DE102021001841A1 - Sensory nucleic acids for the diagnosis and treatment of viral and neoplastic diseases - Google Patents

Sensory nucleic acids for the diagnosis and treatment of viral and neoplastic diseases Download PDF

Info

Publication number
DE102021001841A1
DE102021001841A1 DE102021001841.9A DE102021001841A DE102021001841A1 DE 102021001841 A1 DE102021001841 A1 DE 102021001841A1 DE 102021001841 A DE102021001841 A DE 102021001841A DE 102021001841 A1 DE102021001841 A1 DE 102021001841A1
Authority
DE
Germany
Prior art keywords
virus
substance
sequence
viral
cells
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
DE102021001841.9A
Other languages
German (de)
Inventor
Rüdiger Marcus Flaig
Irén Judit Lange-Flaig
Yvonne Bernadette Lange-Flaig
Gary Jenö Lange-Flaig
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Individual
Original Assignee
Individual
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Individual filed Critical Individual
Priority to DE102021001841.9A priority Critical patent/DE102021001841A1/en
Publication of DE102021001841A1 publication Critical patent/DE102021001841A1/en
Withdrawn legal-status Critical Current

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/0012—Galenical forms characterised by the site of application
    • A61K9/007—Pulmonary tract; Aromatherapy
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/10—Dispersions; Emulsions
    • A61K9/127—Liposomes
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/14—Antivirals for RNA viruses

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Epidemiology (AREA)
  • Virology (AREA)
  • Oncology (AREA)
  • Organic Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Communicable Diseases (AREA)
  • Molecular Biology (AREA)
  • Dispersion Chemistry (AREA)
  • Pulmonology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

Die vorliegende Erfindung betrifft eine Substanz zur Behandlung einer viralen und/oder neoplastischen Krankheit, wobei der intrinsische molekulare Mechanismus der Krankheit ausgenutzt wird, um in und nur in betroffenen Zellen Gegenmechanismen zu aktivieren, um den Krankheitsprozess selbst zu stören und/oder die Sichtbarkeit der betroffenen Zellen für das Immunsystem zu erhöhen, indem die Substanz ein Element umfasst, das in Gegenwart der viralen und/oder neoplastischen Krankheit stark transaktiviert wird. Die zugrundeliegende Aufgabe besteht in der Bereitstellung einer Entwicklungsstrategie für Therapeutika für emergente Krankheiten, die es erlaubt, ausreichend schnell eine kurative Behandlung für jede neu identifizierte Viruserkrankung zu schaffen, um sie zu heilen oder zu lindern, die Symptome zu reduzieren, das Überleben des Patienten zu verlängern oder wahrscheinlicher zu machen, bleibende Schäden zu vermeiden oder zu verringern und/oder die Ausbreitung einer neuartigen Krankheit zu reduzieren, anstatt gesunde Menschen vor einer Infektion zu schützen, und wird gelöst durch eine funktionell zweiteilige Nukleinsäure, die einen Effektor und einen Kontrollschalter für denselben umfasst, wobei der Kontrollschalter die unabhängige Anwesenheit spezifischer viraler oder neoplastischer Elemente innerhalb der Zelle erfordert, um den Effektor freizusetzen.The present invention relates to a substance for the treatment of a viral and/or neoplastic disease, whereby the intrinsic molecular mechanism of the disease is exploited to activate counter-mechanisms in and only in affected cells in order to disrupt the disease process itself and/or the visibility of those affected increase cells for the immune system by comprising an element which is highly transactivated in the presence of the viral and/or neoplastic disease. The underlying task is to provide a therapeutics development strategy for emergent diseases that allows to create a curative treatment for any newly identified viral disease sufficiently quickly to cure or alleviate it, reduce symptoms, increase patient survival prolong or make more likely to avoid or reduce permanent damage and/or reduce the spread of a novel disease rather than protecting healthy people from infection, and is solved by a functionally bipartite nucleic acid containing an effector and a control switch for the same wherein the control switch requires the independent presence of specific viral or neoplastic elements within the cell to release the effector.

