 p. 10089, R.S. Drmanac et al. Science 1993 v.260 p. 1649). This procedure is also included Problems: Only one sequence in one approach are determined, secondary structures disrupt the Hybridization and repeats prevent that correct analysis.

Eine andere Möglichkeit zur Sequenzierung haben Arbeitsgruppen beispielsweise von (Dower US Patent 5.547.839, Canard et al. US Patent S. 798.210, Rasolonjatovo Nucleosides & Nucleotides 1999, v.18 S. 1021, Metzker et al. NAR 1994, v.22, S. 4259, Welch et al. Nucleosides & Nucleotides 1999, v.18, S. 197) entwickelt. Diese Methode wird abgekürzt als BASS (Base Addition Sequencing Scheme) oder SBS (Sequecing by Synthesis) bezeichnet. Dabei wird eine große Anzahl gleicher einzelsträngiger DNA-Stücke an einem definierten Ort auf einer Oberfläche fixiert und das Signal von der Gesamtheit dieser vielen identischen DNA-Stücke analysiert. Zu dieser fixierten DNA wird eine Lösung mit Polymerase und Nukleotiden zugegeben, so dass ein komplementärer Strang synthetisiert werden kann. Dabei soll die Polymerase schrittweise arbeiten: in jedem Schritt wird nur ein einziges Nukleotid eingebaut. Dieses wird detektiert, worauf die Polymerase in einem nächsten Zyklus das nächste Nukleotid einbaut. Working groups have another option for sequencing e.g. from (Dower U.S. Patent 5,547,839, Canard et al. U.S. Patent p. 798,210, Rasolonjatovo Nucleosides & Nucleotides 1999, v.18 p. 1021, Metzker et al. NAR 1994, v.22, p. 4259, Welch et al. Nucleosides & Nucleotides 1999, v.18, p. 197) developed. This method is abbreviated as BASS (Base Addition Sequencing Scheme) or SBS (Sequecing by Synthesis) designated. A large number become the same single-stranded DNA pieces at a defined location on one Surface fixed and the signal from the entirety of this analyzed many identical pieces of DNA. Fixed to this DNA is added a solution with polymerase and nucleotides, so that a complementary strand can be synthesized. The polymerase should work step by step: in each Step, only a single nucleotide is incorporated. This will detects what the polymerase will do in a next cycle incorporates the next nucleotide.

Trotz des Gelingens einiger einzelner Schritte der Methode wurde sie nicht zu einem funktionsfähigen Verfahren entwickelt. Dies kann beispielsweise auf folgenden Tatsachen beruhen: Beim Aufbau der komplementären Stränge tritt sehr schnell eine Desynchronisation der Synthese auf, so dass bei jedem Schritt die Fehler akkumulieren. Deshalb können nur sehr kurze Fragmente sequenziert werden. Es ist zu betonen, dass alle beschriebenen BASS-Methoden nicht auf der Detektion von einzelnen Molekülen beruhen. Das Signal wird stattdessen von einer großen Anzahl identischer an einem definierten Ort immobilisierter Moleküle registriert. Die in diesen Methoden übliche Verwendung der Begriffe "einzelne Moleküle" und "Moleküle" zielt dabei nicht auf individuelle, voneinander getrennte Moleküle, sondern auf eine Population, die aus vielen identischen Molekülen besteht. Identisch heißt in diesem Fall, dass die Moleküle die gleiche Sequenz haben. Despite the success of some of the method's individual steps it did not become a functioning process developed. This may be due to the following facts, for example are based: When building the complementary strands occurs very much desynchronization of the synthesis quickly, so that at accumulate the errors every step. Therefore only very short fragments are sequenced. It should be emphasized that all described BASS methods are not based on the detection based on individual molecules. The signal is instead of a large number of identical ones in a defined location immobilized molecules registered. The in these methods usual use of the terms "single molecules" and "Molecules" is not aimed at individual, from each other separate molecules but on a population that made up there are many identical molecules. Identical means in in this case that the molecules have the same sequence.

Die Analyse des Genexpressions-Spektrums ist zu einem wichtigen Werkzeug in der Wissenschaft geworden. Der Vergleich der Genexpressions-Spektren zwischen verschiedenen Zelllinien, Geweben oder Entwicklungsstadien erlaubt Rückschlüsse auf die darin ablaufenden spezifischen biologischen Prozesse. So kann man z. B. erwarten, dass der Vergleich zwischen Tumorzellen und gesunden Zellen gleicher Herkunft Auskunft über die am Tumorgeschehen beteiligten Gene gibt. Dabei ist wichtig, dass die Aktivität möglichst vieler oder aller Gene gleichzeitig analysiert wird. The analysis of the gene expression spectrum is one become an important tool in science. The comparison the gene expression spectra between different cell lines, Tissues or developmental stages allow conclusions to be drawn about the specific biological processes taking place in it. So can one z. B. expect the comparison between tumor cells and healthy cells of the same origin information about the am Genes involved in tumor events exist. It is important that the activity of as many or all genes as possible at the same time is analyzed.

Die Analyse der Genexpression ist eine komplexe Aufgabe: Die Anzahl der in einem Zelltyp aktiven Gene kann mehrere Tausend betragen. Die Analyse sollte aber möglichst alle im Genom der betreffenden Art enthaltenen Gene (etwa 32000 beim Menschen) berücksichtigen. Hinzu kommt, dass die im jeweiligen Zelltyp aktiven Gene erstens meist noch nicht komplett bekannt sind und zweitens unterschiedlich stark exprimiert werden. The analysis of gene expression is a complex task: The Number of genes active in a cell type can be several thousand be. However, the analysis should, if possible, all in the genome of genes in question (approximately 32,000 in humans) consider. In addition, that in the respective cell type firstly, active genes are usually not fully known and secondly, expressed to different degrees.

Es wurden bereits viele Methoden zur Genexpressionsanalyse entwickelt, so z. B. Differential Display (Nature 1984, v.308 S. 149, Science 1992 v.257 S. 967), Expressed Sequence Tags (EST) (Science 1991 v.252, S. 1656, Nature Genetics 1992, v.2 S. 173), Northern blotting oder RT-PCR (PNAS 1977, v.74, S. S350, Cell 1983 v.34 S. 865, "The PCR Technique, RT-PCR" 1998, Ed. Paul Suebert, Eaton Publishing). Alle diese Methoden können nur eine sehr begrenzte Anzahl an Genen pro Reaktion analysieren und sind zum Teil sehr arbeitsintensiv. There have been many methods for gene expression analysis developed so z. B. Differential Display (Nature 1984, v. 308 P. 149, Science 1992 v.257 p. 967), Expressed Sequence Tags (EST) (Science 1991 v.252, p. 1656, Nature Genetics 1992, v.2 P. 173), Northern blotting or RT-PCR (PNAS 1977, v.74, P. S350, Cell 1983 v.34 p. 865, "The PCR Technique, RT-PCR" 1998, Ed. Paul Suebert, Eaton Publishing). All of these methods can only have a very limited number of genes per reaction analyze and are sometimes very labor intensive.

Die am weitesten verbreitete Methode zur parallelen Analyse der Genexpressionsmuster ist die Hybridisierung eines zu analysierenden Gemischs von cDNA-Molekülen mit an eine Oberfläche gebundenen Oligonukleotiden, die in einer bestimmteh Anordnung, meist als "Microarray" fixiert sind ("Microarray Biochip Technology" 2000, Ed. M. Schena, Eaton Publishing, Zhao et al. Gene 1995, v. 156, S. 207, Schena et al. Science 1995 v.270, S. 467, Lockhart et al. US Patent 6.040.138, Wang US Patent 6.004.755, Arlinghaus et al. US Patent S. 821.060, Southern US Patent S. 700.637, Fodor et al. US Patent S. 871.928). The most widely used parallel analysis method the gene expression pattern is the hybridization of one analyzing mixture of cDNA molecules with an Surface bound oligonucleotides in a certain arrangement, mostly fixed as a "microarray" ("Microarray Biochip Technology" 2000, Ed. M. Schena, Eaton Publishing, Zhao et al. Gene 1995, v. 156, p. 207, Schena et al. Science 1995 v.270, p. 467, Lockhart et al. U.S. patent 6,040,138, Wang U.S. Patent 6,004,755, Arlinghaus et al. US Patent p. 821,060, Southern US patent p. 700,637, Fodor et al. U.S. Patent pp. 871,928).

Zu den großen Nachteilen der Hybridisierungsmethode zählen: Die Fertigung der an die Oberfläche gebundenen Oligonukleotide ist teuer. Die Analyse beschränkt sich auf Gene, deren Sequenzen bereits bekannt sind. Mehrere Mismatch-Kontrollen vergrößern die Anzahl der Oligonukleotide, die immobilisiert werden müssen. The major disadvantages of the hybridization method include: The production of the oligonucleotides bound to the surface is expensive. The analysis is limited to genes whose Sequences are already known. Multiple mismatch controls increase the number of oligonucleotides that are immobilized Need to become.

Die Aufgabe der vorliegenden Erfindung besteht daher darin, ein Verfahren zur Sequenzanalyse von Nukleinsäureketten und der Analyse der Genexpression bereitzustellen, das die Nachteile der oben erwähnten Methoden nicht aufweist und vor allem eine billigere, schnellere und effizientere Analyse von Nukleinsäuresequenzen ermöglicht. Insbesondere soll das Verfahren in der Lage sein, viele Sequenzen parallel zu bestimmen. Es kann dann beispielsweise für die Analyse sehr langer Nukleinsäureketten (mehrere Mb) oder für die Variantenalyse an vielen kurzen Ketten (Mutationsanalyse, SNP- Analyse) in einem Ansatz verwendet werden. The object of the present invention is therefore to a method for sequence analysis of nucleic acid chains and the analysis of gene expression that the Disadvantages of the methods mentioned above does not have and before all a cheaper, faster and more efficient analysis of Allows nucleic acid sequences. In particular, that should Procedures to be able to run many sequences in parallel determine. It can then be very useful for analysis, for example long nucleic acid chains (several Mb) or for that Variant analysis on many short chains (mutation analysis, SNP- Analysis) can be used in one approach.

3. Kurze Beschreibung3. Brief description

Gegenstand der vorliegenden Erfindung ist ein Verfahren zur parallelen Sequenzanalyse von Nukleinsäuresequenzen (Nukleinsäureketten, NSKs) gelöst, bei dem man
Fragmente (NSKFs) einzelsträngiger NSKs mit einer Länge von etwa 50 bis 1000 Nukleotiden erzeugt, die überlappende Teilsequenzen der Gesamtsequenzen darstellen, man
die NSKFs unter Verwendung eines einheitlichen oder mehrerer unterschiedlicher Primer in Form von NSKF-Primer- Komplexen auf einer Reaktionsoberfläche in einer zufälligen Anordnung bindet, man
eine zyklische Aufbaureaktion des komplementären Stranges der NSKFs unter Verwendung einer oder mehrerer Polymerasen durchführt, indem man

  • a) zu den an die Oberfläche gebundenen NSKF-Primer- Komplexen eine Lösung zugibt, die eine oder mehrere Polymerasen und ein bis vier modifizierte Nukleotide (NTs*) enthält, die mit Fluoreszenzfarbstoffen markiert sind, wobei die bei gleichzeitiger Verwendung von mindestens zwei NTs* jeweils an den NTs befindlichen Fluoreszenzfarbstoffe so gewählt sind, dass sich die verwendeten NTs* durch Messung unterschiedlicher Fluoreszenzsignale voneinander unterscheiden lassen, wobei die NTs* strukturell so modifiziert sind, daß die Polymerase nach Einbau eines solchen NT* in einen wachsenden komplementären Strang nicht in der Lage ist, ein weiteres NT* in denselben Strang einzubauen, wobei der zur Termination führende Substituent mit dem Fluoreszenzfarbstoff abspaltbar ist, man
  • b) die in Stufe a) erhaltene stationäre Phase unter Bedingungen inkubiert, die zur Verlängerung der komplementären Stränge geeignet sind, wobei die komplementären Stränge jeweils um ein NT* verlängert werden, man
  • c) die in Stufe b) erhaltene stationäre Phase unter Bedingungen wäscht, die zur Entfernung nicht in einen komplementären Strang eingebauter NTs geeignet sind, man
  • d) die einzelnen, in komplementäre Stränge eingebauten NTs durch Messen des für den jeweiligen Fluoreszenzfarbstoff charakteristischen Signals detektiert, wobei man gleichzeitig die relative Position der einzelnen Fluoreszenzsignale auf der Reaktionsoberfläche bestimmt, man
  • e) zur Erzeugung unmarkierter (NTs oder) NSKFs die zur Termination führenden Substituenten und die Fluoreszenzfarbstoffe von den am komplementären Strang angefügten NTs* abspaltet, man
  • f) die in Stufe e) erhaltene stationäre Phase unter Bedingungen wäscht, die zur Entfernung der Fluoreszenzfarbstoffe und der Liganden geeignet sind, man
die Stufen a) bis f) gegebenenfalls mehrfach wiederholt,
wobei man die relative Position einzelner NSKF-Primer-Komplexe auf der Reaktionsoberfläche und die Sequenz dieser NSKFs durch spezifische Zuordnung der in Stufe d) in aufeinanderfolgenden Zyklen an den jeweiligen Positionen detektierten Fluoreszenzsignale zu den NTs bestimmt. The present invention relates to a method for parallel sequence analysis of nucleic acid sequences (nucleic acid chains, NSKs), in which
Fragments (NSKFs) of single-stranded NSKs with a length of about 50 to 1000 nucleotides are generated, which represent overlapping partial sequences of the total sequences
the NSKFs are bound to a reaction surface in a random arrangement using one or more different primers in the form of NSKF-primer complexes
cyclically build the complementary strand of the NSKFs using one or more polymerases by
  • a) a solution is added to the NSKF-primer complexes bound to the surface which contains one or more polymerases and one to four modified nucleotides (NTs *) which are labeled with fluorescent dyes, the simultaneous use of at least two NTs * Fluorescent dyes located on each of the NTs are selected such that the NTs * used can be distinguished from one another by measuring different fluorescence signals, the NTs * being structurally modified such that the polymerase after incorporating such an NT * into a growing complementary strand is not in the Is able to incorporate another NT * in the same strand, whereby the substituent leading to the termination can be split off with the fluorescent dye
  • b) the stationary phase obtained in stage a) is incubated under conditions which are suitable for the extension of the complementary strands, the complementary strands being extended by one NT * each,
  • c) the stationary phase obtained in stage b) is washed under conditions which are not suitable for removing NTs which are not incorporated in a complementary strand, man
  • d) the individual NTs built into complementary strands are detected by measuring the signal characteristic of the respective fluorescent dye, at the same time determining the relative position of the individual fluorescent signals on the reaction surface
  • e) to generate unlabeled (NTs or) NSKFs, the substituents leading to the termination and the fluorescent dyes are cleaved from the NTs * attached to the complementary strand, man
  • f) the stationary phase obtained in step e) is washed under conditions which are suitable for removing the fluorescent dyes and the ligands
stages a) to f) are repeated several times, if necessary,
the relative position of individual NSKF-primer complexes on the reaction surface and the sequence of these NSKFs being determined by specific assignment of the fluorescence signals detected in step d) in successive cycles at the respective positions to the NTs.

Aus den ermittelten Teilsequenzen kann man beispielsweie die Gesamtsequenz der NSKs bestimmen. Unter einer parallelen Sequenzanalyse wird in diesem Zusammenhang die gleichzeitige Sequenzanalyse vieler NSKFs verstanden (beispielsweise 1.000.000 bis 10.000.000), Wobei diese NSKFs von einer einheitlichen NSK-Population oder von mehreren unterschiedlichen NSK-Populationen abgeleitet sind. From the partial sequences determined, for example, the Determine overall sequence of NSKs. Under a parallel In this context, sequence analysis becomes simultaneous Understanding sequence analysis of many NSKFs (e.g. 1,000,000 to 10,000,000), with these NSKFs of one uniform NSK population or of several different NSK populations are derived.

Die erhaltene Population von überlappenden Teilsequenzen läßt sich beispielsweise bei de novo Sequenzierung mit kommerziell erhältlichen Programmen zur Gesamtsequenz der NSK zusammenfügen (Huang et al. Genom Res. 1999 v.9 S. 868, Huang Genomics 1996 v.33 S. 21, Bonfield et al. NAR 1995 v.23 S. 4992, Miller et al. J. Comput.Biol. 1994 v.1 S. 257). The population of overlapping partial sequences obtained leaves for example in de novo sequencing with commercial programs available for the overall sequence of the NSK (Huang et al. Genom Res. 1999 v.9 p. 868, Huang Genomics 1996 v.33 p. 21, Bonfield et al. NAR 1995 v.23 p. 4992, Miller et al. J. Comput.Biol. 1994 v.1 p. 257).

Bei der Analyse von Varianten einer bekannten Referenzsequenz lassen sich Mutationen oder Einzelnukleotidpolymorphismen durch einen Vergleich der erhaltenen überlappenden Teilsequenzen mit der Referenzsequenz feststellen. When analyzing variants of a known reference sequence can be mutations or single nucleotide polymorphisms by comparing the obtained overlapping Determine partial sequences with the reference sequence.

Gemäß einer besonderen Ausführungsform der Erfindung kann das Verfahren durchgeführt werden, indem man die Stufen a) bis f) der zyklischen Aufbaureaktion mehrfach wiederholt, wobei man

  • a) in jedem Zyklus nur jeweils ein markiertes NT*,
  • b) in jedem Zyklus jeweils zwei unterschiedlich markierte NTs* oder
  • c) in jedem Zyklus jeweils vier unterschiedlich markierte NTs*
einsetzt. According to a particular embodiment of the invention, the process can be carried out by repeating steps a) to f) of the cyclic build-up reaction several times, with
  • a) only one marked NT * in each cycle,
  • b) in each cycle two differently marked NTs * or
  • c) four differently marked NTs * in each cycle
starts.

Wenn die NSKs Varianten einer bekannten Referenzsequenz sind kann das Verfahren auch durchgeführt werden, indem man die Stufen a) bis f) der zyklischen Aufbaureaktion mehrfach wiederholt, wobei man in den Zyklen abwechselnd jeweils zwei unterschiedlich markierte NTs* und zwei unmarkierte NTs einsetzt und man die Gesamtsequenzen durch Vergleich mit der Referenzsequenz ermittelt. If the NSKs are variants of a known reference sequence the method can also be carried out by the Stages a) to f) of the cyclic build-up reaction several times repeated, alternating two cycles differently marked NTs * and two unmarked NTs used and the total sequences by comparison with the Reference sequence determined.

Gegenstand der vorliegenden Erfindung ist ferner ein Verfahren zur hoch parallelen Analyse der Genexpression, bei dem man
einzelsträngige Genprodukte bereitstellt, man
die Genprodukte unter Verwendung eines einheitlichen oder mehrerer unterschiedlichen Primer in Form von Genprodukt- Primer-Komplexen auf einer Reaktionsoberfläche in einer zufälligen Anordnung bindet, man
eine zyklische Aufbaureaktion des komplementären Stranges der Genprodukte unter Verwendung einer oder mehrerer Polymerasen durchführt, indem man

  • a) zu den auf der Oberfläche gebundenen Genprodukt- Primer-Komplexen eine Lösung zugibt, die eine oder mehrere Polymerasen und ein bis vier modifizierte Nukleotide (NTs*) enthält, die mit Fluoreszenzfarbstoffen markiert sind, wobei die bei gleichzeitiger Verwendung von mindestens zwei NTs* jeweils an den NTs* befindlichen Fluoreszenzfarbstoffe so gewählt sind, dass sich die verwendeten NTs* durch Messung unterschiedlicher Fluoreszenzsignale voneinander unterscheiden lassen, wobei die NTs* strukturell so modifiziert sind, daß die Polymerase nach Einbau eines solchen NT* in einen wachsenden komplementären Strang nicht in der Lage ist, ein weiteres NT* in denselben Strang einzubauen, wobei der zur Termination führende Substituent mit dem Fluoreszenzfarbstoff abspaltbar ist, man
  • b) die in Stufe a) erhaltene stationäre Phase unter Bedingungen inkubiert, die zur Verlängerung der komplementären Stränge geeignet sind, wobei die komplementären Stränge jeweils um ein NT* verlängert werden, man
  • c) die in Stufe b) erhaltene stationäre Phase unter Bedingungen wäscht, die zur Entfernung nicht in einen komplementären Strang eingebauter NTs* geeignet sind, man
  • d) die einzelnen, in komplementäre Stränge eingebauten NTs* durch Messen des für den jeweiligen Fluoreszenzfarbstoff charakteristischen Signals detektiert, wobei man gleichzeitig die relative Position der einzelnen Fluoreszenzsignale auf der Reaktionsoberfläche bestimmt, man
  • e) zur Erzeugung unmarkierter (NTs oder) NSKFs die zur Termination führenden Substituenten mit den Fluoreszenzfarbstoffen von den am komplementären Strang angefügten NTs* abspaltet, man
  • f) die in Stufe e) erhaltene stationäre Phase unter Bedingungen wäscht, die zur Entfernung der Fluoreszenzfarbstoffe und der Liganden geeignet sind, man
die Stufen a) bis f) gegebenenfalls mehrfach wiederholt,
wobei man die relative Position einzelner Genprodukt- Primer-Komplexe auf der Reaktionsoberfläche und die Sequenz dieser Genprodukte durch spezifische Zuordnung der in Stufe d) in aufeinanderfolgenden Zyklen an den jeweiligen Positionen detektierten Fluoreszenzsignale zu den NTs bestimmt und man aus den ermittelten Teilsequenzen die Identität der Genprodukte bestimmt. The present invention also relates to a method for highly parallel analysis of gene expression, in which
provides single-stranded gene products, one
the gene products are bound to a reaction surface in a random arrangement using one or more different primers in the form of gene product-primer complexes, one
perform a cyclic build-up reaction of the complementary strand of the gene products using one or more polymerases by
  • a) a solution is added to the gene product-primer complexes bound to the surface which contains one or more polymerases and one to four modified nucleotides (NTs *) which are labeled with fluorescent dyes, the simultaneous use of at least two NTs * Fluorescent dyes located on each of the NTs * are selected such that the NTs * used can be distinguished from one another by measuring different fluorescence signals, the NTs * being structurally modified such that the polymerase after incorporating such an NT * into a growing complementary strand does not is able to incorporate another NT * into the same strand, the terminating substituent being cleavable with the fluorescent dye
  • b) the stationary phase obtained in stage a) is incubated under conditions which are suitable for the extension of the complementary strands, the complementary strands being extended by one NT * each,
  • c) the stationary phase obtained in stage b) is washed under conditions which are not suitable for the removal of NTs * which are not incorporated into a complementary strand
  • d) the individual NTs * built into complementary strands are detected by measuring the signal which is characteristic of the respective fluorescent dye, the relative position of the individual fluorescent signals on the reaction surface being determined at the same time
  • e) to generate unlabeled (NTs or) NSKFs, the substituents leading to the termination with the fluorescent dyes are split off from the NTs * attached to the complementary strand, one man
  • f) the stationary phase obtained in step e) is washed under conditions which are suitable for removing the fluorescent dyes and the ligands
stages a) to f) are repeated several times, if necessary,
whereby the relative position of individual gene product-primer complexes on the reaction surface and the sequence of these gene products are determined by specific assignment of the fluorescence signals detected in step d) in successive cycles at the respective positions to the NTs and the identity of the gene products is determined from the partial sequences determined certainly.

Bei den Genprodukten handelt es sich um die primären Genprodukte der Gene, deren Expression analysiert werden soll. Im wesentlichen handelt es sich dabei um RNA-Transkripte der genannten Gene, welche auch als Target-Sequenzen (oder Target- Nukleinsäuresequenzen) bezeichnet werden. Diese Target- Sequenzen schließen neben mRNA auch davon abgeleitete einzelsträngige und doppelsträngige cDNA, von cDNA abgeleitete RNA oder von cDNA amplifizierte DNA ein. The gene products are the primary ones Gene products of the genes whose expression is to be analyzed. in the these are essentially RNA transcripts called genes, which are also called target sequences (or target Nucleic acid sequences) are called. This target In addition to mRNA, sequences also include derived ones single-stranded and double-stranded cDNA, derived from cDNA RNA or DNA amplified by cDNA.

Die Genprodukte oder Target-Sequenzen können entweder als mRNAs direkt aus einer biologischen Probe (z. B. Zellextrakt, Gewebeextrakt oder Extrakt von ganzen Organismen) isoliert oder als cDNAs durch reverse Transkription der mRNAs erhalten werden. The gene products or target sequences can either be as mRNAs directly from a biological sample (e.g. cell extract, Tissue extract or extract from whole organisms) isolated or obtained as cDNAs by reverse transcription of the mRNAs become.

Unter einer hoch parallelen Analyse wird in diesem Zusammenhang die gleichzeitige Sequenzanalyse vieler Genprodukt-Moleküle verstanden (beispielsweise 1.000.000 bis 10.000.000), wobei diese Genprodukt-Moleküle eine komplexe heterogene Population darstellen, die z. B. einem kompletten Expressionsprofil bzw. einem Expressionsspektrum eines Gewebes entspricht. Taking a highly parallel analysis in this Relationship between the simultaneous sequence analysis of many Understand gene product molecules (e.g. 1,000,000 to 10,000,000), these gene product molecules being a complex represent heterogeneous population z. B. a complete Expression profile or an expression spectrum of a tissue equivalent.

Gemäß einer besonderen Ausführungsform der Erfindung kann das Verfahren durchgeführt werden, indem man die Stufen a) bis f) der zyklischen Aufbaureaktion mehrfach wiederholt, wobei man

  • a) in jedem Zyklus nur jeweils ein markiertes NT*,
  • b) in jedem Zyklus jeweils zwei unterschiedlich markierte NTs* oder
  • c) in jedem Zyklus jeweils vier unterschiedlich markierte NTs*
einsetzt. According to a particular embodiment of the invention, the process can be carried out by repeating steps a) to f) of the cyclic build-up reaction several times, with
  • a) only one marked NT * in each cycle,
  • b) in each cycle two differently marked NTs * or
  • c) four differently marked NTs * in each cycle
starts.

Das Verfahren kann auch durchgeführt werden, indem man die Stufen a) bis f) der zyklischen Aufbaureaktion mehrfach wiederholt, wobei man in den Zyklen abwechselnd jeweils zwei unterschiedlich markierte NTs* und zwei unmarkierte NTs einsetzt und man die Identität der Genprodukte durch Vergleich mit den Referenzsequenzen ermittelt. The process can also be carried out by using the Stages a) to f) of the cyclic build-up reaction several times repeated, alternating two cycles differently marked NTs * and two unmarked NTs and the identity of the gene products is compared determined with the reference sequences.

Gegenstand der Erfindung ist ferner ein Kit zur Durchführung des Verfahrens das eine Reaktionsoberfläche, zur Durchführung des Verfahrens erforderliche Reaktionslösungen, eine oder mehrere Polymerasen, und Nukleotide (NTs) enthält, von denen ein bis vier mit Fluoreszenzfarbstoffen markiert sind, wobei die NTs* an der 3'-Position strukturell so modifiziert sind, daß die Polymerase nach Einbau eines solchen NT* in einen wachsenden komplementären Strang nicht in der Lage ist, ein weiteres NT* in denselben Strang einzubauen, wobei der zur Termination führende Substituent mit dem Fluoreszenzfarbstoff abspaltbar ist. Gemäß einer besonderen Ausführungsform der Erfindung enthält das Kit ferner zur Erzeugung von Einzelsträngen aus Doppelsträngen erforderliche Reagenzien, einzelsträngige Nukleinsäuremoleküle, die als PBS in die NSKFs eingeführt werden, Oligonukleotid-Primer, zur Abspaltung der Fluoreszenzfarbstoffe und der zur Termination führenden Substituenten erforderliche Reagenzien und/oder Waschlösungen. The invention further relates to a kit for carrying out of the process, the one reaction surface to carry out the reaction solutions required, one or contains several polymerases, and nucleotides (NTs), of which one to four are marked with fluorescent dyes, where the NTs * at the 3 'position are structurally modified so that the polymerase after installation of such an NT * in a growing complementary strand is unable to one to install another NT * in the same line, whereby the for Termination leading substituent with the fluorescent dye can be split off. According to a particular embodiment of the Invention also includes the kit for generating Single strands of double strands required reagents, single-stranded nucleic acid molecules that act as PBS in the NSKFs are introduced, oligonucleotide primers, to cleave the Fluorescent dyes and those leading to termination Substituents required reagents and / or wash solutions.

Die erfindungsgemäße Methode dient zur Ermittlung der Nukleinsäuresequenzen und kann in verschiedenen Bereichen der Genetik eingesetzt werden. Dazu zählen insbesondere die Bestimmung unbekannter, langer Sequenzen, Analysen von Sequenz-Polymorphismen und Punktmutationen sowie die parallele Analyse einer großen Zahl an Gensequenzen, sowie die Analyse der Genexpression. The method according to the invention is used to determine the Nucleic acid sequences and can be found in different areas of the Genetics can be used. These include in particular Determination of unknown, long sequences, analysis of Sequence polymorphisms and point mutations as well as the parallel Analysis of a large number of gene sequences, as well as analysis gene expression.

Bei der Analyse langer Nukleinsäureketten (z. B. 100 Kb und länger) hängt die Vorbereitung des zu analysierenden Materials (einzel- und doppelsträngige Nukleinsäuresequenzen) von der Aufgabestellung ab und hat das Ziel, aus einer langen Nukleinsäurekette eine Population an relativ kleinen, einzelsträngigen Nukleinsäurekettenfragmenten (NSKFs) zu bilden, diese Fragmente mit einem für den Start der Sequenzierungsreaktion geeigneten Primer zu versehen (NSKF- Primer-Komplexe) und auf einer planen Oberfläche zu fixieren. When analyzing long nucleic acid chains (e.g. 100 Kb and longer) depends on the preparation of the item to be analyzed Materials (single and double stranded nucleic acid sequences) from the task position and has the goal of a long Nucleic acid chain a population of relatively small, single-stranded nucleic acid chain fragments (NSKFs) form these fragments with one for starting the To provide a suitable primer for the sequencing reaction (NSKF Primer complexes) and fix them on a flat surface.

Dabei werden einzelne NSKFs auf einer planen Oberfläche in einer solchen Weise fixiert, dass eine enzymatische Reaktion an diesen Molekülen ablaufen kann. Prinzipiell sind verschiedene Arten der Immobilisation möglich, die von der Zielsetzung, der Art der NSK und der für die Reaktion eingesetzten Polymerase abhängen. Die NSKFs werden bei der Immobilisierung bzw. Bindung zufällig auf der Oberfläche verteilt, d. h. es muß also nicht auf eine exakte Positionierung der einzelnen Ketten geachtet werden. NSKF- Primer-Komplexe können über die NSKFs oder Primer an die Oberfläche gebunden werden. Die NSKF-Primer-Komplexe müssen dabei in einer solchen Dichte auf der Oberfläche fixiert werden, dass eine eindeutige Zuordnung der später detektierten Signale von den eingebauten NT*s zu einzelnen NSKFs gewährleistet ist. Individual NSKFs are placed on a flat surface fixed in such a way that an enzymatic reaction can run on these molecules. Are principally different types of immobilization possible by the Objective, the type of NSK and the response depend on polymerase used. The NSKFs are at the Immobilization or binding randomly on the surface distributed, d. H. So it doesn't have to be an exact one Positioning of the individual chains must be observed. NSKF- Primer complexes can be linked to the NSKFs or primers Surface bound. The NSKF primer complexes must fixed in such a density on the surface be that an unambiguous assignment of the later detected Signals from the built-in NT * s to individual NSKFs is guaranteed.

Nach der Vorbereitung der NSKFs startet man mit allen auf der Oberfläche immobilisierten NSKF-Primer-Komplex-Molekülen die Sequenzierungsreaktion. Als Grundlage der Sequenzierung dient die Synthese des komplementären Stranges zu jedem einzelnen gebundenen NSKF. Dabei werden in den neu synthetisierten Strang markierte NTs* eingebaut. Die Polymerase baut in einem Zyklus nur ein einziges markiertes NT* in die wachsende Kette ein. After preparing the NSKFs, you start with everyone at the Surface immobilized the NSKF primer complex molecules Sequencing reaction. It serves as the basis for sequencing the synthesis of the complementary strand to each one bound NSKF. Thereby in the newly synthesized String marked NTs * installed. The polymerase builds in one Cycle only a single marked NT * in the growing chain on.

Die Sequenzierungsreaktion verläuft in mehreren Zyklen. Ein Zyklus umfasst folgende Schritte:

  • a) Zugabe einer Lösung mit markierten Nukleotiden (NTs*) und Polymerase zu den gebundenen NSKF-Primer-Komplexen,
  • b) Inkubation der gebundenen NSKF-Primer-Komplexe mit dieser Lösung unter Bedingungen, die zur Verlängerung der komplementären Stränge um ein NT geeignet sind,
  • c) Waschen,
  • d) Detektion der Signale von einzelnen Molekülen,
  • e) Entfernung der Markierung von den eingebauten Nukleotiden,
  • f) Waschen.
The sequencing reaction proceeds in several cycles. A cycle comprises the following steps:
  • a) adding a solution with labeled nucleotides (NTs *) and polymerase to the bound NSKF-primer complexes,
  • b) incubation of the bound NSKF primer complexes with this solution under conditions which are suitable for extending the complementary strands by one NT,
  • c) washing,
  • d) detection of signals from individual molecules,
  • e) removing the label from the incorporated nucleotides,
  • f) washing.

Gegebenenfalls erfolgt eine mehrfache Wiederholung des Zyklus (a-f). If necessary, the cycle is repeated several times (A-f).

Die Reaktionsbedingungen des Schrittes (b) in einem Zyklus werden so gewählt, dass die Polymerasen an mehr als 50% der an der Sequenzierungsreaktion beteiligten NSKFs (extensionsfähige NSKF-Primer-Komplexe) in einem Zyklus ein markiertes NT* einbauen können, vorzugsweise an mehr als 90%. The reaction conditions of step (b) in one cycle are chosen so that the polymerases on more than 50% of the NSKFs involved in the sequencing reaction (expandable NSKF primer complexes) a labeled NT * in one cycle can install, preferably to more than 90%.

Die Anzahl der durchzuführenden Zyklen hängt dabei von der jeweiligen Aufgabenstellung ab, ist theoretisch nicht beschränkt und liegt vorzugsweise zwischen 20 und 5000. The number of cycles to be carried out depends on the respective task, is theoretically not limited and is preferably between 20 and 5000.

Danach wird für jedes fixierte NSKF seine spezifische Sequenz aus der Reihenfolge der eingebauten NTs* ermittelt. After that, each NSKF becomes its specific sequence determined from the order of the installed NTs *.

Aus den überlappenden NSKF-Sequenzen kann in einer Ausführungsform die ursprüngliche NSK-Sequenz rekonstruiert werden ("Automated DNA sequencing and analysis" S. 231 ff. 1994 M. Adams et al. Academic Press, Huang et al. Genom Res. 1999 v.9 S. 868, Huang Genomics 1996 v.33 S. 21, Bonfield et al. NAR 1995 v.23 S. 4992, Miller et al. J. Comput.Biol. 1994 v.1 S. 257). Dabei sucht man in der gesamten Population von NSKF- Sequenzen nach Übereinstimmungen/Überlappungen in den Sequenzen von NSKFs. Durch diese Übereinstimmungen/Überlappungen kann man die NSKF in eine Reihe bringen, z. B.:


In one embodiment, the original NSK sequence can be reconstructed from the overlapping NSKF sequences ("Automated DNA sequencing and analysis" p. 231 ff. 1994 M. Adams et al. Academic Press, Huang et al. Genom Res. 1999 v. 9 p. 868, Huang Genomics 1996 v.33 p. 21, Bonfield et al. NAR 1995 v.23 p. 4992, Miller et al. J. Comput. Biol. 1994 v.1 p. 257). The entire population of NSKF sequences is searched for matches / overlaps in the sequences of NSKFs. Through these matches / overlaps one can bring the NSKF in a row, e.g. B .:


In der Praxis hat sich bei einer Sequenzierung von unbekannten Sequenzen bewährt, eine Länge der sequenzierten Stücke von mehr als 300 bp zu erreichen. Das erlaubt die Sequenzierung von Genomen aus Eukaryonten im Schrotschuss-Verfahren. In practice, there has been a sequencing of unknowns Proven sequences, a length of the sequenced pieces of to reach more than 300 bp. This allows sequencing of genomes from eukaryotes in the shotgun process.

Dabei können die Fehler der Methode mit verschiedenen Mitteln erfasst und korrigiert werden. Sämtliche Schritte des Verfahrens können weitgehend automatisiert werden. The method errors can be done by various means be recorded and corrected. All steps of the Procedures can be largely automated.

Durch die Arbeit mit einzelnen Molekülen ergeben sich große Vorteile gegenüber der früher beschriebenen BASS-Methode:

  • 1. Da die Moleküle einzeln detektiert werden, besteht keine Gefahr, dass das Signal durch die Desynchronisation in der Population fehlerhaft wird. Für jedes fixierte NSKF wird eine eigene Sequenz erstellt. Daher spielt es keine Rolle, ob an einem benachbarten Molekül die Synthese bereits weiter fortgeschritten oder zurückgeblieben ist. Dadurch wird eine hoch parallele Sequenzierung langer NSKF erst möglich.
  • 2. Es ist nicht notwendig, Moleküle in einer definierten Anordnung auf der Oberfläche zu fixieren, da das Signal von einzelnen Molekülen ausgeht und nicht von einer räumlich definierten Population (was bei BASS-Methoden notwendig ist).
  • 3. Es ist nicht zwingend notwendig multiple Kopien von den zu analysierenden Nukleinsäureketten herzustellen, so dass PCR- und bzw. oder Klonierungsschritte entfallen können. Dies führt zu einer enormen Beschleunigung der Analyse im Vergleich zu bestehenden Verfahren.
Working with individual molecules offers great advantages over the BASS method described earlier:
  • 1. Since the molecules are detected individually, there is no danger that the signal will become incorrect due to the desynchronization in the population. A separate sequence is created for each fixed NSKF. It is therefore irrelevant whether the synthesis of a neighboring molecule has already progressed or lagged behind. This makes highly parallel sequencing of long NSKF possible.
  • 2. It is not necessary to fix molecules in a defined arrangement on the surface, since the signal comes from individual molecules and not from a spatially defined population (which is necessary with BASS methods).
  • 3. It is not absolutely necessary to make multiple copies of the nucleic acid chains to be analyzed, so that PCR and / or cloning steps can be omitted. This leads to an enormous acceleration of the analysis compared to existing methods.

Das erfindungsgemäße Verfahren zur Analyse der Genexpression erhält durch eine gleichzeitige Sequenzierung einzelner Genproduktmoleküle mehrere Vorteile gegenüber bekannten Methoden der Analyse der Genexpression:

  • 1. Die Genprodukte können in einer beliebigen Anordnung auf der Oberfläche binden. Eine vorherige aufwendige Synthese von verschiedenen Oligonukleotiden an bestimmten Positionen (wie beispielsweise bei der Hybridisierungsmethode) ist somit nicht notwendig.
  • 2. Das Material kann auf einer standardisierten Oberfläche analysiert werden.
  • 3. Auch die Expression noch unbekannter Gene kann ermittelt werden, weil alle im Ansatz enthaltenen Genprodukte analysiert werden.
  • 4. Die große Anzahl der analysierten Moleküle erlaubt auch die Detektion schwach exprimierter Gene.
  • 5. Kleinste Mengen an Ausgangsmaterial können eingesetzt werden: mRNA aus einer einzelnen Zelle kann für die Analyse ausreichend sein.
  • 6. Sämtliche Schritte des Verfahrens können weitgehend automatisiert werden.
The simultaneous sequencing of individual gene product molecules gives the method according to the invention for analyzing gene expression several advantages over known methods of analyzing gene expression:
  • 1. The gene products can bind to the surface in any arrangement. A previous complex synthesis of different oligonucleotides at certain positions (such as in the hybridization method) is therefore not necessary.
  • 2. The material can be analyzed on a standardized surface.
  • 3. The expression of still unknown genes can also be determined because all gene products contained in the mixture are analyzed.
  • 4. The large number of molecules analyzed also allows the detection of poorly expressed genes.
  • 5. Smallest amounts of starting material can be used: mRNA from a single cell can be sufficient for analysis.
  • 6. All steps of the process can be largely automated.

Die Methode basiert auf mehreren Prinzipien:

  • 1. Kurze Nukleotidsequenzen (10-50 NTs) enthalten genügend Informationen zur Identifizierung des korrespondierenden Gens, wenn die Gensequenz selbst bereits in einer Datenbank enthalten ist.
    Eine Sequenz aus beispielsweise 10 NTs kann mehr als 106 verschiedene Kombinationen bilden. Das ist z. B. für die meisten Gene im menschlichen Genom, das nach heutiger Schätzung 32000 Gene enthält, ausreichend. Für Organismen mit weniger Genen kann die Sequenz noch kürzer sein.
  • 2. Der Methode liegt ein neues Verfahren zur die Sequenzierung einzelner Nukleinsäurekettenmoleküle zugrunde.
  • 3. Es können Nukleinsäureketten-Gemische untersucht werden.
  • 4. Die Sequenzierungsreaktion läuft an vielen Molekülen gleichzeitig ab, wobei die Sequenz jeder einzelnen gebundenen Nukleinsäurekette analysiert wird.
The method is based on several principles:
  • 1. Short nucleotide sequences (10-50 NTs) contain enough information to identify the corresponding gene if the gene sequence itself is already contained in a database.
    A sequence of, for example, 10 NTs can form more than 10 6 different combinations. That is e.g. For example, it is sufficient for most genes in the human genome, which according to current estimates contains 32,000 genes. The sequence can be even shorter for organisms with fewer genes.
  • 2. The method is based on a new method for sequencing individual nucleic acid chain molecules.
  • 3. Mixtures of nucleic acids can be examined.
  • 4. The sequencing reaction takes place simultaneously on many molecules, the sequence of each individual bound nucleic acid chain being analyzed.

Es ist bekannt, dass zur Untersuchung der Genexpression mRNAs oder von der mRNA abgeleitete Nukleinsäureketten (z. B. einzelsträngige cDNAs, doppelsträngige cDNAs, von cDNA abgeleitete RNA oder von cDNA amplifizierte DNA) eingesetzt werden kann. Unabhängig von der genauen Zusammensetzung werden sie im folgenden als Genprodukte bezeichnet. Auch Teilsequenzen dieser Genprodukte werden im folgenden als Genprodukte bezeichnet. It is known to study gene expression mRNAs or nucleic acid chains derived from the mRNA (e.g. single-stranded cDNAs, double-stranded cDNAs, from cDNA derived RNA or DNA amplified by cDNA) can be. Regardless of the exact composition hereinafter referred to as gene products. Also Partial sequences of these gene products are in the following as Called gene products.

Diese Genprodukte stellen ein Gemisch aus verschiedenen Nukleinsäureketten dar. These gene products are a mixture of different ones Nucleic acid chains.

Als Grundlage der Analyse dient die Synthese eines zum Genprodukt komplementären Stranges. The basis of the analysis is the synthesis of a Gene product of complementary strand.

Das Ziel der Vorbereitung ist, auf einer planen Oberfläche in zufälliger Weise gebundene Genprodukt-Primer-Komplexe bereitzustellen, an denen der Einbau von NT*s durch die Polymerase stattfinden kann (extensionsfähige Genprodukt- Primer-Komplexe). The goal of the preparation is to be on a flat surface randomly bound gene product-primer complexes to provide where the installation of NT * s by the Polymerase can take place (extensible gene product Primer complexes).

Mit diesen gebundenen Genprodukt-Primer-Komplexen wird die Sequenzierungsreaktion durchgeführt. With these bound gene product-primer complexes the Sequencing reaction carried out.

Sie verläuft in mehreren Zyklen. Pro Zyklus wird jeweils nur ein einziges markiertes NT* in den wachsenden Strang eingebaut. Ein Zyklus umfasst folgende Schritte:

  • a) Zugabe einer Lösung mit markierten Nukleotiden (NTs*) und Polymerase zu gebundenen Genprodukt-Primer-Komplexen,
  • b) Inkubation der gebundenen Genprodukt-Primer-Komplexe mit dieser Lösung unter Bedingungen, die zur Verlängerung der komplementären Stränge um ein NT* geeignet sind,
  • c) Waschen,
  • d) Detektion der Signale von einzelnen modifizierten, in die neu synthetisierten Stränge eingebauten NTs*-Molekülen,
  • e) Entfernung der Markierung von den eingebauten Nukleotiden,
  • f) Waschen.
It runs in several cycles. Only one marked NT * per cycle is installed in the growing strand. A cycle comprises the following steps:
  • a) adding a solution with labeled nucleotides (NTs *) and polymerase to bound gene product-primer complexes,
  • b) incubation of the bound gene product-primer complexes with this solution under conditions which are suitable for extending the complementary strands by one NT *,
  • c) washing,
  • d) detection of the signals from individual modified NTs * molecules built into the newly synthesized strands,
  • e) removing the label from the incorporated nucleotides,
  • f) washing.

Dieser Zyklus kann mehrmals wiederholt werden, so dass von jedem an der Sequenzierungsreaktion teilnehmenden Genprodukt- Primer-Komplex vorzugsweise 10 bis 50 NTs ermittelt werden. Danach erfolgt die Rekonstruktion der Nukleinsäuresequenzen aus den detektierten Signalen. Die ermittelten Sequenzen der gebundenen Genprodukte werden zur Bestimmung der Abundanzen untereinander verglichen und durch Vergleich mit Gensequenzen in Datenbanken bestimmten Genen zugeordnet. This cycle can be repeated several times, so that from any gene product participating in the sequencing reaction Primer complex preferably 10 to 50 NTs can be determined. The nucleic acid sequences are then reconstructed from the detected signals. The sequences of the Bound gene products are used to determine the abundance compared with each other and by comparison with gene sequences assigned to specific genes in databases.

4. Detaillierte Beschreibung4. Detailed description

Allgemeine Prinzipien der Reaktion, Materialauswahl und Materialvorbereitung (Erzeugung kurzer NSKFs, Einführung einer PBS, Einzelstrangvorbereitung, Primerauswahl, Fixierung von NSKFs), sowie die Detektionsapparatur und Detektion werden am Beispiel des Verfahrens zur Sequenzierung langer NSKs dargestellt. Das Verfahren zur Analyse der Genexpression wird anschließend im Beispiel 3 beschrieben. General principles of reaction, choice of materials and Material preparation (generation of short NSKFs, introduction a PBS, single strand preparation, primer selection, fixation from NSKFs), as well as the detection apparatus and detection become longer using the example of the sequencing method NSKs shown. The method of analyzing gene expression is then described in Example 3.

4.1 Allgemeine Prinzipien der Reaktion4.1 General principles of the reaction

Im folgenden sollen anhand der Sequenzierung eines mehrere Mb langen DNA-Stückes beispielhaft die allgemeinen Prinzipien der Reaktion dargestellt werden (Fig. 1). Der Sequenzierung und der Rekonstruktion von Nukleinsäurensequenzen liegt das Shotgun-Prinzip zugrunde ("Automated DNA sequencing and analysis" S. 231 ff. 1994 M. Adams et al. Academic Press, Huang et al. Genom Res. 1999 v.9 S. 868, Huang Genomics 1996 v.33 S. 21, Bonfield et al. NAR 1995 v.23 S. 4992, Miller et al. J. Comput.Biol. 1994 v.1 S. 257). Die Sequenz eines langen DNA- Stücks wird dabei durch die Sequenzierung kleiner DNA-Fragmente und nachfolgender Rekonstruktion ermittelt. Das zu analysierende Material (1) wird für die Sequenzierungsreaktion vorbereitet, indem es in Fragmente von vorzugsweise 50 bis 1000 bp Länge zerlegt wird (2). Jedes Fragment wird anschließend mit einer Primerbindungsstelle und einem Primer versehen (3). Dieses Gemisch aus verschiedenen DNA-Fragmenten wird nun auf einer planen Oberfläche fixiert (4). Die nicht gebundenen DNA-Fragmente werden durch einen Waschschritt entfernt. Danach wird die Sequenzierungsreaktion an der gesamten Reaktionsoberfläche durchgeführt. Diese Reaktion verläuft zyklisch. Im 1. Schritt des Zyklus wird ein mit einem Fluoreszenzfarbstoff markiertes NT* in den wachsenden Strang eingebaut: Dabei wird die Reaktion so gesteuert, dass in jedem Zyklus jeweils nur ein markiertes NT von einer Polymerase in den wachsenden Strang eingebaut werden kann. Das wird durch die Verwendung von NTs* erreicht, die an der 3-Position der Desoxyribose ein reversibel gekoppeltes, zur Termination führenden Substituenten tragen. Der Einbau eines weiteren markierten NT* wird dadurch unmöglich gemacht. Die Polymerase und die markierten NTs* werden gleichzeitig in die Reaktion eigesetzt (5). Danach wird das Reaktionsgemisch entfernt und die Oberfläche in geeigneter Art und Weise gewaschen (6). Nun folgt ein Detektionsschritt (7): Die Oberfläche wird mit einer für die Einzelmoleküldetektion geeigneten Vorrichtung (bestehend aus Lichtquelle, Mikroskop, Kamera, Scantisch, Computer mit Steuerungs- und Bilderkennungs- bzw. Bildverarbeitungssoftware) abgescannt und die Signale der einzelnen, eingebauten markierten NTs identifiziert. Nach dem Detektionsschritt wird die Markierung und der zur Termination führende Substituent von allen eingebauten NTs entfernt (8). Nach einem sich anschließenden Waschschritt kann ein neuer Zyklus beginnen. Zur Rekonstruktion einer größeren ursprünglichen DNA-Sequenz (z. B. mehrere Mb langes DNA-Stück) sollen die DNA-Fragmente einige Hundert NT lang sein, falls man die Rekonstruktion nach dem Shotgun-Prinzip durchführt ("Automated DNA sequencing and analysis" S. 231 ff. 1994 M. Adams et al. Academic Press, Huang et al. Genom Res. 1999 v.9 S. 868, Huang Genomics 1996 v.33 S. 21, Bonfield et al. NAR 1995 v,23 S. 4992, Miller et al. J. Comput,Biol. 1994 v.1 S. 257). Da pro Zyklus nur jeweils ein markiertes NT* eingebaut wird, sind mindestens 300 Zyklen zur Sequenzierung notwendig. In the following, the general principles of the reaction are to be illustrated by way of example using the sequencing of a piece of DNA of several Mb length ( FIG. 1). The sequencing and reconstruction of nucleic acid sequences is based on the shotgun principle ("Automated DNA sequencing and analysis" p. 231 ff. 1994 M. Adams et al. Academic Press, Huang et al. Genom Res. 1999 v.9 p. 868 , Huang Genomics 1996 v.33 p. 21, Bonfield et al. NAR 1995 v.23 p. 4992, Miller et al. J. Comput. Biol. 1994 v.1 p. 257). The sequence of a long piece of DNA is determined by sequencing small DNA fragments and subsequent reconstruction. The material to be analyzed (1) is prepared for the sequencing reaction by breaking it down into fragments of preferably 50 to 1000 bp in length (2). Each fragment is then provided with a primer binding site and a primer (3). This mixture of different DNA fragments is now fixed on a flat surface (4). The unbound DNA fragments are removed by a washing step. The sequencing reaction is then carried out on the entire reaction surface. This reaction is cyclical. In the first step of the cycle, an NT * labeled with a fluorescent dye is incorporated into the growing strand: the reaction is controlled in such a way that only one labeled NT from a polymerase can be incorporated into the growing strand in each cycle. This is achieved by using NTs * which have a reversibly coupled substituent leading to the termination at the 3-position of the deoxyribose. This makes the installation of another marked NT * impossible. The polymerase and the labeled NTs * are used simultaneously in the reaction (5). The reaction mixture is then removed and the surface is washed in a suitable manner (6). Now there is a detection step (7): The surface is scanned with a device suitable for single-molecule detection (consisting of light source, microscope, camera, scanning table, computer with control and image recognition or image processing software) and the signals of the individual, built-in marked NTs identified. After the detection step, the label and the substituent leading to the termination are removed from all built-in NTs (8). After a subsequent washing step, a new cycle can begin. For the reconstruction of a larger original DNA sequence (eg several Mb long piece of DNA), the DNA fragments should be a few hundred NT long if the reconstruction is carried out according to the shotgun principle ("Automated DNA sequencing and analysis" p . 231 ff. 1994 M. Adams et al. Academic Press, Huang et al. Genom Res. 1999 v.9 p. 868, Huang Genomics 1996 v.33 p. 21, Bonfield et al. NAR 1995 v, 23 p. 4992, Miller et al. J. Comput, Biol. 1994 v.1 p. 257). Since only one marked NT * is installed per cycle, at least 300 cycles are required for sequencing.

4.2 Auswahl des Materials4.2 Selection of the material

Mit Hilfe der erfindungsgemäßen Methode ist es möglich, sowohl vorselektionierte DNA-Sequenzen (z. B. in YAC-, PAC-, oder BAC- Vektoren (R. Anand et al. NAR 1989 v.17 S. 3425, H. Shizuya et al. PNAS 1992 v.89 S. 8794, "Construction of bacterial artificial chromosome libraries using the modified PAC system" in "Current Protocols in Human genetics" 1996 John Wiley & Sons Inc.) klonierte Abschnitte eines Genoms) als auch nicht vorselektionierte DNA (z. B. genomische DNA, cDNA-Gemische) zu analysieren. Durch eine Vorselektion ist es möglich, im Vorfeld relevante Informationen, wie z. B. Sequenz-Abschnitte aus einem Genom oder Populationen an Genprodukten, aus der große Menge genetischer Informationen herauszufiltern und damit die Menge der zu analysierenden Sequenzen einzuschränken. Besonders hervorzuheben sind die Ausführungsformen, bei denen die erfindungsgemäßen Verfahren ohne Vorselektionierung und ohne eine Vervielfältigung des Materials eingesetzt werden. Verzicht auf PCR und Klonierung bringt eine entscheidende Beschleunigung in der hoch parallelen Analyse von Nukleinsäuresequenzen, was mit anderen Verfahren bis jetzt nicht möglich war. With the help of the method according to the invention it is possible to both preselected DNA sequences (e.g. in YAC, PAC, or BAC Vectors (R. Anand et al. NAR 1989 v.17 p. 3425, H. Shizuya et al. PNAS 1992 v.89 p. 8794, "Construction of bacterial artificial chromosome libraries using the modified PAC system " in "Current Protocols in Human genetics" 1996 John Wiley & Sons Inc.) cloned sections of a genome) as well preselected DNA (e.g. genomic DNA, cDNA mixtures) analyze. A preselection makes it possible to Relevant information in advance, such as B. Sequence sections from a genome or populations of gene products from which to filter out a large amount of genetic information and hence the amount of sequences to be analyzed limit. They are particularly noteworthy Embodiments in which the inventive method without preselection and without duplication of the Materials are used. No PCR and cloning brings a crucial acceleration in the high parallel analysis of nucleic acid sequences, what with others Procedure was not possible until now.

4.3 Vorbereitung des Materials4.3 Preparation of the material

Ziel der Materialvorbereitung ist es, gebundene einzelsträngige NSKFs mit einer Länge von vorzugsweise 50-1000 NTs, einer einzelnen Primerbindungsstelle und einem hybridisierten Primer (gebundene NSKF-Primer-Komplexe) zu erhalten. Diese NSKF-Primer-Komplexe haben beispielsweise die in Fig. 2 dargestellte Struktur. Im einzelnen können sehr variable Konstruktionen aus dieser allgemeinen Struktur abgeleitet werden. Zur Verbesserung der Anschaulichkeit folgen nun einige Beispiele, wobei die angeführten Methoden einzeln oder in Kombination eingesetzt werden können. The aim of the material preparation is to obtain bound single-stranded NSKFs with a length of preferably 50-1000 NTs, a single primer binding site and a hybridized primer (bound NSKF-primer complexes). These NSKF primer complexes have, for example, the structure shown in FIG. 2. In particular, very variable constructions can be derived from this general structure. To improve the clarity, here are some examples, whereby the methods listed can be used individually or in combination.

4.3.1 Erzeugung kurzer Nukleinsäurekettenfragmente (50-1000 NTs) (Fragmentierungsschritt)4.3.1 Generation of Short Nucleic Acid Chain Fragments (50-1000 NTs) (fragmentation step)

Wichtig ist, dass die Fragmentierung der NSKs so erfolgt, dass Fragmente erhalten werden, die überlappende Teilsequenzen der Gesamtsequenzen darstellen. Dies wird durch Verfahren erreicht, bei denen unterschiedlich lange Fragmente als Spaltprodukte in zufallsmäßiger Verteilung entstehen. It is important that the NSKs are fragmented in such a way that Fragments are obtained that overlap partial sequences of the Display overall sequences. This is done through procedures achieved in which fragments of different lengths than Fission products are created in a random distribution.

Erfindungsgemäß kann die Erzeugung der Nukleinsäurekettenfragmente (NSKFs) durch mehrere Methoden erfolgen, z. B. durch die Fragmentierung des Ausgangsmaterials mit Ultraschall oder durch Endonukleasen ("Molecular cloning" 1989 J. Sambrook et al. Cold Spring Harbor Laborotary Press), wie z. B. durch unspezifische Endonukleasegemische. Erfindungsgemäß wird die Ultraschall-Fragmentierung bevorzugt. Man kann die Bedingungen so einstellen, dass Fragmente mit einer durchschnittlichen Länge von 100 bp bis 1 kb entstehen. Diese Fragmente werden anschließend an ihren Enden durch das Klenow-Fragment (E.coli- Polymerase I) oder durch die T4-DNA-Polymerase aufgefüllt ("Molecular cloning" 1989 J. Sambrook et al. Cold Spring Harbor Laborotary Press). According to the generation of the Nucleic acid chain fragments (NSKFs) are made by several methods, e.g. B. by the fragmentation of the starting material with ultrasound or by endonucleases ("Molecular cloning" 1989 J. Sambrook et al. Cold Spring Harbor Laborotary Press), e.g. B. by non-specific endonuclease mixtures. According to the Ultrasonic fragmentation preferred. You can see the conditions adjust so that fragments with an average Length of 100 bp to 1 kb arise. These fragments will then at their ends by the Klenow fragment (E. coli Polymerase I) or filled in by the T4 DNA polymerase ("Molecular cloning" 1989 J. Sambrook et al. Cold Spring Harbor Laborotary Press).

Ausserdem können aus einer langen NSK unter Verwendung randomisierter Primer komplementäre kurze NSKFs synthetisiert werden. Besonders bevorzugt wird diese Methode bei der Analyse der Gen-Sequenzen. Dabei werden an der mRNA einzelsträngige DNA-Fragmente mit randomisierten Primern und einer reversen Transkriptase gebildet (Zhang-J et al. Biochem. J. 1999 v.337 S. 231, Ledbetter et al. J. Biol.Chem. 1994 v.269 S. 31544, Kolls et al. Anal.Biochem. 1993 v.208 S. 264, Decraene et al. Biotechniques 1999 v.27 S. 962). You can also use a long NSK randomized primers synthesized complementary short NSKFs become. This method is particularly preferred for analysis of the gene sequences. In this way, single-stranded are on the mRNA DNA fragments with randomized primers and one reverse Transcriptase formed (Zhang-J et al. Biochem. J. 1999 v.337 P. 231, Ledbetter et al. J. Biol. Chem. 1994 v.269 p. 31544, Kolls et al. Anal. 1993 v.208 p. 264, Decraene et al. Biotechniques 1999 v.27 p. 962).

4.3.2 Einführung einer Primerbindungsstelle in das NSKF4.3.2 Introduction of a primer binding site in the NSKF

Die Primerbindungsstelle (PBS) ist ein Sequenzabschnitt, der eine selektive Bindung des Primers an das NSKF ermöglichen soll. The primer binding site (PBS) is a sequence section that enable a selective binding of the primer to the NSKF should.

In einer Ausführungsform können die Primerbindungsstellen unterschiedlich sein, so dass mehrere unterschiedliche Primer verwendet werden müssen. In diesem Fall können bestimmte Sequenzabschnitte der Gesamtsequenz als natürliche PBSs für spezifische Primer dienen. Diese Ausführungsform ist besonders für die Untersuchung bereits bekannter SNP-Stellen geeignet, s. Beispiel 4 "SNP-Analyse mit sequenzspezifischen Primern". In one embodiment, the primer binding sites be different, so several different primers must be used. In this case, certain Sequence sections of the total sequence as natural PBSs for serve specific primers. This embodiment is special suitable for the investigation of already known SNP bodies, s. Example 4 "SNP analysis with sequence-specific primers".

In einer anderen Ausführungsform ist es aus Gründen der Vereinfachung der Analyse günstig, wenn eine einheitliche Primerbindungsstelle in allen NSKFs vorhanden ist. Gemäß einer bevorzugten Ausführungsform der Erfindung werden die Primerbindungsstellen daher in die NSKFs extra eingeführt. Auf diese Weise können Primer mit einheitlicher Struktur für die Reaktion eingesetzt werden. In another embodiment, it is for the sake of Simplify the analysis favorably if a uniform Primer binding site is present in all NSKFs. According to one preferred embodiment of the invention, the Primer binding sites are therefore specially introduced in the NSKFs. On this way primers with a uniform structure for the Reaction can be used.

Im folgenden wird diese Ausführungsform detailliert beschrieben. This embodiment is detailed below described.

Die Zusammensetzung der Primerbindungsstelle ist nicht eingeschränkt. Ihre Länge beträgt vorzugsweise zwischen 20 und 50 NTs. Die Primerbindungsstelle kann eine funktionelle Gruppe zur Immobilisation des NSKF tragen. Diese funktionelle Gruppe kann z. B. eine Biotingruppe sein. The composition of the primer binding site is not limited. Their length is preferably between 20 and 50 NTs. The primer binding site can be a functional group to immobilize the NSKF. This functional group can e.g. B. be a biotin group.

Als Beispiel für die Einführung einer einheitlichen Primerbindungsstelle werden im folgenden die Ligation und das Nukleotid-Tailing an DNA-Fragmente beschrieben. As an example of the introduction of a uniform Primer binding site are the ligation and the following Nucleotide tailing on DNA fragments is described.

a) Ligationa) Ligation

Dabei wird ein doppelsträngiger Oligonukleotidkomplex mit einer Primerbindungsstelle verwendet (Fig. 3a). Dieser wird mit kommerziell erhältlichen Ligasen an die DNA-Fragmente ligiert ("Molecular cloning" 1989 J. Sambrook et al. Cold Spring Harbor Laborotary Press). Es ist wichtig, dass nur eine einzige Primerbindungsstelle an das DNA-Fragment ligiert wird. Das erreicht man z. B. durch eine Modifikation einer Seite des Oligonukleotidkomplexes an beiden Strängen (Fig. 3b). Die Resultate nach der Ligation bzw. nach anschließender Denaturierung sind in Fig. 3c und 3d dargestellt. Die modifizierenden Gruppen am Oligonukleotidkompex können zur Immobilisation dienen. Die Synthese und die Modifikation eines solchen Oligonukleotidkomplexes kann nach standardisierten Vorschriften durchgeführt werden. Zur Synthese kann z. B. der DNA-Synthesizer 380 A Applied Biosystems verwendet werden. Oligonucleotide mit einer bestimmten Zusammensetzung mit oder ohne Modifikationen sind aber auch als Auftragssynthese kommerziell erhältlich, z. B. von MWG-Biotech GmbH, Germany. A double-stranded oligonucleotide complex with a primer binding site is used ( FIG. 3a). This is ligated to the DNA fragments using commercially available ligases ("molecular cloning" 1989 J. Sambrook et al. Cold Spring Harbor Laborotary Press). It is important that only a single primer binding site be ligated to the DNA fragment. This is achieved e.g. B. by a modification of one side of the oligonucleotide complex on both strands ( Fig. 3b). The results after the ligation or after subsequent denaturation are shown in FIGS. 3c and 3d. The modifying groups on the oligonucleotide complex can be used for immobilization. The synthesis and modification of such an oligonucleotide complex can be carried out according to standardized regulations. For synthesis, e.g. B. the DNA synthesizer 380 A Applied Biosystems can be used. Oligonucleotides with a certain composition with or without modifications are also commercially available as custom synthesis, e.g. B. from MWG-Biotech GmbH, Germany.

b) Nukleotid-Tailingb) Nucleotide tailing

Statt der Ligation mit einem Oligonukleotid kann man mit einer terminalen Deoxynucleotidyltransferase mehrere (z. B. zwischen 10 und 20) Nukleosid-monophosphate an das 3-Ende eines ss- DNA-Fragments anknüpfen ("Molecular cloning" 1989 J. Sambrook et al. Cold Spring Harbor Laborotary Press, "Method in Enzymology" 1999 v.303, S. 37-38) (Fig. 4), z. B. mehrere Guanosin-Monophosphate ((G)n-Tailing genannt). Das entstehende Fragment wird zur Bindung des Primers, in diesem Beispiel eines (C)n-Primers, verwendet. Instead of ligation with an oligonucleotide, a terminal deoxynucleotidyl transferase can be used to attach several (eg between 10 and 20) nucleoside monophosphates to the 3-end of an SS DNA fragment ("Molecular cloning" 1989 J. Sambrook et al. Cold Spring Harbor Laborotary Press, "Method in Enzymology" 1999 v.303, pp. 37-38) ( Fig. 4), e.g. B. several guanosine monophosphates (called (G) n-tailing). The resulting fragment is used to bind the primer, in this example a (C) n primer.

4.3.3 Einzelstrang-Vorbereitung4.3.3 Single strand preparation

Für die Sequenzierungsreaktion werden einzelsträngige NSKFs benötigt. Falls das Ausgangsmaterial in doppelsträngiger Form vorliegt, gibt es mehrere Möglichkeiten, aus doppelsträngiger DNA eine einzelsträngige Form zu erzeugen (z. B. Hitze- Denaturierung oder Alkali-Denaturierung) ("Molecular cloning" 1989 J. Sambrook et al. Cold Spring Harbor Laborotary Press). Single-stranded NSKFs are used for the sequencing reaction needed. If the starting material is in double-stranded form there are several options, from double-stranded DNA to produce a single-stranded form (e.g. heat Denaturation or Alkali Denaturation) ("Molecular cloning" 1989 J. Sambrook et al. Cold Spring Harbor Laborotary Press).

4.3.4 Primer für die Sequenzierungsreaktion4.3.4 Primers for the sequencing reaction

Dieser hat die Funktion, den Start an einer einzigen Stelle des NSKF zu ermöglichen. Er bindet an die Primerbindungsstelle im NSKF. Die Zusammensetzung und die Länge des Primers sind nicht eingeschränkt. Außer der Startfunktion kann der Primer auch andere Funktionen übernehmen, wie z. B. eine Verbindung zur Reaktionsoberfläche zu schaffen. Primer sollten so an die Länge und Zusammensetzung der Primerbindungsstelle angepaßt werden, dass der Primer den Start der Sequenzierungsreaktion mit der jeweiligen Polymerase ermöglicht. This has the function of starting at a single point of the NSKF. It binds to the primer binding site in the NSKF. The composition and length of the primer are not limited. In addition to the start function, the primer also take on other functions, such as. B. a connection to create the reaction surface. Primers should match the Adjusted length and composition of the primer binding site be that the primer starts the sequencing reaction with the respective polymerase.

Bei der Verwendung unterschiedlicher, beispielsweise natürlich in der ursprünglichen Gesamtsequenz vorkommender Primerbindungsstellen, werden die für die jeweilige Primerbindungsstelle sequenzspezifischen Primer verwendet. In diesem Fall wird für die Sequenzierung ein Primergemisch eingesetzt. When using different, for example, of course occurring in the original overall sequence Primer binding sites are those for the respective Primer binding site sequence-specific primer used. In in this case a primer mixture is used for sequencing used.

Bei einer einheitlichen, beispielsweise durch die Ligation an die NSKFs angekoppelten Primerbindungsstelle wird ein einheitlicher Primer verwendet. With a uniform, for example through the ligation the priming site coupled to NSKFs becomes a uniform primer used.

Vorzugsweise beträgt die Länge des Primers zwischen 6 und 100 NTs, optimalerweise zwischen 15 und 30 NTs. Der Primer kann eine Funktionsgruppe tragen, die zur Immobilisierung des NSKF dient, beispielsweise ist eine solche Funktionsgruppe eine Biotingruppe (s. Abschnitt Immobilisierung). Sie soll die Sequenzierung nicht stören. Die Synthese eines solchen Primers kann z. B. mit dem DNA-Synthesizer 380 A Applied Biosystems ausgeführt werden oder aber als Auftragssynthese bei einem kommerziellen Anbieter, z. B. MWG-Bictech GmbH, Germany erstellt werden). The length of the primer is preferably between 6 and 100 NTs, ideally between 15 and 30 NTs. The primer can carry a functional group that is responsible for the immobilization of the NSKF serves, for example, such a function group is one Biotin group (see section Immobilization). It should Do not interfere with sequencing. The synthesis of such a primer can e.g. B. with the DNA synthesizer 380 A Applied Biosystems be carried out or as a custom synthesis at a commercial providers, e.g. B. MWG-Bictech GmbH, Germany to be created).

Der Primer kann vor der Hybridisierung an die zu analysierenden NSKFs auf der Oberfläche mit verschiedenen Techniken fixiert oder direkt auf der Oberfläche synthetisiert werden, beispielsweise nach (McGall et al. US Patent 5412087, Barrett et al. US Patent 5482867, Mirzabekov et al. US Patent 5981734, "Microarray biochip technology" 2000 M. Schena Eaton Publishing, "DNA Microarrays" 1999 M. Schena Oxford University Press, Fodor et al. Science 1991 v.285 S. 767, Timofeev et al. Nucleic Acid Research (NAR) 1996, v.24 S. 3142, Ghosh et al. NAR 1987 v.15 S. 5353, Gingeras et al. NAR 1987 v.15 S. 5373, Maskos et al. NAR 1992 v.20 S. 1679). The primer can be attached to the prior to hybridization analyzing NSKFs on the surface with different Techniques fixed or directly on the surface can be synthesized, for example according to (McGall et al. US Patent 5412087, Barrett et al. US Patent 5482867, Mirzabekov et al. US Patent 5981734, "Microarray biochip technology" 2000 M. Schena Eaton Publishing, "DNA Microarrays" 1999 M. Schena Oxford University Press, Fodor et al. Science 1991 v.285 P. 767, Timofeev et al. Nucleic Acid Research (NAR) 1996, v.24 P. 3142, Ghosh et al. NAR 1987 v.15 p. 5353, Gingeras et al. NAR 1987 v.15 p. 5373, Maskos et al. NAR 1992 v.20 p. 1679).

Die Primer werden auf der Oberfläche beispielsweise in einer Dichte zwischen 10 bis 100 pro 100 µm2, 100 bis 10.000 pro 100 µm2 oder 10.000 bis 1.000.000 pro 100 µm2 gebunden. The primers are bound on the surface, for example in a density between 10 to 100 per 100 µm 2 , 100 to 10,000 per 100 µm 2 or 10,000 to 1,000,000 per 100 µm 2 .

Der Primer oder das Primergemisch wird mit NSKFs unter Hybridisierungsbedingungen inkubiert, die ihn selektiv an die Primerbindungsstelle des NSKF binden lassen. Diese Primer- Hybridisierung (Annealing) kann vor (1), während (2) oder nach (3) der Bindung der NSKFs an die Oberfläche erfolgen. Die Optimierung der Hybridisierungsbedingungen hängt von der genauen Struktur der Primerbindungsstelle und des Primers ab und läßt sich nach Rychlik et al. NAR 1990 v.18 S. 6409 berechnen. Im folgenden werden diese Hybridisierungsbedingungen als standardisierte Hybridisierungsbedingungen bezeichnet. The primer or mixture of primers is covered with NSKFs Hybridization conditions incubated that selectively to the Have the NSKF primer binding site bound. This primer Hybridization (annealing) can take place before (1), during (2) or after (3) the NSKFs bind to the surface. The Optimization of the hybridization conditions depends on the exact structure of the primer binding site and the primer and can be according to Rychlik et al. NAR 1990 v.18 p. 6409 to calculate. The following are these Hybridization conditions are referred to as standardized hybridization conditions.

Falls eine für alle NSKFs gemeinsame Primerbindungsstelle mit bekannter Struktur beispielsweise durch Ligation eingeführt wird, können Primer mit einheitlicher Struktur eingesetzt werden. Die Primerbindungsstelle kann an ihrem 3'-Ende eine funktionelle Gruppe tragen, die z. B. zur Immobilisation dient. Beispielsweise ist diese Gruppe eine Biotin-Gruppe. Der Primer hat eine zur Primerbindungsstelle komplementäre Struktur. If there is a primer binding site common to all NSKFs known structure introduced for example by ligation primers with a uniform structure can be used become. The primer binding site can have one at its 3 'end wear functional group that z. B. is used for immobilization. For example, this group is a biotin group. The primer has a structure complementary to the primer binding site.

Ein Beispiel einer Primerbindungstelle und eines Primers ist nachfolgend dargestellt.
5'TAATACGACTCACTATAGG3' Primer (T7-19-Primer)
Biotin-3'ATTATGCTGAGTGATATCCS' Primerbindungsstelle
An example of a primer binding site and a primer is shown below.
5'TAATACGACTCACTATAGG3 'primer (T7-19 primer)
Biotin-3'ATTATGCTGAGTGATATCCS 'primer binding site

4.3.5 Fixierung von NSKF-Primer-Komplexe an die Oberfläche (Bindung bzw. Immobilisierung von NSKFs)4.3.5 Fixation of NSKF primer complexes on the surface (Binding or immobilization of NSKFs)

Ziel der Fixierung (Immobilisierung) ist es, NSKF-Primer- Komplexe auf einer geeigneten planen Oberfläche in einer Art und Weise zu fixieren, dass eine zyklische enzymatische Sequenzierungsreaktion ablaufen kann. Dies kann beispielsweise durch Bindung des Primers (s. o.) oder des NSKF an die Oberfläche erfolgen. The aim of the fixation (immobilization) is to NSKF primer Complexes on a suitable flat surface in one way and way to fix that a cyclic enzymatic Sequencing reaction can take place. For example by binding the primer (see above) or the NSKF to the Surface.

Die Reihenfolge der Schritte bei der Fixierung von NSKF- Primer-Komplexen kann variabel sein:

  • 1. Die NSKF-Primer-Komplexe können zunächst in einer Lösung durch Hybridisierung (Annealing) gebildet und anschließend an die Oberfläche gebunden werden.
  • 2. Primer können zunächst auf einer Oberfläche gebunden werden und NSKFs anschließend an die gebundenen Primer hybridisiert werden, wobei NSKF-Primer-Komplexe entstehen (NSKFs indirekt an die Oberfläche gebunden)
  • 3. Die NSKFs können zunächst an die Oberfläche gebunden werden (NSKFs direkt an die Oberfläche gebunden) und im anschließenden Schritt die Primer an die gebundenen NSKFs hybridisiert werden, wobei NSKF-Primer-Komplexe entstehen.
The order of the steps in fixing NSKF primer complexes can be variable:
  • 1. The NSKF primer complexes can first be formed in a solution by hybridization (annealing) and then bound to the surface.
  • 2. Primers can first be bound to a surface and then NSKFs can be hybridized to the bound primers, whereby NSKF-primer complexes are formed (NSKFs indirectly bound to the surface)
  • 3. The NSKFs can first be bound to the surface (NSKFs bound directly to the surface) and in the subsequent step the primers can be hybridized to the bound NSKFs, whereby NSKF-primer complexes are formed.

Die Immobilisierung der NSKFs an die Oberfläche kann daher durch direkte oder indirekte Bindung erfolgen. The NSKFs can therefore be immobilized on the surface by direct or indirect binding.

Oberfläche und Reaktionsoberfläche sind vorliegend als gleichwertige Begriffe aufzufassen, außer wenn explizit auf eine andere Bedeutung hingewiesen wird. Als Reaktionsoberfläche dient die Oberfläche einer festen Phase eines beliebigen Materials. Dieses Material ist vorzugsweise enzymatischen Reaktionen gegenüber inert und verursacht keine Störungen der Detektion. Silicon, Glas, Keramik, Kunststoff (z. B. Polycarbonate oder Polystyrole), Metall (Gold, Silber, oder Alluminium) oder beliebiges anderes Material, das diesen funktionellen Anforderungen genügt, kann verwendet werden. Vorzugsweise ist die Oberfläche nicht verformbar, denn sonst ist mit einer Verzerrung der Signale bei der wiederholten Detektion zu rechnen. Surface and reaction surface are in the present case as to understand equivalent terms, unless explicitly another meaning is pointed out. As Reaction surface is the surface of a solid phase of any material. This material is preferred enzymatic reactions to inert and causes none Detection disorders. Silicon, glass, ceramic, plastic (e.g. polycarbonates or polystyrenes), metal (gold, silver, or aluminum) or any other material that this functional requirements can be used. The surface is preferably not deformable, because otherwise is repeated with a distortion of the signals Detection.

Falls eine gelartige feste Phase (Oberfläche eines Gels) verwendet wird, so kann dieses Gel z. B. ein Agarose- oder Polyacrylamidgel sein. Das Gel ist vorzugsweise für Moleküle mit einer Molekularmasse unter 5000 Da frei passierbar (beispielsweise kann ein 1 bis 2% Agarose-Gel oder 10 bis 15% Polyacrylamid Gel verwendet werden). Eine solche Geloberfläche hat anderen festen Oberflächen gegenüber den Vorteil, dass es zu einer wesentlich geringeren unspezifischen Bindung von NT*s an die Oberfläche kommt. Durch die Bindung der NSKF-Primer- Komplexe auf der Oberfläche ist die Detektion der Fluoreszenzsignale von eingebauten NTs* möglich. Die Signale von freien NTs* werden nicht detektiert, weil sie nicht an das Material des Gels binden und somit nicht immobilisiert werden. Das Gel ist vorzugsweise auf einer festen Unterlage befestigt (Fig. 5a). Diese feste Unterlage kann Silicon, Glas, Keramik, Kunststoff (z. B. Polycarbonate oder Polystyrole), Metall (Gold, Silber, oder Alluminium) oder beliebiges anderes Material sein. If a gel-like solid phase (surface of a gel) is used, this gel can e.g. B. an agarose or polyacrylamide gel. The gel is preferably freely passable for molecules with a molecular mass below 5000 Da (for example, a 1 to 2% agarose gel or 10 to 15% polyacrylamide gel can be used). Such a gel surface has the advantage over other solid surfaces that there is a significantly lower non-specific binding of NT * s to the surface. By binding the NSKF primer complexes on the surface, the detection of the fluorescence signals from built-in NTs * is possible. The signals from free NTs * are not detected because they do not bind to the material of the gel and are therefore not immobilized. The gel is preferably attached to a solid base ( Fig. 5a). This solid base can be silicone, glass, ceramic, plastic (e.g. polycarbonate or polystyrene), metal (gold, silver, or aluminum) or any other material.

Die Dicke des Gels beträgt vorzugsweise nicht mehr als 0,1 mm. Die Geldicke ist vorzugsweise größer als die einfache Tiefenschärfe des Objektivs sein, damit unspezifisch an die feste Unterlage gebundene NTs* nicht in die Fokusebene gelangen und damit detektiert werden. Wenn die Tiefenschärfe z. B. 0,3 µm beträgt, so liegt die Geldicke vorzugsweise zwischen 1 µm und 100 µm. Die Oberfläche kann als eine kontinuierliche Oberfläche oder als diskontinuierliche, aus einzelnen kleinen Bestandteilen (z. B. Agarose-Kügelchen) zusammengesetzte Oberfläche hergestellt werden (Fig. 5b). Die Reaktionsoberfläche muß groß genug sein, um die notwendige Anzahl der NSKFs bei entsprechender Dichte immobilisieren zu können. Die Reaktionsoberfläche sollte vorzugsweise nicht größer als 20 cm2 sein. The thickness of the gel is preferably not more than 0.1 mm. The gel thickness is preferably greater than the simple depth of field of the lens, so that NTs * bound non-specifically to the solid base do not get into the focal plane and are therefore detected. If the depth of field e.g. B. 0.3 microns, the gel thickness is preferably between 1 micron and 100 microns. The surface can be produced as a continuous surface or as a discontinuous surface composed of individual small components (e.g. agarose beads) ( FIG. 5b). The reaction surface must be large enough to be able to immobilize the necessary number of NSKFs with the appropriate density. The reaction surface should preferably not be larger than 20 cm 2 .

Die verschiedenen Zyklusschritte erfordern einen Austausch der unterschiedlichen Reaktionslösungen über der Oberfläche. Die Reaktionsoberfläche ist vorzugsweise Bestandteil eines Reaktionsgefäßes. Das Reaktionsgefäß ist wiederum vorzugsweise Bestandteil einer Reaktionsapparatur mit Durchflußvorrichtung. Die Durchflußvorrichtung ermöglicht einen Austausch der Lösungen im Reaktionsgefäß. Der Austausch kann mit einer durch einen Computer gesteuerten Pumpvorrichtung oder manuell erfolgen. Wichtig dabei ist, dass die Oberfläche nicht austrocknet. Vorzugsweise beträgt das Volumen des Reaktionsgefäßes weniger als 50 µl. Idealerweise beträgt sein Volumen weniger als 1 µl. Ein Beispiel eines solchen Durchflußsystems ist in Fig. 6 gegeben. The different cycle steps require an exchange of the different reaction solutions above the surface. The reaction surface is preferably part of a reaction vessel. The reaction vessel is in turn preferably part of a reaction apparatus with a flow device. The flow device enables the solutions in the reaction vessel to be exchanged. The exchange can be done with a computer controlled pumping device or manually. It is important that the surface does not dry out. The volume of the reaction vessel is preferably less than 50 μl. Ideally, its volume is less than 1 µl. An example of such a flow system is given in FIG. 6.