Description

Eine Vielzahl von medizinisch und wirtschaftlich bedeutsamen Erkrankungen wird durch das Vorhandensein abweichender molekularer Entitäten, insbesondere unphysiologischer Nukleinsäuresequenzen als Trägern „maligner Information“, im Organismus verursacht und charakterisiert. Dies gilt insbesondere für die großen Bereiche der Infektionskrankheiten einerseits und der Neoplasien andererseits, zwischen denen sich aus dieser Sicht eine erhebliche Überschneidung ergibt, wie das Vorhandensein von Onkoviren belegt; ohne Beschränkung auf oder durch die Theorie weisen wir darauf hin, dass aus einer streng molekularen Perspektive virale und neoplastische Zustände insofern so viel gemeinsam haben, als beide durch das Vorhandensein abweichender genetischer Informationen in den betroffenen Zellen verursacht werden, dass man so weit gehen könnte, Krebs im Wesentlichen als nicht übertragbare quasi-virale Störung der Zelldifferenzierung aufgrund der Präsenz unphysiologischer Nukleinsäuresequenzen zu verstehen, während Infektionen und Infestationen mit zellulär strukturierten Pathogenen, ob Bakterien, Protozoen oder Mehrzellern, sich deutlich vom viral-onkologischen Komplex unterscheiden, da jedes dieser Pathogene grundsätzlich einen eigenen Metabolismus aufweist, der sich funktionell und räumlich von dem der befallenen Zelle oder des betroffenen Gewebes unterscheidet und dementsprechend durch eine chemische Behandlung gegen Bestandteile des Stoffwechsels und/oder der molekularen Anatomie des infektiösen Agens, die dem Wirtsorganismus fehlen, gezielt behandelt werden kann - bekannte Beispiele umfassen die auf bakterielle Zellwände wirkenden β-Laktame und die auf bakterielle Ribosomen wirkenden Aminoglykoside. Es ist daher nicht verwunderlich, dass die antivirale und antineoplastische Forschung in Ermangelung chemischer Achillesfersen der verantwortlichen molekularen Entitäten bisher weit weniger zufriedenstellende Ergebnisse erbracht hat als die antibakterielle und antiparasitäre Forschung; die meisten antiviralen und antineoplastischen Wirkstoffe sind mit einer schlechten Wirksamkeit und ausgeprägten Nebenwirkungen belastet, was zu einem ungünstigen therapeutischen Index führt, zusammen mit einer engen Spezifität und einer Tendenz zur Resistenzentwicklung.A large number of medically and economically significant diseases are caused and characterized by the presence in the organism of deviating molecular entities, in particular non-physiological nucleic acid sequences as carriers of “malignant information”. This applies in particular to the large areas of infectious diseases on the one hand and neoplasms on the other hand, between which there is a considerable overlap from this point of view, as evidenced by the presence of oncoviruses; Without being limited to or by theory, we suggest that from a strictly molecular perspective, viral and neoplastic conditions have so much in common in that both are caused by the presence of differing genetic information in the affected cells that one could go so far as to Cancer is essentially to be understood as a non-transmissible quasi-viral disorder of cell differentiation due to the presence of non-physiological nucleic acid sequences, while infections and infestations with cellular structured pathogens, whether bacteria, protozoa or multicellular organisms, differ significantly from the viral-oncological complex, since each of these pathogens is fundamentally exhibits its own metabolism, functionally and spatially distinct from that of the affected cell or tissue, and is appropriately controlled by chemical treatment against components of the metabolism and/or molecular anatomy of the infectious A genes that the host organism lacks can be treated in a targeted manner - well-known examples include the β-lactams that act on bacterial cell walls and the aminoglycosides that act on bacterial ribosomes. It is therefore not surprising that, in the absence of chemical Achilles' heels of the responsible molecular entities, antiviral and antineoplastic research has so far yielded far less satisfactory results than antibacterial and antiparasitic research; most antiviral and antineoplastic drugs are burdened with poor efficacy and pronounced side effects, resulting in an unfavorable therapeutic index, along with narrow specificity and a tendency to develop resistance.

Im Stand der Technik finden sich für antivirale Therapeutika derzeit hauptsächlich die folgenden Angriffsziele:

  • - Proteasen, die virale Proteine durch Zuschneiden in die reife, d.h. funktionsfähige Form bringen;
  • - für RNA- und Retroviren: Polymerasen (Replikasen und Reverstranskriptasen);
  • - für große DNA-Viren: Thymidinkinasen.
In the state of the art, the following main targets are currently found for antiviral therapeutics:
  • - Proteases that cut viral proteins into the mature, ie functional form;
  • - for RNA and retroviruses: polymerases (replicases and reverse transcriptases);
  • - for large DNA viruses: thymidine kinases.