Falls die Fixierung der NSKF-Primer-Komplexe auf der Oberfläche über die NSKFs erfolgt, kann dies beispielsweise durch die Bindung der NSKFs an einem der beiden Ketten-Enden erfolgen. Dies kann durch entsprechende kovalente, affine oder andere Bindungen erreicht werden. Es sind viele Beispiele der Immobilisierung von Nukleinsäuren bekannt (McGall et al. US Patent 5412087, Nikiforov et al. US Patent 5610287, Barrett et al. US Patent 5482867, Mirzabekov et al. US Patent 5981734, "Microarray biochip technology" 2000 M. Schena Eaton Publishing, "DNA Microarrays" 1999 M. Schena Oxford University Press, Rasmussen et al. Analytical Biochemistry v.198, S. 138, Allemand et al. Biophysical Journal 1997, v.73, S. 2064, Trabesinger et al. Analytical Chemistry 1999, v.71, S. 279, Osborne et al. Analytical Chemistry 2000 , v.72, S. 3678, Timofeev et al. Nucleic Acid Research (NAR) 1996, v.24 5.3142, Ghosh et al. NAR 1987 v.15 S. 5353, Gingeras et al. NAR 1987 v.15 S. 5373, Maskos et al. NAR 1992 v.20 S. 1679). Die Fixierung kann auch durch eine unspezifische Bindung, wie z. B. durch Austrocknung der NSKFs enthaltenden Probe auf der planen Oberfläche erreicht werden. If the NSKF primer complexes are fixed on the For example, this can be done via the NSKFs by binding the NSKFs to one of the two chain ends respectively. This can be done by appropriate covalent, affine or other ties can be achieved. There are many examples of that Immobilization of nucleic acids known (McGall et al. US Patent 5412087, Nikiforov et al. U.S. Patent 5,610,287, Barrett et al. U.S. Patent 5482867, Mirzabekov et al. US patent 5981734, "Microarray biochip technology" 2000 M. Schena Eaton Publishing, "DNA Microarrays" 1999 M. Schena Oxford University Press, Rasmussen et al. Analytical Biochemistry v.198, p. 138, Allemand et al. Biophysical Journal 1997, v.73, p. 2064, Trabesinger et al. Analytical Chemistry 1999, v.71, p. 279, Osborne et al. Analytical Chemistry 2000, v.72, p. 3678, Timofeev et al. Nucleic Acid Research (NAR) 1996, v.24 5.3142, Ghosh et al. NAR 1987 v.15 p. 5353, Gingeras et al. NAR 1987 v.15 p. 5373, Maskos et al. NAR 1992 v.20 p. 1679). The Fixation can also be achieved through an unspecific binding, such as z. B. by drying the NSKFs containing sample on the plan surface can be reached.

Die NSKFs werden auf der Oberfläche beispielsweise in einer Dichte zwischen 10 und 100 NSKFs pro 100 µm2, 100 bis 10.000 pro 100 µm2, 10.000 bis 1.000.000 pro 100 µm2 gebunden. The NSKFs are bound on the surface, for example in a density between 10 and 100 NSKFs per 100 µm 2 , 100 to 10,000 per 100 µm 2 , 10,000 to 1,000,000 per 100 µm 2 .

Die für die Detektion notwendige Dichte von extensionsfähigen NSKF-Primer-Komplexen beträgt ca. 10 bis 100 pro 100 µm2. Sie kann vor, während oder nach der Hybridisierung der Primer an die Genprodukte erreicht werden. The density of NSKF primer complexes which can be extended is necessary for the detection to be approximately 10 to 100 per 100 µm 2 . It can be achieved before, during or after hybridization of the primers to the gene products.

Beispielhaft werden im folgenden einige Methoden zur Bindung von NSKF-Primer-Komplexen näher dargestellt: In einer Ausführungsform erfolgt die Immobilisierung der NSKFs über Biotin-Avidin oder Biotin-Streptavidin-Bindung. Dabei wird Avidin oder Streptavidin auf der Oberfläche kovalent gebunden, das 5'-Ende des Primers enthält Biotin. Nach der Hybridisierung der markierten Primer mit den NSKFs (in Lösung) werden diese auf der mit Avidin/Streptavidin beschichteten Oberfläche fixiert. Die Konzentration der mit Biotin markierten Hybridisierungs-Produkte sowie die Zeit der Inkubation dieser Lösung mit der Oberfläche wird so gewählt, dass eine für die Sequenzierung geeignete Dichte bereits in diesem Schritt erreicht wird. Some binding methods are shown below as examples of NSKF primer complexes: In one In one embodiment, the NSKFs are immobilized via Biotin-avidin or biotin-streptavidin binding. Doing so Avidin or streptavidin covalently bound on the surface, the 5 'end of the primer contains biotin. After Hybridization of the labeled primers with the NSKFs (in solution) these are coated on the with avidin / streptavidin Fixed surface. The concentration of those with biotin marked hybridization products as well as the time of Incubation of this solution with the surface is chosen so that a density suitable for sequencing is already in this step is achieved.

In einer anderen bevorzugten Ausführungsform werden die für die Sequenzierungsreaktion geeigneten Primer vor der Sequenzierungsreaktion auf der Oberfläche mit geeigneten Methoden fixiert (s. o.). Die einzelsträngigen NSKFs mit jeweils einer Primerbindungsstelle pro NSKF werden damit unter Hybridisierungsbedingungen inkubiert (Annealing). Dabei binden sie an die fixierten Primer und werden dadurch gebunden (indirekte Bindung), wobei Primer-NSKF-Komplexe entstehen. Die Konzentration der einzelsträngigen NSKFs und die Hybridisierungsbedingungen werden so gewählt, dass man eine für die Sequenzierung geeignete Immobilisationsdichte von 10 bis 100 extensionsfähigen NSKF-Primer-Komplexen pro 100 µm2 erreicht. Nach der Hybridisierung werden ungebundene NSKFs durch einen Waschschritt entfernt. Bei dieser Ausführungsform wird eine Oberfläche mit einer hohen Primerdichte bevorzugt, z. B. ca. 1.000.000 Primer pro 100 µm2 oder noch höher, da die gewünschte Dichte an NSKF-Primer-Komplexen schneller erreicht wird, wobei die NSKFs nur an einen Teil der Primer binden. In another preferred embodiment, the primers suitable for the sequencing reaction are fixed on the surface using suitable methods before the sequencing reaction (see above). The single-stranded NSKFs, each with one primer binding site per NSKF, are thus incubated under hybridization conditions (annealing). They bind to the fixed primers and are thereby bound (indirect binding), resulting in primer-NSKF complexes. The concentration of the single-stranded NSKFs and the hybridization conditions are chosen such that an immobilization density of 10 to 100 NSKF primer complexes capable of extension per 100 μm 2 suitable for sequencing is achieved. After hybridization, unbound NSKFs are removed by a washing step. In this embodiment, a surface with a high primer density is preferred, e.g. B. approx. 1,000,000 primers per 100 µm 2 or even higher, since the desired density of NSKF-primer complexes is reached more quickly, the NSKFs only binding to a part of the primers.

In einer anderen Ausführungsform werden die NSKFs an die Oberfläche direkt gebunden (s. o.) und anschließend mit Primern unter Hybridisierungsbedingungen inkubiert. Bei einer Dichte von ca. 10 bis 100 NSKFs pro 100 µm2 wird man versuchen alle verfügbaren NSKFs mit einem Primer zu versehen und für die Sequenzierugnsreaktion verfügbar zu machen. Dies kann z. B. durch hohe Primerkonzentration, beispielsweise 1 bis 100 mmol/l, erreicht werden. Bei einer höheren Dichte der fixierten NSKFs auf der Oberfläche, beispielsweise 10.000 bis 1.000.000 pro 100 µm2, kann die für die optische Detektion notwendige Dichte der NSKF-Primer-Komplexe während der Primer-Hybridisierung erreicht werden. Dabei sind die Hybridisierungsbedingungen (z. B. Temperatur, Zeit, Puffer, Primerkonzentration) so zu wählen, dass die Primer nur an einen Teil der immobilisierten NSKFs binden. In another embodiment, the NSKFs are bound directly to the surface (see above) and then incubated with primers under hybridization conditions. With a density of approx. 10 to 100 NSKFs per 100 µm 2 , attempts will be made to prime all available NSKFs and make them available for the sequencing reaction. This can e.g. B. can be achieved by high primer concentration, for example 1 to 100 mmol / l. With a higher density of the fixed NSKFs on the surface, for example 10,000 to 1,000,000 per 100 μm 2 , the density of the NSKF-primer complexes necessary for optical detection can be achieved during the primer hybridization. The hybridization conditions (e.g. temperature, time, buffer, primer concentration) should be selected so that the primers only bind to a part of the immobilized NSKFs.

Falls die Oberfläche einer festen Phase (z. B. Silikon oder Glas) zur Immobilisation verwendet wird, wird vorzugsweise eine Blockierungslösung auf die Oberfläche vor dem Schritt (a) in jedem Zyklus gebracht, die zur Vermeidung einer unspezifischen Adsorbtion von NTs* an der Oberfläche dient. Diese Bedingungen für eine Blockierlösung erfüllt beispielsweise eine Albuminlösung (BSA) mit einem pH-Wert zwischen 8 und 10. If the surface of a solid phase (e.g. silicone or Glass) is used for immobilization is preferred a blocking solution on the surface before step (a) brought in every cycle to avoid a non-specific adsorption of NTs * on the surface. This For example, conditions for a blocking solution are met an albumin solution (BSA) with a pH between 8 and 10.

4.4 Wahl der Polymerase4.4 Choice of polymerase

Als Polymerasen eignen sich prinzipiell alle DNA-abhängigen DNA-Polymerasen ohne 3'-5' Exonuklease-Aktivität (DNA- Replication" 1992 Ed. A. Kornberg, Freeman and company NY), z. B. modifizierte T7-Polymerase vom Typ "Sequenase Version 2" (Amersham Pharmacia Biotech), 3'-5' exonuklease freies Klenow Fragment der DNA-Polymerase I (Amersham Pharmacia Biotech), Polymerase Beta verschiedenen Ursprungs (Animal Cell DNA Polymerases" 1983, Fry M., CRC Press Inc., kommerziell erhältlich bei Chimerx) thermostabile Polymerasen wie beispielsweise Taq-Polymerase (GibcoßRL), proHATM Polymerase (Eurogentech). In principle, all DNA-dependent ones are suitable as polymerases DNA polymerases without 3'-5 'exonuclease activity (DNA Replication "1992 Ed. A. Kornberg, Freeman and company NY), z. B. Modified "Sequenase Version 2" T7 Polymerase (Amersham Pharmacia Biotech), 3'-5 'exonuclease free Klenow DNA polymerase I fragment (Amersham Pharmacia Biotech), Polymerase beta of various origins (Animal Cell DNA Polymerases "1983, Fry M., CRC Press Inc., commercial available from Chimerx) thermostable polymerases such as for example Taq polymerase (GibcoßRL), proHATM polymerase (Euro GM).

Polymerasen mit 3'-5' Exonuklease-Aktivität können eingesetzt werden (z. B. Klenow-Fragment der E.coli-Polymerase I), sofern Reaktionsbedingungen gewählt werden, die vorhandene 3'-5' Exonuklease-Aktivität unterdrücken, wie z. B. ein niedriger pH- Wert (pH 6.5) beim Klenow-Fragment (Lehman and Richardson, J. Biol. Chem. 1964 v.239 S. 233) oder Zugabe von NaF zur Einbaureaktion. Eine andere Möglichkeit besteht in der Verwendung von NTs* mit einer Phosphorothioate-Verbindung (Kunkel et al. PNAS 1981, v.78 S. 6734). Dabei werden eingebaute NTs* von der 3'-5' Exonuklease-Aktivität der Polymerase nicht angegriffen. Im folgenden werden all diese Polymerasearten als "Polymerase" bezeichnet. Polymerases with 3'-5 'exonuclease activity can be used (e.g. Klenow fragment of E. coli polymerase I), provided that Reaction conditions are selected, the existing 3'-5 ' Suppress exonuclease activity, e.g. B. a low pH Value (pH 6.5) for the Klenow fragment (Lehman and Richardson, J. Biol. Chem. 1964 v.239 p. 233) or addition of NaF to Incorporation reaction. Another possibility is the Use of NTs * with a phosphorothioate compound (Kunkel et al. PNAS 1981, v.78 p. 6734). In doing so built-in NTs * from the 3'-5 'exonuclease activity of the Polymerase not attacked. The following are all of these Types of polymerase referred to as "polymerase".

4.5 Chemie4.5 chemistry 4.5.1 Allgemeine NT-Struktur4.5.1 General NT structure

In den erfindungsgemäßen Verfahren können unterschiedliche NT*s verwendet werden (vorzugsweise 2'-deoxy-Nukleotid- Triphosphate), die an ihrer 3'-Position des Riboseringes einen Substituenten tragen. Dieser Substituent kann alleine oder zusammen mit dem Fluoreszenzfarbstoff zur Termiantion der Einbaureaktion führen und kann unter milden Bedingungen vom Nukleotid abgespalten werden. An diesen Substituenten ist ein für das jeweilige NT* charakteristischer Fluoreszenzfarbstoff angekoppelt, so dass der Substituent auch die Rolle eines Linkers zwischen dem Nukleotid und dem Fluoreszenzfarbstoff übernimmt. Der Fluoreszenzfarbstoff wird vorzugsweise an diesen Linker durch eine unter milden Bedingungen spaltbare Bindung angekoppelt. Different methods can be used in the method according to the invention NT * s can be used (preferably 2'-deoxy nucleotide Triphosphates) at their 3 'position of the ribose ring carry a substituent. This substituent can do it alone or together with the fluorescent dye for termination of the paving reaction and can occur under mild conditions are cleaved from the nucleotide. On these substituents one characteristic of the respective NT * Fluorescent dye coupled so that the substituent also the role of a linker between the nucleotide and the Fluorescent dye takes over. The fluorescent dye is preferably to this linker through a sub mild one Cleavable bond conditions coupled.

Unter "milden Bedingungen" werden Spaltungsbedingungen verstanden, die weder zur Denaturierung des Primer- Nukleinsäure-Komplexes führen, noch zur Spaltung seiner einzelner Bestandteile. Cleavage conditions become "mild conditions" understood that neither to denature the primer Nucleic acid complex still lead to its cleavage individual components.

Formeln (1-3) stellen Beispiele für die reversiblen spaltbaren Terminatoren dar:

1) NT-3'-O-S(1)-F

2) NT-3'-O-S(2)-N-F

3) NT-3'-O-S(2)-N-L-F

NT-3'-O - stellt den 2'-Deoxy-Nukleosid-Triphosphat-Rest dar.
S(1) - stellt einen Substituenten (Formel 1) dar, der unter milden Bedingungen vom NT* abgespalten werden kann. An diesen Substituenten ist ein Fluoreszenzfarbstoff (F) gekoppelt.
S(2)-N - stellt einen weiteren Substituenten (Formel 2 und 3) dar, der unter milden Bedingungen vom NT* abgespalten werden kann. Dieser Substituent ist mit dem Fluoreszenzfarbstoff (F) durch eine unter milden Bedingungen spaltbare Gruppe (N) verbunden. Der Fluoreszenzfarbstoff kann unmittelbar an die spaltbare Gruppe (Formel 2) oder durch einem weiteren Linker (L) (Formel 3) gekoppelt sein.
Formulas (1-3) are examples of the reversible cleavable terminators:

1) NT-3'-OS (1) -F

2) NT-3'-OS (2) -NF

3) NT-3'-OS (2) -NLF

NT-3'-O - represents the 2'-deoxy nucleoside triphosphate residue.
S (1) - represents a substituent (Formula 1) that can be split off from the NT * under mild conditions. A fluorescent dye (F) is coupled to these substituents.
S (2) -N - represents another substituent (formulas 2 and 3) which can be split off from the NT * under mild conditions. This substituent is linked to the fluorescent dye (F) by a group (N) which is cleavable under mild conditions. The fluorescent dye can be coupled directly to the cleavable group (formula 2) or by a further linker (L) (formula 3).

Beispiele für NT*-Strukturen, NT*-Synthese, zur Polymerase- Wahl für die Einbaureakiton, Reaktionsbedingungen der NT*- Einbaureakion und Abspaltungsreaktion sind in (Kwiatkoxski WO-Patent 01/25247, Kwiatkowski US-Patent 6.255.475, Conard et al. US-Patent 6.001.566, Dower (US Patent 5.547.839), Canard et al. (US Patent 5.798.210), Rasolonjatovo (Nucleosides & Nucleotides 1999, v.18 S. 1021), Metzker et al. (NAR 1994, v.22, S4259), Welch et al. (Nucleosides & Nucleotides 1999, v.18, S. 197) beschrieben. Examples of NT * structures, NT * synthesis, for polymerase Choice for the installation reaction, reaction conditions of the NT * - Incorporation and cleavage reactions are in (Kwiatkoxski WO patent 01/25247, Kwiatkowski, US patent 6,255,475, Conard et al. U.S. Patent 6,001,566, Dower (U.S. Patent 5,547,839), Canard et al. (U.S. Patent 5,798,210), Rasolonjatovo (Nucleosides & Nucleotides 1999, v.18 p. 1021), Metzker et al. (NAR 1994, v.22, S4259), Welch et al. (Nucleosides & Nucleotides 1999, v.18, p. 197).

4.5.2 Marker, Fluorophore4.5.2 Markers, fluorophores

Jedes Nukleotid ist mit einem charakteristischen Marker (F) markiert. Der Marker ist ein fluoreszierender Farbstoff. Die Wahl ist nicht eingeschränkt, sofern der Farbstoff folgenden Anforderungen genügt:

  • a) Die verwendete Detektionsapparatur muß diesen Marker als einziges Molekül gebunden an DNA unter milden Bedingungen (vorzugsweise Reaktionsbedingungen) identifizieren können. Die Farbstoffe haben vorzugsweise große Photostabilität. Ihre Fluoreszenz wird vorzugsweise von der DNA nicht oder nur unwesentlich gequencht.
  • b) Der an das NT gebundene Farbstoff darf keine irreversible Störung der enzymatischen Reaktion verursachen.
  • c) mit dem Farbstoff markierte NTs* müssen von der Polymerase in die Nukleinsäurekette eingebaut werden.
  • d) Bei einer Markierung mit verschiedenen Farbstoffen sollen diese Farbstoffe keine beträchtlichen Überlappungen in ihren Emissionsspektren aufweisen.
Each nucleotide is labeled with a characteristic marker (F). The marker is a fluorescent dye. The choice is not restricted if the dye meets the following requirements:
  • a) The detection apparatus used must be able to identify this marker as the only molecule bound to DNA under mild conditions (preferably reaction conditions). The dyes preferably have great photostability. Their fluorescence is preferably not quenched by the DNA or only to a minor extent.
  • b) The dye bound to the NT must not cause an irreversible disturbance of the enzymatic reaction.
  • c) NTs * marked with the dye must be incorporated into the nucleic acid chain by the polymerase.
  • d) When labeled with different dyes, these dyes should not have any significant overlaps in their emission spectra.

Beispielsweise sind einige Fluorophore, die im Rahmen der vorliegenden Erfindung verwendbar sind, in "Handbook of Fluorescent Probes und Research Chemicals" 6th ed. 1996, R. Haugland, Molecular Probes mit Strukturformeln zusammengestellt. Erfindungsgemäß werden vorzugsweise folgende Farbstoffklassen als Marker eingesetzt: Cyanin- Farbstoffe und deren Abkömmlinge (z. B. Cy2, Cy3, Cy5, Cy7 Amersham Pharmacia Biotech, Waggoner US-Patent 5.268.486), Rhodamine und deren Abkömmlinge (z. B. TAMRA, TRITC, RG6, R110, ROX, Molecular Probes, s. Handbuch), Xanthene-Derivate (z. B. Alexa 568, Alexa 594, Molecular Probes, Mao et al. US- Patent 6.130.101) und Porphyrine (Porphyrin-Systems, Deutschland). Diese Farbstoffe sind kommerziell erhältlich. For example, some fluorophores that are part of the present invention can be used in "Handbook of Fluorescent Probes and Research Chemicals "6th ed. 1996, R. Haugland, Molecular Probes with structural formulas compiled. According to the invention are preferred the following dye classes are used as markers: cyanine Dyes and their descendants (e.g. Cy2, Cy3, Cy5, Cy7 Amersham Pharmacia Biotech, Waggoner U.S. Patent 5,268,486), Rhodamine and its descendants (e.g. TAMRA, TRITC, RG6, R110, ROX, Molecular Probes, see Manual), xanthene derivatives (e.g. Alexa 568, Alexa 594, Molecular Probes, Mao et al. Patent 6,130,101) and porphyrins (porphyrin system, Germany). These dyes are commercially available.

Dabei kann man je nach spektralen Eigenschaften und vorhandener Apparatur entsprechende Farbstoffe auswählen. Die Farbstoffe werden an das NT* über einen spaltbaren Linker gebunden. Die Farbstoffe können an den Linker z. B. über Thiocyanat- oder Ester-Bindung gekoppelt werden ("Handbook of Fluorescent Probes und Research Chemicals" 6th ed. 1996, R. Haugland, Molecular Probes, Jameson et al. Methods in Enzymology 1997 v.278 S. 363, Waggoner Methods in Enzymology 1995 v.246 S.362). Depending on the spectral properties and Select appropriate dyes from existing equipment. The Dyes are attached to the NT * via a cleavable linker bound. The dyes can on the linker z. B. about Thiocyanate or ester bond can be coupled ("Handbook of Fluorescent Probes and Research Chemicals "6th ed. 1996, R. Haugland, Molecular Probes, Jameson et al. Methods in Enzymology 1997 v.278 p. 363, Waggoner Methods in Enzymology 1995 v.246 p.362).

4.5.3 Spaltbare Bindung zwischen dem Nukleotid und dem Substituenten, Spaltung4.5.3 Fissile bond between the nucleotide and the Substituents, cleavage

Der zur Termination führende Substituent ist an das NT durch eine unter milden Bedingungen spaltbare Bindung gekoppelt. Beispiele für diese Verbindungen stellen Ester und Acetale dar. The substituent leading to the termination is through to the NT a bond that is cleavable under mild conditions is coupled. Examples of these compounds are esters and acetals represents.

Die Spaltung der Ester erfolgt vorzugsweise im basischen pH- Bereich (z. B. 9 bis 11). Die Spaltung von Acetalen erfolgt im saueren Bereich (z. B. zwischen 3 und 4). The esters are preferably cleaved in basic pH Range (e.g. 9 to 11). The splitting of acetals takes place in the acidic range (e.g. between 3 and 4).

Ester können auch enzymatisch durch Polymerasen oder Esterasen abgespalten werden. Esters can also be enzymatic by polymerases or esterases be split off.

In einer bevorzugten Ausführungsform der Erfindung wird der Substituent zusammen mit dem Fluoreszenzfarbstoff in einem Schritt abgespalten. In a preferred embodiment of the invention, the Substituent together with the fluorescent dye in one Split off step.

4.5.4 Spaltbare Bindung zwischen dem Substituenten und dem Fluoreszenzfarbstoff, Spaltung4.5.4 Cleavable bond between the substituent and the Fluorescent dye, cleavage

In einer anderen bevorzugten Ausführungsform der Erfindung ist der Fluoreszenzfarbstoff an den Substituenten durch eine unter milden Bedingungen spaltbare Gruppe gekoppelt. In another preferred embodiment of the invention the fluorescent dye on the substituents by a below mild conditions coupled to cleavable group.

Vorzugsweise gehört die genannte Gruppe zu chemisch oder enzymatisch spaltbaren oder photolabilen Verbindungen. The said group preferably belongs to chemical or enzymatically cleavable or photolabile compounds.

Ester-, Thioester-, Disulfid-Verbindungen und photolabile Verbindungen eignen sich besonders gut als spaltbare Verbindung zwischen dem Substituenten und dem Fluoreszenzfarbstoff. Ester, thioester, disulfide compounds and photolabile Compounds are particularly suitable as cleavable Connection between the substituent and the Fluorescent dye.

Als Beispiele von chemisch spaltbaren Gruppen sind Ester-, Thioester- und Disulfid-Verbindungen bevorzugt ("Chemistry of protein conjugation and crosslinking" Shan S. Wong 1993 CRC Press Inc., Herman et al. Method in Enzymology 1990 v.184 S. 584, Lomant et al. J. Mol.Biol. 1976 v.104 243, "Chemistry of carboxylic acid and esters" S. Patai 1969 Interscience Publ.). Beispiele für photolabile Verbindungen können in folgenden Literaturstellen gefunden werden: "Protective groups in organic synthesis" 1991 John Willey & Sons, Inc., V. Pillai Synthesis 1980 S. 1, V. Pillai Org.Photochem. 1987 v.9 S. 225, Dissertation "Neue photolabile Schutzgruppen für die lichtgesteuerte Oligonucleotidsynthese" H. Giegrich, 1996, Konstanz, Dissertation "Neue photolabile Schutzgruppen für die lichtgesteuerte Oligonucleotidsynthese" S.M. Bühler, 1999, Konstanz). Examples of chemically cleavable groups are ester, Thioester and disulfide compounds preferred ("Chemistry of protein conjugation and crosslinking "Shan S. Wong 1993 CRC Press Inc., Herman et al. Method in Enzymology 1990 v.184 P. 584, Lomant et al. J. Mol. Biol. 1976 v.104 243, "Chemistry of carboxylic acid and esters "S. Patai 1969 Interscience Publ.). Examples of photolabile compounds can be found in the following References are found: "Protective groups in organic synthesis "1991 John Willey & Sons, Inc., V. Pillai Synthesis 1980 p. 1, V. Pillai Org.Photochem. 1987 v.9 p. 225, Dissertation "New photolabile protecting groups for the light-controlled oligonucleotide synthesis "H. Giegrich, 1996, Constance, dissertation "New photolabile protecting groups for the light-controlled oligonucleotide synthesis "S.M. Bühler, 1999, Konstanz).

Der Spaltungsschritt ist in jedem Zyklus vorhanden und muß unter milden Bedingungen verlaufen, so dass die Nukleinsäuren nicht beschädigt oder modifiziert werden. The cleavage step is present in every cycle and must run under mild conditions so that the nucleic acids not be damaged or modified.

Die Spaltung läuft bevorzugt chemisch (z. B. in milder saurer oder basischer Umgebung für eine Ester-Verbindung oder durch Zugabe eines Reduktionsmittels, z. B. Dithiothreitol oder Mercaptoethanol (Sigma) bei der Spaltung einer Disulfid- Verbindung), oder physikalisch (z. B. durch Beleuchtung der Oberfläche mit Licht einer bestimmten Wellenlänge für die Spaltung einer photolabilen Gruppe, Dissertation "Neue photolabile Schutzgruppen für die lichtgesteuerte Oligonucleotidsynthese" H. Giegrich, 1996, Konstanz) ab. The cleavage is preferably chemical (e.g. mild acidic or basic environment for an ester compound or by Addition of a reducing agent, e.g. B. dithiothreitol or Mercaptoethanol (Sigma) when cleaving a disulfide Connection), or physically (e.g. by illuminating the Surface with light of a certain wavelength for the Splitting of a photolabile group, dissertation "Neue photolabile protective groups for the light-controlled Oligonucleotide Synthesis "H. Giegrich, 1996, Konstanz).

In dieser Ausführungsform wird nach der Detektion zunächst der Fluoreszenzfarbstoff abgespalten und erst dann der an die 3'-Position gekoppelte, zur Termination führende Substituent. In this embodiment, the first step is after the detection the fluorescent dye is split off and only then that to the 3'-coupled substituent leading to termination.

4.5.5 Farbiges Kodierungsschema, Anzahl der Farbstoffe4.5.5 Color coding scheme, number of dyes

Jedes NT* muß eindeutig mit einem charakteristischen Farbstoff markiert sein. Vorzugsweise kann man einen Zyklus durchführen mit:

  • a) vier verschieden markierten NT*s
  • b) zwei verschieden markierten NT*s
  • c) einem markierten NT*
  • d) zwei verschieden markierten NT*s und zwei unmarkierten NTs,
(auch andere Kombinationen sollten einem Fachmann naheliegend erscheinen) d. h.
  • a) Man kann alle 4 NTs mit verschiedenen Farbstoffen markieren und alle 4 gleichzeitig in die Reaktion einsetzten. Dabei erreicht man die Sequenzierung einer Nukleinsäurekette mit einer minimalen Anzahl von Zyklen. Diese Variante der Erfindung stellt allerdings hohe Anforderungen an das Detektionssystem: 4 verschiedene Farbstoffe müssen in jedem Zyklus identifiziert werden.
  • b) Zur Vereinfachung der Detektion kann eine Markierung mit zwei Farbstoffen gewählt werden. Dabei werden 2 Paare von NTs* gebildet, die jeweils verschieden markiert sind, z. B. A und G tragen die Markierung "X", C und U tragen die Markierung "Y". In die Reaktion in einem Zyklus (n) werden 2 unterschiedlich markierte NTs* gleichzeitig eingesetzt, z. B. C* in Kombination mit A*, und im darauffolgenden Zyklus (n+1) werden dann U* und G* zugegeben.
  • c) Man kann auch nur einen einzigen Farbstoff zur Markierung aller 4 NTs* verwenden und pro Zyklus nur ein NT* einsetzen.
  • d) In einer technisch vereinfachten Ausführungsform werden pro Zyklus zwei unterschiedlich markierte NT*s eingesetzt und zwei unmarkierte NTs (sogen. 2NT*s/2NTs-Methode). Diese Ausführungsform kann verwendet werden, um Varianten (z. B. Mutationen, oder alternativ gespleißte Gene) einer bereits bekannten Sequenz zu ermitteln.
Every NT * must be clearly marked with a characteristic dye. A cycle can preferably be carried out with:
  • a) four differently marked NT * s
  • b) two differently marked NT * s
  • c) a marked NT *
  • d) two differently marked NT * s and two unmarked NTs,
(other combinations should also be obvious to a specialist) ie
  • a) You can mark all 4 NTs with different dyes and use all 4 at the same time in the reaction. The sequencing of a nucleic acid chain is achieved with a minimal number of cycles. However, this variant of the invention places high demands on the detection system: 4 different dyes have to be identified in each cycle.
  • b) A marking with two dyes can be selected to simplify the detection. Two pairs of NTs * are formed, each marked differently, e.g. B. A and G are marked "X", C and U are marked "Y". Two differently labeled NTs * are used simultaneously in the reaction in one cycle (s), e.g. B. C * in combination with A *, and in the subsequent cycle (n + 1) then U * and G * are added.
  • c) You can also use only a single dye to mark all 4 NTs * and use only one NT * per cycle.
  • d) In a technically simplified embodiment, two differently marked NT * s are used per cycle and two unmarked NTs (so-called 2NT * s / 2NTs method). This embodiment can be used to determine variants (e.g. mutations, or alternatively spliced genes) of an already known sequence.

Unter Reaktionsbedingungen erfolgt der Einbau von NT*s in die NSKFs vorzugsweise so, daß an mehr als 50% der an der Sequenzierungsreaktion beteiligten NSKFs in einem Zyklus ein markiertes NT* eingebaut wird, vorzugsweise an mehr als 90%. Das hängt damit zusammen, daß an manchen Nukleinsäureketten die Reaktion sehr langsam abläuft. Ein Einbau der NTs* an jeder komplementären Position in jedem Zyklus wird angestrebt, ist aber nicht erforderlich, weil nur die erfolgreichen Einbaureaktionen detektiert und ausgewertet werden; eine verzögerte Reaktion im Nachfolgenden Zyklus führt nicht zu einem Sequenzierungsfehler. NT * s is installed in the under reaction conditions NSKFs preferably so that more than 50% of those at the Sequencing reaction involved NSKFs in one cycle marked NT * is installed, preferably at more than 90%. This is due to the fact that some nucleic acid chains the reaction is very slow. Installation of the NTs * every complementary position in every cycle aspired but is not necessary because only that successful installation reactions detected and evaluated become; a delayed response in the subsequent cycle does not lead to a sequencing error.

Vorzugsweise wird für alle NTs* dieselbe Polymerase verwendet. Es können aber auch verschiedene Polymerasen für verschiedene NTs* eingesetzt werden. The same polymerase is preferred for all NTs * used. However, different polymerases can also be used for different NTs * are used.

4.6 Detektionsapparatur4.6 Detection equipment

Einzelne Moleküle auf einer Oberfläche kann man mit verschiedenen Methoden untersuchen. Es sind mehrere Verfahren bekannt: z. B. AtomForce-Mikroscopie, Elektronen-Mikroskopie, Nahfeld-Fluoreszenz-Mikroscopie, Weitfeld-Fluoreszenz- Mikroskopie, TIR-Mikroskopie usw. (Science 1999 v.283 1667, Unger et al. BioTechniques 1999 v.27 S. 1008, Ishijaima et al. Cell 1998 v.92 S. 161, Dickson et al. Science 1996 v.274 S. 966, Xie et al. Science 1994 v.265 S. 361, Nie et al. Science 1994 v.266 S. 1018, Betzig et al. Science 1993 v.262 S. 1422). You can use individual molecules on a surface investigate different methods. There are several procedures known: e.g. B. AtomForce microscopy, electron microscopy, Near-field fluorescence microscopy, wide-field fluorescence Microscopy, TIR microscopy etc. (Science 1999 v.283 1667, Unger et al. BioTechniques 1999 v.27 p. 1008, Ishijaima et al. Cell 1998 v.92 p. 161, Dickson et al. Science 1996 v.274 p. 966, Xie et al. Science 1994 v.265 p. 361, Nie et al. Science 1994 v.266 p. 1018, Betzig et al. Science 1993 v.262 p. 1422).

Erfindungsgemäß werden Fluoreszenz-Signale einzelner in die Nukleinsäurekette eingebauter NTs* vorzugsweise mit einem Weitfeld-Fluoreszenz-Mikroskop (Epifluoreszenz) oder einem Laser-Scanning-Mikroskop (Epifluoreszenz) oder einem TIRF- Microskop (Total Internal Reflection Fluorescence Microscope). According to the invention, fluorescence signals are transmitted individually into the Nucleic acid chain of incorporated NTs * preferably with one Wide field fluorescence microscope (epifluorescence) or one Laser scanning microscope (epifluorescence) or a TIRF Microscope (Total Internal Reflection Fluorescence Microscope).

Es sind verschiedene Varianten der Konstruktion einer solchen Apparatur möglich (Weston et al. J. Chem.Phys. 1998 v.109 S. 7474, Trabesinger et al. Anal. Chem. 1999 v.71 S. 79, Adachi et al. Journal of Microscopy 1999 v.195 S. 125, Unger et al. BioTechniques 1999 v.27 S. 1008, Ishijaima et al. Cell 1998 v.92 S. 161, Dickson et al. Science 1996 v.274 S. 66, Tokunaga et al. Bichem.Biophys.Res.Com. 1997 v.235 S. 7, "Confocal Laser Scanning Microscopy" 1997 Ed. Sheppard, BIOS Scientific Publishers, "New Techniques of optical microscopy and microspectroscopy" 1991 Ed. R. Cherry CRC Press, Inc., "Fluorescence microscopy" 1998 2.ed. Herman BIOS Scientific Publishers, "Handbook of biological confocal microscopy" 1995 J. Pawley Plenum Press). Unterschiede in ihrem konkreten Aufbau ergeben sich aus der Variation ihrer Einzelteile. Die Vorrichtung für das Anregungslicht kann z. B. auf der Basis eines Lasers, einer Lampe oder von Dioden funktionieren. Für die Detektionsvorrichtung können sowohl CCD-Kameras als auch PMT dienen. Andere Beispiele für technische Details siehe ("Confocal Laser Scanning Microscopy" 1997 Ed. Sheppard, BIOS Scientific Publishers, "New Techniques of optical microscopy and microspectroscopy" 1991 Ed. R. Cherry CRC Press, Inc., "Fluorescence microscopy" 1998 2.ed. Herman BIOS Scientific Publishers, "Handbook of biological confocal microscopy" 1995 J. Pawley Plenum Press). Es ist nicht die Aufgabe dieser Erfindung, alle möglichen technischen Varianten einer Detektionsvorrichtung aufzuzählen. Der prinzipielle Aufbau einer geeigneten Apparatur wird in einem Schema Fig. 8 erläutert. Sie besteht aus folgenden Elementen:
Lichtquelle zur Anregung der Fluoreszenz (1)
Lichtleitender Teil (2)
Scantisch (3)
Vorrichtung zur Selektion von Spektren (4)
Detektionsvorrichtung (5)
Computer mit Steuerungs- und Analysefunktionen (6)
Various variants of the construction of such an apparatus are possible (Weston et al. J. Chem. Phys. 1998 v.109 p. 7474, Trabesinger et al. Anal. Chem. 1999 v.71 p. 79, Adachi et al. Journal of Microscopy 1999 v.195 p. 125, Unger et al. BioTechniques 1999 v.27 p. 1008, Ishijaima et al. Cell 1998 v.92 p. 161, Dickson et al. Science 1996 v.274 p. 66, Tokunaga et al. Bichem.Biophys.Res.Com. 1997 v.235 p. 7, "Confocal Laser Scanning Microscopy" 1997 Ed. Sheppard, BIOS Scientific Publishers, "New Techniques of optical microscopy and microspectroscopy" 1991 Ed. R. Cherry CRC Press, Inc., "Fluorescence microscopy" 1998 2nd ed. Herman BIOS Scientific Publishers, "Handbook of biological confocal microscopy" 1995 J. Pawley Plenum Press). Differences in their concrete structure result from the variation of their individual parts. The device for the excitation light can, for. B. function on the basis of a laser, a lamp or diodes. Both CCD cameras and PMT can be used for the detection device. For other examples of technical details, see ("Confocal Laser Scanning Microscopy" 1997 Ed. Sheppard, BIOS Scientific Publishers, "New Techniques of optical microscopy and microspectroscopy" 1991 Ed. R. Cherry CRC Press, Inc., "Fluorescence microscopy" 1998 2. ed. Herman BIOS Scientific Publishers, "Handbook of biological confocal microscopy" 1995 J. Pawley Plenum Press). It is not the object of this invention to list all possible technical variants of a detection device. The basic structure of a suitable apparatus is explained in a diagram in FIG. 8. It consists of the following elements:
Light source to excite fluorescence (1)
Light guiding part (2)
Scan table (3)
Spectra selection device (4)
Detection device (5)
Computers with control and analysis functions (6)

Diese Elemente der Apparatur können kommerziell erworben werden (Mikroskop-Firmen: Zeiss, Leica, Nikon. Olympus). These elements of the apparatus can be purchased commercially (microscope companies: Zeiss, Leica, Nikon. Olympus).

Im folgenden soll beispielsweise eine für die Detektion einzelner Moleküle geeignete Kombination aus diesen Elementen vorgestellt werden:
Weitfeld-Fluoreszenz-Mikroskop Axioplan 2 (Zeiss) mit Quecksilberdampflampe
Objektiv Planneofluar 100x, NA 1.4 (Zeiss)
Kamera Photometrix oder AxioCam (Zeiss)
Computer mit Software zur Steuerung und Analyse
In the following, for example, a combination of these elements suitable for the detection of individual molecules will be presented:
Axioplan 2 (Zeiss) wide-field fluorescence microscope with mercury vapor lamp
Lens Planneofluar 100x, NA 1.4 (Zeiss)
Camera Photometrix or AxioCam (Zeiss)
Computer with software for control and analysis

Nachfolgend soll die Vorgehensweise bei der Detektion erläutert werden. Man beachte dabei die allgemeinen Regeln der Fluoreszezmikroskopie ("Confocal Laser Scanning Microscopy" 1997 Ed. Sheppard, BIOS Scientific Publishers, "New Techniques of optical microscopy and microspectroscopy" 1991 Ed. R. Cherry CRC Press, Inc., "Fluorescence microscopy" 1998 2.ed. Herman BIOS Scientific Publishers, "Handbook of biological confocal microscopy" 1995 J. Pawley Plenum Press). The following is the procedure for the detection are explained. Please note the general rules of the Fluoresce microscopy ("Confocal Laser Scanning Microscopy") 1997 Ed. Sheppard, BIOS Scientific Publishers, "New Techniques of optical microscopy and microspectroscopy "1991 Ed. R. Cherry CRC Press, Inc., "Fluorescence microscopy" 1998 2.ed. Herman BIOS Scientific Publishers, "Handbook of biological confocal microscopy "1995 J. Pawley Plenum Press).

Die Detektion umfaßt folgende Phasen:

  • 1. Vorbereitung zur Detektion
  • 2. Durchführung eines Detektionsschrittes in jedem Zyklus, wobei jeder Detektionsschritt als Scanvorgang abläuft und folgende Operationen umfaßt:
    • a) Einstellung der Position des Objektivs (X,Y-Achse),
    • b) Einstellung der Fokusebene (Z-Achse),
    • c) Detektion der Signale einzelner Moleküle, Zuordnung des Signals zu NT* und Zuordnung des Signals zum jeweiligen NSKF,
    • d) Verschiebung zur nächsten Position auf der Oberfläche.
The detection comprises the following phases:
  • 1. Preparation for detection
  • 2. Execution of a detection step in each cycle, each detection step running as a scanning process and comprising the following operations:
    • a) adjusting the position of the lens (X, Y axis),
    • b) adjustment of the focal plane (Z axis),
    • c) detection of the signals of individual molecules, assignment of the signal to NT * and assignment of the signal to the respective NSKF,
    • d) Shift to the next position on the surface.

Die Signale von in die NSKFs eingebauten NTs* werden durch das Abscannen der Oberfläche registriert. Der Scanvorgang kann in verschiedener Weise ausgeführt werden ("Confocal Laser Scanning Microscopy" 1997 Ed. Sheppard, BIOS Scientific Publishers, "New Techniques of optical microscopy and microspectroscopy" 1991 Ed. R. Cherry CRC Press, Inc., "Fluorescence microscopy" 1998 2.ed. Herman BIOS Scientific Publishers, "Handbook of biological confocal microscopy" 1995 J. Pawley Plenum Press). Beispielsweise wird ein diskontinuierlicher Scanvorgang gewählt. Dabei wird das Objektiv schrittweise über die Oberfläche bewegt (Fig. 8a), so dass von jeder Oberflächenposition ein zweidimensionales Bild (2D-Bild) entsteht (Fig. 8b, c). The signals from NTs * built into the NSKFs are registered by scanning the surface. The scanning process can be carried out in various ways ("Confocal Laser Scanning Microscopy" 1997 Ed. Sheppard, BIOS Scientific Publishers, "New Techniques of optical microscopy and microspectroscopy" 1991 Ed. R. Cherry CRC Press, Inc., "Fluorescence microscopy" 1998 2. ed. Herman BIOS Scientific Publishers, "Handbook of biological confocal microscopy" 1995 J. Pawley Plenum Press). For example, a discontinuous scanning process is selected. The lens is moved step by step over the surface ( FIG. 8a), so that a two-dimensional image (2D image) is created from each surface position ( FIG. 8b, c).

Dieses 2D-Bild kann mit verschiedenen Methoden erstellt werden: z. B. durch den Laser-Scan einer Position des Mikroskopfeldes (Laser-Scanning-Microskopie) oder durch eine Kameraaufnahme an einer Position (vgl. Handbücher der Mikroskopie). Als Beispiel wird die Detektion einzelner Moleküle mit einer CCD-Kamera beschrieben. This 2D image can be created using various methods will: z. B. by the laser scan of a position of the Microscope field (laser scanning microscopy) or by a Camera recording at one position (see manuals of the Microscopy). As an example, the detection of individual Molecules described with a CCD camera.

Die Detektion wird schematisch am Beispiel der Sequenzierung eines 1 Mb langen DNA-Stücks erläutert: The detection is schematic using the example of sequencing of a 1 Mb piece of DNA explains:

1) Vorbereitung zur Detektion1) Preparation for detection

Am Anfang wird festgelegt, wie viele NSKF-Sequenzen zur Rekonstruktion der ursprünglichen Sequenz analysiert werden müssen. Im Fall einer Rekonstruktion nach dem Schrotschuß- Verfahren ("Automated DNA sequencing and analysis" S. 231 ff. 1994 M. Adams et al. Academic Press, Huang et al. Genom Res. 1999 v.9 S. 868, Huang Genomics 1996 v.33 S. 21, Bonfield et al. NAR 1995 v.23 S. 4992, Miller et al. J. Comput.Biol. 1994 v.1 S. 257) spielen folgende Faktoren eine Rolle: 1) Von jedem NSKF wird bei der Sequenzierung eine Sequenz von ca. 300-500 NTs bestimmt. 2) Die Gesamtlänge der zu analysierenden Sequenz ist wichtig. 3) Bei der Sequenzierung muß ein bestimmtes Maß an Redundanz erreicht werden, um die Genauigkeit zu steigern und eventuelle Fehler zu korrigieren. Insgesamt ist zur Rekonstruktion des größten Teils der ursprünglichen Sequenz die etwa 10- bis 100-fache Menge an Rohsequenzen erforderlich, d. h. bei diesem Beispiel mit einer Mb, werden 10 bis 100 Mb Rohsequenzdaten gebraucht. Bei einer durchschnittlichen Sequenzlänge von 400 bp pro NSKF benötigt man entsprechend 25.000 bis 250.000 DNA-Fragmente. At the beginning it is determined how many NSKF sequences are to be used Reconstruction of the original sequence can be analyzed have to. In the case of a reconstruction after the shotgun Procedure ("Automated DNA sequencing and analysis" p. 231 ff. 1994 M. Adams et al. Academic Press, Huang et al. Genome Res. 1999 v.9 p. 868, Huang Genomics 1996 v.33 p. 21, Bonfield et al. NAR 1995 v.23 p. 4992, Miller et al. J. Comput.Biol. 1994 v.1 P. 257) the following factors play a role: 1) From each NSKF a sequence of approx. 300-500 NTs certainly. 2) The total length of the sequence to be analyzed is important. 3) When sequencing, a certain amount of must Redundancy can be achieved to increase accuracy and correct any errors. Overall is for Reconstruction of most of the original sequence about 10 to 100 times the amount of raw sequences required, d. H. in this example with one Mb, 10 to 100 Mb Raw sequence data needed. With an average A sequence length of 400 bp per NSKF is required accordingly 25,000 to 250,000 DNA fragments.

2) Durchführung eines Detektionsschrittes in jedem Zyklus2) Performing a detection step in every cycle

Zur Sequenzierung müssen die Positionen der NSKFs bestimmt werden, damit man eine Grundlage für die Zuordnung der Signale hat. Die Kenntnis dieser Positionen erlaubt eine Aussage darüber, ob die Signale einzelner Moleküle von eingebauten NTs* stammen oder von zufällig an die Oberfläche gebundenen NTs*. Diese Positionen können mit verschiedenen Methoden identifiziert werden. The positions of the NSKFs must be determined for sequencing be a basis for assigning the signals Has. Knowing these positions allows a statement to be made about whether the signals of individual molecules from built-in NTs * originate or from randomly bound to the surface NTs *. These positions can be done using different methods be identified.

In einer bevorzugten Ausführungsform werden die Positionen gebundener NSKF-Primer-Komplexe während der Sequenzierung identifiziert. Dabei wird die Tatsache genutzt, dass die Signale von den in die Nukleinsäurekette eingebauten NTs* immer dieselben Koordinaten haben. Das ist durch die Fixierung der Nukleinsäureketten gewährleistet. Die unspezifisch gebundenen NTs* binden zufällig an verschieden Stellen der Oberfläche. In a preferred embodiment, the positions bound NSKF primer complexes during sequencing identified. The fact that the Signals from the NTs * built into the nucleic acid chain always have the same coordinates. That is through the fixation the nucleic acid chains guaranteed. The unspecific bound NTs * bind randomly to different places of the Surface.

Zur Identifizierung der Positionen von fixierten NSKFs werden die Signale auf Übereinstimmung ihrer Koordinaten aus mehreren aufeinander folgenden Zyklen überprüft. Das kann z. B. am Anfang der Sequenzierung erfolgen. Die übereinstimmende Koordinaten werden als Koordinaten der DNA-Fragmente bewertet und gespeichert. To identify the positions of fixed NSKFs the signals match their coordinates from several consecutive cycles checked. That can e.g. B. on Start sequencing. The matching one Coordinates are evaluated as coordinates of the DNA fragments and saved.

Das Scan-System muß reproduzierbar über mehrere Zyklen die Oberfläche abscannen können. X,Y und Z-Achsen-Einstellungen an jeder Oberflächenposition können von einem Computer kontrolliert werden. Stabilität und Reproduzierbarkeit der Einstellung von Objektivpositionen in jedem Scanvorgang entscheiden über die Qualität der Detektion und somit über die Identifizierung der Signale einzelner Moleküle. The scan system must be reproducible over several cycles Can scan the surface. X, Y and Z axis settings Any surface position can be viewed from a computer to be controlled. Stability and reproducibility of the Setting of lens positions in every scan decide on the quality of the detection and thus on the Identification of the signals of individual molecules.

a) Einstellung der Position des Objektivs (X,Y-Achse)a) Setting the position of the lens (X, Y axis)

Die mechanische Instabilität der kommerziell erhältlichen Scantische und die geringe Reproduzierbarkeit der wiederholten Einstellung derselben X,Y-Positionen machen eine präzise Analysen der Signale einzelner Moleküle über mehrere Zyklen schwierig. Es existieren viele Möglichkeiten, eine Übereinstimmung der Koordinaten bei wiederholten Einstellungen zu verbessern bzw. mögliche Abweichungen zu kontrollieren. Als Beispiel wird eine Kontrollmöglichkeit angeführt. Nach einer groben mechanischen Einstellung der Objektivposition wird ein Kontrollbild von einem mit der Oberfläche fest verbundenen Muster gemacht. Auch wenn die mechanische Einstellung nicht exakt dieselben Koordinaten aufweist (Abweichungen bis zu 10 µm sind durchaus möglich), kann man mittels optischer Kontrolle eine Korrektur vornehmen. Das Kontrollbild vom Muster dient als Koordinatensystem für das Bild mit Signalen von eingebauten NTs*. Eine Voraussetzung für eine solche Korrektur ist, dass keine weiteren Bewegungen der Oberfläche zwischen diesen beiden Aufnahmen gemacht werden. Signale von einzelnen Molekülen werden in Relation zum Muster gesetzt, so dass eine X,Y-Abweichung in der Musterposition gleiche X,Y- Abweichung in der Position der Signale einzelner Moleküle bedeutet. Das Kontrollbild vom Muster kann vor, während oder nach der Detektion einzelner Moleküle gemacht werden. Ein solches Kontrollbild muß entsprechend bei jeder Einstellung auf einer neuen Oberflächenposition gemacht werden. The mechanical instability of the commercially available Scanning tables and the low reproducibility of the repeated Setting the same X, Y positions make a precise Analysis of the signals of individual molecules over several cycles difficult. There are many options, one Coordinates for repeated settings to improve or control possible deviations. As An example of a control option is given. After a rough mechanical adjustment of the lens position becomes a Control image of one firmly attached to the surface Pattern made. Even if the mechanical adjustment is not has exactly the same coordinates (deviations up to 10 µm are quite possible), one can by means of optical Check to make a correction. The control picture from Pattern serves as the coordinate system for the image with signals of built-in NTs *. A prerequisite for one Correction is that no further surface movements between these two shots. Signals from individual molecules are placed in relation to the pattern, see above that an X, Y deviation in the pattern position is the same X, Y- Deviation in the position of the signals of individual molecules means. The control image of the pattern can be before, during or after the detection of individual molecules. On such control picture must be corresponding with each setting be made on a new surface position.

b) Einstellung der Fokusebene (Z-Achse)b) Setting the focal plane (Z axis)

Die Oberfläche ist nicht absolut plan und weist verschiedene Unebenheiten auf. Dadurch verändert sich der Oberfläche-Objektiv-Abstand beim abscannen benachbarter Stellen. Diese Unterschiede im Abstand können dazu führen, dass einzelne Moleküle die Fokusebene verlassen und so der Detektion entgehen. The surface is not absolutely flat and has different features Bumps on. This changes the Surface-lens distance when scanning neighboring areas. This Differences in distance can lead to individual molecules leave the focal plane and thus avoid detection.

Aus diesem Grund ist es wichtig, dass beim Abscannen der Oberfläche eine reproduzierbare Einstellung der Fokusebene an jeder Objektivposition erreicht wird. For this reason it is important that when scanning the Reproducible setting of the focus plane every lens position is reached.

Es gibt verschiedene Möglichkeiten, die Fokusebene reproduzierbar einzustellen. Beispielsweise kann folgende Methode angewendet werden: Da die Anregung einzelner Moleküle zum Auslöschen ihrer Fluoreszenz führen kann, wird auf die Oberfläche ein Marker aufgebracht, der zur Einstellung der Fokusebene dient. Danach erfolgt die Detektion der Signale einzelner Moleküle. Der Marker kann beliebiger Natur sein (z. B. Farbstoff oder Muster), darf aber die Detektion und die Reaktion nicht beeinträchtigen. There are several options to the focus level adjust reproducible. For example, the following Method to be applied: Because the excitation of individual molecules can lead to the extinction of their fluorescence Applied a surface marker to adjust the Focus plane serves. The signals are then detected individual molecules. The marker can be of any nature (e.g. dye or pattern), but the detection and the Do not affect reaction.

c) Detektion der Signale einzelner Moleküle, Zuordnung des Signals zu NT* und Zuordnung des Signals zum jeweiligen NSKFc) detection of the signals of individual molecules, assignment of the Signals to NT * and assignment of the signal to the respective NSKF

Das mit Hilfe des Detektionssystems erzeugte zweidimensionale Bild der Reaktionsoberfläche enthält die Signalinformationen von in die NSKFs eingebauten NT*s. Diese müssen vor der weiteren Verarbeitung aus der Gesamtdatenmenge der Bildinformationen mit geeigneten Methoden extrahiert werden. Die dazu notwendigen Algorithmen zur Skalierung, Transformation und Filterung der Bildinformationen zählen zum Standardrepertoir der digitalen Bildverarbeitung und Mustererkennung (Haberäcker P. "Praxis der Digitalen Bildverarbeitung und Mustererkennung". Hanser-Verlag, München, Wien, 1995; Galbiati L.J. "Machine vision and digital image processing fundamentals". Prentice Hall, Englewood Cliffs, New Jersey, 1990). Die Signalextraktion erfolgt vorzugsweise über ein Grauwertbild, das die Helligkeitsverteilung der Reaktionsoberfläche für den jeweiligen Fluoreszenzkanal abbildet. Wenn bei der Sequenzierungsreaktion mehrere Nukleotide mit unterschiedlichen Fluoreszenz-Farbstoffen verwendet werden, kann zunächst für jedes verwendete fluoreszenzmarkierte Nukleotid (A,T,C,G oder U) ein separates Grauwert-Bild erzeugt werden. Dafür können prinzipiell 2 Verfahren angewendet werden:

  • 1. Durch Verwendung von geeigneten Filtern (Zeiss-Filtersätze) wird für jeden Fluoreszenzkanal ein Grauwertbild erzeugt.
  • 2. Aus einem aufgenommenen Mehrkanal-Farb-Bild werden mit Hilfe eines geeigneten Algorithmus durch ein Bildverarbeitungsprogramm die relevanten Farbkanäle extrahiert und jeweils als Grauwertbild einzeln weiterverarbeitet. Zur Kanalextraktion wird dabei ein für den jeweiligen Kanal spezifischer Farb-Schwellwertalgorithmus eingesetzt. So entstehen zunächst aus einem Mehrkanal-Farbbild einzelne Grauwertbilder 1 bis N. Diese Bilder definieren sich wie folgt:
    GBN = (s(x,y)) einkanaliges Grauwertbild
    N = {1,. . .,Anzahl der Fluoreszenzkanäle}.
    M = {0,1,. . .,255} Grauwertmenge
    S = (s(x,y)) Bildmatrix des Grauwertbildes
    x = 0,1,. . .,L-1 Bildzeilen
    y = 0,1,. . .,R-1 Bildspalten
    (x,y) Ortskoordinaten eines Bildpunktes
    s(x,y)∈ M Grauwert des Bildpunktes.
The two-dimensional image of the reaction surface generated with the aid of the detection system contains the signal information from NT * s built into the NSKFs. Before further processing, these must be extracted from the total amount of image information using suitable methods. The algorithms required for scaling, transforming and filtering the image information are part of the standard repertoire of digital image processing and pattern recognition (Haberäcker P. "Practice of digital image processing and pattern recognition". Hanser-Verlag, Munich, Vienna, 1995; Galbiati LJ "Machine vision and digital image processing fundamentals ". Prentice Hall, Englewood Cliffs, New Jersey, 1990). The signal extraction is preferably carried out via a gray value image, which depicts the brightness distribution of the reaction surface for the respective fluorescence channel. If several nucleotides with different fluorescent dyes are used in the sequencing reaction, a separate gray value image can first be generated for each fluorescence-labeled nucleotide (A, T, C, G or U). In principle, two methods can be used for this:
  • 1. A gray value image is generated for each fluorescence channel by using suitable filters (Zeiss filter sets).
  • 2. The relevant color channels are extracted from a recorded multichannel color image with the aid of a suitable algorithm by an image processing program and are individually processed further as a gray-scale image. A channel-specific color threshold algorithm is used for channel extraction. Individual gray value images 1 to N are thus initially created from a multi-channel color image. These images are defined as follows:
    GB N = (s (x, y)) single-channel gray-scale image
    N = {1 ,. , ., Number of fluorescence channels}.
    M = {0.1 ,. , ., 255} Gray value set
    S = (s (x, y)) image matrix of the gray scale image
    x = 0.1 ,. , ., L-1 image lines
    y = 0.1 ,. , ., R-1 image columns
    (x, y) location coordinates of a pixel
    s (x, y) ∈ M gray value of the pixel.

Aus dieser Datenmenge wird nun durch ein geeignetes Programm die relevante Bildinformation extrahiert. Ein solches Programm sollte folgende Arbeitsschritte realisieren: A suitable program is now used to convert this amount of data the relevant image information is extracted. Such a program should implement the following steps:

Für GB1 bis GBN durchführen:

  • A) Vorverarbeitung des Bildes, so zum Beispiel gegebenenfalls Reduktion des durch die Digitalisierung der Bildinformation entstandenen Bildrauschens, etwa durch Grauwertglättung.
  • B) Prüfung jedes Bildpunkt (x,y) des Grauwertbildes, ob dieser Punkt im Zusammenhang mit den ihn umgebenden unmittelbaren und weiter entfernten Nachbarbildpunkten die Eigenschaften eines Fluoreszenzpunktes erfüllt. Diese Eigenschaften hängen unter anderem von der verwendeten Detektionsapparatur und der Auflösung des Grauwertbildes ab. Sie können beispielsweise ein typisches Verteilungsmuster von Helligkeits-Intensitätswerten über einer den Bildpunkt umgebenden Matrix darstellen. Die dazu verwendbaren Methoden der Bildsegmentierung reichen von einfachen Schwellwertverfahren bis hin zur Verwendung neuronaler Netze.
For GB 1 to GB N :
  • A) preprocessing the image, for example, if necessary, reducing the image noise caused by the digitization of the image information, for example by gray value smoothing.
  • B) Checking each pixel (x, y) of the gray-scale image as to whether this point fulfills the properties of a fluorescence point in connection with the immediate and more distant neighboring pixels surrounding it. These properties depend, among other things, on the detection equipment used and the resolution of the gray-scale image. For example, you can display a typical distribution pattern of brightness intensity values over a matrix surrounding the pixel. The image segmentation methods that can be used range from simple threshold value methods to the use of neural networks.

Erfüllt ein Bildpunkt (x,y) diese Anforderungen, dann folgt ein Vergleich mit den Koordinaten von in bisher durchgeführten Sequenzierungszyklen identifizierten NSKFs. Bei einer Übereinstimmung erfolgt die Zuordnung des Signals mit dem aus dem jeweiligen Fluoreszenzkanal hervorgehenden Nukleotid zu diesem NSKF. Signale mit nicht übereinstimmenden Koordinaten werden als Hintergrundsignale bewertet und verworfen. Die Analyse der Signale kann parallel zum Scanvorgang erfolgen. If a pixel (x, y) fulfills these requirements, then follows a comparison with the coordinates of in previously performed Sequencing cycles identified NSKFs. At a The signal is matched with that from the respective fluorescence channel emerging nucleotide to this NACF. Signals with mismatched coordinates will be rated as background signals and discarded. The analysis of the Signals can be made in parallel with the scanning process.

In einer beispielhaften Ausführung wurde ein 8-Bit-Grauwertbild mit einer Auflösung von 1317 × 1035 Pixel verwendet. Um die durch die Digitalisierung entstandenen Veränderungen am Bild zu reduzieren, erfolgte zunächst eine Vorverarbeitung des Gesamtbildes: Jedem Bildpunkt wurde der Mittelwert der Helligkeiten seiner 8-Nachbarn zugewiesen. Bei der gewählten Auflösung entsteht dadurch ein für einen Fluoreszenzpunkt typisches Muster eines zentralen Bildpunkt mit dem größten Helligkeitswert und Nachbarbildpunkten mit nach allen Seiten hin abfallenden Helligkeiten. Erfüllte ein Bildpunkt diese Kriterien und Überschritt der zentrifugale Helligkeitsabfall einen bestimmten Schwellenwert (zur Exklusion zu schwacher Fluoreszenzpunkte), dann wurde dieser zentrale Bildpunkt als Koordinate eines Fluoreszenzpunktes gewertet. In an exemplary embodiment, a 8-bit gray scale image with a resolution of 1317 × 1035 pixels used. About those created by digitization The first step was to reduce changes in the image Preprocessing of the overall picture: The Average value of the brightness of its 8 neighbors assigned. at the chosen resolution is one for one Fluorescence dot typical pattern of a central pixel with the greatest brightness value and neighboring pixels with brightness falling on all sides. Met one Pixel these criteria and passed the centrifugal Drop in brightness a certain threshold (for Exclusion too weak fluorescence spots), then this was central image point as the coordinate of a fluorescence point scored.

d) Verschiebung des Objektivs zur nächsten Position auf der Oberfläche. Nach der Detektion der Signale einzelner Moleküle wird das Objektiv über einer anderen Position der Oberfläche positioniert. d) moving the lens to the next position on the Surface. After the detection of the signals of individual molecules the lens will be over another position of the surface positioned.

Insgesamt kann beispielsweise eine Folge von Aufnahmen mit der Kontrolle der X,Y-Position, der Einstellung der Fokusebene und mit der Detektion einzelner Moleküle bei jeder neuen Objektivposition gemacht werden. Diese Schritte können durch einen Computer gesteuert werden. Overall, for example, a sequence of recordings with the Control of the X, Y position, the adjustment of the focus plane and with the detection of individual molecules in each new one Lens position. These steps can be done by one Computer controlled.

4.7 Zeitlicher Ablauf der Verfahrensschritte4.7 Timing of the procedural steps

Der Scanvorgang sowie die biochemische Reaktion nehmen eine gewisse Zeit in Anspruch. Wenn man diese Vorgänge nacheinander schaltet, kann man eine optimale Leistung der Apparatur erreichen. In einer bevorzugten Ausführung wird die Reaktion auf zwei getrennten Oberflächen durchgeführt. The scanning process and the biochemical reaction take one take some time. If you do these operations one after the other switches, you can get an optimal performance of the equipment to reach. In a preferred embodiment, the response to performed two separate surfaces.

Als Beispiel kann eine Oberfläche mit gebundenen NSKF-Primer- Komplexen in 2 räumlich isolierte Teile getrennt werden, so dass Reaktionen auf diesen beiden Teilen unabhängig voneinander ablaufen können. In einem anderen Beispiel können NSKFs auch von vornherein auf 2 getrennten Oberflächen immobilisiert werden. As an example, a surface with bound NSKF primer Complexes are separated into 2 spatially isolated parts, so that reactions to these two parts are independent can run from each other. In another example, you can NSKFs also from the start on 2 separate surfaces be immobilized.

Danach wird die Reaktion gestartet. Das Prinzip dabei ist, dass während auf einem Teil der Oberfläche die Reaktions- und Waschschritte ablaufen, der zweite Teil abgescannt wird. Dadurch kann man einen kontinuierlichen Ablauf der Analyse erreichen und die Geschwindigkeit der Sequenzierung steigern. The reaction is then started. The principle here is that while on a part of the surface the reaction and Wash steps run, the second part is scanned. This enables a continuous flow of analysis reach and increase the speed of sequencing.

Die Anzahl der Oberflächen, auf denen die Reaktion abläuft, kann auch größer als 2 sein. Das erscheint dann sinnvoll, wenn die Reaktion als zeitlich limitierender Schritt auftritt, d. h. die Detektion der Signale auf der Oberfläche schneller als die Reaktions- und Waschschritte abläuft. Um die Gesamtdauer der Reaktion an die Detektionsdauer anzupassen, kann jeder einzelne Schritt der Reaktion auf einer einzelnen Oberfläche mit einer zeitlichen Verzögerung im Vergleich zur nächsten Oberfläche ablaufen. The number of surfaces on which the reaction takes place can also be larger than 2. That makes sense if the reaction occurs as a time-limiting step, d. H. the detection of the signals on the surface faster than that Reaction and washing steps take place. To the total duration of the Anyone can adapt the reaction to the duration of the detection single step of reaction on a single surface with a time lag compared to the next one Surface run off.

Die Erfindung wird nachfolgend anhand von Beispielen verdeutlicht. The invention is illustrated below using examples clarified.

BeispieleExamples Beispiel 1example 1 Sequenzanalyse mit 4 markierten NTs*Sequence analysis with 4 marked NTs *

Bei einer bevorzugten Ausführungsform der Erfindung werden alle vier in die Reaktion eingesetzten NTs* mit Fluoreszenzfarbstoffen markiert. In a preferred embodiment of the invention all four NTs * used in the reaction Fluorescent dyes marked.

1A. Rekonstruktion der ursprünglichen Sequenzen nach dem Schrotschuß-Prinzip ("Automated DNA sequencing and analysis" S. 231 ff. 1994 M. Adams et al. Academic Press, Huang et al. Genom Res. 1999 v.9 S. 868, Huang Genomics 1996 v.33 S. 21, Bonfield et al. NAR 1995 v.23 S. 4992, Miller et al. J. Comput.Biol. 1994 v.1 S. 257). (Dieses Prinzip ist insbesondere bei der Analyse neuer, unbekannter Sequenzen geeignet.) 1A. Reconstruction of the original sequences after the Shotgun principle ("Automated DNA sequencing and analysis "pp. 231 ff. 1994 M. Adams et al. Academic Press, Huang et al. Genom Res. 1999 v.9 p. 868, Huang Genomics  1996 v.33 p. 21, Bonfield et al. NAR 1995 v.23 p. 4992, Miller et al. J. Comput.Biol. 1994 v.1 p. 257). (This Principle is particularly important when analyzing new, unknown sequences.)

1A-1Sequenzierung eines langen DNA-Stücks1A-1 sequencing of a long piece of DNA

Im folgenden soll anhand der Sequenzierung eines 1 Mb langen DNA-Stückes schematisch die Sequenzierung langer Nukleinsäureketten dargestellt werden (Fig. 1). Der Sequenzierung liegt das Shotgun-Prinzip zugrunde ("Automated DNA sequencing and analysis" S. 231 ff. 1994 M. Adams et al. Academic Press, Huang et al. Genom Res. 1999 v.9 S. 868, Huang Genomics 1996 v.33 S. 21, Bonfield et al. NAR 1995 v.23 S. 992, Miller et al. J. Comput.Biol. 1994 v.1 S. 257). Das zu analysierende Material wird für die Sequenzierungsreaktion vorbereitet, indem es in Fragmente von vorzugsweise 50 bis 1000 bp Länge zerlegt wird. Jedes Fragment wird anschließend mit einer Primerbindungsstelle und einem Primer versehen. Dieses Gemisch aus verschiedenen DNA-Fragmenten wird nun auf einer planen Oberfläche fixiert. Die nicht gebundenen DNA- Fragmente werden durch einen Waschschritt entfernt. Danach wird die Sequenzierungsreaktion an der gesamten Reaktionsoberfläche durchgeführt. Zur Rekonstruktion einer 1 Mb langen DNA-Sequenz sollten die Sequenzen von NSKFs vorzugsweise länger als 300 NTs sein, durchschnittlich ca. 400 bp. Da pro Zyklus nur jeweils ein markiertes NT* eingebaut wird, sind mindestens 400 Zyklen zur Sequenzierung notwendig. In the following, the sequencing of long nucleic acid chains will be shown schematically on the basis of the sequencing of a 1 Mb piece of DNA ( FIG. 1). The sequencing is based on the shotgun principle ("Automated DNA sequencing and analysis" p. 231 ff. 1994 M. Adams et al. Academic Press, Huang et al. Genom Res. 1999 v.9 p. 868, Huang Genomics 1996 v .33 p. 21, Bonfield et al. NAR 1995 v.23 p. 992, Miller et al. J. Comput. Biol. 1994 v.1 p. 257). The material to be analyzed is prepared for the sequencing reaction by breaking it down into fragments of preferably 50 to 1000 bp in length. Each fragment is then provided with a primer binding site and a primer. This mixture of different DNA fragments is now fixed on a flat surface. The unbound DNA fragments are removed by a washing step. The sequencing reaction is then carried out on the entire reaction surface. To reconstruct a 1 Mb long DNA sequence, the sequences of NSKFs should preferably be longer than 300 NTs, on average approx. 400 bp. Since only one marked NT * is installed per cycle, at least 400 cycles are required for sequencing.

Insgesamt ist zur Rekonstruktion der ursprünglichen Sequenz die etwa 10- bis 100-fache Menge an Rohsequenzen erforderlich, d. h. 10 bis 100 Mb. Bei einer durchschnittlichen Sequenzlänge von ca. 400 bp pro NSKF benötigt man entsprechend 25.000 bis 250.000 DNA- Fragmente, um mehr als 99,995% der Gesamtsequenz abzudecken. Overall, the original is to be reconstructed Sequence approximately 10 to 100 times the amount of raw sequences required, d. H. 10 to 100 Mb average sequence length of approx. 400 bp per NSKF you need 25,000 to 250,000 DNA Fragments to more than 99.995% of the total sequence cover.

Die ermittelten NSKF-Sequenzen stellen eine Population von überlappenden Teilsequenzen dar, die sich mit kommerziell erhältlichen Programmen zur Gesamtsequenz der NSK zusammenfügen lassen ("Automated DNA sequencing and analysis" S. 231 ff. 1994 M. Adams et al. Academic Press, Huang et al. Genom Res. 1999 v.9 S. 868, Huang Genomics 1996 v.33 S. 21, Bonfield et al. NAR 1995 v.23 S. 4992, Miller et al. J. Comput.Biol. 1994 v.1 S. 257). The NSKF sequences determined represent a population of overlapping partial sequences that deal with commercial programs available for the overall sequence of the NSK put together ("Automated DNA sequencing and analysis "pp. 231 ff. 1994 M. Adams et al. Academic Press, Huang et al. Genom Res. 1999 v.9 p. 868, Huang Genomics 1996 v.33 p. 21, Bonfield et al. NAR 1995 v.23 p. 4992, Miller et al. J. Comput.Biol. 1994 v.1 p. 257).

1A-2Sequenzierung der Genprodukte am Beispiel der cDNA-Sequenzierung1A-2 sequencing of the gene products using the example of cDNA sequencing

In einer bevorzugten Ausführungsform können statt einer Sequenz mehrere Sequenzen in einem Ansatz analysiert werden. Die ursprünglichen Sequenzen können aus den gewonnen Rohdaten z. B. nach dem Schrotschuß-Prinzip rekonstruiert werden. In a preferred embodiment, instead of one Sequence analyzed multiple sequences in one approach become. The original sequences can be found in the obtained raw data e.g. B. according to the shotgun principle be reconstructed.

Zunächst werden NSKFs erzeugt. Man kann z. B. mRNA in eine doppelsträngige cDNA überführen und diese cDNA mit Ultraschall fragmentieren. Anschließend werden diese NSKFs mit einer Primerbindungsstelle versehen, denaturiert, immobilisiert und mit einem Primer hybridisiert. Zu beachten ist bei dieser Variante der Probenvorbereitung, dass die cDNA-Moleküle unvollständige mRNA-Sequenzen darstellen können (Method in Enzymology 1999, v.303, S. 19 und andere Artikel in diesem Band, "cDNA library protocols" 1997 Humana Press). First, NSKFs are created. You can e.g. B. mRNA in a transfer double-stranded cDNA and this cDNA with Fragment ultrasound. Then these NSKFs provided with a primer binding site, denatured, immobilized and hybridized with a primer. To note with this variant of sample preparation, that the cDNA molecules have incomplete mRNA sequences (Method in Enzymology 1999, v.303, p. 19 and other articles in this volume, "cDNA library protocols "1997 Humana Press).

Eine andere Möglichkeit bei der Generierung einzelsträngiger NSKFs von mRNA besteht in der reversen Transkription der mRNA mit randomisierten Primern. Dabei werden viele relativ kurze antisense DNA-Fragmente gebildet (Zhang-J et al. Biochem. J. 1999 v.337 S. 231, Ledbetter et al. J. Biol.Chem. 1994 v.269 S. 31544, Kolls et al. Anal.Biochem. 1993 v.208 S. 264, Decraene et al. Biotechniques 1999 v.27 S. 962). Diese Fragmente können anschließend mit einer Primerbindungstelle versehen werden (s. o). Weitere Schritte entsprechen oben beschriebenen Vorgängen. Mit dieser Methode können komplette mRNA- Sequenzen (vom 5'- bis zum 3'-Ende) analysiert werden, da die randomisierten Primer über die gesamte Länge der mRNA binden. Another way of generating single-stranded NSKFs of mRNA consists of the reverse Transcription of the mRNA with randomized primers. there are many relatively short antisense DNA fragments formed (Zhang-J et al. Biochem. J. 1999 v.337 p. 231, Ledbetter et al. J. Biol. Chem. 1994 v.269 p. 31544, Kolls et al. Anal. 1993 v.208 p. 264, Decraene et al. Biotechniques 1999 v.27 p. 962). These fragments can then be provided with a primer binding site (see above). Further steps correspond to those described above Operations. With this method, complete mRNA Sequences (from the 5 'to the 3' end) can be analyzed because the randomized primers over the entire length of the mRNA tie.

Immobilisierte NSKFs werden mit einer der oben angeführten Ausführungsformen der Sequenzierung analysiert. Da mRNA- Sequenzen wesentlich weniger repetitive Sequenzen aufweisen als z. B. genomische DNA, kann die Anzahl der detektierten Signale der eingebauten NTs* von einem NSKF geringer als 300 sein und liegt vorzugsweise zwischen 20 und 1000. Die Anzahl der NSKFs, die analysiert werden müssen, errechnet sich nach denselben Prinzipien wie bei einer Schrotschuß-Rekonstruktion einer langen Sequenz. Immobilized NSKFs are listed with one of the above Embodiments of sequencing analyzed. Because mRNA Sequences much less repetitive sequences have as z. B. genomic DNA, the number of detected signals of the installed NTs * from an NSKF be less than 300 and is preferably between 20 and 1000. The number of NSKFs that are analyzed must be calculated according to the same principles as in a shot shot reconstruction of a long sequence.

Aus NSKF-Sequenzen werden nach den Prinzipien des Schrotschuß-Verfahrens die ursprünglichen Gensequenzen rekonstruiert. NSKF sequences are made according to the principles of Shotgun procedure the original gene sequences reconstructed.

Diese Methode erlaubt die gleichzeitige Sequenzierung von vielen mRNAs ohne vorherige Klonierung. This method allows the sequencing of many mRNAs without prior cloning.

1B. Analyse von Sequenzvarianten1B. Analysis of sequence variants

Die Bestätigung einer bereits bekannten Sequenz oder der Nachweis von Varianten dieser Sequenz stellt sehr viel geringere Ansprüche an die Länge und Redundanz der ermittelten NSKF-Sequenzen. Auch die Sequenzbearbeitung ist in diesem Fall einfacher. Die Vollsequenz braucht nicht neu rekonstruiert zu werden. Die NSKF-Sequenzen werden vielmehr mit Hilfe eines kommerziell erhältlichen Programms der Vollsequenz zugeordnet und eventuelle Abweichungen detektiert. Einem solchen Programm kann z. B. BLAST oder FASTA Algorithmus zugrunde liegen ("Introduction to computational Biology" 1995 M.S. Waterman Chapman & Hall). Confirmation of an already known sequence or the Detection of variants of this sequence represents a great deal lower demands on the length and redundancy of the determined NSKF sequences. Sequence editing too is easier in this case. The full sequence needs not to be reconstructed. The NSKF sequences are rather using a commercially available Program assigned to the full sequence and any Deviations detected. Such a program can e.g. B. BLAST or FASTA algorithm ("Introduction to computational Biology" 1995 M.S. Waterman Chapman & Hall).

Die zu analysierende Sequenz wird mit einer der oben genannten Methoden in NSKFs überführt. Diese NSKFs werden mit dem erfindungsgemäßen Verfahren sequenziert, wobei man sowohl einen einheitlichen Primer und eine einheitliche Primerbindungsstelle als auch unterschiedliche, sequenzspezifische Primer und natürliche, in der zu untersuchenden Gesamtsequenz vorkommende Primerbindungsstellen verwenden kann. Anschließend werden die ermittelten Sequenzen von NSKFs nicht nach dem Schrotschuß-Verfahren zusammengesetzt, sondern mit der Referenzsequenz verglichen und auf diese Weise ihren Positionen in der Vollsequenz zugeordnet. Dabei kann es sich um genomische oder cDNA-Sequenzen handeln. The sequence to be analyzed is one of the above mentioned methods in NSKFs. These NSKFs will sequenced with the inventive method, wherein one both a uniform primer and a uniform Primer binding site as well as different, sequence specific primers and natural ones in which to investigating overall sequence occurring Can use primer binding sites. Then be the sequences of NSKFs not determined after Shotgun procedure, but with the Reference sequence compared and in this way their positions in assigned to the full sequence. It can be act genomic or cDNA sequences.

Im Gegensatz zu einer Rekonstruktion nach dem Schrotschuß- Verfahren braucht man für die Analyse einer Sequenzvariante erheblich weniger Rohsequenzdaten. So kann die 5- bis 10- fache Rohsequenzmenge ausreichend für die Wiederherstellung einer neuen Variante einer Vollsequenz sein. Mit dem Schrotschuß-Verfahren wird für eine Wiederherstellung eine 10- bis 100-fache Menge an Rohsequenzen benötigt ("Automated DNA sequencing and analysis" S. 231 ff. 1994 M. Adams et al. Academic Press, Huang et al. Genom Res. 1999 v.9 S. 868, Huang Genomics 1996 v.33 S. 21, Bonfield et al. NAR 1995 v.23 S. 4992, Miller et al. J. Comput.Biol. 1994 v.1 S. 257). In contrast to a reconstruction after the shotgun One needs procedures for the analysis of one Sequence variant significantly less raw sequence data. So can 5 to 10 times the raw sequence quantity sufficient for the Restoration of a new variant of a full sequence his. With the shotgun process is for a Restore a 10- to 100-fold amount of Raw sequences required ("Automated DNA sequencing and analysis "pp. 231 ff. 1994 M. Adams et al. Academic Press, Huang et al. Genom Res. 1999 v.9 p. 868, Huang Genomics  1996 v.33 p. 21, Bonfield et al. NAR 1995 v.23 p. 4992, Miller et al. J. Comput.Biol. 1994 v.1 p. 257).

Die Länge der ermittelten NSKF-Sequenzen soll für eine eindeutige Zuordnung zu einer bestimmten Position in der Referenzsequenz ausreichend sein, so können z. B. bereits Sequenzen mit einer Länge von 20 NTs (z. B. aus nicht repetitiven Abschnitten im menschlichen Genom) eindeutig identifiziert werden. Für die Vergleichsanalyse der repetitiven Abschnitte werden längere Sequenzen benötigt. Die genaue Länge der Sequenzen hängt dabei von der Aufgabenstellung ab. Vorzugsweise beträgt die Länge der ermittelten NSKF-Sequenzen bei der Analyse von nicht repetitiven Abschnitten mehr als 20 NTs. Für die Analyse der repetitiven Abschnitte liegt sie vorzugsweise über 500 NTs. The length of the NSKF sequences determined should be for one unique assignment to a specific position in the Reference sequence should be sufficient, z. B. already Sequences with a length of 20 NTs (e.g. from not repetitive sections in the human genome) be identified. For the comparative analysis of the Repetitive sections require longer sequences. The the exact length of the sequences depends on the Task from. The length is preferably determined NSKF sequences when analyzing non-repetitive Sections more than 20 NTs. For the analysis of the repetitive sections it is preferably over 500 NTs.

Die Zielsetzungen bei der Sequenzierung neuer Varianten einer bereits bekannten Vollsequenz können sehr unterschiedlich sein. Meist wird ein Vergleich der neu ermittelten Sequenz mit der bekannten Vollsequenz/Referenzsequenz angestrebt. Dabei können die beiden Sequenzen aus evolutionär unterschiedlich weit auseinanderliegenden Spezies stammen. Verschiedene Parameter der Zusammensetzung dieser beiden Sequenzen können verglichen werden. Als Beispiele für eine solche Analyse dienen: Mutations- oder Polymorphismusanalysen und die Analyse von alternativ gespleißten Genprodukten. The objectives when sequencing new variants an already known full sequence can be very be different. Usually a comparison of the new determined sequence with the known Full sequence / reference sequence sought. The two sequences from evolutionarily different distances separate species. Different parameters the composition of these two sequences be compared. As examples of such an analysis serve: mutation or polymorphism analysis and the Analysis of alternative spliced gene products.