Die ersten beiden sind für ihre Anpassungsfähigkeit bekannt, und die Entwicklung eines niedermolekularen Inhibitors für ein virales Enzyme, der zugleich für den Wirtsorganismus ungiftig ist, ist ein höchst aufwendiger empirischer Prozess. Für viele Viren sind indes nicht einmal solche Angriffsziele charakterisiert, sonderlich für solche, die weitgehend darauf setzen, Wirtsproteine zu ihren Zwecken umzufunktionieren. Für die Papovaviren etwa wird ohne Beschränkung durch oder auf die Theorie angenommen, dass einerseits Expression der onkogenen T-Proteine und deren Komplexbildung mit Wirtsproteinen, andererseits Transspleißen, möglicherweise durch N-terminale Fusion des Agnoproteins an zelluläre Proteine, dem gesamten Virusmechanismus zugrunde liegt, ohne dass eine einzige virusspezifisch katalysierte biochemische Reaktion identifiziert werden könnte. Es liegt in der Natur der Sache, dass diese Komplexierungen und Fusionierungen schwierig zu erforschen und noch schwieriger zu inhibieren sind.The first two are known for their adaptability, and the development of a small molecule inhibitor of a viral enzyme that is also nontoxic to the host organism is a highly laborious empirical process. For many viruses, however, not even such targets have been characterized, especially for those that rely largely on repurposing host proteins for their own purposes. For the papovaviruses, for example, it is assumed without being restricted by or on theory that, on the one hand, expression of the oncogenic T proteins and their complex formation with host proteins and, on the other hand, trans-splicing, possibly through N-terminal fusion of the agnoprotein to cellular proteins, underlies the entire virus mechanism without that a single virus-specifically catalyzed biochemical reaction could be identified. By their very nature, these complexations and fusions are difficult to study and even more difficult to inhibit.

Daher werden heute in beiden Bereichen Alternativen zur „frontalen“, d.h. unmittelbar auf das infektiöse Agens gerichteten, Pharmakotherapie bevorzugt: In der Onkologie wurde eine breite Palette von Inhibitoren und Immunmodulatoren entwickelt, um Krebszellen ohne Verabreichung allgemein zytotoxischer Substanzen möglichst weitgehend in Schach zu halten; in der Virologie ist ebenfalls die Immunmodulation in Form von Impfungen der aktuelle Goldstandard. An dieser Stelle sei flankierend angemerkt, dass die entwickelten Welt über lange Zeit hinweg Viruserkrankungen als geringfügiges Ärgernis betrachten und sich auf „Zivilisationskrankheiten“ wie den metabolisch-kardiovaskulären Komplex konzentrieren konnte - ein Vorurteil, das mit dem Auftreten der coronaviralen SARS/Covid-19-Pandemie im Jahr 2020 widerlegt wurde.Therefore, alternatives to "frontal" pharmacotherapy, i.e. directed directly at the infectious agent, are preferred in both areas today: In oncology, a wide range of inhibitors and immune modulators have been developed to keep cancer cells in check as far as possible without administering generally cytotoxic substances; in virology, immune modulation in the form of vaccinations is also the current gold standard. It should be noted at this point that the developed world has long been able to view viral diseases as a minor nuisance and focus on "civilization diseases" such as the metabolic-cardiovascular complex - a prejudice that started with the emergence of the coronavirus SARS/Covid-19 Pandemic disproved in 2020.

Während die Impfung mit lebenden, toten oder rekombinanten Vakzinen zweifellos von unschätzbarem Wert im Kampf gegen viele virale Krankheiten ist - hier sind die von der WHO als ausgerottet gemeldeten Pocken und der Masern/Rinderpest-Komplex als bekannte Erfolge zu nennen -, sollten ihre Nachteile nicht vergessen werden: While vaccination with live, dead or recombinant vaccines is undoubtedly invaluable in the fight against many viral diseases - smallpox, reported to have been eradicated by the WHO, and the measles/rinderpest complex are notable successes - its disadvantages should not be forgotten:

Die Geschwindigkeit der Impfstoffentwicklung ist-gleich der Entwicklung von chemischen Virustatika - für emergente Krankheiten, die in unserer globalisierten Weit ein zunehmendes Problem darstellen, unzureichend; insbesondere eine großflächige Anwendung von Impfstoffen zum Pandemieschutz führt aufgrund der notwendigerweise hohen Anzahl der Impflinge - grundsätzlich gelten für prophylaktische höhere ethische Anforderungen als für kurative Mittel - zu sehr strengen Sicherheitsanforderungen, die in der Zeitspanne vom Auftreten bis zur Pandemie offensichtlich nicht erfüllt werden können.The speed of vaccine development - like the development of chemical antivirals - is insufficient for emergent diseases, which represent an increasing problem in our globalized world; In particular, a large-scale use of vaccines for pandemic protection leads to very strict safety requirements due to the necessarily high number of vaccinees - in principle, higher ethical requirements apply to prophylactic than to curative agents - which obviously cannot be met in the period from the onset to the pandemic.

Darüber hinaus sind viele Viren, insbesondere RNA-basierte Viren, anfälliger für Mutationen, als es z.B. Pockenviren sind, was unter Umständen zur Entstehung von „Escape-Mutationen“ führt, also Ausbildung von viralen Formen, die - in Analogie zu den Resistenzbildungen gegen Proteaseinhibitoren - vom geimpften Immunsystem nicht mehr erkannt werden und so einen Impfstoff faktisch unbrauchbar machen, und tatsächlich wurde im Zusammenhang mit der Covid-19-Pandemie vermutet, dass Impfstoffe mit geringer Wirksamkeit und verspäteten Verabreichungsschemata die Bildung von Escape-Mutationen begünstigen. Ohne Beschränkung durch oder auf die Theorie wird darauf hingewiesen, dass Tumorzellen ebenso wie viele Viren, insbesondere RNA-Viren, eine R-Strategie mit kurzen Generationszeiten und hohen Nachkommenzahlen verfolgen, was eine schnelle Anpassung an einen neuen Selektionsdruck ermöglicht.In addition, many viruses, especially RNA-based viruses, are more susceptible to mutations than, for example, poxviruses, which under certain circumstances can lead to the development of "escape mutations", i.e. the formation of viral forms that - in analogy to the formation of resistance to protease inhibitors - are no longer recognized by the vaccinated immune system and thus make a vaccine effectively unusable, and in fact in the context of the Covid-19 pandemic it has been suspected that vaccines with low efficacy and delayed administration schedules promote the formation of escape mutations. Without being limited by or to theory, it is pointed out that tumor cells, like many viruses, especially RNA viruses, follow an R-strategy with short generation times and high progeny numbers, which allows rapid adaptation to a new selection pressure.

Drittens steigt mit den Fortschritten in der Biotechnologie auch das Risiko, dass Bioterroristen absichtlich Escape-Mutationen von „ausgerotteten“ Krankheitserregern erzeugen - neben vielen anderen denkbaren Möglichkeiten entweder durch die Veränderung entscheidender Epitope oder durch die Einführung aktiv immunsuppressiver Elemente wie dem Nef-Protein von HIV oder andere Komponenten, die z.B. in die Peptidpräsentation durch MHC-Moleküle eingreifen, aktivierende Signalwege blockieren, inhibitorische Signalwege verstärken, Signalstoffe inaktivieren usw. Es liegt auf der Hand, dass dergleichen aktiv immunsuppressive und damit immunologisch tarnende Elemente ein unauflösliches immunologisches Dilemma bilden und eine prophylaktische Impfung in hohem Maße erschweren.Third, as biotechnology advances, so does the risk that bioterrorists will intentionally create escape mutations of “eradicated” pathogens—either by altering critical epitopes or by introducing active immunosuppressive elements such as the Nef protein of HIV, among many other conceivable possibilities or other components that intervene, for example, in peptide presentation by MHC molecules, block activating signaling pathways, enhance inhibitory signaling pathways, inactivate signaling substances, etc. It is obvious that such actively immunosuppressive and thus immunologically camouflaged elements form an insoluble immunological dilemma and a prophylactic one make vaccination very difficult.