Nachfolgend soll schematisch und beispielhaft ein Vergleich der zu untersuchenden Sequenz mit einer Referenzsequenz ohne vorherige Rekonstruktion der zu analysierenden Sequenz betrachtet werden. Ein solcher Vergleich kann z. B. zur Mutations- oder SNP-Analyse dienen. The following is a schematic and exemplary Comparison of the sequence to be examined with a Reference sequence without prior reconstruction of the analyzing sequence can be considered. Such a Comparison can e.g. B. for mutation or SNP analysis serve.

1B-11B-1

Eine lange, zu analysierende Sequenz, z. B. 1 Mb, wird in NSKFs mit einer der oben genannten Methode geteilt. Diese NSKFs werden unter Verwendung einheitlicher Primer mit dem erfindungsgemäßen Verfahren sequenziert. Die ermittelten Sequenzen von jedem einzelnen NSKF werden direkt mit der Referenzsequenz verglichen. Die Referenzsequenz dient dabei als Grundlage für die Zuordnung ermittelter NSKF- Sequenzen, so dass die aufwendige Rekonstruktion nach dem Schrotschuß-Verfahren entfällt. Vorzugsweise beträgt die Länge der ermittelten NSKF-Sequenzen bei der Analyse von nicht repetitiven Abschnitten mehr als 20 NTs. Für die Analyse der repetitiven Abschnitte liegt sie vorzugsweise über 500 NTs. Die Anzahl der zu analysierenden NSKFs richtet sich dabei nach der Gesamtlänge der zu untersuchenden Sequenz, der durchschnittlichen Länge der NSKF-Sequenzen und der notwendigen Genauigkeit der Sequenzierung. Bei einer durchschnittlichen Länge der ermittelten NSKF-Sequenz von 100 NTs, einer Gesamtlänge der zu untersuchenden Sequenz von 1 Mb und einer Genauigkeit, die der Rohsequenzermittlung entspricht (d. h. jede Stelle soll möglichst nur einmal sequenziert werden) benötigt man z. B. die ca. 5-fache Menge an Rohsequenzen, d. h. 5 Mb, weil die Verteilung der NSKFs über die Gesamtsequenz zufällig erfolgt. Insgesamt müssen 50.000 NSKFs analysiert werden, um mehr als 99% der Gesamtstrecke abzudecken. A long sequence to be analyzed, e.g. B. 1 Mb, is in NSKFs shared using one of the above methods. This NSKFs are primed using the same primer sequenced inventive methods. The determined Sequences from each individual NSKF are linked directly to the Reference sequence compared. The reference sequence serves thereby as the basis for the assignment of determined NSKF Sequences so that the elaborate reconstruction after the Shotgun procedure is omitted. The is preferably Length of the determined NSKF sequences when analyzing non-repetitive sections over 20 NTs. For the Analysis of the repetitive sections is preferable over 500 NTs. The number of NSKFs to be analyzed depends on the total length of the investigating sequence, the average length of the NSKF sequences and the necessary accuracy of the Sequencing. With an average length of determined NSKF sequence of 100 NTs, a total length the sequence of 1 Mb and one to be examined Accuracy that corresponds to raw sequence determination (i.e. each position should be sequenced only once if possible) you need z. B. about 5 times the amount of raw sequences, d. H. 5 Mb because the distribution of NSKFs over the Overall sequence is done randomly. A total of 50,000 NSKFs are analyzed to cover more than 99% of the total distance cover.

Anschließend werden die ermittelten NSKF-Sequenzen mit Hilfe eines kommerziell erhältlichen Programms der Vollsequenz zugeordnet und eventuelle Abweichungen detektiert. Einem solchen Programm kann z. B. BLAST oder FASTA Algorithmus zugrunde liegen ("Introduction to computational Biology" 1995 M.S. Waterman Chapman & Hall). Then the NSKF sequences determined are included Using a commercially available program from Full sequence assigned and any deviations detected. Such a program can e.g. B. BLAST or FASTA algorithm ("Introduction to computational biology "1995 M.S. Waterman Chapman & Hall).

Beispiel 2Example 2

Sequenzanalyse mit 2 markierten NTs* und 2 unmarkierten NTs (2NTs*/2NTs-Methode). Sequence analysis with 2 marked NTs * and 2 unmarked NTs (2NTs * / 2NTs method).

In einer anderen Ausführungsform werden für die Analyse der Sequenzen 2 modifizierte NTs* und 2 unmodifizierte NTs eingesetzt. In another embodiment, the analysis of the Sequences 2 modified NTs * and 2 unmodified NTs used.

Diese Methode eignet sich besonders zur Analyse der Sequenzvarianten (z. B. SNP- oder Mutationsanalyse) und setzt die Kenntnis einer Referenzsequenz voraus. Dabei wird die Vollsequenz nicht rekonstruiert, sondern die ermittelten Sequenzen werden mit Hilfe eines Programms der Referenzsequenz zugeordnet und eventuelle Abweichungen registriert. Einem solchen Programm kann z. B. der BLAST oder FASTA Algorithmus zugrunde liegen ("Introduction to computational Biology" 1995 M.S. Waterman Chapman & Hall). This method is particularly suitable for the analysis of Sequence variants (e.g. SNP or mutation analysis) and sets the Knowledge of a reference sequence beforehand. The Full sequence not reconstructed, but the determined one Sequences are created using a program of the reference sequence assigned and any deviations registered. a such a program can e.g. B. the BLAST or FASTA algorithm underlying ("Introduction to computational Biology" 1995 M.S. Waterman Chapman & Hall).

Diese Ausführungsform beruht auf dem Prinzip, dass eine Abfolge aus 2 Signalen (markierte NT*s) genügend Informationen zur Identifizierung einer Sequenz enthalten kann. Die ermittelte Sequenz wird mit der Referenzsequenz verglichen und einer bestimmten Position zugeordnet, z. B.:
ACCAAAACACCC - ermittelte Sequenz (dCTP* und dATP* sind markiert)
ATCATCGTTCGAAATATCGATCGCCTGATGCC - Referenzsequenz
A-C---C-AAA-A-C-A-C-CC (zugeordnete ermittelte Sequenz) ATCATCGTTCGAAATATCGATCGCCTGATGCC (Referenzsequenz)
This embodiment is based on the principle that a sequence of 2 signals (marked NT * s) can contain enough information to identify a sequence. The determined sequence is compared with the reference sequence and assigned to a specific position, e.g. B .:
ACCAAAACACCC - determined sequence (dCTP * and dATP * are marked)
ATCATCGTTCGAAATATCGATCGCCTGATGCC - reference sequence
AC --- C-AAA-ACAC-CC (assigned determined sequence) ATCATCGTTCGAAATATCGATCGCCTGATGCC (reference sequence)

Die unbekannte, zu analysierende Variante der Referenzsequenz wird wie oben beschrieben zur Sequenzierung vorbereitet (NSK wird in NSKFs überführt, diese werden mit PBS ligiert, anschließend mit einem Primer hybridisiert und auf Reaktionsoberfläche immobilisiert). Auf diese Weise vorbereitete NSKFs werden mit 2NTs*/2NTs-Methode sequenziert. Man erhält NSKF-Sequenzen, wobei jede NSKF-Sequenz eine Abfolge aus 2NTs* darstellt. Um eine eindeutige Zuordnung der ermittelten Sequenz zu einer bekannten Referenzsequenz zu ermöglichen, muß diese Abfolge lang genug sein. Vorzugsweise beträgt die Länge der ermittelten NSKF-Sequenzen mehr als 40 NT*s. Da 2 markierte NTs* nur einen Teil der Sequenz darstellen, ist die Gesamtlänge des synthetisierten komplementären Strangs ca. doppelt so lang, wie die Abfolge der detektierten NTs* (bei 40 detektierten NTs* beträgt die Gesamtlänge z. B. durchschnittlich 80 NTs). The unknown variant of the reference sequence to be analyzed is prepared for sequencing as described above (NSK is transferred to NSKFs, these are ligated with PBS, then hybridized with a primer and on Reaction surface immobilized). In this way prepared NSKFs are sequenced using the 2NTs * / 2NTs method. NSKF sequences are obtained, each NSKF sequence being one Sequence of 2NTs * represents. In order to clearly assign the determined sequence to a known reference sequence enable, this sequence must be long enough. Preferably the length of the NSKF sequences determined is more than 40 NT * s. Since 2 marked NTs * only part of the sequence represent the total length of the synthesized complementary strand about twice as long as the sequence of the detected NTs * (for 40 detected NTs * the Total length z. B. on average 80 NTs).

Zur Synthese eines komplementären Stranges werden 4 Nukleotide benötigt. Da die mit einem Fluoreszenzfarbstoff markierten NTs* in der vorliegenden Erfindung als Semiterminatoren auftreten, d. h. die Termination ausschließlich bei Verfügbarkeit modifizierter NTs* auftritt, müssen unmodifizierte NTs in einem zusätzlichen Schritt in jedem Zyklus in die Reaktion zugegeben werden. Die genaue Position dieses Schrittes in dem Zyklus kann variieren. Wichtig dabei ist, dass die markierten NTs* und die unmodifizierte NTs getrennt verwendet werden. 4 nucleotides are used to synthesize a complementary strand needed. Because those marked with a fluorescent dye NTs * in the present invention as semiterminators occur d. H. the termination only at Availability of modified NTs * occurs unmodified NTs in an additional step in each Cycle can be added to the reaction. The exact position this step in the cycle can vary. Important here is that the marked NTs * and the unmodified NTs can be used separately.

Ein Zyklus bei dieser Ausführungsform kann beispielhaft folgendermaßen aussehen:

  • a) Zugabe einer Lösung mit modifizierten NTs* und Polymerasen auf die Oberfläche mit den bereitgestellten NSKFs
  • b) Inkubation der immobilisierten Nukleinsäureketten mit dieser Lösung unter Bedingungen, die zur Verlängerung der komplementären Stränge um ein NT geeignet sind
  • c) Waschen
  • d) Detektion der Signale von einzelnen, modifizierten und in die den NSKFs komplementären neusynthetisierten Strängen eingebauten NTs*-Molekülen
  • e) Entfernung der Markierung und der terminierenden Gruppe bei den eingebauten Nukleotiden
  • f) Waschen
  • g) Zugabe von 2 unmodifizierten NTs und Polymerasen
  • h) Waschen.
A cycle in this embodiment may look as follows, for example:
  • a) Add a solution with modified NTs * and polymerases to the surface with the NSKFs provided
  • b) Incubation of the immobilized nucleic acid chains with this solution under conditions which are suitable for extending the complementary strands by one NT
  • c) washing
  • d) Detection of the signals from individual, modified NTs * molecules built into the newly synthesized strands complementary to the NSKFs
  • e) Removal of the label and the terminating group in the built-in nucleotides
  • f) washing
  • g) addition of 2 unmodified NTs and polymerases
  • h) washing.

Diese 2NT*s/2NTs-Methode eignet sich beispielsweise für die SNP-Analyse einer genomischen Strecke eines Gens oder für doppelsträngige cDNA-Analyse. Ihr liegen folgende Prinzipien zugrunde:

  • 1. Die genetische Information in jedem der beiden komplementären DNA-Stränge ist identisch, so dass fehlende Informationen in einem Strang durch die Information aus dem anderen Strang vervollständingt werden können.
  • 2. Durch bestimmte Paarkombinationen markierter NTs* kann man mit nur 2 NTs* die komplette Information aus einer doppelsträngigen DNA erhalten. Zulässige Kombinationen von NT*s bei dieser Ausführungsform sind: A*C*; A*G*; C*T*/C*U*; G*T*/G*U*. Bevorzugt wird die Kombination C* und U*.
  • 3. Als Grundlage der Analyse dient eine bereits bekannte Referenzsequenz.
  • 4. Die NSKFs stammen von beiden Strängen der zu analysierenden NSK und die ermittelten NSKF-Sequenzen decken die gesamte Länge der zu analysierenden Sequenz ab.
This 2NT * s / 2NTs method is suitable, for example, for the SNP analysis of a genomic stretch of a gene or for double-stranded cDNA analysis. It is based on the following principles:
  • 1. The genetic information in each of the two complementary DNA strands is identical, so that missing information in one strand can be completed by the information from the other strand.
  • 2. By means of certain combinations of pairs of labeled NTs *, the complete information can be obtained from a double-stranded DNA with only 2 NTs *. Permissible combinations of NT * s in this embodiment are: A * C *; A * G *; C * T * / C * U *; G * T * / G * U *. The combination C * and U * is preferred.
  • 3. An already known reference sequence serves as the basis for the analysis.
  • 4. The NSKFs come from both strands of the NSK to be analyzed and the NSKF sequences determined cover the entire length of the sequence to be analyzed.

Am folgenden Beispiel wird erklärt, wie die Information aus einem doppelsträngigen DNA-Fragment mit nur 2 markierten NTs* gewonnen wird und wie die Unterschiede zur ursprünglichen oder nicht mutierten Sequenz (Referenzsequenz/Vergleichsequenz) festgestellt werden können. Sequenzen unter (1) und (2) sind bis auf eine Stelle identisch (unterstrichen). A* und C* sind markiert. The following example explains how the information is made up a double-stranded DNA fragment with only 2 labeled NTs * is won and how the differences to the original or non-mutated sequence (reference sequence / comparison sequence) can be determined. Sequences under (1) and (2) are identical except for one place (underlined). A * and C * are marked.

1) zu prüfende Sequenz1) Sequence to be checked

Die zu prüfende Sequenz wird mit 2NT*s/2NTs-Methode sequenziert, so dass eine Population an NSKF-Sequenzen (ermittelte NSKF-Sequenzen(n)) entsteht. Diese ermittelten NSKF-Sequenzen enthalten Information von jedem Strang:
5'A-C---C-AAA-A-C-A-C-CC3' - ermittelte NSKF-Sequenz(i)
5'ATCGTTCGAAATATCGATCGCCTG3'
3'TAGCAAGCTTTATAGCTAGCGGAC5'
3' A-CAA-C---A-A-C-A-C---C5' - ermittelte NSKF-Sequenz(i+1)
The sequence to be checked is sequenced using the 2NT * s / 2NTs method, so that a population of NSKF sequences (determined NSKF sequences (n)) is formed. The NSKF sequences determined contain information from each strand:
5'A- C --- C-AAA-ACAC-CC3 '- NSKF sequence determined (i)
5'AT C GTTCGAAATATCGATCGCCTG3 '
3'TA G CAAGCTTTATAGCTAGCGGAC5 '
3 'A-CAA-C --- AACAC --- C5' - NSKF sequence determined (i + 1)

2) Vergleichsequenz2) comparison sequence

Zur Analyse ist eine Vergleichsequenz (Referenzsequenz) erforderlich:
5'ATTGTTCGAAATATCGATCGCCTG3'
3'TAACAAGCTTTATAGCTAGCGGAC5'
A comparison sequence (reference sequence) is required for analysis:
5'AT T GTTCGAAATATCGATCGCCTG3 '
3'TA A CAAGCTTTATAGCTAGCGGAC5 '

3) Vergleichsequenz mit angepaßten ermittelten NSKF-Sequenzen3) Comparison sequence with adapted NSKF sequences determined

Mit Hilfe eines Programms werden ermittelte NSKF-Sequenzen bestimmten Stellen in der Vergleichsequenz zugeordnet und eventuelle Abweichungen detektiert:


With the help of a program, determined NSKF sequences are assigned to specific points in the comparison sequence and possible deviations are detected:


Mit dieser Ausführungsform kann man eine doppelsträngige Nukleinsäure auf SNP oder Mutationen untersuchen. Dabei werden die ermittelten NSKF-Sequenzen mit einer Referenzsequenz verglichen. Die Grundregeln des Vergleichs einer Teilsequenz und einer kompletten Sequenz bei der Analyse mit nur 2 markierten NTs unterscheiden sich nicht prinzipiell von denen, die bei dem Vergleich der Sequenzen anhand aller 4 markierten NTs* gelten. Näheres s. Sequenzvergleich bei Mutationsanalyse und SNP-Analyse mit 4 NTs* (Beispiel 1B). With this embodiment, you can make a double-stranded Examine nucleic acid for SNP or mutations. In doing so the NSKF sequences determined with a reference sequence compared. The basic rules for comparing a partial sequence and a complete sequence in the analysis with only 2 marked NTs do not differ fundamentally from those those marked when comparing the sequences using all 4 NTs * apply. For more information see Sequence comparison in mutation analysis and SNP analysis with 4 NTs * (Example 1B).

Beispiel 3Example 3 Analyse der GenexpressionAnalysis of gene expression

Die Grundprinzipien der Sequenzierungsreaktion bei der Genexpressionsanalyse entsprechen denen der Sequenzierungsreaktion langer NSKs (Fig. 7). Die Grundprinzipien zur Durchführung eines Reaktionszyklus (die Wahl der NT*-Struktur, der Polymerase, der Reaktionsbedingungen für die NT*-Einbaureaktion und die Abspaltungsreaktion), sowie zur Detektion der Signale von eingebauten NT*, entsprechen denen im Verfahren zur Sequenzierung langer NSKs. Die wesentlichen Unterschiede zwischen beiden Verfahren liegen in der Materialauswahl und -Vorbereitung und in der Verarbeitung der gewonnenen Daten. The basic principles of the sequencing reaction in gene expression analysis correspond to those of the sequencing reaction of long NSKs ( Fig. 7). The basic principles for carrying out a reaction cycle (the choice of the NT * structure, the polymerase, the reaction conditions for the NT * incorporation reaction and the cleavage reaction) and for the detection of the signals from built-in NT * correspond to those in the process for sequencing long NSKs. The main differences between the two processes lie in the selection and preparation of materials and the processing of the data obtained.

Auswahl des MaterialsChoice of material

Genprodukte können von verschiedenen biologischen Objekten stammen, so z. B. von einzelnen Zellen, Zellpopulationen, einem Gewebe oder von kompletten Organismen. Auch biologische Flüssigkeiten wie Blut, Sputum oder Liquor können als Quelle der Genprodukte dienen. Die Methoden zur Gewinnung der Genprodukte aus den verschiedenen biologischen Objekten sind bespielsweise folgenden Literaturquellen zu entnehmen: "Molecular cloning" 1989, Ed. Maniatis, Cold Spring Harbor Laboratory, "Method in Enzymology" 1999, v303, "cDNA library protocols" 1997, Ed. I.G. Cowell, Humana Press Inc. Gene products can come from different biological objects originate, e.g. B. of individual cells, cell populations, a tissue or entire organisms. Even biological Liquids such as blood, sputum or cerebrospinal fluid can be used as a source serve the gene products. The methods of extracting the There are gene products from the various biological objects For example, the following literature sources can be found: "Molecular cloning" 1989, Ed. Maniatis, Cold Spring Harbor Laboratory, "Method in Enzymology" 1999, v303, "cDNA library protocols "1997, Ed. I.G. Cowell, Humana Press Inc.

Es kann sowohl die Gesamtheit der isolierten Genprodukte als auch ein durch eine Vorselektion ausgewählter Teil davon in die Sequenzierungsreaktion eingesetzt werden. Durch Vorselektion kann man die Menge der zu analysierenden Genprodukte reduzieren. Die Vorselektion kann beispielsweise durch molekularbiologische Verfahren wie z. B. PCR- Amplifikation, Gel-Auftrennung oder Hybridisierung mit anderen Nukleinsäureketten erfolgen ("Molecular cloning" 1989, Ed. Maniatis, Cold Spring Harbor Laboratory, "Method in Enzymology" 1999, v303, "cDNA library protocols" 1997, Ed. I.G. Cowell, Humana Press Inc.) It can be both the entirety of the isolated gene products also a part of it selected by a preselection in the sequencing reaction can be used. By Preselection can be used to analyze the amount of Reduce gene products. The preselection can, for example by molecular biological methods such. B. PCR Amplification, gel separation or hybridization with other nucleic acid chains (molecular cloning) 1989, Ed. Maniatis, Cold Spring Harbor Laboratory, "Method in Enzymology "1999, v303," cDNA library protocols "1997, Ed. I. G. Cowell, Humana Press Inc.)

Vorzugsweise wird die Gesamtheit der Genprodukte als Ausgangsmaterial gewählt. Preferably, the entirety of the gene products as Starting material selected.

Vorbereitung des MaterialsPreparation of the material

Ziel der Vorbereitung des Materials ist es, aus dem Ausgangsmaterial an die Oberfläche gebundene, extensionsfähige Genprodukt-Primer-Komplexe zu bilden. Wobei pro Genprodukt maximal nur ein Primer binden sollte. The aim of preparing the material is from the Source material bound to the surface, capable of extension To form gene product-primer complexes. Whereby per gene product should only bind a maximum of one primer.

Primerbindungsstelle (PBS)Primer binding agency (PBS)

Jedes Genprodukt hat vorzugsweise nur eine Primerbindungsstelle. Each gene product preferably has only one Primer binding site.

Eine Primerbindungsstelle ist ein Sequenzabschnitt, der eine selektive Bindung des Primers an das Genprodukt ermöglichen soll. A primer binding site is a sequence section that contains a enable selective binding of the primer to the gene product should.

Als Primerbindungsstellen können Abschnitte in der Nukleinsäuresequenz dienen, die in den zu analysierenden Sequenzen natürlicherweise vorkommen (z. B. polyA-Strecken in mRNA). Eine Primerbindungsstelle kann auch zusätzlich in das Genprodukt eingeführt werden (Molecular cloning" 1989, Ed. Maniatis, Cold Spring Harbor Laboratory, "Method in Enzymology" 1999, v303, "cDNA library protocols" 1997, Ed. I.G. Cowell, Humana Press Inc.). Sections in the Nucleic acid sequence serve to be analyzed in the Sequences occur naturally (e.g. polyA stretches in mRNA). A primer binding site can also be added to the Gene product are introduced (Molecular cloning "1989, Ed. Maniatis, Cold Spring Harbor Laboratory, "Method in Enzymology "1999, v303," cDNA library protocols "1997, Ed. I. G. Cowell, Humana Press Inc.).

Aus Gründen der Vereinfachung der Analyse kann es wichtig sein, dass eine möglichst einheitliche Primerbindungsstelle in allen Genprodukten vorhanden ist. Dann können Primer mit einheitlicher Struktur in die Reaktion eingesetzt werden. Die Zusammensetzung der Primerbindungsstelle ist nicht eingeschränkt. Ihre Länge beträgt vorzugsweise zwischen 10 und 100 NTs. Die Primerbindungsstelle kann eine funktionelle Gruppe tragen, beispielsweise zur Bindung des Genprodukts an die Oberfläche. Diese funktionelle Gruppe kann z. B. eine Biotin- oder Digoxigenin-Gruppe sein. It may be important for the sake of simplifying the analysis be that a primer binding site as uniform as possible in all gene products are present. Then primers can be used uniform structure can be used in the reaction. The composition of the primer binding site is not limited. Their length is preferably between 10 and 100 NTs. The primer binding site can be a functional group wear, for example to bind the gene product to the Surface. This functional group can e.g. B. a biotin or digoxigenin group.

Als Beispiel für die Einführung einer Primerbindungsstelle in die Genprodukte wird das Nukleotid-Tailing von antisense cDNA- Fragmenten beschrieben. As an example for the introduction of a primer binding site in the gene products, the nucleotide tailing of antisense cDNA Fragments described.

Als erstes werden einzelsträngige cDNAs von mRNAs synthetisiert. Es resultiert eine Population an cDNA- Molekülen, die eine Kopie der mRNA-Population darstellen, sogenannte antisense-cDNA. (Molecular cloning" 1989, Ed. Maniatis, Cold Spring Harbor Laboratory, "Method in Enzymology" 1999, v303, "cDNA library protocols" 1997, Ed. I.G. Cowell, Humana Press Inc.). Mit einer terminalen Deoxynucleotidyltransferase kann man mehrere (z. B. zwischen 10 und 20) Nukleosid-monophosphate an das 3'-Ende dieser antisense cDNA anknüpfen, z. B. mehrere Adenosin-Monophosphate ((dA)n-Tail genannt). Das entstehende Fragment wird zur Bindung des Primers, in diesem Beispiel eines (dT)n-Primers, verwendet("Molecular cloning" 1989 J. Sambrook et al. Cold Spring Harbor Laborotary Press, "Method in Enzymology" 1999 v.303, S. 37-38). First, single-stranded cDNAs from mRNAs synthesized. The result is a population of cDNA Molecules that are a copy of the mRNA population so-called antisense cDNA. (Molecular cloning "1989, Ed. Maniatis, Cold Spring Harbor Laboratory, "Method in Enzymology "1999, v303," cDNA library protocols "1997, Ed. I. G. Cowell, Humana Press Inc.). With a terminal Deoxynucleotidyltransferase can be several (e.g. between 10 and 20) nucleoside monophosphates at the 3 'end of these Attach antisense cDNA, e.g. B. several adenosine monophosphates ((dA) called n-tail). The resulting fragment becomes Binding of the primer, in this example a (dT) n primer, used ("Molecular cloning" 1989 J. Sambrook et al. Cold Spring Harbor Laborotary Press, "Method in Enzymology" 1999 v.303, pp. 37-38).

Primer für die SequenzierungsreaktionPrimer for the sequencing reaction

Dieser hat die Funktion, den Start an einer einzigen Stelle des Genprodukts zu ermöglichen. Vorzugsweise bindet er an die Primerbindungsstelle im Genprodukt. Die Zusammensetzung und die Länge des Primers sind nicht eingeschränkt. Außer der Startfunktion kann der Primer auch andere Funktionen übernehmen, wie z. B. eine Verbindung der Genprodukt-Primer- Komplexe zur Reaktionsoberfläche zu schaffen. Primer sollten so an die Länge und Zusammensetzung der Primerbindungsstelle angepaßt werden, dass der Primer den Start der Sequenzierungsreaktion mit der jeweiligen Polymerase ermöglicht. This has the function of starting at a single point to enable the gene product. It preferably binds to the Primer binding site in the gene product. The composition and the length of the primer is not restricted. Except for the Start function, the primer can also perform other functions take over such. B. a compound of the gene product primer To create complexes to the reaction surface. Primers should be like this the length and composition of the primer binding site be adjusted so that the primer starts the Sequencing reaction with the respective polymerase enables.

Vorzugsweise beträgt die Länge des Primers zwischen 6 und 100 NTs, optimalerweise zwischen 15 und 30 NTs. Der Primer kann eine funktionelle Gruppe tragen, die beispielsweise zur Bindung des Primers an die Oberfläche dient, beispielsweise ist eine solche funktionelle Gruppe eine Biotingruppe (s. Abschnitt Immobilisierung). Sie soll die Sequenzierung nicht stören. Die Synthese eines solchen Primers kann z. B. mit dem DNA-Synthesizer 380 A Applied Biosystems ausgeführt werden oder aber als Auftragssynthese bei einem kommerziellen Anbieter, z. B. MWG-Biotech GmbH, Deutschland, erstellt werden. The length of the primer is preferably between 6 and 100 NTs, ideally between 15 and 30 NTs. The primer can carry a functional group that, for example, for Binding of the primer to the surface is used, for example is such a functional group a biotin group (see Immobilization section). It is not supposed to be sequencing to disturb. The synthesis of such a primer can e.g. B. with the DNA synthesizer 380 A Applied Biosystems or as a custom synthesis at a commercial Provider, e.g. B. MWG-Biotech GmbH, Germany.

Es können auch unterschiedliche Primer verwendet werden, ein definierter Primersatz, oder ein Primergemisch. Different primers can also be used defined primer set, or a primer mixture.

Der Primer kann vor der Hybridisierung an die zu analysierenden Fragmente auf der Oberfläche mit verschiedenen Techniken fixiert oder direkt auf der Oberfläche synthetisiert werden beispielsweise nach (McGall et al. US Patent 5412087, Barrett et al. US Patent 5482867, Mirzabekov et al. US Patent 5981734, "Microarray biochip technology" 2000 M. Schena Eaton Publishing, "DNA Microarrays" 1999 M. Schena Oxford University Press, Fodor et al. Science 1991 v.285 S .767, Timofeev et al. Nucleic Acid Research (NAR) 1996, v.24 S. 3142, Ghosh et al. NAR 1987 v.15 S. 5353, Gingeras et al. NAR 1987 v.15 S. 5373, Maskos et al. NAR 1992 v.20 S. 1679). The primer can be attached to the prior to hybridization analyzing fragments on the surface with different Techniques fixed or synthesized directly on the surface are described, for example, in (McGall et al. US Patent 5412087, Barrett et al. U.S. Patent 5482867, Mirzabekov et al. U.S. patent 5981734, "Microarray biochip technology" 2000 M. Schena Eaton Publishing, "DNA Microarrays" 1999 M. Schena Oxford University Press, Fodor et al. Science 1991 v.285 p. 767, Timofeev et al. Nucleic Acid Research (NAR) 1996, v.24 p. 3142, Ghosh et al. NAR 1987 v.15 p. 5353, Gingeras et al. NAR 1987 v.15 p. 5373, Maskos et al. NAR 1992 v.20 p. 1679).

Die Primer werden auf der Oberfläche in einer Dichte zwischen 10 bis 100 pro 100 µm2, 100 bis 10.000 pro 100 µm2, 10.000 bis 1.000.000 pro 100 µm2 oder größer als 1.000.000 pro 100 µm2 gebunden. The primers are bound on the surface in a density between 10 to 100 per 100 µm 2 , 100 to 10,000 per 100 µm 2 , 10,000 to 1,000,000 per 100 µm 2 or greater than 1,000,000 per 100 µm 2 .

Der Primer oder das Primergemisch wird mit Genprodukten unter Hybridisierungsbedingungen inkubiert, die ihn selektiv an die Primerbindungsstelle jedes Genprodukts binden lassen. Diese Primer-Hybridisierung (Annealing) kann vor (1), während (2) oder nach (3) der Bindung der Genprodukte an die Oberfläche erfolgen. Falls Genprodukte als doppelsträngige Nukleinsäuren vorliegen, werden sie vor der Hybridisierung durch Hitze denaturiert ("Molecular cloning" 1989 J. Sambrook et al. Cold Spring Harbor Laborotary Press). Die Optimierung der Hybridisierungsbedingungen hängt von der genauen Struktur der Primerbindungsstelle und des Primers ab und läßt sich nach Rychlik et al. (NAR 1990 v.18 S. 6409) berechnen. Im folgenden werden diese Hybridisierungsbedingungen als standardisierte Hybridisierungsbedingungen bezeichnet. The primer or the primer mixture is covered with gene products Hybridization conditions incubated that selectively to the Let the primer binding site of each gene product bind. This Primer hybridization (annealing) can be done before (1) while (2) or after (3) the binding of the gene products to the surface respectively. If gene products as double-stranded nucleic acids are present before the hybridization by heat denatured ("Molecular cloning" 1989 J. Sambrook et al. Cold Spring Harbor Laborotary Press). Optimizing the Hybridization conditions depend on the exact structure of the Primer binding site and the primer and can be Rychlik et al. (NAR 1990 v.18 p. 6409). Hereinafter these hybridization conditions are standardized Called hybridization conditions.

Falls das Ausgangsmaterial eine poly-A-Strecke oder eine polydA-Strecke aufweist (z. B. mRNA, sense cDNA oder antisense-cDNA mit (dA)n-Tail) kann man einen oligo-dT-Primer verwenden. Es kann allerdings auch ein Primergemisch bestehend aus 12 verschiedenen Primern mit folgender allgemeiner Struktur 5'(K)nMN3' verwendet werden. Wobei (n) zwischen 10 und 50 liegt, vorzugsweise zwischen 20 und 30. "K" steht für dT oder du, "M" und "N" stehen jeweils für dA, dT oder dU, dC, dG (z. B. 5'-dTdTdTdTdTdTdTdTdTdT10dTdTdTdTdTdTdTdTdTdT20dAdG-3'). Ein solches Primergemisch ermöglicht einen exakten Start der Sequenzierungsreaktion am Ende der polyA-Strecke oder der polydA-Strecke (geankerter Primer). If the starting material has a poly-A stretch or a polydA stretch (e.g. mRNA, sense cDNA or antisense cDNA with (dA) n -Tail), an oligo-dT primer can be used. However, a primer mixture consisting of 12 different primers with the following general structure 5 '(K) n MN3' can also be used. Where (n) is between 10 and 50, preferably between 20 and 30. "K" stands for dT or du, "M" and "N" each stand for dA, dT or dU, dC, dG (e.g. 5th '-dTdTdTdTdTdTdTdTdTdT 10 dTdTdTdTdTdTdTdTdTdT 20 dAdG-3'). Such a primer mixture enables an exact start of the sequencing reaction at the end of the polyA stretch or the polydA stretch (anchored primer).

Fixierung von Genprodukt-Primer-Komplexen an die Oberfläche (Bindung bzw. Immobilisierung von Genprodukten)Fixation of gene product-primer complexes to the surface (Binding or immobilization of gene products)

Ziel der Fixierung (Bindung, Immobilisierung) ist es, Genprodukt-Primer-Komplexe auf einer geeigneten planen Oberfläche in einer Art und Weise zu fixieren, dass eine zyklische enzymatische Sequenzierungsreaktion ablaufen kann. Dies kann beispielsweise durch Bindung des Primers (s. o.) oder des Genprodukts an die Oberfläche erfolgen. The aim of fixation (binding, immobilization) is to Gene product-primer complexes on a suitable plan To fix surface in a way that a cyclic enzymatic sequencing reaction can take place. This can be done, for example, by binding the primer (see above) or of the gene product to the surface.

Die Reihenfolge der Schritte bei der Bindung von Genprodukt- Primer-Komplexen kann variabel sein:

  • 1. Die Genprodukt-Primer-Komplexe können zunächst in einer Lösung durch Hybridisierung (Annealing) gebildet und anschließend an die Oberfläche gebunden werden.
  • 2. Primer können zunächst auf einer Oberfläche gebunden werden und Genprodukte anschließend an die gebundenen Primer hybridisiert werden, wobei Genprodukt-Primer- Komplexe entstehen (Genprodukte indirekt an die Oberfläche gebunden)
  • 3. Die Genprodukte können zunächst an die Oberfläche gebunden werden (Genprodukte direkt an die Oberfläche gebunden) und im anschließenden Schritt die Primer an die gebundenen Genprodukte hybridisiert werden, wobei Genprodukt-Primer-Komplexe entstehen.
The order of the steps in binding gene product-primer complexes can be variable:
  • 1. The gene product-primer complexes can first be formed in a solution by hybridization (annealing) and then bound to the surface.
  • 2. Primers can first be bound to a surface and gene products can then be hybridized to the bound primers, producing gene product-primer complexes (gene products indirectly bound to the surface)
  • 3. The gene products can first be bound to the surface (gene products bound directly to the surface) and in the subsequent step the primers can be hybridized to the bound gene products, producing gene product-primer complexes.

Die Immobilisierung der Genprodukte an die Oberfläche kann daher durch direkte oder indirekte Bindung erfolgen. The immobilization of the gene products to the surface can therefore done by direct or indirect binding.

Oberfläche und Reaktionsoberfläche sind in dieser Anmeldung als gleichwertige Begriffe aufzufassen, außer wenn explizit auf eine andere Bedeutung hingewiesen wird. Als Reaktionsoberfläche dient die Oberfläche einer festen Phase eines beliebigen Materials. Dieses Material ist vorzugsweise enzymatischen Reaktionen gegenüber inert und verursacht keine Störungen der Detektion. Silicon, Glas, Keramik, Kunststoff (z. B. Polycarbonate oder Polystyrole), Metall (Gold, Silber, oder Aluminium) oder beliebiges anderes Material, das diesen funktionalen Anforderungen genügt, kann verwendet werden. Vorzugsweise ist die Oberfläche nicht verformbar, denn sonst ist mit einer Verzerrung der Signale bei der wiederholten Detektion zu rechnen. Surface and reaction surface are in this application to be understood as equivalent terms, unless explicitly another meaning is pointed out. As Reaction surface serves the surface of a solid phase any material. This material is preferred enzymatic reactions to inert and causes none Detection disorders. Silicon, glass, ceramic, plastic (e.g. polycarbonates or polystyrenes), metal (gold, silver, or aluminum) or any other material that this functional requirements can be used. The surface is preferably not deformable, because otherwise is repeated with a distortion of the signals Detection.

Falls eine gelartige feste Phase (Oberfläche eines Gels) verwendet wird, so kann dieses Gel z. B. ein Agarose- oder Polyacrylamidgel sein. Das Gel ist vorzugsweise für Moleküle mit einer Molekularmasse unter 5000 Da frei passierbar (beispielsweise kann ein 1 bis 2% Agarose-Gel oder 5 bis 15% Polyacrylamid Gel verwendet werden). Eine solche Geloberfläche hat anderen festen Oberflächen gegenüber den Vorteil, dass es zu einer wesentlich geringeren unspezifischen Bindung von NT*s an die Oberfläche kommt. Durch die Bindung der Genprodukt- Primer-Komplexe auf der Oberfläche ist die Detektion der Fluoreszenzsignale von eingebauten NTs* möglich. Die Signale von freien NTs* werden nicht detektiert, weil sie nicht an das Material des Gels binden und somit nicht immobilisiert werden. Das Gel ist vorzugsweise auf einer festen Unterlage befestigt. Diese feste Unterlage kann Silicon, Glas, Keramik, Kunststoff (z. B. Polycarbonate oder Polystyrole), Metall (Gold, Silber, oder Aluminium) oder beliebiges anderes Material sein. If a gel-like solid phase (surface of a gel) is used, this gel z. B. an agarose or Be polyacrylamide gel. The gel is preferably for molecules with a molecular mass below 5000 Da freely passable (for example a 1 to 2% agarose gel or 5 to 15% Polyacrylamide gel can be used). Such a gel surface has the advantage over other solid surfaces that it to a significantly lower non-specific binding of NT * s comes to the surface. By binding the gene product Primer complexes on the surface is the detection of Fluorescence signals from built-in NTs * possible. The signals of free NTs * are not detected because they do not match the Bind the material of the gel and therefore not be immobilized. The gel is preferably attached to a solid surface. This solid base can be silicone, glass, ceramic, plastic (e.g. polycarbonates or polystyrenes), metal (gold, silver, or aluminum) or any other material.

Die Dicke des Gels beträgt vorzugsweise nicht mehr als 0,1 mm. Die Geldicke ist jedoch vorzugsweise größer als die einfache Tiefenschärfe des Objektivs, damit unspezifisch an die feste Unterlage gebundene NTs* nicht in die Fokusebene gelangen und damit detektiert werden. Wenn die Tiefenschärfe z. B. 0,3 µm beträgt, so liegt die Geldicke vorzugsweise zwischen 1 µm und 100 µm. Die Oberfläche kann als eine kontinuierliche Oberfläche oder als diskontinuierliche, aus einzelnen kleinen Bestandteilen (z. B. Agarose-Kügelchen) zusammengesetzte Oberfläche hergestellt werden. Die Reaktionsoberfläche muß groß genug sein, um die notwendige Anzahl der Genprodukte bei entsprechender Dichte binden zu können. Die Reaktionsoberfläche sollte vorzugsweise nicht größer als 20 cm2 sein. The thickness of the gel is preferably not more than 0.1 mm. However, the gel thickness is preferably greater than the simple depth of field of the lens, so that NTs * bound non-specifically to the solid base do not reach the focal plane and are therefore detected. If the depth of field e.g. B. 0.3 microns, the gel thickness is preferably between 1 micron and 100 microns. The surface can be produced as a continuous surface or as a discontinuous surface composed of individual small components (e.g. agarose beads). The reaction surface must be large enough to be able to bind the necessary number of gene products with the appropriate density. The reaction surface should preferably not be larger than 20 cm 2 .

Die verschiedenen Zyklusschritte erfordern einen Austausch der unterschiedlichen Reaktionslösungen über der Oberfläche. Die Reaktionsoberfläche ist vorzugsweise Bestandteil eines Reaktionsgefäßes. Das Reaktionsgefäß ist wiederum vorzugsweise Bestandteil einer Reaktionsapparatur mit Durchflußvorrichtung. Die Durchflußvorrichtung ermöglicht einen Austausch der Lösungen im Reaktionsgefäß. Der Austausch kann mit einer durch einen Computer gesteuerten Pumpvorrichtung oder manuell erfolgen. Wichtig dabei ist, dass die Oberfläche nicht austrocknet. Vorzugsweise beträgt das Volumen des Reaktionsgefäßes weniger als 50 µl. Idealerweise beträgt sein Volumen weniger als 1 µl. The different cycle steps require an exchange of the different reaction solutions above the surface. The Reaction surface is preferably part of a Reaction vessel. The reaction vessel is again preferred Part of a reaction apparatus with a flow device. The flow device allows an exchange of Solutions in the reaction vessel. The exchange can be done with a a computer controlled pumping device or manually respectively. It is important that the surface is not dry out. The volume of the Reaction vessel less than 50 µl. Ideally it is Volume less than 1 µl.

Falls die Fixierung der Genprodukt-Primer-Komplexe auf der Oberfläche über die Genprodukte erfolgt, kann dies beispielsweise durch die Bindung der Genprodukte an einem der beiden Ketten-Enden erfolgen. Dies kann durch entsprechende kovalente, affine oder andere Bindungen erreicht werden. Es sind viele Beispiele der Immobilisierung von Nukleinsäuren bekannt (McGall et al. US Patent 5412087, Nikiforov et al. US Patent 5610287, Barrett et al. US Patent 5482867, Mirzabekov et al. US Patent 5981734, "Microarray biochip technology" 2000 M. Schena Eaton Publishing, "DNA Microarrays" 1999 M. Schena Oxford University Press, Rasmussen et al. Analytical Biochemistry v.198, S.138, Allemand et al. Biophysical Journal 1997, v.73, S. 2064, Trabesinger et al. Analytical Chemistry 1999, v.71, S. 279, Osborne et al. Analytical Chemistry 2000, v.72, S. 3678, Timofeev et al. Nucleic Acid Research (NAR) 1996, v.24 S. 3142, Ghosh et al. NAR 1987 v.15 S. 5353, Gingeras et al. NAR 1987 v.15 S. 5373, Maskos et al. NAR 1992 v.20 S. 1679). Die Fixierung kann auch durch eine unspezifische Bindung, wie z. B. durch Austrocknung der Genprodukte enthaltenden Probe auf der planen Oberfläche erreicht werden. Die Genprodukte werden auf der Oberfläche in einer Dichte zwischen 10 und 100 pro 100 µm2, 100 bis 10.000 pro 100 µm2, 10.000 bis 1000.000 pro 100 µm2 gebunden. If the gene product-primer complexes are fixed on the surface via the gene products, this can be done, for example, by binding the gene products at one of the two chain ends. This can be achieved by appropriate covalent, affine or other bonds. Many examples of immobilization of nucleic acids are known (McGall et al. US Patent 5412087, Nikiforov et al. US Patent 5610287, Barrett et al. US Patent 5482867, Mirzabekov et al. US Patent 5981734, "Microarray biochip technology" 2000 M. Schena Eaton Publishing, "DNA Microarrays" 1999 M. Schena Oxford University Press, Rasmussen et al. Analytical Biochemistry v.198, p.138, Allemand et al. Biophysical Journal 1997, v.73, p. 2064, Trabesinger et al. Analytical Chemistry 1999, v.71, p. 279, Osborne et al. Analytical Chemistry 2000, v.72, p. 3678, Timofeev et al. Nucleic Acid Research (NAR) 1996, v.24 p. 3142, Ghosh et al NAR 1987 v.15 p. 5353, Gingeras et al. NAR 1987 v.15 p. 5373, Maskos et al. NAR 1992 v.20 p. 1679). The fixation can also be achieved by a non-specific binding, such as. B. can be achieved by drying the sample containing gene products on the flat surface. The gene products are bound on the surface in a density between 10 and 100 per 100 µm 2 , 100 to 10,000 per 100 µm 2 , 10,000 to 1000,000 per 100 µm 2 .

Die für die Detektion notwendige Dichte von extensionsfähigen Genprodukt-Primer-Komplexen beträgt ca. 10 bis 100 pro 100 µm2. Sie kann vor, während oder nach der Hybridisierung der Primer an die Genprodukte erreicht werden. The density of gene product-primer complexes which can be extended is necessary for the detection to be approximately 10 to 100 per 100 µm 2 . It can be achieved before, during or after hybridization of the primers to the gene products.

Beispielhaft werden im folgenden einige Methoden zur Bindung näher dargestellt:
In einer Ausführungsform erfolgt die Bindung der Genprodukt- Primer-Komplexe über Biotin-Avidin oder Biotin-Streptavidin- Bindung. Dabei wird Avidin oder Streptavidin auf der Oberfläche kovalent gebunden, das 5'-Ende des Primers ist mit Biotin modifiziert. Nach der Hybridisierung der modifizierten Primer mit den Genprodukten (in Lösung) werden diese auf der mit Avidin/Streptavidin beschichteten Oberfläche fixiert. Die Konzentration der mit Biotin markierten Genprodukt-Primer- Komplexe sowie die Zeit der Inkubation dieser Lösung mit der Oberfläche wird so gewählt, dass eine für die Sequenzierung geeignete Dichte erreicht wird.
Some binding methods are described in more detail below:
In one embodiment, the gene product-primer complexes are bound via biotin-avidin or biotin-streptavidin binding. Avidin or streptavidin is covalently bound on the surface, the 5 'end of the primer is modified with biotin. After hybridization of the modified primers with the gene products (in solution), these are fixed on the surface coated with avidin / streptavidin. The concentration of the gene product-primer complexes labeled with biotin and the time of incubation of this solution with the surface are selected so that a density suitable for sequencing is achieved.

In einer anderen Ausführungsform werden die für die Sequenzierungsreaktion geeigneten Primer vor der Sequenzierungsreaktion auf der Oberfläche mit geeigneten Methoden fixiert (s. o.). Die einzelsträngigen Genprodukte mit jeweils einer Primerbindungsstelle pro Genproduktmolekül werden damit unter Hybridisierungsbedingungen inkubiert (Annealing). Dabei binden sie an die fixierten Primer und werden dadurch an die Oberfläche gebunden (indirekte Bindung). Die Konzentration der einzelsträngigen Genprodukte und die Hybridisierungsparameter (z. B. Temperatur, Zeit, Puffer) werden so gewählt, dass man eine für die Sequenzierung geeignete Dichte von ca. 10 bis 100 extensionsfähigen Genprodukt-Primer-Komplexen pro 100 µm2 erreicht. Nach der Hybridisierung werden ungebundene Genprodukte durch einen Waschschritt entfernt. Bei dieser Ausführungsform wird eine Oberfläche mit einer hohen Primerdichte bevorzugt, z. B. ca. 1.000.000 Primer pro 100 µm2 oder noch höher, da die gewünschte Dichte an Genprodukt-Primer-Komplexen schneller erreicht wird, wobei die Genprodukte nur an einen Teil der Primer binden. In another embodiment, the primers suitable for the sequencing reaction are fixed on the surface using suitable methods before the sequencing reaction (see above). The single-stranded gene products, each with one primer binding site per gene product molecule, are thus incubated under hybridization conditions (annealing). They bind to the fixed primers and are thus bound to the surface (indirect binding). The concentration of the single-stranded gene products and the hybridization parameters (for example temperature, time, buffer) are selected so that a density of approx. 10 to 100 gene product-primer complexes capable of extension per 100 μm 2 suitable for sequencing is achieved. After hybridization, unbound gene products are removed by a washing step. In this embodiment, a surface with a high primer density is preferred, e.g. B. approx. 1,000,000 primers per 100 µm 2 or even higher, since the desired density of gene product-primer complexes is reached more quickly, the gene products binding only to a part of the primers.

In einer anderen Ausführungsform werden die Genprodukte an die Oberfläche direkt gebunden (s. o.) und anschließend mit Primern unter Hybridisierungsbedingungen inkubiert. Bei einer Dichte von ca. 10 bis 100 Genprodukte pro 100 µm2 wird man versuchen alle verfügbaren Genprodukte mit einem Primer zu versehen und für die Sequenzierugnsreaktion verfügbar zu machen. Dies kann durch hohe Primerkonzentration beispielsweise 1 bis 100 mmol/l erreicht werden. Bei einer höheren Dichte der fixierten Genprodukte auf der Oberfläche, beispielsweise 10.000 bis 1.000.000 pro 100 µm2, kann die für die optische Detektion notwendige Dichte der Genprodukt-Primer-Komplexe während der Primer-Hybridisierung erreicht werden. Dabei sind die Hybridisierungsbedingungen (z. B. Temperatur, Zeit, Puffer, Primerkonzentration) so zu wählen, dass die Primer nur an einen Teil der immobilisierten Genprodukte binden. In another embodiment, the gene products are bound directly to the surface (see above) and then incubated with primers under hybridization conditions. With a density of approx. 10 to 100 gene products per 100 µm 2 , one will try to provide all available gene products with a primer and to make them available for the sequencing reaction. This can be achieved by high primer concentration, for example 1 to 100 mmol / l. With a higher density of the fixed gene products on the surface, for example 10,000 to 1,000,000 per 100 μm 2 , the density of the gene product-primer complexes required for optical detection can be achieved during the primer hybridization. The hybridization conditions (e.g. temperature, time, buffer, primer concentration) must be selected so that the primers only bind to a part of the immobilized gene products.

Falls die Oberfläche einer festen Phase (z. B. Silikon oder Glas) zur Immobilisation verwendet wird, wird vorzugsweise eine Blockierungslösung auf die Oberfläche vor dem Schritt (a) in jedem Zyklus gebracht, die zur Vermeidung einer unspezifischen Adsorbtion von NTs* an der Oberfläche dient. Diese Bedingungen für eine Blockierlösung erfüllt beispielsweise eine Albuminlösung (BSA) mit einem pH-Wert zwischen 8 und 10. If the surface of a solid phase (e.g. silicone or Glass) is used for immobilization is preferred a blocking solution on the surface before step (a) brought in every cycle to avoid a non-specific adsorption of NTs * on the surface. This For example, conditions for a blocking solution are met an albumin solution (BSA) with a pH between 8 and 10.

Wahl der PolymeraseChoice of polymerase

Bei der Wahl der Polymerase spielt die Art der verwendeten immobilisierten Nukleinsäure (RNA oder DNA) eine entscheidende Rolle:
Falls RNA als Genprodukt (z. B. mRNA) in die Sequenzierungsreaktion eingesetzt wird, können handelsübliche RNA-abhängige DNA-Palymerasen eingesetzt werden, z. B. AMV- Reverse Transcriptase (Sigma), M-MLV Reverse Transcriptase (Sigma), HIV-Reverse Transcriptase ohne RNAse-Aktivität. Alle Reverse Transcriptasen müssen von RNAse-Aktivität weitgehend frei sein ("Molecular cloning" 1989, Ed. Maniatis, Cold Spring Harbor Laboratory).
The type of immobilized nucleic acid (RNA or DNA) used plays a decisive role in the choice of polymerase:
If RNA is used as a gene product (e.g. mRNA) in the sequencing reaction, commercially available RNA-dependent DNA polymerases can be used, e.g. B. AMV reverse transcriptase (Sigma), M-MLV reverse transcriptase (Sigma), HIV reverse transcriptase without RNAse activity. All reverse transcriptases must be largely free of RNAse activity ("Molecular cloning" 1989, Ed. Maniatis, Cold Spring Harbor Laboratory).

Falls DNA als Genprodukt (z. B. cDNA) verwendet wird, eignen sich als Polymerasen prinzipiell alle DNA-abhängigen DNA- Polymerasen ohne 3'-5' Exonuklease-Aktivität (DNA- Replication" 1992 Ed. A. Kornberg, Freeman and company NY), z. B. modifizierte T7-Polymerase vom Typ "Sequenase Version 2" (Amersham Pharmacia Biotech), Klenow Fragment der DNA-Polymerase I ohne 3'-5' Exonukleaseaktivität (Amersham Pharmacia Biotech), Polymerase Beta verschiedenen Ursprungs (Animal Cell DNA Polymerases" 1983, Fry M., CRC Press Inc., kommerziell erhältlich bei Chimerx) thermostabile Polymerasen wie Taq-Polymerase (GibcoßRL), proHA-DNA-Polymerase (Eurogentec). If DNA is used as a gene product (e.g. cDNA), are suitable in principle, all DNA-dependent DNA Polymerases without 3'-5 'exonuclease activity (DNA Replication "1992 Ed. A. Kornberg, Freeman and company NY), z. B. Modified "Sequenase Version 2" T7 Polymerase (Amersham Pharmacia Biotech), Klenow fragment of the DNA polymerase I without 3'-5 'exonuclease activity (Amersham Pharmacia Biotech), polymerase beta of various origins (Animal Cell DNA Polymerases "1983, Fry M., CRC Press Inc., commercially available from Chimerx) thermostable polymerases such as Taq polymerase (GibcoßRL), proHA DNA polymerase (Eurogentec).

Detektiondetection

Wie bei der Sequenzierung langer NSKs, umfasst die Detektion folgende Phasen:
1) Vorbereitung zur Detektion
Durchführung eines Detektionsschrittes in jedem Zyklus, wobei jeder Detektionsschritt als Scanvorgang abläuft und folgende Operationen umfaßt:

  • a) Einstellung der Position des Objektivs (X,Y-Achse),
  • b) Einstellung der Fokusebene (Z-Achse),
  • c) Detektion der Signale einzelner Moleküle, Zuordnung des Signals zu NT* und Zuordnung des Signals zum jeweiligen Genprodukt,
  • d) Verschiebung zur nächsten Position auf der Oberfläche.
As with the sequencing of long NSKs, the detection comprises the following phases:
1) Preparation for detection
Execution of a detection step in each cycle, each detection step running as a scanning process and comprising the following operations:
  • a) adjusting the position of the lens (X, Y axis),
  • b) adjustment of the focal plane (Z axis),
  • c) detection of the signals of individual molecules, assignment of the signal to NT * and assignment of the signal to the respective gene product,
  • d) Shift to the next position on the surface.

Die Signale von in die den Genprodukten komplementären Stränge eingebauten NT* werden durch das Abscannen der Oberfläche registriert. Der Scanvorgang wird wie bei der Sequenzierung langer NSKs durchgeführt. Dabei wird das Objektiv schrittweise über die Oberfläche bewegt, so daß von jeder Oberflächenposition ein zweidimensionales Bild (2D- Bild) entsteht. The signals from in complementary to the gene products NT * strands are built by scanning the Surface registered. The scanning process is the same as for the Long NSKs sequenced. It will Lens gradually moved over the surface, so that from a two-dimensional image for each surface position (2D Image) arises.

Vorbereitung zur DetektionPreparation for detection

Am Anfang wird festgelegt, wie viele Kopien der Genprodukte zur Expressionsanalyse notwendig sind. Mehrere Faktoren spielen dabei eine Rolle. Die genaue Zahl hängt z. B. von der relativen Präsenz der Genprodukte im Ansatz und von der gewünschten Genauigkeit der Analyse ab. Die Anzahl der analysierten Genprodukte liegt vorzugsweise zwischen 1000 und 10.000.000. Für stark exprimierte Gene kann die Anzahl der analysierten Genprodukte niedrig sein, z. B. 1000 bis 10.000. Bei der Analyse schwach exprimierter Gene muß sie erhöht werden, z. B. auf 100.000 oder noch weiter. At the beginning it is determined how many copies of the gene products are necessary for expression analysis. Several factors play a role in this. The exact number depends e.g. B. from the relative presence of the gene products in the approach and by the desired accuracy of the analysis. The number of analyzed gene products are preferably between 1000 and 10,000,000. For highly expressed genes, the number of analyzed gene products be low, e.g. B. 1000 to 10,000. When analyzing poorly expressed genes, it must be increased be, e.g. B. 100,000 or even further.

Es werden bespielsweise 100.000 einzelne Genprodukte gleichzeitig analysiert. Dabei werden auch schwach exprimierte Gene (mit z. B. ca. 100 mRNA-Molekülen/Zelle, was ca. 0.02% gesamt-mRNA entspricht) in der Reaktion mit durchschnittlich 20 identifizierten Genprodukten repräsentiert.
2) Durchführung eines Detektionsschrittes in jedem Zyklus gleicht der in der Sequenzierung langer NSKs. Anstelle von NSKFs werden Genprodukte verwendet.
For example, 100,000 individual gene products are analyzed simultaneously. Weakly expressed genes (with e.g. approx. 100 mRNA molecules / cell, which corresponds to approx. 0.02% total mRNA) are also represented in the reaction with an average of 20 identified gene products.
2) Performing a detection step in each cycle is the same as in the sequencing of long NSKs. Genetic products are used instead of NSKFs.

Analyseanalysis

Die gewonnenen Daten (kurze Sequenzen) werden mit Hilfe eines Programms mit bekannten Gensequenzen verglichen. Einem solchen Programm kann z. B. ein BLAST oder FASTA Algorithmus zugrunde liegen ("intraduction to computational Biology" 1995 M.S. Waterman Chapman & Hall). The data obtained (short sequences) are analyzed using a Program compared with known gene sequences. a such a program can e.g. B. a BLAST or FASTA algorithm underlying ("intraduction to computational biology" 1995 M.S. Waterman Chapman & Hall).

Durch die Wahl der Methode zur Materialvorbereitung wird unter anderem festgelegt, in welchen Abschnitten der Genprodukte die Sequenzen ermittelt werden und zu welchem Strang (sense oder antisense) sie gehören. Z. B. werden bei der Verwendung der polyA-Strecken als Primerbindungsstelle in mRNA Sequenzen aus NTRs (non-translating-regions) bestimmt. Bei der Verwendung der Methode mit antisense-cDNA als Matrize stammen die ermittelten Sequenzen unter anderem aus den proteinkodierenden Bereichen der Genprodukte. By choosing the method of material preparation among other things, stipulates in which sections the Gene products the sequences are determined and to which Strand (sense or antisense) they belong. For example, at the use of the polyA routes as a primer binding site in mRNA sequences determined from NTRs (non-translating regions). When using the method with antisense cDNA as a template The sequences determined originate, among other things, from the protein coding areas of gene products.

Bei einer bevorzugten einfachen Variante der Erfindung wird die Genexpression nur qualitativ bestimmt. Dabei ist nur die Tatsache der Expression bestimmter Gene von Bedeutung. In a preferred simple variant of the invention gene expression is determined only qualitatively. Only that is Fact of expression of certain genes of importance.

Bei einer anderen bevorzugten Ausführungsform ist eine quantitative Bestimmung der Verhältnisse zwischen einzelnen Genprodukten im Ansatz von Interesse. Es ist bekannt, daß die Aktivität eines Gens in einer Zelle durch eine Population identischer mRNA-Moleküle repräsentiert ist. In einer Zelle sind viele Gene gleichzeitig aktiv und werden dabei unterschiedlich stark exprimiert, was zum Vorhandensein vieler verschiedener unterschiedlich stark repräsentierter mRNA-Populationen führt. In another preferred embodiment, one is quantitative determination of the relationships between individuals Genetic products of interest. It is known that the Activity of a gene in a cell by a population identical mRNA molecules is represented. In a cell many genes are active at the same time and become involved expressed differently, leading to the presence many different represented differently leads mRNA populations.

Im folgenden wird auf die quantitative Analyse der Genexpression näher eingegangen:
Für eine quantitative Analyse der Genexpression werden die Abundanzen einzelner Genprodukte in der Sequenzierungsreaktion bestimmt. Dabei sind die Produkte stark exprimierter Gene in der Sequenzierungsreaktion häufiger vertreten als die schwach exprimierter Gene.
The quantitative analysis of gene expression is discussed in more detail below:
The abundances of individual gene products in the sequencing reaction are determined for a quantitative analysis of the gene expression. The products of highly expressed genes are more frequently represented in the sequencing reaction than the poorly expressed genes.

Nach der Zuordnung der Sequenzen zu bestimmten Genen wird der Anteil der ermittelten Sequenzen für jedes einzelne Gen bestimmt. Gene mit starker Expression haben einen höheren Anteil an der Gesamtpopulation der Genprodukte als Gene mit schwacher Expression. After assigning the sequences to certain genes, the Proportion of the sequences determined for each individual gene certainly. Genes with strong expression have a higher one Share in the total population of gene products as genes with weak expression.

Die Anzahl der analysierten Genprodukte liegt vorzugsweise zwischen 1000 und 10.000.000. Die genaue Anzahl der zu analysierenden Genprodukte hängt von der Aufgabenstellung ab. Für stark exprimierte Gene kann sie niedrig sein, z. B. 1000 bis 10.000. Bei der Analyse schwach exprimierter Gene muß sie erhöht werden, z. B. auf 100.000 oder höher. The number of gene products analyzed is preferably between 1,000 and 10,000,000. The exact number of to analyzing gene products depends on the task. For highly expressed genes, it can be low, e.g. B. 1000 up to 10,000. When analyzing poorly expressed genes, it must be increased, e.g. B. 100,000 or higher.

Werden bespielsweise 100.000 einzelne Genprodukte gleichzeitig analysiert, sind auch schwach exprimierte Gene, wie z. B. ca. 100 mRNA-Moleküle/Zelle (was ca. 0.02% gesamtmRNA entspricht), in der Reaktion mit durchschnittlich 20 identifizierten Genprodukten repräsentiert. For example, 100,000 individual gene products analyzed at the same time, are also poorly expressed genes, such as B. about 100 mRNA molecules / cell (which is about 0.02% total mRNA) in the reaction with an average of 20 represented identified gene products.

Als interne Kontrolle der Hybridisierung, der Immobilisation und der Sequenzierungsreaktion läßt sich folgende Methode verwenden:
Es können eine oder mehrere Nukleinsäureketten mit bekannten Sequenzen als Kontrolle eingesetzt werden. Die Zusammensetzung dieser Kontrollsequenzen ist nicht eingeschränkt, sofern sie die Identifizierung der Genprodukte nicht störten. Bei der Sequenzanalyse der mRNA-Proben werden RNA-Kontrollproben, bei der Analyse der cDNA-Proben entsprechend DNA-Kontrollproben eingesetzt. Diese Proben werden vorzugsweise bei allen Schritten mitgeführt. Sie können z. B. nach der mRNA-Isolation zugegeben werden. Im allgemeinen werden die Kontrollproben in gleicher Weise zur Sequenzanalyse vorbereitet wie die zu analysierenden Genprodukte.
The following method can be used as internal control of the hybridization, the immobilization and the sequencing reaction:
One or more nucleic acid chains with known sequences can be used as a control. The composition of these control sequences is not restricted, provided that they do not interfere with the identification of the gene products. RNA control samples are used in the sequence analysis of the mRNA samples, and corresponding DNA control samples are used in the analysis of the cDNA samples. These samples are preferably carried along in all steps. You can e.g. B. added after mRNA isolation. In general, the control samples are prepared for sequence analysis in the same way as the gene products to be analyzed.

Die Kontrollsequenzen werden in bekannten, fest eingestellten Konzentrationen zu den zu analysierenden Genprodukten zugegeben. Konzentrationen der Kontrollproben können unterschiedlich sein, vorzugsweise liegen diese Konzentrationen zwischen 0.01% und 10% der Gesamtkonzentration der zu analysierenden Probe (100%). Beträgt die Konzentration der mRNA beispielsweise 10 ng/µl, dann liegen die Konzentrationen von Kontrollproben zwischen 1 pg/µl und 1 ng/µl. The control sequences are set in known, fixed ones Concentrations for the gene products to be analyzed added. Concentrations of the control samples can be different, preferably these are Concentrations between 0.01% and 10% of the Total concentration of the sample to be analyzed (100%). If the concentration of the mRNA is, for example, 10 ng / μl, then the concentrations of control samples are between 1 pg / µl and 1 ng / µl.

Bei der quantitativen Analyse der Genexpression muß auch die allgemeine metabolische Aktivität der Zellen berücksichtigt werden, insbesondere, wenn ein Vergleich der Expression bestimmter Gene bei verschiedenen äußeren Bedingungen angestrebt wird. In the quantitative analysis of gene expression, the general metabolic activity of the cells is taken into account be, especially when comparing expression certain genes under different external conditions is sought.

Die Veränderung im Expressionsniveau eines bestimmten Gens kann als Folge der Veränderung in der Transkriptionsrate dieses Gens oder als Folge einer globalen Veränderung der Genexpression in der Zelle auftreten. Zur Beobachtung der metabolischen Zustände in der Zelle kann man die Expression der sogenannten "House-keeping-Gene" analysieren. Beim Mangel an wichtigen Metaboliten ist beispielsweise das allgemeine Expressionsniveau in der Zelle niedrig, so daß auch konstitutiv exprimierte Gene eine niedriges Expressionsniveau haben. The change in the level of expression of a particular gene may be a result of the change in the transcription rate this gene or as a result of a global change in Gene expression occurs in the cell. To observe the metabolic states in the cell can be used for expression analyze the so-called "house-keeping genes". If there is a shortage the important metabolite is, for example, the general one Expression level in the cell low, so too constitutively expressed genes have a low level of expression to have.

Im Prinzip können alle konstitutiv exprimierten Gene als "House-keeping-Gene" dienen. Als Beispiele seien das Transferrin-Rezeptor-Gen oder das Beta-Aktin-Gen genannt. In principle, all constitutively expressed genes can be considered Serve "house-keeping genes". As examples Called transferrin receptor gene or the beta actin gene.

Die Expression dieser House-keeping-Gene dient somit als Bezugsgröße für die Analyse der Expression anderer Gene. Die Sequenzermittlung und Quantifizierung der Expression der House-keeping-Gene ist vorzugsweise ein Bestandteil des Analyse-Programms für die Genexpression. The expression of these house-keeping genes thus serves as Reference value for the analysis of the expression of other genes. The Sequence determination and quantification of the expression of the House-keeping genes are preferably part of the Analysis program for gene expression.

Wie bei der Sequenzierung langer NSKs kann man Sequenzierungsreaktion mit 4 markierten oder 2 markierten und 2 unmarkierten NT* durchführen. As with sequencing long NSKs, one can Sequencing reaction with 4 labeled or 2 labeled and Carry out 2 unmarked NT *.

Sequenzanalyse mit 4 markierten NTs*Sequenzanalyse mit 4 markierten NTs*Sequence analysis with 4 marked NTs * Sequence analysis with 4 marked NTs *

Bei einer bevorzugten Ausführungsform der Erfindung werden alle vier in die Reaktion eingesetzten NTs* mit Fluoreszenzfarbstoffen markiert. In a preferred embodiment of the invention all four NTs * used in the reaction Fluorescent dyes marked.

Dabei verwendet man eine der oben genannten farbigen Kodierungsschemata. Die Zahl der ermittelten NTs für jede Sequenz aus einem Genprodukt liegt zwischen 5 und 100, idealerweise zwischen 20 und 50. Diese ermittelten Sequenzen werden mit Hilfe eines Programms mit bekannten Sequenzen in Gen-Datenbanken verglichen und entsprechenden Genen zugeordnet. Einem solchen Programm kann z. B. der BLAST oder FASTA Algorithmus zugrunde liegen ("Introduction to computational Biology" 1995 M.S. Waterman Chapman & Hall). One of the above colored ones is used Coding schemes. The number of NTs found for each Sequence from a gene product is between 5 and 100, ideally between 20 and 50. These determined sequences are created using a program with known sequences Gene databases compared and corresponding genes assigned. Such a program can e.g. B. the BLAST or FASTA algorithm ("Introduction to computational biology "1995 M.S. Waterman Chapman & Hall).

Ein Zyklus hat folgende Schritte:

  • a) Zugabe einer Lösung mit markierten Nukleotiden (NTs*) und Polymerase zu immobilisierten Nukleinsäureketten,
  • b) Inkubation der immobilisierten Nukleinsäureketten mit dieser Lösung unter Bedingungen, die zur Verlängerung der komplementären Stränge um ein NT geeignet sind,
  • c) Waschen
  • d) Detektion der Signale von einzelnen Molekülen
  • e) Entfernung der Markierung von den eingebauten Nukleotiden und des zur Termination führenden Substituenten,
  • f) Waschen.
A cycle has the following steps:
  • a) adding a solution with labeled nucleotides (NTs *) and polymerase to immobilized nucleic acid chains,
  • b) incubation of the immobilized nucleic acid chains with this solution under conditions which are suitable for extending the complementary strands by one NT,
  • c) washing
  • d) detection of signals from individual molecules
  • e) removing the label from the built-in nucleotides and the substituent leading to the termination,
  • f) washing.

Sequenzanalyse mit 2 markierten NTs* und 2 unmarkierten NTs (2NTs*/2NTs-Methode)Sequence analysis with 2 marked NTs * and 2 unmarked NTs (2NTs * / 2NTs method)

In einer anderen Ausführungsform werden für die Analyse der Sequenzen 2 modifizierte NTs* und 2 unmodifizierte NTs eingesetzt. In another embodiment, the analysis of the Sequences 2 modified NTs * and 2 unmodified NTs used.

Diese Ausführungsform beruht auf dem Prinzip, daß eine Abfolge aus 2 Signalen (markierte NT*s) genügend Informationen zur Identifizierung einer Sequenz enthalten kann. Die ermittelte Sequenz wird mit der Referenzsequenz verglichen und einer bestimmten Position zugeordnet, z. B.:
ACCAAAACACCC - ermittelte Sequenz (dCTP* und dATP* sind markiert)
ATCATCGTTCGAAATATCGATCGCCTGATGCC - Referenzsequenz
A-C---C-AAA-A-C-A-C-CC (zugeordnete ermittelte Sequenz) ATCATCGTTCGAAATATCGATCGCCTGATGCC (Referenzsequenz)
This embodiment is based on the principle that a sequence of 2 signals (marked NT * s) can contain enough information to identify a sequence. The determined sequence is compared with the reference sequence and assigned to a specific position, e.g. B .:
ACCAAAACACCC - determined sequence (dCTP * and dATP * are marked)
ATCATCGTTCGAAATATCGATCGCCTGATGCC - reference sequence
AC --- C-AAA-ACAC-CC (assigned determined sequence) ATCATCGTTCGAAATATCGATCGCCTGATGCC (reference sequence)

Vorzugsweise wird die ermittelten Sequenzen mit Hilfe eines Programms der Referenzsequenz zugeordnet. Einem solchen Programm kann z. B. der BLAST oder FASTA Algorithmus zugrunde liegen ("Introduction to computational Biology" 1995 M.S. Waterman Chapman & Hall). The sequences determined are preferably determined using a Program assigned to the reference sequence. Such one Program can e.g. B. the BLAST or FASTA algorithm ("Introduction to computational Biology" 1995 M.S. Waterman Chapman & Hall).

Die Genprodukte werden wie oben beschrieben zur Sequenzierung vorbereitet und mit 2NTs*/2NTs-Methode sequenziert. Man erhält Sequenzenabschnitte aus Genprodukten, wobei jede Sequenz eine Abfolge aus 2NTs* darstellt. Bekannte Gensequenzen dienen als Referenzsequenzen. Um eine eindeutige Zuordnung der ermittelten Sequenz zu einer bekannten Referenzsequenz zu ermöglichen, muß diese Abfolge lang genug sein. Vorzugsweise beträgt die Länge der ermittelten Sequenzen mehr als 20 NT*s. Da 2 markierte NTs* nur einen Teil der Sequenz darstellen, ist die Gesamtlänge des synthetisierten komplementären Strangs ca. doppelt so lang, wie die Abfolge der detektierten NTs* (bei 20 detektierten NTs* beträgt die Gesamtlänge z. B. durchschnittlich 40 NTs). The gene products are used for sequencing as described above prepared and sequenced using the 2NTs * / 2NTs method. you receives sequence sections from gene products, each Sequence represents a sequence of 2NTs *. Known Gene sequences serve as reference sequences. To be clear Assignment of the determined sequence to a known one To enable the reference sequence, this sequence must be long enough his. The length of the determined is preferably Sequences more than 20 NT * s. Since 2 marked NTs * only a part the sequence is the total length of the synthesized complementary strand about twice as long, like the sequence of the detected NTs * (at 20 detected NTs * is the total length z. B. 40 NTs on average).

Zur Synthese eines komplementären Stranges werden 4 Nukleotide benötigt. Da die mit einem Fluoreszenzfarbstoff markierten NTs* in der vorliegenden Erfindung als Semiterminatoren auftreten, d. h. die Termination ausschließlich bei Verfügbarkeit modifizierter NTs* auftritt, müssen unmodifizierte NTs in einem zusätzlichen Schritt in jedem Zyklus in die Reaktion zugegeben werden. Die genaue Position dieses Schrittes in dem Zyklus kann variieren. Wichtig dabei ist, daß die markierten NTs* und die unmodifizierte NTs getrennt verwendet werden. To synthesize a complementary strand, 4 Nucleotides needed. Because the one with a fluorescent dye marked NTs * in the present invention as Semiterminators occur, d. H. the termination occurs only when modified NTs * are available, need unmodified NTs in an additional step be added to the reaction in each cycle. The exact The position of this step in the cycle can vary. It is important that the marked NTs * and the unmodified NTs can be used separately.

Ein Zyklus bei dieser Ausführungsform kann beispielhaft folgendermaßen aussehen:

  • a) Zugabe einer Lösung mit modifizierten NTs* und Polymerasen auf die Oberfläche mit den bereitgestellten Genprodukten
  • b) Inkubation der immobilisierten Nukleinsäureketten mit dieser Lösung unter Bedingungen, die zur Verlängerung der komplementären Stränge um ein NT geeignet sind,
  • c) Waschen
  • d) Detektion der Signale von einzelnen, modifizierten und in die den Genprodukten komplementären neusynthetisierten Strängen eingebauten NTs*-Molekülen
  • e) Entfernung der Markierung und der terminierenden Gruppe bei den eingebauten Nukleotiden
  • f) Waschen
  • g) Zugabe von 2 unmodifizierten NTs und Polymerasen
  • h) Waschen.
A cycle in this embodiment may look as follows, for example:
  • a) Adding a solution with modified NTs * and polymerases to the surface with the gene products provided
  • b) incubation of the immobilized nucleic acid chains with this solution under conditions which are suitable for extending the complementary strands by one NT,
  • c) washing
  • d) Detection of the signals from individual, modified NTs * molecules built into the newly synthesized strands complementary to the gene products
  • e) removal of the label and the terminating group in the incorporated nucleotides
  • f) washing
  • g) addition of 2 unmodified NTs and polymerases
  • h) washing.

Die Konzentration der NTs liegt vorzugsweise unter 1 mM, idealerweise unter 10 µM. The concentration of the NTs is preferably below 1 mM, ideally less than 10 µM.

Beispiel 4Example 4

Eine besondere Ausführungsform des Verfahrens stellt die Analyse von Einzelnukleotidpolymorphismen mit sequenzspezifischen Primern dar. A special embodiment of the method is the Analysis of single nucleotide polymorphisms with sequence-specific primers.

Zusätzlich zu Abschnitt 1 "Abkürzungen und Begriffserläuterungen" werden für dieses Beispiel folgende Begriffe definiert:
Primer - Zur Verdeutlichung des erfinderischen Gedankens werden in diesem Beispiel folgende Begriffe unterschieden:

  • a) Unter einem "Primer" wird vorliegend allgemein eine Population von Primermolekülen mit einheitlicher Struktur verstanden.
  • b) "mehrere Primer" o. ä. werden im Text als mehrere Populationen von Primermolekülen verstanden, die unterschiedliche Struktur besitzen.
  • c) "Ein Primer-Molekül" bedeutet ein einziges Oligonukleotid-Molekül.
  • d) "Mehrere Primer-Moleküle" bedeuten mehrere einzelne Oligonukleotid-Moleküle; sie können einheitliche oder unterschiedliche Struktur aufweisen.
SNP-Stelle - eine Position in NSK, die auf Vorhandensein oder Abwesenheit von SNP untersucht wird.
Zielsequenz - Teil einer Gesamtsequenz, der durch die Verwendung eines spezifischen Primers in der Sequenzierungsreaktion sequenziert/bestimmt wird. Eine Gesamtsequenz kann mehrere Zielsequenzen enthalten. Eine Zielsequenz ist genügend lang, um eine Positionierung dieser Zielsequenz innerhalb der Gesamtsequenz mit großer Wahrscheinlichkeit zu gewährleisten. Zielsequenzen können beispielsweise eine oder mehrere SNP-Stellen enthalten.
Erkennungssequenz - Teil der Zielsequenz, der für die Zuordnung dieser Zielsequenz in der Gesamtsequenz verwendet wird. In addition to Section 1 "Abbreviations and Definitions", the following terms are defined for this example:
Primer - To clarify the inventive idea, the following terms are distinguished in this example:
  • a) In the present case, a "primer" is generally understood to mean a population of primer molecules with a uniform structure.
  • b) "Several primers" or the like are understood in the text as several populations of primer molecules which have different structures.
  • c) "A primer molecule" means a single oligonucleotide molecule.
  • d) "multiple primer molecules" mean multiple individual oligonucleotide molecules; they can have a uniform or different structure.
SNP position - a position in NSK that is checked for the presence or absence of SNP.
Target Sequence - Part of an overall sequence that is sequenced / determined using a specific primer in the sequencing reaction. An entire sequence can contain several target sequences. A target sequence is long enough to ensure that it is very likely to be positioned within the overall sequence. Target sequences can contain one or more SNP sites, for example.
Detection Sequence - Part of the target sequence that is used to assign this target sequence to the overall sequence.

In dieser Ausführungsform zur SNP-Analyse werden mehrere potentielle SNP-Positionen in der Referenzsequenz ausgewählt, die in einer zu analysierenden NSK untersucht werden. Zu diesen Positionen werden entsprechend unterschiedliche, sequenzspezifische Primer bereitgestellt. Diese Primer können einen standardisierten Primersatz zur SNP-Analyse bei einer bestimmten Fragestellung bilden und einheitlich als Kit für die betreffende Analysen eingesetzt werden. In this embodiment for SNP analysis there will be several potential SNP positions selected in the reference sequence, which are examined in an NSK to be analyzed. To these positions are correspondingly different, sequence specific primers provided. These primers can a standardized primer set for SNP analysis at a form a specific question and uniform as a kit for the relevant analyzes are used.

Die Vorbereitung des zu analysierenden Materials (auf SNP zu untersuchende einzel- und doppelsträngige Nukleinsäureketten) hat erfindungsgemäß das Ziel, aus einer oder mehreren langen Nukleinsäureketten (Gesamtsequenz) eine Population an relativ kleinen, zwischen 30 und 2000 NT langen, einzelsträngigen Nukleinsäurekettenfragmenten (NSKFs) zu bilden. The preparation of the material to be analyzed (towards SNP investigating single and double-stranded nucleic acid chains) according to the invention has the goal of one or more long Nucleic acid chains (total sequence) a population of relative small, between 30 and 2000 NT long, single-stranded Form nucleic acid chain fragments (NSKFs).

Diese NSKF-Moleküle werden zufällig auf einer planen Oberfläche mit einer Dichte zwischen 10 und 1.000.000 pro 100 µm2, vorzugsweise 10 und 100 NSKFs pro 100 µm2, 100 bis 10.000 pro 100 µm2 oder 10.000 bis 1.000.000 pro 100 µm2 immobilisiert. An die auf der Oberfläche gebundenen NSKFs werden Primer hybridisiert, so dass die Dichte der extensionsfähigen NSKF- Primer-Komplexe ca. 10-100 pro 100 µm2 beträgt. Nach der Hybridisierung werden nicht gebundene Primer entfernt und die Sequenzierungsreaktion gestartet. These NSKF molecules happen to be on a flat surface with a density between 10 and 1,000,000 per 100 µm 2 , preferably 10 and 100 NSKFs per 100 µm 2 , 100 to 10,000 per 100 µm 2 or 10,000 to 1,000,000 per 100 µm 2 immobilized. Primers are hybridized to the NSKFs bound on the surface, so that the density of the NSKF primer complexes which can be extended is approximately 10-100 per 100 μm 2 . After hybridization, unbound primers are removed and the sequencing reaction started.

Durch eine Auswahl der Zielsequenzen und der sequenzspezifischen Primer werden nur die relevanten Abschnitte der Gesamtsequenz untersucht, was die Menge nicht relevanter Informationen verringert und die Analysezeit verkürzt. By selecting the target sequences and the sequence-specific primers are only the relevant ones Sections of the total sequence examined what the amount was not relevant information is reduced and the analysis time shortened.

Dieser Ausführungsform des Verfahrens zur SNP-Analyse liegen folgende Prinzipien zugrunde:
Es werden Stellen in einer Referenzsequenz ausgewählt, die in den zu untersuchenden NSKs (Gesamtsequenz) auf Einzelnukleotidpolymorphismen (SNPs) überprüft werden sollen.

  • 1. Zur Analyse jeder ausgewählten SNP-Stelle werden spezifische Primer bereitgestellt, so dass jede zu untersuchende SNP-Stelle entweder die nächste Position in 3"-Richtung vom Primer einnimmt oder innerhalb von 2 bis 100, vorzugsweise 2 bis 50, idealerweise 2 bis 20 Positionen in 3"-Richtung vom Primer liegt. Die SNP- Stelle liegt somit innerhalb der Zielsequenz, die während der Sequenzierungsreaktion bestimmt wird. Es werden vorzugsweise mehrere SNP-Stellen gleichzeitig analysiert, so dass mehrere spezifische Primer verwendet werden müssen. Die Primer werden vorzugsweise so ausgewählt, dass sie möglichst einheitliche Annealing- Temperaturen haben, d. h. Unterschiede zwischen Schmelztemperaturen einzelner Primerpopulationen liegen beispielsweise innerhalb eines Bereichs von ca. 4 Grad, besser innerhalb von 2 Grad, noch besser innerhalb von 1 Grad.
  • 2. Von der Gesamtsequenz werden kurze Nukleinsäurekettenfragmente (NSKFs) abgeleitet, wobei diese Fragmente einzelsträngig sind und eine Länge von 20 bis 2000 NT, vorzugsweise 30 bis 500 NT besitzen.
  • 3. NSKF-Moleküle werden in einer zufälligen Anordnung auf der Oberfläche immobilisiert.
  • 4. Nach der Hybridisierung (Annealing) von sequenzspezifischen Primern an die auf der Oberfläche immobilisierten NSKFs wird eine zyklische Sequenzierungsreaktion durchgeführt, wobei für jedes an der Reaktion beteiligte NSKF-Molekül eine Zielsequenz ermittelt wird. Die Sequenzierungsreaktion läuft an vielen Molekülen gleichzeitig ab.
  • 5. Die ermittelten Zielsequenzen enthalten Information über die Zugehörigkeit zu einem bestimmten Abschnitt in der Gesamtsequenz und über den SNP in diesem Abschnitt bei der zu untersuchenden Probe. Die Länge der Zielsequenzen und somit die Zahl der Zyklen ist so zu wählen, dass eine Identifizierung der Sequenzen gewährleistet werden kann.
    In einer vorteilhaften Ausführungsform werden die ermittelten Zielsequenzen mit der Referenzsequenz verglichen und durch Sequenzübereinstimmung zugeordnet. Bei einer genügend langen ermittelten Zielsequenz kann man sie mit großer Wahrscheinlichkeit zu einer bestimmten Position in der Referenzsequenz zuordnen. Beispielsweise kann eine Sequenz aus 10 NTs mehr als 106 verschiedene Kombinationen bilden und somit mit einer großen Wahrscheinlichkeit in einer NSK von nur 100.000 NT eindeutig identifiziert werden. Nach der Zuordnung der ermittelten Zielsequenz zur bestimmten Position innerhalb der Referenzsequenz werden Unterschiede in den Sequenzen, die SNPs, sichtbar.
    Zur Identifizierung der Zielsequenzen wird in einer anderen vorteilhaften Ausführungsform sowohl die bereits bekannte Anzahl der Primer, ihre Zusammensetzung und ein bereits bekannter, an die Primerbindungsstelle anschließender Sequenzabschnitt der Referenzsequenz verwendet. Dabei werden die ermittelten Zielsequenzen nach ihrer Zugehörigkeit zu den Primern analysiert, wobei nur die nah an der Primerbindungsstelle liegenden Sequenzen berücksichtigt werden müssen. Wenn beispielsweise nur 1000 Primer verwendet werden, reichen weniger als 10 NTs der ermittelten Zielsequenzen, um eine Zuordnung zu den entsprechenden Primern zu ermöglichen.
This embodiment of the method for SNP analysis is based on the following principles:
Locations in a reference sequence are selected which are to be checked for single nucleotide polymorphisms (SNPs) in the NSKs to be examined (overall sequence).
  • 1. Specific primers are provided for the analysis of each selected SNP site, so that each SNP site to be examined either takes the next position in the 3 "direction from the primer or within 2 to 100, preferably 2 to 50, ideally 2 to 20 Positions in 3 "direction from the primer. The SNP site is thus within the target sequence that is determined during the sequencing reaction. Several SNP sites are preferably analyzed simultaneously, so that several specific primers have to be used. The primers are preferably selected such that they have annealing temperatures that are as uniform as possible, ie differences between melting temperatures of individual primer populations are, for example, within a range of approximately 4 degrees, better within 2 degrees, even better within 1 degree.
  • 2. Short nucleic acid chain fragments (NSKFs) are derived from the total sequence, these fragments being single-stranded and having a length of 20 to 2000 NT, preferably 30 to 500 NT.
  • 3. NSKF molecules are immobilized in a random arrangement on the surface.
  • 4. After the hybridization (annealing) of sequence-specific primers to the NSKFs immobilized on the surface, a cyclic sequencing reaction is carried out, a target sequence being determined for each NSKF molecule involved in the reaction. The sequencing reaction takes place on many molecules simultaneously.
  • 5. The determined target sequences contain information about the affiliation to a certain section in the overall sequence and about the SNP in this section for the sample to be examined. The length of the target sequences and thus the number of cycles should be chosen so that an identification of the sequences can be guaranteed.
    In an advantageous embodiment, the determined target sequences are compared with the reference sequence and assigned by sequence matching. If the target sequence is sufficiently long, it is very likely that it can be assigned to a specific position in the reference sequence. For example, a sequence of 10 NTs can form more than 10 6 different combinations and can therefore be identified with a high probability in a NSK of only 100,000 NT. After assigning the determined target sequence to the specific position within the reference sequence, differences in the sequences, the SNPs, become visible.
    In another advantageous embodiment, both the already known number of primers, their composition and an already known sequence section of the reference sequence following the primer binding site are used to identify the target sequences. The target sequences determined are analyzed according to their affiliation with the primers, only the sequences close to the primer binding site having to be taken into account. If, for example, only 1000 primers are used, fewer than 10 NTs of the determined target sequences are sufficient to enable an assignment to the corresponding primers.

Die zu analysierende Probe enthält meistens mehrere identische Gesamtsequenzmoleküle, z. B. mehrere Kopien von genomischer DNA aus Zellen eines Gewebes oder mehrere identische mRNA-Populationen aus Zellen eines Gewebes. The sample to be analyzed usually contains several identical total sequence molecules, e.g. B. multiple copies of genomic DNA from cells of one or more tissues identical mRNA populations from cells of a tissue.

a) Wahl der SNP-Stellea) Choice of the SNP position

Mit der erfindungsgemäßen Methode kann man sowohl bekannte SNP-Stellen analysieren als auch neue SNP-Stellen ermitteln. Als potentielle SNP-Stelle kann jede Position in der NSK auftreten. Die Auswahl richtet sich nach der Fragestellung, z. B. SNP-Analyse in Genen, deren Produkte mit bestimmten Krankheiten assoziiert sind, oder SNP-Analyse in konservierten, kodierenden Abschnitten der Gene, die für Membranrezeptoren kodieren, oder Überprüfung bekannter SNP- Stellen in regulatorischen Sequenzen von Genen, die für die Zellteilung wichtig sind. With the method according to the invention one can do both known ones Analyze SNP positions as well as identify new SNP positions. Any position in the NSK can be a potential SNP position occur. The selection depends on the question, z. B. SNP analysis in genes, the products of which with certain Diseases are associated, or SNP analysis in conserved, coding sections of the genes responsible for Encode membrane receptors, or review known SNP Put in regulatory sequences of genes for the Cell division is important.

Eine zu analysierende SNP-Stelle liegt innerhalb einer Zielsequenz, die während der Sequenzierungsreaktion bestimmt wird. Man kann mehrere SNP-Stellen innerhalb einer Zielsequenz ermitteln. Man kann andererseits auch mehrere Zielsequenzen z. B. innerhalb eines Gens wählen. Wichtig dabei ist, dass die Zielsequenzen in genügendem Abstand voneinander in der Gesamtsequenz liegen. Dieser Abstand ist notwendig, damit nur ein sequenzspezifischer Primer pro NSKF hybridisiert, und er ist von der durchschnittlichen NSKF-Länge abhängig: je kürzer die NSKFs, desto näher aneinander können Zielsequenzen liegen. Die SNP-Stellen können bei angemessener Primer-Wahl an beiden Strängen einer doppelsträngigen Nukleinsäurekette analysiert werden. An SNP position to be analyzed lies within one Target sequence determined during the sequencing reaction becomes. You can have multiple SNP sites within a target sequence determine. On the other hand, you can also have multiple target sequences z. B. select within a gene. It is important that the Target sequences at a sufficient distance from each other in the Overall sequence. This distance is necessary so only one sequence specific primer hybridizes per NSKF, and he depends on the average NSKF length: the shorter the NSKFs, the closer to each other target sequences can be. With an appropriate choice of primers, the SNP sites can do both Strands of a double-stranded nucleic acid chain were analyzed become.

Das Verfahren bietet auch die Möglichkeit, beispielsweise mehrere SNP-Stellen aus vielen Individuen (als Stichprobe einer Population) gleichzeitig zu kontrollieren. Dadurch kann z. B. das SNP-Profil einer Population untersucht werden. The method also offers the possibility, for example several SNP positions from many individuals (as a sample of a population) at the same time. This can z. B. the SNP profile of a population can be examined.

b) Primer für die Sequenzierungsreaktionb) primers for the sequencing reaction

Sequenzierungsreaktion an einem einzelnen NSKF-Molekül wird durch ein Primer-Molekül ermöglicht. Ein sequenzspezifischer Primer ist erfindungsgemäß notwendig, um die Sequenzierungsreaktion jeweils an einer bestimmten/spezifischen Zielsequenz innerhalb der Gesamtsequenz durchführen zu können. Der für die Analyse einer SNP-Stelle, bzw. einer Zielsequenz einzusetzende sequenzspezifische Primer stellt eine Population von Primer-Molekülen mit identischer Struktur dar. Für die Analyse mehrerer, unterschiedlicher Zielsequenzen sind mehrere unterschiedliche Primer-Populationen notwendig. Sequencing reaction on a single NSKF molecule made possible by a primer molecule. A sequence specific According to the invention, primer is necessary in order to Sequencing reaction on each specific / specific target sequence within the overall sequence to be able to perform. The one for the analysis of an SNP position, or a target sequence to be used sequence-specific Primer provides a population of primer molecules identical structure. For the analysis of several, different target sequences are several different ones Primer populations necessary.

Durch die Verwendung sequenzspezifischer Primer werden nur die relevanten Sequenzabschnitte, die Zielsequenzen, analysiert. Im erfindungsgemäßen Verfahren wird die zu sequenzierende Länge der Sequenzen möglichst niedrig gehalten, damit die Geschwindigkeit der Analyse steigt. By using sequence specific primers only the relevant sequence sections, the target sequences, analyzed. In the method according to the invention, the sequencing length of the sequences as short as possible held so that the speed of the analysis increases.

Ein sequenzspezifischer Primer bindet an eine für ihn spezifische Primerbindungsstelle in der zu analysierenden Sequenz, PBS. Die Zusammensetzung und die Länge der Primer werden für jede potentielle SNP-Stelle, bzw. Zielsequenz, optimiert. Beispiele für Optimierungsschritte sind in Rychlik et al. NAR 1990 v.18 S. 6409 dargestellt. Bei der Primerwahl bzw. bei der Wahl der PBS (Primerbindungsstelle) sind folgende Aspekte besonders zu berücksichtigen:

  • 1. Die zu analysierende SNP-Stelle sollte entweder gleich nach dem 3'-Ende des Primers oder innerhalb der nächsten 2 bis 50 NTs, vorzugsweise 2 bis 20 NTs liegen.
  • 2. Die Positionierung (die Wahl der Sequenzlänge und der Zusammensetzung) der PBS zu SNP-Stelle sollte so erfolgen, dass die verschiedenen PBS-Sequenzen und die korrespondierenden Primer-Sequenzen möglichst ähnliche "Annealing-Temperaturen" besitzen, um bei möglichst einheitlichen Hybridisierungsbedingungen zu binden. Das kann beispielsweise durch Veränderung der PBS-Position im Bezug auf die jeweilige, zu analysierende SNP-Stelle oder durch die Veränderung der Primersequenzlänge erfolgen (Rychlik et al. NAR 1990 v.18 S. 6409).
  • 3. Der minimale Abstand zwischen Primern, die an denselben Strang in der Gesamtsequenz binden, sollte die durchschnittliche NSKF-Länge nicht unterschreiten.
A sequence-specific primer binds to a specific primer binding site in the sequence to be analyzed, PBS. The composition and length of the primers are optimized for each potential SNP site or target sequence. Examples of optimization steps are in Rychlik et al. NAR 1990 v.18 p. 6409. When choosing the primer or choosing the PBS (primer binding site), the following aspects must be considered:
  • 1. The SNP site to be analyzed should either be immediately after the 3 'end of the primer or within the next 2 to 50 NTs, preferably 2 to 20 NTs.
  • 2. The positioning (the choice of the sequence length and the composition) of the PBS at the SNP site should be carried out in such a way that the different PBS sequences and the corresponding primer sequences have “annealing temperatures” that are as similar as possible in order to achieve the most uniform hybridization conditions possible tie. This can be done, for example, by changing the PBS position in relation to the respective SNP site to be analyzed or by changing the length of the primer sequence (Rychlik et al. NAR 1990 v.18 p. 6409).
  • 3. The minimum distance between primers that bind to the same strand in the overall sequence should not be less than the average NSKF length.

Es können Primer für beide Stränge einer Doppelstrang-NSK verwendet werden. Damit lassen sich beispielsweise nah aneinander liegende SNP-Stellen erfassen, oder man kann eine Kontrolle einer SNP-Stelle in beiden Strängen vornehmen. Primers can be used for both strands of a double-strand NSK be used. This can be used, for example, to get close Detect adjacent SNP points, or you can Check an SNP point in both lines.

Vorzugsweise beträgt die Länge des Primers zwischen 6 und 100 NTs, optimalerweise zwischen 10-30 oder 30-40 oder 40-50. Für verschiedene SNP-Stellen, bzw. Zielsequenzen können Primer mit unterschiedlicher Länge eingesetzt werden. The length of the primer is preferably between 6 and 100 NTs, ideally between 10-30 or 30-40 or 40-50. For different SNP positions or target sequences Primers with different lengths can be used.

Für die SNP-Analyse mit sequenzspezifischen Primern werden Primer erfindungsgemäß in einer Hybridisierungslösung an die auf der Reaktionsoberfläche immobilisierten NSKFs hybridisiert (Annealing-Reaktion). For the SNP analysis with sequence-specific primers Primer according to the invention in a hybridization solution to the NSKFs immobilized on the reaction surface hybridizes (annealing reaction).

c) Immobilisierung von NSKFsc) Immobilization of NSKFs

In dieser Ausführungform werden erfindungsgemäß die NSKF- Primer-Komplexe ausschließlich über die NSKFs an die Oberfläche gebunden (direkte Bindung von NSKFs an die Oberfläche), wobei die bereitgestellten NSKF-Moleküle an die plane Oberfläche in zufälliger Anordnung gebunden werden. In this embodiment, the NSKF Primer complexes exclusively via the NSKFs to the Surface bound (direct binding of NSKFs to the Surface), the NSKF molecules provided attached to the flat surface can be bound in a random arrangement.

Die Immobilisierung der NSKFs erfolgt vorzugsweise an einem der beiden Ketten-Enden (s. o.). Die Immobilisierung kann auch durch eine unspezifische Bindung, wie z. B. durch Austrocknung der NSKFs enthaltenden Probe auf der planen Oberfläche erreicht werden. Die Dichte der Immobilisation kann zwischen 10 und 100, 100 und 10.000, 10.000 und 1.000.000 NSKFs pro 100 µm2 liegen. The NSKFs are preferably immobilized at one of the two chain ends (see above). Immobilization can also be achieved by means of a non-specific binding, such as e.g. B. can be achieved by drying the sample containing NSKFs on the flat surface. The density of the immobilization can be between 10 and 100, 100 and 10,000, 10,000 and 1,000,000 NSKFs per 100 µm 2 .

d) Hybridisierungd) hybridization

Die gebundenen NSKFs und die Primer werden unter stringenten Hybridisierungsbedingungen inkubiert, die eine möglichst selektive Anbindung (Annealing) der Primer an die entsprechenden Primerbindungsstellen der NSKFs erlauben. Optimale Hybridisierungsbedingungen hängen von der genauen Struktur der Primerbindungsstellen und der jeweiligen Primerstrukturen ab und lassen sich beispielsweise nach Rychlik et al. NAR 1990 v.18 S. 6409 berechnen. The bound NSKFs and the primers are under stringent Hybridization conditions are incubated to the extent possible selective binding (annealing) of the primer to the allow appropriate primer binding sites of the NSKFs. Optimal hybridization conditions depend on the exact Structure of the primer binding sites and the respective Primer structures and can be, for example Rychlik et al. Calculate NAR 1990 v.18 p. 6409.

Die Primer stellen vorzugsweise ein Primergemisch dar. Die Konzentrationen einzelner sequenzspezifischer Primer (Einzelkonzentrationen von Primer-Populationen) liegen beispielsweise zwischen 10 pmol/l und 1 mmol/l, vorzugsweise zwischen 0.1 µmol/l und 10 µmol/l. Die Gesamtkonzentration von Primern im Primergemisch liegt vorzugsweise zwischen 1 nmol/l und 10 mmol/l. Das Verhältnis zwischen einzelnen Primer- Populationen kann variieren. Primer können in deutlichem Überschuss über die immobilisierten NSKFs zugegeben werden, so dass die Hybridisierungszeit gering ist. The primers are preferably a mixture of primers Concentrations of individual sequence-specific primers (Individual concentrations of primer populations) for example between 10 pmol / l and 1 mmol / l, preferably between 0.1 µmol / l and 10 µmol / l. The total concentration of Primers in the primer mixture are preferably between 1 nmol / l and 10 mmol / l. The relationship between individual primer Populations can vary. Primers can be clearly Excess over the immobilized NSKFs are added, so that the hybridization time is short.

Die für die Detektion notwendige Dichte von extensionsfähigen NSKF-Primer-Komplexen beträgt ca. 10 bis 100 pro 100 µm2. Sie kann vor, während oder nach der Hybridisierung der Primer erreicht werden. The density of NSKF primer complexes which can be extended is necessary for the detection to be approximately 10 to 100 per 100 µm 2 . It can be achieved before, during or after hybridization of the primers.

Bei einer bekannten NSKF-Konzentration können in einer Ausführungsform die Immobilisierungsbedingungen so gewählt werden, dass die NSKFs in einer Dichte von ca. 10 bis 1000 Moleküle pro 100 µm2 gebunden werden. NSKFs bestimmen somit die Dichte der NSKF-Primer-Komplexe. In the case of a known NSKF concentration, in one embodiment the immobilization conditions can be selected such that the NSKFs are bound in a density of approx. 10 to 1000 molecules per 100 µm 2 . NSKFs thus determine the density of the NSKF primer complexes.

In einer anderen Ausführungsform kann die Dichte der immobilisierten NSKFs wesentlich höher als 1000 NSKFs pro 100 µm2 liegen, z. B. 1.000.000 pro 100 µm2. Die für die optische Detektion notwendige Dichte der NSKF-Primer-Komplexe wird während der Primer-Hybridisieruhg erreicht. Dabei sind die Hybridisierungsbedingungen (z. B. Temperatur, Zeit, Puffer) so zu wählen, dass die Primer nur an einen Teil der immobilisierten NSKFs binden. In another embodiment, the density of the immobilized NSKFs can be substantially higher than 1000 NSKFs per 100 µm 2 , e.g. B. 1,000,000 per 100 µm 2 . The density of the NSKF primer complexes required for optical detection is achieved during the primer hybridization. The hybridization conditions (e.g. temperature, time, buffer) should be selected so that the primers only bind to a part of the immobilized NSKFs.

Bei unbekannter NSKF-Konzentration und entsprechend unbekannter Immobilisationsdichte kann die Hybridisierung (Annealing) von Primern an die NSKFs zu einer höheren als optimale Dichte von NSKF-Primer-Komplexen führen. If the NSKF concentration is unknown and accordingly Hybridization can result in unknown immobilization density (Annealing) from primers to the NSKFs at a higher than lead to optimal density of NSKF primer complexes.

Aus diesem Grund wird in einer vorteilhaften Ausführungsform ein Teil der NSKFs enthaltenden Probe für die Ermittlung der optimalen Dichte verwendet. Dieser Teil wird auf einer Reaktionsoberfläche immobilisiert, die Primer werden an die NSKFs hybridisiert und die entstandenen NSKF-Primer-Komplexe werden durch den Einbau von Fluoreszenzfarbstoff tragenden NT*s (z. B. Cy3-dCTP, Amersham Pharmacia Biotech) markiert. Aus der ermittelten Dichte lässt sich einerseits die eventuell notwendige Verdünnung oder Konzentrierung der ursprünglichen Probe für den endgültigen Sequenzierungsansatz errechnen (Die Hybridisierungsbedingungen werden beibehalten). Andererseits können daraus notwendige Veränderungen in den Hybridisierungsbedingungen errechnet werden, beispielsweise eine Verkürzung der Hybridisierungszeit, wobei die NSKF-Immobilisierungsdichte konstant bleibt. For this reason, an advantageous embodiment a part of the sample containing NSKFs for the determination of the optimal density used. This part is on a Immobilized reaction surface, the primers are attached to the NSKFs hybridized and the resulting NSKF primer complexes are supported by the incorporation of fluorescent dye NT * s (e.g. Cy3-dCTP, Amersham Pharmacia Biotech) marked. On the one hand, the density determined can be used to determine the any necessary dilution or concentration of the original sample for the final sequencing approach calculate (The hybridization conditions are retained). On the other hand, this can result in necessary Changes in the hybridization conditions are calculated be shortened, for example Hybridization time, the NSKF immobilization density remains constant.

Das Mengen-Verhältnis zwischen Primerpopulationen kann unterschiedlich oder gleich groß sein. Durch eine höhere Primerkonzentrationen können gewisse, beispielsweise seltenere Sequenzen mit größerer Wahrscheinlichkeit in einem bestimmten Zeitraum gebunden werden. The quantity ratio between primer populations can be different or the same size. By a higher one Primer concentrations can be certain, for example less likely sequences in one certain period.

Der große Vorteil der beschriebenen Verfahrensanordnung gegenüber einer Verfahrensanordnung mit auf einer Oberfläche irnobilisierten sequenzspezifischen Primern und einer anschließenden Hybridisierung von Proben an diese Primer ist die deutliche Verkürzung der Zeit für die Hybridisierung (Annealing) zwischen den sequenzspezifischen Primern und den zu analysierenden Proben auf der Reaktionsoberfläche. The great advantage of the process arrangement described compared to a process arrangement with on a surface immobilized sequence-specific primers and one subsequent hybridization of samples to these primers the significant reduction in the time for hybridization (Annealing) between the sequence-specific primers and the samples to be analyzed on the reaction surface.

Legenden zu Fig. 1 bis 8Legends for Fig. 1 to 8 Legende zu Fig. 1Legend to Fig. 1 Schematische Darstellung der Sequenzierung einer langen NukleinsäureketteSchematic representation of a long sequencing nucleic acid chain

Der Sequenzierung und der Rekonstruktion von langen Nukleinsäuresequenzen (NSKs) liegt das Shotgun-Prinzip zugrunde. Die Sequenz eines langen DNA-Stücks wird dabei durch die Sequenzierung kleiner Fragmente (NSKFs) und eine nachfolgende Rekonstruktion ermittelt.

  • 1. Ausgangsmaterial - die zu analysierende lange Nukleinsäurensequenz, Gesamtsequenz
  • 2. Fragmente von 50-1000 bp - die im Fragmentierungsschritt aus der Gesamtsequenz erzeugten NSKFs
  • 3. Fragmente mit jeweils einem Primer - NSKF-Primer-Komplexe
  • 4. Immobilisierte Fragmente - an die plane Oberfläche gebundene NSKF-Primer-Komplexe, in dieser Ausführungsform erfolgt die Bindung am 3'-Ende der NSKFs
  • 5. Zugabe einer Lösung mit Polymerasen und NT*s - der erste Schritt in einem Zyklus der Sequenzierungsreaktion
  • 6. Waschschritt - nach dem Einbauschritt wird die Oberfläche gewaschen
  • 7. Detektion - die Signale von einzelnen eingebauten NT*s werden detektiert
  • 8. Entfernung der Markierung und der zur Termination führenden Gruppe
The sequencing and reconstruction of long nucleic acid sequences (NSKs) is based on the shotgun principle. The sequence of a long piece of DNA is determined by sequencing small fragments (NSKFs) and a subsequent reconstruction.
  • 1. Starting material - the long nucleic acid sequence to be analyzed, total sequence
  • 2. Fragments of 50-1000 bp - the NSKFs generated from the total sequence in the fragmentation step
  • 3. Fragments with one primer each - NSKF-primer complexes
  • 4. Immobilized fragments - NSKF primer complexes bound to the flat surface, in this embodiment the binding takes place at the 3 'end of the NSKFs
  • 5. Add a solution with polymerases and NT * s - the first step in a cycle of the sequencing reaction
  • 6. Washing step - after the installation step, the surface is washed
  • 7. Detection - the signals from individual built-in NT * s are detected
  • 8. Remove the marking and the group leading to the termination

Legende zur Fig. 2Legend for Fig. 2 Beispiele für allgemeine Struktur von NSKF-Primer-KomplexenExamples of general structure of NSKF primer complexes

In dieser Ausführungsform wird eine einheitliche Primerbindungsstelle (PBS) an das 3'-Ende der NSKFs angekoppelt und an diese PBS bindet ein einheitlicher Primer. In this embodiment, a unified Primer binding site (PBS) at the 3 'end of the NSKFs coupled and to this PBS binds a uniform primer.

Legende zur Fig. 3Legend to Fig. 3 Ein Beispiel für die Ankopplung einer einheitlichen Primerbindungsstelle (PBS), die eine funktionelle Gruppe zur Bindung an die Oberfläche trägtAn example of connecting a uniform Primer binding site (PBS), which is a functional group for Binding to the surface

In diesem Fall wird ein doppelsträngiger Oligonukleotidkomplex (3a), der beispielsweise eine Modifikation an beiden Strängen hat (3b), an die doppelsträngigen NSKFs liegiert (3c). Nach Denaturierung entstehen einzelsträngige NSKFs mit einheitlicher PBS (3d). In this case it becomes a double strand Oligonucleotide complex (3a), for example a Modification on both strands has (3b) to which double-stranded NSKFs lying (3c). After denaturation single-strand NSKFs with uniform PBS (3d) are created.

Legende zur Fig. 4Legend for Fig. 4 Ein anderes Beispiel für die Erzeugung einer einheitlichen Primerbindungsstelle (PBS)Another example of creating a unified Primer binding agency (PBS)

In diesem Fall werden NTs an das 3'-Ende der einzelsträngigen NSKFs angekoppelt (ein so genanntes "Tailing"). Durch Verwendung eines einheitlichen NT entsteht eine einheitliche PBS. In this case, NTs are at the 3 'end of the single strand NSKFs coupled (a so-called "tailing"). By Using a unified NT creates a unified PBS.

Legende zur Fig. 5Legend for Fig. 5 Beispiel für die Bindung von NSKFs an eine gelartige ReaktionsoberflächeExample of the binding of NSKFs to a gel-like one reaction surface

Auf einer festen Unterlage (1) haftet eine Gelschicht (2), z. B. ein Polyacrylamidgel (Fig. 5a), oder haften viele Gelkügelchen (5), z. B. Agarosekügelchen (Fig. 5b). An die Oberfläche des Gels sind NSKFs (4) gebunden. Die NSKFs tragen eine funktionelle Gruppe, z. B. Biotin, und sind an das Gel über Streptavidin oder Avidin (3) gebunden. A gel layer (2), e.g. B. a polyacrylamide gel ( Fig. 5a), or stick many gel beads (5), z. B. agarose beads ( Fig. 5b). NSKFs (4) are bound to the surface of the gel. The NSKFs have a functional group, e.g. B. biotin, and are bound to the gel via streptavidin or avidin (3).

Legende zur Fig. 6Legend for Fig. 6 Beispiel für eine DurchflussvorrichtungExample of a flow device

Eine gelartige Reaktionsoberfläche (1) ist auf einer für das Anregungs- und Fluoreszenzlicht durchlässige festen Unterlage (2) befestigt. Sie bilden zusammen den Deckel der Flow-Cell. Die Flüssigkeiten in der Flow-Cell können kontrolliert ausgetauscht werden, wobei die Flow-Cell zusammen mit Vorratsbehälter (3 ), Pumpe (4) und Ventil (5) eine Durchflussvorrichtung bilden. Auf der Reaktionsoberfläche sind NSKF-Primer-Komplexe gebunden (hier nicht abgebildet). Die Signale der eingebauten NT*s werden mit der Detektionsapparatur (6) detektiert. A gel-like reaction surface (1) is on one for the Solid base that is permeable to excitation and fluorescent light (2) attached. Together they form the lid of the flow cell. The liquids in the flow cell can be controlled can be replaced, the flow cell together with Storage container (3), pump (4) and valve (5) one Form flow device. On the reaction surface NSKF primer complexes are bound (not shown here). The signals of the built-in NT * s are with the Detection apparatus (6) detected.

Legende zur Fig. 7Legend for Fig. 7 Schematische Darstellung der Analyse von mRNA-PopulationSchematic representation of the analysis of mRNA population

Der Analyse liegt die Sequenzierung kurzer Abschnitte von mRNA zugrunde.

  • 1. mRNA - die zu analysierende mRNA-Population, in diesem Beispiel bestehend aus zwei unterschiedlichen mRNA- Molekülpopulationen (dünne und dicke Streifen repräsentieren mRNA-Moleküle)
  • 2. Immobilisierte mRNA - an die plane Oberfläche gebundene mRNA-Primer-Komplexe, in diesem Beispiel erfolgt die Bindung durch die Cligo-dT-Primer
  • 3. Zugabe einer Lösung mit Polymerasen und NT*s - der erste Schritt in einem Zyklus der Sequenzierungsreaktion
  • 4. Waschschritt - nach dem Einbauschritt wird die Oberfläche gewaschen
  • 5. Detektion - die Signale von einzelnen eingebauten NT*s werden detektiert
  • 6. Entfernung der Markierung und der zur Termination führenden Gruppe
The analysis is based on the sequencing of short sections of mRNA.
  • 1. mRNA - the mRNA population to be analyzed, in this example consisting of two different mRNA molecule populations (thin and thick strips represent mRNA molecules)
  • 2. Immobilized mRNA - mRNA-primer complexes bound to the flat surface, in this example the binding is carried out by the cligo-dT primer
  • 3. Add a solution with polymerases and NT * s - the first step in a cycle of the sequencing reaction
  • 4. Washing step - after the installation step, the surface is washed
  • 5. Detection - the signals from individual built-in NT * s are detected
  • 6. Remove the marking and the group leading to the termination

Legende zur Fig. 8Legend for Fig. 8 Beispiel für ein DetektionssystemExample of a detection system

Dargestellt ist ein Weitfeld-Optik-Detektionssystem. Nach dem Einbau von markierten NT*s wird die Oberfläche (7) abgescannt, wobei die. Fluoreszenzsignale von einzelnen, an die NTs gekoppelten Farbstoffmolekülen detektiert werden. A wide-field optical detection system is shown. After this Installation of marked NT * s the surface (7) scanned, the. Fluorescence signals from individual the NTs coupled dye molecules are detected.

Fig. 8a Schematische Darstellung eines Abschnittes der Reaktionsoberfläche (grau), der abgescannt wird. Die Kreise entsprechen jeweils der Aufnahme eines 2D-Bildes und repräsentieren die Flächen, von denen die Fluoreszenzsignale detektiert werden. Dabei werden pro Aufnahme mehrere Signale (beispielsweise 100 bis 10.000) von einzelnen Molekülen gleichzeitig registriert. Die Reaktionsoberfläche wird in jedem Zyklus abgescannt, wobei während des Scannvorganges mehrere Aufnahmen von unterschiedlichen Stellen der Oberfläche gemacht werden. Dabei können bis zu mehreren Millionen Signale von eingebauten NT*s aufgenommen werden. Die hohe Parallelität ist die Grundlage für die Geschwindigkeit des Verfahrens. Fig. 8a Schematic representation of a portion of the reaction surface (gray) that is scanned. The circles correspond to the recording of a 2D image and represent the areas from which the fluorescence signals are detected. Several signals (for example 100 to 10,000) of individual molecules are registered simultaneously per exposure. The reaction surface is scanned in each cycle, several images being taken from different locations on the surface during the scanning process. Up to several million signals can be recorded by built-in NT * s. The high degree of parallelism is the basis for the speed of the process.

Fig. 8b Eine Aufnahme (ein 2D-Bild) mit Signalen von einzelnen, eingebauten NT*s. Fig. 8b A recording (a 2D image) with signals from individual, built-in NT * s.

Fig. 8c Ausschnitt aus Abb. 8b. Der Ausschnitt zeigt Signale von vier eingebauten NT*s. Jedes Signal besitzt charakteristische Eigenschaften der Einzelmolekülsignale (s. Beschreibung) und kann aufgrund dieser identifiziert werden (vorzugsweise mit Hilfe eines Computer-Programms). Jedem der identifizierten Signale werden die entsprechenden X,Y- Koordinaten zugeordnet. Fig. 8c detail from Fig. 8b. The section shows signals from four built-in NT * s. Each signal has characteristic properties of the single molecule signals (see description) and can be identified on the basis of these (preferably with the aid of a computer program). The corresponding X, Y coordinates are assigned to each of the identified signals.

Claims (42)

1. Verfahren zur parallelen Sequenzanalyse von Nukleinsäuresequenzen (Nukleinsäureketten, NSKs), bei dem man
Fragmente (NSKFs) einzelsträngiger NSKs mit einer Länge von etwa 50 bis 1000 Nukleotiden erzeugt, die überlappende Teilsequenzen einer Gesamtsequenz darstellen können, man
die NSKFs unter Verwendung eines einheitlichen oder mehrerer unterschiedlichen Primer in Form von NSKF-Primer- Komplexen auf einer Reaktionsoberfläche in einer zufälligen Anordnung bindet, man
eine zyklische Aufbaureaktion des komplementären Stranges der NSKFs unter Verwendung einer oder mehrerer Polymerasen durchführt, indem man a) zu den auf der Oberfläche gebundenen NSKF-Primer- Komplexen eine Lösung zugibt, die eine oder mehrere Polymerasen und ein bis vier modifizierte Nukleotide (NTs*) enthält, die mit Fluoreszenzfarbstoffen markiert sind, wobei die bei gleichzeitiger Verwendung von mindestens zwei NTs* jeweils an den NTs* befindlichen Fluoreszenzfarbstoffe so gewählt sind, dass sich die verwendeten NTs* durch Messung unterschiedlicher Fluoreszenzsignale voneinander unterscheiden lassen, wobei die NTs* an der 3'- Position strukturell so modifiziert sind, daß die Polymerase nach Einbau eines solchen NT' in einen wachsenden komplementären Strang nicht in der Lage ist, ein weiteres NT* in denselben Strang einzubauen, wobei der zur Termination führende Substituent und der Fluoreszenzfarbstoff abspaltbar ist, man b) die in Stufe a) erhaltene stationäre Phase unter Bedingungen inkubiert, die zur Verlängerung der komplementären Stränge geeignet sind, wobei die komplementären Stränge jeweils um ein NT* verlängert werden, man c) die in Stufe b) erhaltene stationäre Phase unter Bedingungen wäscht, die zur Entfernung nicht in einen komplementären Strang eingebauter NTs* geeignet sind, man d) die einzelnen, in komplementäre Stränge eingebauten NT* durch Messen des für den jeweiligen Fluoreszenzfarbstoff charakteristischen Signals detektiert, wobei man gleichzeitig die relative Position der einzelnen Fluoreszenzsignale auf der Reaktionsoberfläche bestimmt, man e) zur Erzeugung unmarkierter (NTs oder) NSKFs die zur Termination führenden Substituenten und die Fluoreszenzfarbstoffe von den am komplementären Strang angefügten NTs* abspaltet, man f) die in Stufe e) erhaltene stationäre Phase unter Bedingungen wäscht, die zur Entfernung der Fluoreszenzfarbstoffe und der Liganden geeignet sind, man die Stufen a) bis f) gegebenenfalls mehrfach wiederholt,
wobei man die relative Position einzelner NSKF-Primer- Komplexe auf der Reaktionsoberfläche und die Sequenz dieser NSKFs durch spezifische Zuordnung der in Stufe d) in aufeinanderfolgenden Zyklen an den jeweiligen Positionen detektierten Fluoreszenzsignale zu den NTs bestimmt.
1. A method for parallel sequence analysis of nucleic acid sequences (nucleic acid chains, NSKs), in which one
Generated fragments (NSKFs) of single-stranded NSKs with a length of about 50 to 1000 nucleotides, which can represent overlapping partial sequences of an entire sequence
the NSKFs are bound on a reaction surface in a random arrangement using one or more different primers in the form of NSKF-primer complexes
cyclically build the complementary strand of the NSKFs using one or more polymerases by a) a solution is added to the NSKF primer complexes bound to the surface, which contains one or more polymerases and one to four modified nucleotides (NTs *) which are labeled with fluorescent dyes, the simultaneous use of at least two NTs * each of the fluorescent dyes located on the NTs * are selected such that the NTs * used can be distinguished from one another by measuring different fluorescence signals, the NTs * at the 3 'position being structurally modified such that the polymerase after incorporation of such an NT' in a growing complementary strand is unable to incorporate another NT * into the same strand, the terminating substituent and the fluorescent dye being removable, man b) the stationary phase obtained in stage a) is incubated under conditions which are suitable for the extension of the complementary strands, the complementary strands being extended by one NT * each, c) the stationary phase obtained in stage b) is washed under conditions which are not suitable for the removal of NTs * which are not incorporated into a complementary strand d) the individual NT * built into complementary strands are detected by measuring the signal characteristic of the respective fluorescent dye, the relative position of the individual fluorescent signals on the reaction surface being determined at the same time e) to generate unlabeled (NTs or) NSKFs, the substituents leading to the termination and the fluorescent dyes are cleaved from the NTs * attached to the complementary strand, man f) the stationary phase obtained in step e) is washed under conditions which are suitable for removing the fluorescent dyes and the ligands stages a) to f) are repeated several times, if necessary,
the relative position of individual NSKF-primer complexes on the reaction surface and the sequence of these NSKFs being determined by specific assignment of the fluorescence signals detected in step d) in successive cycles at the respective positions to the NTs.
2. Verfahren nach Anspruch 1, dadurch gekennzeichnet, dass man die Stufen a) bis f) der zyklischen Aufbaureaktion mehrfach wiederholt, wobei man in jedem Zyklus nur jeweils ein markiertes NT* einsetzt. 2. The method according to claim 1, characterized in that stages a) to f) of the cyclic build-up reaction repeated several times, only in each cycle a marked NT * is used. 3. Verfahren nach Anspruch 1, dadurch gekennzeichnet, dass man die Stufen a) bis f) der zyklischen Aufbaureaktion mehrfach wiederholt, wobei man in jedem Zyklus jeweils zwei unterschiedlich markierte NTs* einsetzt. 3. The method according to claim 1, characterized in that stages a) to f) of the cyclic build-up reaction repeated several times, one in each cycle uses two differently marked NTs *. 4. Verfahren nach Anspruch 1, dadurch gekennzeichnet, dass man die Stufen a) bis f) der zyklischen Aufbaureaktion mehrfach wiederholt, wobei man in jedem Zyklus jeweils vier unterschiedlich markierte NTs* einsetzt. 4. The method according to claim 1, characterized in that stages a) to f) of the cyclic build-up reaction repeated several times, one in each cycle uses four differently marked NTs *. 5. Verfahren nach Anspruch 1, dadurch gekennzeichnet, dass die NSKs Varianten einer bekannten Referenzsequenz sind und man die Stufen a) bis f) der zyklischen Aufbaureaktion mehrfach wiederholt, wobei man in den Zyklen abwechselnd jeweils zwei unterschiedlich markierte NTs* und zwei unmarkierte NTs einsetzt und man die Gesamtsequenzen durch Vergleich mit der Referenzsequenz ermittelt. 5. The method according to claim 1, characterized in that the NSKs are variants of a known reference sequence and stages a) to f) of the cyclic build-up reaction repeated several times, alternating in the cycles two differently marked NTs * and two unlabeled NTs and you go through the total sequences Comparison with the reference sequence determined. 6. Verfahren nach den Ansprüchen 1 bis 5, dadurch gekennzeichnet, dass man in die NSKFs jeweils eine Primerbindungsstelle (PBS) einführt, wobei man bei doppelsträngigen NSKs an beiden komplementären Einzelsträngen jeweils eine PBS einführt und wobei die Primerbindungsstellen für alle NSKFs jeweils gleiche oder verschiedene Sequenzen aufweisen. 6. The method according to claims 1 to 5, characterized characterized that one in each NSKFs Introduces primer binding site (PBS), whereby one with double-stranded NSKs on each of two complementary single strands Introduces PBS and where the primer binding sites for everyone NSKFs each have the same or different sequences exhibit. 7. Verfahren nach den Ansprüchen 1 bis 6, dadurch gekennzeichnet, dass man die NSKFs mit Primern in einer Lösung unter Bedingungen in Kontakt bringt, die zur Hybridisierung der Primer an die Primerbindungsstellen (PBSs) der NSKFs geeignet sind, wobei die Primer untereinander gleiche oder verschiedene Sequenzen aufweisen, und man die gebildeten NSKF-Primer-Komplexe anschließend auf der Reaktionsoberfläche bindet. 7. The method according to claims 1 to 6, characterized characterized that the NSKFs with primers in a solution under conditions that lead to Hybridization of the primers to the primer binding sites (PBSs) of the NSKFs are suitable, with the primers among themselves have the same or different sequences, and the formed NSKF primer complexes subsequently on the Reaction surface binds. 8. Verfahren nach den Ansprüchen 1 bis 6, dadurch gekennzeichnet, dass man die NSKFs zunächst auf der Reaktionsoberfläche immobilisiert und erst anschließend mit Primern unter Bedingungen in Kontakt bringt, die zur Hybridisierung der Primer an die Primerbindungsstellen (PBSs) der NSKFs geeignet sind, wobei NSKF-Primer-Komplexe gebildet werden, wobei die Primer untereinander gleiche oder verschiedene Sequenzen aufweisen. 8. The method according to claims 1 to 6, characterized characterized that the NSKFs are initially on the Immobilized reaction surface and only then with primers under conditions that lead to Hybridization of the primers to the primer binding sites (PBSs) of the NSKFs are suitable, with NSKF primer complexes being formed be, the primers being the same as each other or have different sequences. 9. Verfahren nach den Ansprüchen 1 bis 6, dadurch gekennzeichnet, dass man die Primer zunächst auf der Reaktionsoberfläche immobilisiert und erst anschließend mit NSKFs unter Bedingungen in Kontakt bringt, die zur Hybridisierung der Primer an die Primerbindungsetellen (PBSs) der NSKFs geeignet sind, wodurch NSKFs an die Oberfläche gebunden und NSKF-Prirner-Komplexe gebildet werden, wobei die Primer untereinander gleiche oder verschiedene Sequenzen aufweisen. 9. The method according to claims 1 to 6, characterized characterized in that the primers are initially on the Immobilized reaction surface and only afterwards with NSKFs under conditions that lead to Hybridization of the primers to the primer binding sites (PBSs) of the NSKFs are suitable, whereby NSKFs are linked to the Surface bound and NSKF-Prirner complexes formed be, the primers being the same as each other or have different sequences. 10. verfahren nach den Ansprüchen 1 bis 9, dadurch gekennzeichnet, dass die Dichte der extensionsfähigen NSKF-Primer-Komplexe zwischen etwa 10 und 100 pro 100 µm2 liegt. 10. The method according to claims 1 to 9, characterized in that the density of the NSKF primer complexes capable of extension is between about 10 and 100 per 100 µm 2 . 11. Verfahren nach Anspruch 1, dadurch gekennzeichnet, dass die Nukleinsäuresequenzen (NSKs) Sequenzabschnitte einer Gesamtsequenz sind und die Primer sequenzspezifische Primer sind, wobei man
einzelsträngige NSKFs mit einer Länge von etwa 30 bis 1000 Nukleotiden bereitstellt, die überlappenden Teilsequenzen der Gesamtsequenz entsprechen, man
die NSKF-Moleküle direkt an einer planen Oberfläche in einer zufälligen Anordnung bindet, man
mit einer oder mehreren sequenzspezifischen Primerpopulationen eine Hybridisierung (Annealing) an die immobilisierten NSKFs durchführt, wobei die Dichte der einzelnen extensionsfähigen NSKF-Primer-Komplexe zwischen 10 und 100 pro 100 µm2 liegt, man
eine zyklische Aufbaureaktion der zu NSKFs komplementären Stränge durchführt, indem man a) zu den gebundenen NSKF-Primer-Komplexen eine Lösung zugibt, die eine oder mehrere Polymerasen und ein bis vier modifizierte Nukleotide (NTs*) enthält, die mit Fluoreszenzfarbstoffen markiert sind, wobei die bei gleichzeitiger Verwendung von mindestens zwei NTs* jeweils an den NTs* befindlichen Fluoreszenzfarbstoffe so gewählt sind, daß sich die verwendeten NTs* durch Messung unterschiedlicher Fluoreszenzsignale voneinander unterscheiden lassen, wobei die NTs* an der 3'-Position strukturell so modifiziert sind, daß die Polymerase nach Einbau eines solchen NT* in einen wachsenden komplementären Strang nicht in der Lage ist, ein weiteres NT* in denselben Strang einzubauen, wobei der zur Termination führende Substituent und der Fluoreszenzfarbstoff abspaltbar ist, man b) die in Stufe a) erhaltene stationäre Phase unter Bedingungen inkubiert, die zur Verlängerung der komplementären Stränge geeignet sind, wobei die komplementären Stränge jeweils um ein NT* verlängert werden, man c) die in Stufe b) erhaltenen stationären Phase unter Bedingungen wäscht, die zur Entfernung nicht in einen komplementären Strang eingebauter NTs* geeignet sind, man d) die einzelnen, in komplementäre Stränge eingebauten NT*-Moleküle durch Messen des für den jeweiligen Fluoreszenzfarbstoff charakteristischen Signals detektiert, wobei man gleichzeitig die relative Position der einzelnen Fluoreszenzsignale auf der Reaktionsoberfläche bestimmt, man e) die zur Termination führenden Substituenten und die Fluoreszenzfarbstoffe von den am komplementären Strang angefügten NTs* zur Erzeugung unmarkierter (NTs oder) NSKFs abspaltet, man f) die in Stufe e) erhaltene stationäre Phase unter Bedingungen wäscht, die zur Entfernung der zu Termination führenden Gruppen mit den Fluoreszenzfarbstoffen geeignet sind, man die Stufen a) bis f) gegebenenfalls mehrfach wiederholt,
wobei man die relative Position einzelner NSKF-Primer- Komplexe auf der Reaktionsoberfläche und die Sequenz dieser NSKFs durch spezifische Zuordnung der in Stufe d) in aufeinanderfolgenden Zyklen an den jeweiligen Positionen detektierten Fluoreszenzsignale zu den NTs bestimmt.
11. The method according to claim 1, characterized in that the nucleic acid sequences (NSKs) are sequence sections of an overall sequence and the primers are sequence-specific primers, wherein one
provides single-stranded NSKFs with a length of about 30 to 1000 nucleotides, which correspond to overlapping partial sequences of the entire sequence
the NSKF molecules bind directly to a flat surface in a random arrangement, one
hybridization (annealing) to the immobilized NSKFs is carried out with one or more sequence-specific primer populations, the density of the individual NSKF-primer complexes capable of extension being between 10 and 100 per 100 μm 2
performs a cyclic build-up reaction of the strands complementary to NSKFs by a) a solution is added to the bound NSKF-primer complexes, which contains one or more polymerases and one to four modified nucleotides (NTs *), which are labeled with fluorescent dyes, with the simultaneous use of at least two NTs * each on the Fluorescent dyes located in NTs * are selected such that the NTs * used can be distinguished from one another by measuring different fluorescence signals, the NTs * at the 3 'position being structurally modified such that the polymerase after incorporation of such an NT * into a growing complementary one Strand is unable to incorporate another NT * into the same strand, the terminating substituent and the fluorescent dye being removable, man b) the stationary phase obtained in stage a) is incubated under conditions which are suitable for the extension of the complementary strands, the complementary strands being extended by one NT * each, c) the stationary phase obtained in stage b) is washed under conditions which are not suitable for the removal of NTs * which are not incorporated in a complementary strand d) the individual NT * molecules built into complementary strands are detected by measuring the signal characteristic of the respective fluorescent dye, at the same time determining the relative position of the individual fluorescent signals on the reaction surface e) the substituents leading to the termination and the fluorescent dyes are cleaved from the NTs * attached to the complementary strand to produce unlabelled (NTs or) NSKFs, man f) the stationary phase obtained in step e) is washed under conditions which are suitable for removing the groups leading to termination with the fluorescent dyes stages a) to f) are repeated several times, if necessary,
the relative position of individual NSKF-primer complexes on the reaction surface and the sequence of these NSKFs being determined by specific assignment of the fluorescence signals detected in step d) in successive cycles at the respective positions to the NTs.
12. Verfahren zur hoch parallelen Analyse der Genexpression bei dem man
einzelsträngige Genprodukte bereitstellt, man
die Genprodukte unter Verwendung eines einheitlichen oder mehrerer unterschiedlichen Primer in Form von Genprodukt- Primer-Komplexen auf einer Reaktionsoberfläche in einer zufälligen Anordnung bindet, man
eine zyklische Aufbaureaktion des komplementären Stranges der Genprodukte unter Verwendung einer oder mehrerer Polymerasen durchführt, indem man a) zu den auf der Oberfläche gebundenen Genprodukt- Primer-Komplexen eine Lösung zugibt, die eine oder mehrere Polymerasen und ein bis vier modifizierte Nukleotide (NTs*) enthält, die mit Fluoreszenzfarbstoffen markiert sind, wobei die bei gleichzeitiger Verwendung von mindestens zwei NTs* jeweils an den NTs* befindlichen Fluoreszenzfarbstoffe so gewählt sind, dass sich die verwendeten NTs* durch Messung unterschiedlicher Fluoreszenzsignale voneinander unterscheiden lassen, wobei die NTs* an der 3'- Position strukturell so modifiziert sind, daß die Polymerase nach Einbau eines solchen NT* in einen wachsenden komplementären Strang nicht in der Lage ist, ein weiteres NT* in denselben Strang einzubauen, wobei der zur Termination führende Substituent und der Fluoreszenzfarbstoff abspaltbar ist, man b) die in Stufe a) erhaltene stationäre Phase unter Bedingungen inkubiert, die zur Verlängerung der komplementären Stränge geeignet sind, wobei die komplementären Stränge jeweils um ein NT* verlängert werden, man c) die in Stufe b) erhaltene stationäre Phase unter Bedingungen wäscht, die zur Entfernung nicht in einen komplementären Strang eingebauter NTs* geeignet sind, man d) die einzelnen, in komplementäre Stränge eingebauten NTs* durch Messen des für den jeweiligen Fluoreszenzfarbstoff charakteristischen Signals detektiert, wobei man gleichzeitig die relative Position der einzelnen Fluoreszenzsignale auf der Reaktionsoberfläche bestimmt, man e) zur Erzeugung unmarkierter, (NTs oder) Genprodukte die zur Termination führenden Substituenten und die Fluoreszenzfarbstoffe von den am komplementären Strang angefügten NTs* abspaltet, man f) die in Stufe e) erhaltene stationäre Phase unter Bedingungen wäscht, die zur Entfernung der Fluoreszenzfarbstoffe und der Liganden geeignet sind, man die Stufen a) bis f) gegebenenfalls mehrfach wiederholt,
wobei man die relative Position einzelner Genprodukt- Primer-Komplexe auf der Reaktionsoberfläche und die Sequenz dieser Genprodukte durch spezifische Zuordnung der in Stufe d) in aufeinanderfolgenden Zyklen an den jeweiligen Positionen detektierten Fluoreszenzsignale zu den NTs bestimmt und man aus den ermittelten Teilsequenzen die Identität der Genprodukte bestimmt.
12. Method for highly parallel analysis of gene expression in which one
provides single-stranded gene products, one
the gene products are bound to a reaction surface in a random arrangement using one or more different primers in the form of gene product-primer complexes, one
perform a cyclic build-up reaction of the complementary strand of the gene products using one or more polymerases by a) a solution is added to the gene product-primer complexes bound to the surface which contains one or more polymerases and one to four modified nucleotides (NTs *) which are labeled with fluorescent dyes, the simultaneous use of at least two NTs * each of the fluorescent dyes located on the NTs * are selected such that the NTs * used can be distinguished from one another by measuring different fluorescence signals, the NTs * at the 3 'position being structurally modified such that the polymerase after incorporation of such an NT * in a growing complementary strand is unable to incorporate another NT * into the same strand, the terminating substituent and the fluorescent dye being removable, man b) the stationary phase obtained in stage a) is incubated under conditions which are suitable for the extension of the complementary strands, the complementary strands being extended by one NT * each, c) the stationary phase obtained in stage b) is washed under conditions which are not suitable for the removal of NTs * which are not incorporated into a complementary strand d) the individual NTs * built into complementary strands are detected by measuring the signal which is characteristic of the respective fluorescent dye, the relative position of the individual fluorescent signals on the reaction surface being determined at the same time e) to generate unlabelled (NTs or) gene products, the substituents leading to the termination and the fluorescent dyes are cleaved from the NTs * attached to the complementary strand, man f) the stationary phase obtained in step e) is washed under conditions which are suitable for removing the fluorescent dyes and the ligands stages a) to f) are repeated several times, if necessary,
whereby the relative position of individual gene product-primer complexes on the reaction surface and the sequence of these gene products are determined by specific assignment of the fluorescence signals detected in step d) in successive cycles at the respective positions to the NTs and the identity of the gene products is determined from the partial sequences determined certainly.
13. Verfahren nach Anspruch 12, dadurch gekennzeichnet, dass man die Stufen a) bis f) der zyklischen Aufbaureaktion mehrfach wiederholt, wobei man in jedem Zyklus nur jeweils ein markiertes NT* einsetzt. 13. The method according to claim 12, characterized in that stages a) to f) of the cyclic build-up reaction repeated several times, only in each cycle each uses a marked NT *. 14. Verfahren nach Anspruch 12, dadurch gekennzeichnet, dass man die Stufen a) bis f) der zyklischen Aufbaureaktion mehrfach wiederholt, wobei man in jedem Zyklus jeweils zwei unterschiedlich markierte NTs* einsetzt. 14. The method according to claim 12, characterized in that stages a) to f) of the cyclic build-up reaction repeated several times, one in each cycle uses two differently marked NTs *. 15. Verfahren nach Anspruch 12, dadurch gekennzeichnet, dass man die Stufen a) bis f) der zyklischen Aufbaureaktion mehrfach wiederholt, wobei man in jedem Zyklus jeweils vier unterschiedlich markierte NTs* einsetzt. 15. The method according to claim 12, characterized in that stages a) to f) of the cyclic build-up reaction repeated several times, one in each cycle uses four differently marked NTs *. 16. Verfahren nach Anspruch 12, dadurch gekennzeichnet, dass bereits bekannte Gene als Referenzsequenzen dienen und man die Stufen a) bis f) der zyklischen Aufbaureaktion mehrfach wiederholt, wobei man in den Zyklen abwechselnd jeweils zwei unterschiedlich markierte NTs* und zwei unmarkierte NTs einsetzt und man die Identität der Genprodukte durch Vergleich der gewonnenen Sequenzen mit denen der Referenzsequenzen ermittelt. 16. The method according to claim 12, characterized in that already known genes serve as reference sequences and stages a) to f) of the cyclic build-up reaction repeated several times, alternating in the cycles two differently marked NTs * and two uses unmarked NTs and the identity of the Gene products by comparing the sequences obtained with those of the reference sequences determined. 17. Verfahren nach den Ansprüchen 12 bis 16, dadurch gekennzeichnet, dass man in die Genprodukte jeweils eine Primerbindungsstelle (PBS) einführt, wobei die Primerbindungsstellen für alle Genprodukte jeweils gleiche oder verschiedene Sequenzen aufweisen. 17. The method according to claims 12 to 16, characterized characterized in that one in each of the gene products Introduces primer binding site (PBS), the Primer binding sites for the same or identical gene products have different sequences. 18. Verfahren nach den Ansprüchen 12 bis 17, dadurch gekennzeichnet, dass man die Genprodukte mit Primern in einer Lösung unter Bedingungen in Kontakt bringt, die zur Hybridisierung der Primer an die Primerbindungsstellen (PBSs) der Genprodukte geeignet sind, wobei die Primer untereinander gleiche oder verschiedene Sequenzen aufweisen, und man die gebildeten Genprodukt-Primer- Komplexe anschließend auf der Reaktionsoberfläche bindet. 18. The method according to claims 12 to 17, characterized characterized that the gene products with primers in one Contacting solution under conditions leading to Hybridization of the primers to the primer binding sites (PBSs) of the gene products are suitable, the primers mutually identical or different sequences and the gene product primer formed Complex subsequently binds to the reaction surface. 19. Verfahren nach den Ansprüchen 12 bis 17, dadurch gekennzeichnet, dass man die Genprodukte zunächst auf der Reaktionsoberfläche immobilisiert und erst anschließend mit Primern unter Bedingungen in Kontakt bringt, die zur Hybridisierung der Primer an die Primerbindungsstellen (PBSs) der Genprodukte geeignet sind, wobei Genprodukt- Primer-Komplexe gebildet werden, wobei die Primer untereinander gleiche oder verschiedene Sequenzen aufweisen. 19. The method according to claims 12 to 17, characterized characterized in that the gene products are initially on the Immobilized reaction surface and only then with Contacting primers under conditions leading to Hybridization of the primers to the primer binding sites (PBSs) of the gene products are suitable, Primer complexes are formed, the primer mutually identical or different sequences exhibit. 20. Verfahren nach den Ansprüchen 12 bis 17, dadurch gekennzeichnet, dass man die Primer zunächst auf der Reaktionsoberfläche immobilisiert und erst anschließend mit Genprodukten unter Bedingungen in Kontakt bringt, die zur Hybridisierung der Primer an die Primerbindungsstellen (PBSs) der Genprodukte geeignet sind, wodurch Genprodukte an die Oberfläche gebunden und Genprodukt-Primer-Komplexe gebildet werden, wobei die Primer untereinander gleiche oder verschiedene Sequenzen aufweisen. 20. The method according to claims 12 to 17, characterized characterized in that the primers are initially on the Immobilized reaction surface and only then with Brings gene products into contact under conditions that lead to Hybridization of the primers to the primer binding sites (PBSs) of the gene products are suitable, thereby creating gene products bound to the surface and gene product primer complexes are formed, the primers being identical to one another or have different sequences. 21. Verfahren nach den Ansprüchen 12 bis 20, dadurch gekennzeichnet, dass die Dichte der extensionsfähigen Genprodukt-Primer-Komplexe zwischen etwa 10 und 100 pro 100 µm2 liegt. 21. The method according to claims 12 to 20, characterized in that the density of the extensible gene product-primer complexes is between about 10 and 100 per 100 µm 2 . 22. Verfahren nach Ansprüchen 1 bis 21 dadurch gekennzeichnet, dass der Fluoreszenzfarbstoff zusammen mit dem zur Termination führenden Substituenten abgespalten wird. 22. The method according to claims 1 to 21, characterized in that the fluorescent dye together with that for Termination leading substituents is split off. 23. Verfahren nach Ansprüchen 1 bis 21 dadurch gekennzeichnet, dass zunächst der Fluoreszenzfarbstoff abgespalten wird und erst danach der zur Termination führende Substituent abgespalten wird. 23. The method according to claims 1 to 21, characterized in that the fluorescent dye is first split off and only then the substituent leading to the termination is split off. 24. Verfahren nach Ansprüchen 1 bis 21, dadurch gekennzeichnet, dass man im Detektionsschritt (d) folgende Detektionsarten einsetzt: Weitfeld- Epifluoreszenzmikroskopie, Laser-Scanning- Fluoreszenzmikroskopie, TIRF-Mikroskopie. 24. The method according to claims 1 to 21, characterized characterized in that in the detection step (d) uses the following types of detection: Epifluorescence microscopy, laser scanning Fluorescence microscopy, TIRF microscopy. 25. Verfahren nach den Ansprüchen 1 oder 11, dadurch gekennzeichnet, dass es ein Verfahren zur SNP-Analyse ist und man einen sequenzspezifischen Primer zur Identifizierung jeder SNP-Stelle in der Gesamtsequenz verwendet. 25. The method according to claims 1 or 11, characterized characterized that it is a procedure for SNP analysis and you use a sequence-specific primer Identification of each SNP site in the overall sequence used. 26. Verfahren nach Anspruch 25, dadurch gekennzeichnet, dass die Zahl der parallel zu analysierenden SNP-Stellen größer als 2 ist und man für jede SNP-Stelle einen sequenzspezifischen Primer verwendet. 26. The method according to claim 25, characterized in that the number of SNP positions to be analyzed in parallel is greater than 2 and one for each SNP position sequence-specific primer used. 27. Verfahren nach den Ansprüchen 1 bis 26, dadurch gekennzeichnet, dass die Reaktionsoberfläche aus der Gruppe bestehend aus Silicon, Glas, Keramik, Kunststoffen, Gelen ausgewählt ist. 27. The method according to claims 1 to 26, characterized characterized that the reaction surface from the group consisting of silicone, glass, ceramics, plastics, gels is selected. 28. Verfahren nach Anspruch 27, dadurch gekennzeichnet, dass die Kunststoffe Polycarbonate oder Polystyrole oder Derivate derselben sind. 28. The method according to claim 27, characterized in that the plastics polycarbonates or polystyrenes or Derivatives are the same. 29. Verfahren nach Anspruch 27, dadurch gekennzeichnet, dass die Gele Agarose- oder Polyacrylamidgele oder Derivate derselben sind. 29. The method according to claim 27, characterized in that the gels agarose or polyacrylamide gels or derivatives are the same. 30. Verfahren nach Anspruch 29, dadurch gekennzeichnet, dass die Gele 1 bis 2% Agarose-Gele oder 10 bis 15% Polyacrylamid-Gele sind. 30. The method according to claim 29, characterized in that the gels 1 to 2% agarose gels or 10 to 15% Are polyacrylamide gels. 31. Verfahren nach den Ansprüchen 1 bis 30, dadurch gekennzeichnet, dass die Polymerase eine DNA-Polymerase ohne 3'-5'-Exonukleaseaktivität ist. 31. The method according to claims 1 to 30, characterized characterized in that the polymerase is a DNA polymerase without 3'-5 'exonuclease activity. 32. Verfahren nach Anspruch 31, dadurch gekennzeichnet, daß die Polymerase aus der Gruppe bestehend aus viralen DNA- Polymerasen vom Sequenase-Typ, bakteriellen thermolabilen und thermostabilen DNA-Polymerasen, DNA- Polymerasen Beta aus Eukaryonten und Reversen- Transkriptasen ausgewählt ist. 32. The method according to claim 31, characterized in that the polymerase from the group consisting of viral DNA Sequenase-type polymerases, bacterial thermolabile and thermostable DNA polymerases, DNA Polymerases beta from eukaryotes and reverse Transcriptases is selected. 33. Verfahren nach den Ansprüchen 1 bis 32, dadurch gekennzeichnet, dass die Fluoreszenzfarbstoffe aus der Gruppe bestehend aus Cyanin-Farbstoffen, Rhodamine, Xanthene, Porphyrine und deren Derivaten ausgewählt sind. 33. The method according to claims 1 to 32, characterized characterized in that the fluorescent dyes from the Group consisting of cyanine dyes, rhodamines, Xanthenes, porphyrins and their derivatives are selected. 34. Träger zur Durchführung des Verfahrens nach den Ansprüchen 1 bis 33, dadurch gekennzeichnet, dass auf seiner Oberfläche die Nukleinsäureketten oder deren Fragmente in einer zufälligen Anordnung immobilisiert sind, wobei die Dichte der immobilisierten Nukleinsäureketten-Moleküle oder deren Fragmente zwischen 10 und 100 pro 100 µm2 liegt. 34. Carrier for carrying out the method according to claims 1 to 33, characterized in that the nucleic acid chains or their fragments are immobilized in a random arrangement on its surface, the density of the immobilized nucleic acid chain molecules or their fragments between 10 and 100 per 100 µm 2 lies. 35. Träger zur Durchführung des Verfahrens nach den Ansprüchen 1 bis 33, dadurch gekennzeichnet, dass auf seiner Oberfläche die Nukleinsäureketten oder deren Fragmente in einer zufälligen Anordnung immobilisiert sind, wobei die Dichte der immobilisierten Nukleinsäureketten-Moleküle oder deren Fragmente zwischen 100 und 1.000.000 pro 100 µm2 liegt. 35. Carrier for performing the method according to claims 1 to 33, characterized in that the nucleic acid chains or their fragments are immobilized in a random arrangement on its surface, the density of the immobilized nucleic acid chain molecules or their fragments between 100 and 1,000,000 per 100 µm 2 . 36. Kit zur Durchführung des Verfahrens nach den Ansprüchen 1 bis 35, dadurch gekennzeichnet, daß es eine Reaktionsoberfläche (einen festen Träger), zur Durchführung des Verfahrens erforderliche Reaktionslösungen, ein oder mehrere Polymerasen, und Nukleotide (NTs) enthält, von denen ein bis vier mit Fluoreszenzfarbstoffen markiert sind, wobei die markierten NTs ferner strukturell so modifiziert sind (NT* bzw. NTs*), daß die Polymerase nach Einbau eines solchen NT* in einen wachsenden komplementären Strang nicht in der Lage ist, ein weiteres. NT* in denselben Strang einzubauen, wobei der zur Termination führende Substituent mit dem Fluoreszenzfarbstoff abspaltbar ist 36. Kit for performing the method according to the claims 1 to 35, characterized in that it is a Reaction surface (a solid support) for Perform the procedure required Reaction solutions, one or more polymerases, and Contains nucleotides (NTs), one to four of which contain Fluorescent dyes are marked, the marked NTs are also structurally modified in this way (NT * or NTs *) that the polymerase after installation of such an NT * in a growing complementary strand unable is another. To install NT * in the same line, the substituent leading to the termination with the Fluorescent dye is cleavable 37. Kit nach Anspruch 36, dadurch gekennzeichnet, daß es ferner Bestandteile enthält: a) zur Erzeugung von Einzelsträngen aus Doppelsträngen erforderliche Reagenzien, b) Nukleinsäuremoleküle, die als PBS in die NSKFs eingeführt werden, c) Oligonukleotid-Primer, d) zur Abspaltung der Substituenten mit den Fluoreszenzfarbstoffen erforderliche Reagenzien, e) Waschlösungen. 37. Kit according to claim 36, characterized in that it further contains components: a) reagents required for the production of single strands from double strands, b) nucleic acid molecules which are introduced as PBS into the NSKFs, c) oligonucleotide primers, d) reagents required to split off the substituents with the fluorescent dyes, e) washing solutions. 38. Kit nach den Anspruch 36 oder 37, dadurch gekennzeichnet, daß die Reaktionsoberfläche aus der Gruppe bestehend aus Silicon, Glas, Keramik, Kunststoffen, Gelen ausgewählt ist. 38. Kit according to claim 36 or 37, characterized characterized in that the reaction surface from the Group consisting of silicone, glass, ceramic, Plastics, gels is selected. 39. Kit nach Anspruch 38, dadurch gekennzeichnet, daß die Gele Polyacrylamidgele sind. 39. Kit according to claim 38, characterized in that the Gels are polyacrylamide gels. 40. Kit nach Anspruch 39, dadurch gekennzeichnet, daß die Gele 5 bis 30% Polyacrylamid-Gele sind. 40. Kit according to claim 39, characterized in that the Gels are 5 to 30% polyacrylamide gels. 41. Kit nach den Ansprüchen 36 bis 40, dadurch gekennzeichnet, daß die DNA-Polymerase eine DNA-Polymerase ohne 3'- 5'-Endonukleaseaktivität ist. 41. Kit according to claims 36 to 40, characterized characterized in that the DNA polymerase is a DNA polymerase without 3'- 5'-endonuclease activity. 42. Kit nach den Ansprüchen 36 bis 41, dadurch gekennzeichnet, daß die an die Nukleotide gekoppelten Fluoreszenzfarbstoffe aus der Gruppe bestehend aus Cyanin-Farbstoffen, Rhodamine, Xanthene, Porphyrine und deren Derivaten ausgewählt sind. 42. Kit according to claims 36 to 41, characterized characterized in that the coupled to the nucleotides Fluorescent dyes from the group consisting of Cyanine dyes, rhodamines, xanthenes, porphyrins and whose derivatives are selected.
DE10239504A 2001-08-29 2002-08-28 Parallel sequencing of nucleic acid fragments, useful e.g. for detecting mutations, comprises sequential single-base extension of immobilized fragment-primer complex Ceased DE10239504A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
DE10239504A DE10239504A1 (en) 2001-08-29 2002-08-28 Parallel sequencing of nucleic acid fragments, useful e.g. for detecting mutations, comprises sequential single-base extension of immobilized fragment-primer complex

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
DE10142256 2001-08-29
DE10239504A DE10239504A1 (en) 2001-08-29 2002-08-28 Parallel sequencing of nucleic acid fragments, useful e.g. for detecting mutations, comprises sequential single-base extension of immobilized fragment-primer complex

Publications (1)

Publication Number Publication Date
DE10239504A1 true DE10239504A1 (en) 2003-04-24

Family

ID=7696956

Family Applications (1)

Application Number Title Priority Date Filing Date
DE10239504A Ceased DE10239504A1 (en) 2001-08-29 2002-08-28 Parallel sequencing of nucleic acid fragments, useful e.g. for detecting mutations, comprises sequential single-base extension of immobilized fragment-primer complex

Country Status (3)

Country Link
AU (1) AU2002337030A1 (en)
DE (1) DE10239504A1 (en)
WO (1) WO2003020968A2 (en)

Families Citing this family (56)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2290364A1 (en) 1996-04-25 2011-03-02 BioArray Solutions Ltd. Light-controlled electrokinetic assembly of particles near surfaces
US7875440B2 (en) 1998-05-01 2011-01-25 Arizona Board Of Regents Method of determining the nucleotide sequence of oligonucleotides and DNA molecules
US6780591B2 (en) 1998-05-01 2004-08-24 Arizona Board Of Regents Method of determining the nucleotide sequence of oligonucleotides and DNA molecules
US9709559B2 (en) 2000-06-21 2017-07-18 Bioarray Solutions, Ltd. Multianalyte molecular analysis using application-specific random particle arrays
US9708358B2 (en) 2000-10-06 2017-07-18 The Trustees Of Columbia University In The City Of New York Massive parallel method for decoding DNA and RNA
CA2425112C (en) 2000-10-06 2011-09-27 The Trustees Of Columbia University In The City Of New York Massive parallel method for decoding dna and rna
US7262063B2 (en) 2001-06-21 2007-08-28 Bio Array Solutions, Ltd. Directed assembly of functional heterostructures
IL161391A0 (en) 2001-10-15 2004-09-27 Bioarray Solutions Ltd Multiplexed analysis of polymorphic loci by concurrent interrogation and enzyme-mediated detection
GB0129012D0 (en) 2001-12-04 2002-01-23 Solexa Ltd Labelled nucleotides
US11008359B2 (en) 2002-08-23 2021-05-18 Illumina Cambridge Limited Labelled nucleotides
US7414116B2 (en) 2002-08-23 2008-08-19 Illumina Cambridge Limited Labelled nucleotides
GB2395954A (en) 2002-08-23 2004-06-09 Solexa Ltd Modified nucleotides
US7526114B2 (en) 2002-11-15 2009-04-28 Bioarray Solutions Ltd. Analysis, secure access to, and transmission of array images
WO2005031305A2 (en) 2003-09-22 2005-04-07 Bioarray Solutions, Ltd. Surface immobilized polyelectrolyte with multiple functional groups capable of covalently bonding to biomolecules
JP2007521017A (en) 2003-10-28 2007-08-02 バイオアレイ ソリューションズ リミテッド Optimization of gene expression analysis using immobilized capture probes
JP2007509629A (en) * 2003-10-29 2007-04-19 バイオアレイ ソリューションズ リミテッド Complex nucleic acid analysis by cleavage of double-stranded DNA
US8637650B2 (en) 2003-11-05 2014-01-28 Genovoxx Gmbh Macromolecular nucleotide compounds and methods for using the same
US7169560B2 (en) 2003-11-12 2007-01-30 Helicos Biosciences Corporation Short cycle methods for sequencing polynucleotides
CA2557177A1 (en) * 2004-02-19 2005-09-01 Stephen Quake Methods and kits for analyzing polynucleotide sequences
US20050260609A1 (en) * 2004-05-24 2005-11-24 Lapidus Stanley N Methods and devices for sequencing nucleic acids
DE602005027700D1 (en) * 2004-05-25 2011-06-09 Helicos Biosciences Corp PROCESS FOR NUCLEIC ACID IMMOBILIZATION
US7848889B2 (en) 2004-08-02 2010-12-07 Bioarray Solutions, Ltd. Automated analysis of multiplexed probe-target interaction patterns: pattern matching and allele identification
US9035035B2 (en) 2004-11-05 2015-05-19 Genovoxx Gmbh Macromolecular nucleotide compounds and methods for using the same
US7666593B2 (en) 2005-08-26 2010-02-23 Helicos Biosciences Corporation Single molecule sequencing of captured nucleic acids
US20070196832A1 (en) * 2006-02-22 2007-08-23 Efcavitch J William Methods for mutation detection
EP2548972A1 (en) 2006-06-14 2013-01-23 Verinata Health, Inc Methods for the diagnosis of fetal abnormalities
WO2008042067A2 (en) 2006-09-28 2008-04-10 Illumina, Inc. Compositions and methods for nucleotide sequencing
DE112007002932B4 (en) 2006-12-01 2015-08-06 The Trustees Of Columbia University In The City Of New York Four-color DNA sequencing by synthesis using cleavable, reversible, fluorescent nucleotide terminators
EP2209911B1 (en) 2007-10-19 2013-10-16 The Trustees of Columbia University in the City of New York Dna sequencing with non-fluorescent nucleotide reversible terminators and cleavable label modified nucleotide terminators and a deoxyinosine analogue with a reversible terminator group
EP2940029B1 (en) 2007-10-19 2023-11-29 The Trustees of Columbia University in the City of New York Design and synthesis of cleavable fluorescent nucleotides as reversible terminators for dna sequencing by synthesis
US10174368B2 (en) 2009-09-10 2019-01-08 Centrillion Technology Holdings Corporation Methods and systems for sequencing long nucleic acids
CN102858995B (en) 2009-09-10 2016-10-26 森特瑞隆技术控股公司 Targeting sequence measurement
ES2821500T3 (en) 2009-11-06 2021-04-26 Univ Leland Stanford Junior Non-invasive diagnosis of graft rejection in organ transplant patients
ES2687761T3 (en) 2011-01-31 2018-10-29 F. Hoffmann-La Roche Ag Methods of identification of multiple epitopes in cells
US20120252682A1 (en) 2011-04-01 2012-10-04 Maples Corporate Services Limited Methods and systems for sequencing nucleic acids
CA2854832C (en) 2011-11-07 2023-05-23 Ingenuity Systems, Inc. Methods and systems for identification of causal genomic variants
US10174310B2 (en) 2012-08-08 2019-01-08 Roche Sequencing Solutions, Inc. Increasing dynamic range for identifying multiple epitopes in cells
GB2547875B (en) 2013-02-01 2017-12-13 Univ California Methods for meta-genomics analysis of microbes
US9411930B2 (en) 2013-02-01 2016-08-09 The Regents Of The University Of California Methods for genome assembly and haplotype phasing
JP6333297B2 (en) 2013-03-15 2018-05-30 イルミナ ケンブリッジ リミテッド Modified nucleoside or modified nucleotide
WO2014144883A1 (en) 2013-03-15 2014-09-18 The Trustees Of Columbia University In The City Of New York Raman cluster tagged molecules for biological imaging
US20160040234A1 (en) 2013-03-15 2016-02-11 Lineage Biosciences, Inc. Methods of sequencing the immune repertoire
KR20240038168A (en) 2013-11-07 2024-03-22 더 보드 어브 트러스티스 어브 더 리랜드 스탠포드 주니어 유니버시티 Cell-free nucleic acids for the analysis of the human microbiome and components thereof
WO2015089243A1 (en) 2013-12-11 2015-06-18 The Regents For Of The University Of California Methods for labeling dna fragments to recontruct physical linkage and phase
EP4219710A3 (en) 2014-08-01 2023-08-16 Dovetail Genomics, LLC Tagging nucleic acids for sequence assembly
NZ734854A (en) 2015-02-17 2022-11-25 Dovetail Genomics Llc Nucleic acid sequence assembly
US11807896B2 (en) 2015-03-26 2023-11-07 Dovetail Genomics, Llc Physical linkage preservation in DNA storage
WO2017070123A1 (en) 2015-10-19 2017-04-27 Dovetail Genomics, Llc Methods for genome assembly, haplotype phasing, and target independent nucleic acid detection
JP7441003B2 (en) 2016-02-23 2024-02-29 ダブテイル ゲノミクス エルエルシー Generation of phased read sets and haplotype phasing for genome assembly
DK3455356T3 (en) 2016-05-13 2021-11-01 Dovetail Genomics Llc RECOVERY OF LONG-TERM BINDING INFORMATION FROM PRESERVED SAMPLES
US20210371918A1 (en) 2017-04-18 2021-12-02 Dovetail Genomics, Llc Nucleic acid characteristics as guides for sequence assembly
EP3642358A1 (en) 2017-06-21 2020-04-29 Bluedot LLC Systems and methods for identification of nucleic acids in a sample
WO2019060716A1 (en) 2017-09-25 2019-03-28 Freenome Holdings, Inc. Methods and systems for sample extraction
CA3090102A1 (en) 2018-01-31 2019-08-08 Dovetail Genomics, Llc Sample prep for dna linkage recovery
US11166996B2 (en) 2018-12-12 2021-11-09 Flagship Pioneering Innovations V, Inc. Anellovirus compositions and methods of use
CN110951852B (en) * 2019-11-25 2022-11-25 齐鲁工业大学 Single-base continuous extension flow type target sequencing method

Family Cites Families (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5547839A (en) * 1989-06-07 1996-08-20 Affymax Technologies N.V. Sequencing of surface immobilized polymers utilizing microflourescence detection
US5302509A (en) * 1989-08-14 1994-04-12 Beckman Instruments, Inc. Method for sequencing polynucleotides
WO1993005183A1 (en) * 1991-09-09 1993-03-18 Baylor College Of Medicine Method and device for rapid dna or rna sequencing determination by a base addition sequencing scheme
GB9208733D0 (en) * 1992-04-22 1992-06-10 Medical Res Council Dna sequencing method
DE69928265T3 (en) * 1998-07-30 2013-11-28 Illumina Cambridge Ltd. MATRICES OF BIOMOLECULES AND THEIR USE IN SEQUENCING
EP1356119B1 (en) * 2001-01-30 2007-09-26 Solexa Ltd. The preparation of polynucleotide arrays
DE10120797B4 (en) * 2001-04-27 2005-12-22 Genovoxx Gmbh Method for analyzing nucleic acid chains

Also Published As

Publication number Publication date
WO2003020968A2 (en) 2003-03-13
WO2003020968A3 (en) 2003-12-31
AU2002337030A1 (en) 2003-03-18

Similar Documents

Publication Publication Date Title
DE10239504A1 (en) Parallel sequencing of nucleic acid fragments, useful e.g. for detecting mutations, comprises sequential single-base extension of immobilized fragment-primer complex
DE10120797B4 (en) Method for analyzing nucleic acid chains
DE10120798B4 (en) Method for determining gene expression
DE69837913T2 (en) PROCESS FOR THE MAKING OF NUCLEIC ACID
DE69928683T2 (en) PROCESS FOR THE AMPLIFICATION AND SEQUENCING OF NUCLEIC ACIDS
DE60114525T2 (en) Array-based methods for the synthesis of nucleic acid mixtures
DE60208278T2 (en) System and method for testing nucleic acid molecules
DE10246005A1 (en) Automated nucleic acid sequencer, useful e.g. for analyzing gene expression, based on parallel incorporation of fluorescently labeled terminating nucleotides
DE69233458T2 (en) NUCLEIC ACIDIFYING BY POLYMERASE EXTENSION OF OLIGONUCLEOTIDES USING TERMINATOR MIXTURES
DE60125243T2 (en) POLYNUCLEOTIDE SEQUENCE ASSAY
EP1204765B1 (en) Method for relative quantization of methylation of cytosin-type bases in dna samples
DE10214395A1 (en) Parallel sequencing of nucleic acid segments, useful for detecting single-nucleotide polymorphisms, by single-base extensions with labeled nucleotide
DE69924140T2 (en) DETERMINATION OF THE LENGTH OF REPETITIVE NUCLEIC ACID SEQUENCES BY A DISCONTINUOUS PRIMER EXTENSION
DE102004025694A1 (en) Optical fluorescent ultra-high parallel process to analyse nucleic acid chains in which a sample solid is bound with a primer-matrix complex
DE102004025744A1 (en) Surface of a solid support, useful for multiple parallel analysis of nucleic acids by optical methods, having low non-specific binding of labeled components
DE102004025745A1 (en) Surface of solid phase, useful for parallel, optical analysis of many nucleic acids, has reduced non-specific binding of labeled components
DE60038109T2 (en) Method for analyzing AFLP reaction mixtures using primer extension techniques
DE10149786A1 (en) Reaction surface for reacting immobilized molecules, useful for nucleic acid sequencing, comprises a gel and allows molecules to be detected individually
WO2008080629A2 (en) Improved molecular biological processing system
EP1294946B1 (en) Multiplex sequencing method
EP1458892B1 (en) Evanescence-based multiplex sequencing method
DE102011056606B3 (en) A method for the electrochemical detection of nucleic acid oligomer hybridization events
DE19806962B4 (en) Labeling of nucleic acids with special sample mixtures
DE102004038359A1 (en) Sequencing nucleic acids for e.g. analyzing genomes, comprises contacting nucleic acid-degrading enzymes with free fluorescent labeled nucleic acids, and determining base sequence
EP1234056B1 (en) Dynamic determination of analytes using arrays on internal surfaces

Legal Events

Date Code Title Description
OP8 Request for examination as to paragraph 44 patent law
8131 Rejection