Nicht vergessen werden sollte auch die grundsätzliche Problematik, die sich aus der inneren Zweiteilung des Immunsystems in einen antikörperbasierten und einen zellvermittelten - auch zytolytisch oder zytotoxisch genannten - Zweig ergibt: Induktion von Antikörpern gegen ein bestimmtes Zielantigen ist sowohl leichter zu erreichen als auch leichter nachzuweisen als Induktion einer zellvermittelten Immunantwort, jedoch sind Antikörper aus einer Reihe von Gründen von begrenztem Wert gegen viral bedingte Erkrankungen - Viruspartikel bieten wenig Angriffspunkte für Antikörper, die überdies in vielen Fällen auch leicht mutieren und sich damit der Immunreaktion entziehen können; sobald eine Infektion etabliert ist, ist die Hauptmasse der Viren intrazellulär zu finden, wo sie auch ihren physiologischen Schaden verursachen, und damit außerhalb der Reichweite von Antikörpern, nur für die zytolytische Immunreaktion erreichbar. Im schlimmsten Fall kann es sogar zur Bildung aktivierender Antikörper kommen, die den Viren das Eindringen in Zielzellen erleichtern und das Krankheitsbild damit exazerbieren. Überdies gelten die Dauer und „Erinnerbarkeit“ einer antikörpervermittelten Immunantwort als geringer als die einer zytolytischen.The fundamental problem that results from the inner division of the immune system into an antibody-based and a cell-mediated - also known as cytolytic or cytotoxic - branch should not be forgotten either: induction of antibodies against a specific target antigen is both easier to achieve and easier to detect than Induction of a cell-mediated immune response, however, antibodies are of limited value against viral diseases for a number of reasons - virus particles offer few targets for antibodies, which, moreover, in many cases can also easily mutate and thus evade the immune response; once infection is established, the bulk of the virus is found intracellularly, where it also causes its physiological damage, and thus beyond the reach of antibodies, accessible only to the cytolytic immune response. In the worst case, it can even lead to the formation of activating antibodies that make it easier for the virus to penetrate target cells and thus exacerbate the clinical picture. Moreover, the duration and "rememberability" of an antibody-mediated immune response are considered to be less than that of a cytolytic one.

Auf der sozialen Ebene bestehen bei vielen Völkern und Kulturen überdies unterschiedlich gelagerte Vorurteile gegen eine Impfung gesunder Personen, die von Sorgen vor Fertilitätsstörungen bis zu diffusen Ängsten vor einer „Belastung des Immunsystems“ reichen.At the social level, many peoples and cultures also have different prejudices against vaccination of healthy people, ranging from concerns about fertility disorders to diffuse fears of "stress on the immune system".

Beim gegenwärtigen Stand der Technik sind diese Probleme nicht grundsätzlich unüberwindlich, aber hinreichend groß, um bei emergenten oder schnell mutierenden Viren eine wirksame Impfung in der Praxis unmöglich zu machen.With the current state of the art, these problems are not fundamentally insurmountable, but are sufficiently great to make effective vaccination in practice impossible in the case of emergent or rapidly mutating viruses.

Es besteht also ein ungedeckter medizinischer Bedarf an einer „zweiten Verteidigungslinie“ im Sinne einer Entwicklungsstrategie für Therapeutika für emergente Krankheiten, die es erlaubt, ausreichend schnell eine kurative Behandlung für jedwede (bekannte oder) neu identifizierte Viruserkrankung zu schaffen, um sie zu heilen oder zu lindern, die Symptome zu reduzieren, das Überleben des Patienten zu verlängern oder wahrscheinlicher zu machen, bleibende Schäden zu vermeiden oder zu verringern und/oder die Ausbreitung einer neuartigen Krankheit zu reduzieren, anstatt gesunde Menschen vor einer Infektion bzw. dem Ausbruch einer Krankheit nach einer Infektion zu schützen zu versuchen. In Anbetracht der obigen Ausführungen wäre eine solche Strategie auch bei neoplastischen Erkrankungen anwendbar und von Vorteil, da aus molekularer Sicht jeder einzelne Krebsfall als eine neu entstehende Krankheit interpretiert werden kann, weswegen hat die Idee der „personalisierten Therapie“ trotz der damit verbundenen enormen Kosten viel Interesse geweckt hat.Thus, there is an unmet medical need for a “second line of defense” in the sense of a therapeutics development strategy for emergent diseases that would allow a curative treatment to be developed for any (known or) newly identified viral disease quickly enough to cure or stop it alleviate, reduce symptoms, prolong or increase the likelihood of patient survival, avoid or reduce permanent damage, and/or reduce the spread of a novel disease rather than healthy people before infection or disease onset after to try to protect against infection. In view of the above, such a strategy would also be applicable to neoplastic diseases and would be beneficial since, from a molecular point of view, each and every cancer case can be interpreted as an emerging disease, which is why the idea of “personalized therapy” has a lot despite the enormous costs involved has aroused interest.

Die vorliegende Erfindung erfüllt diese Aufgabe durch eine funktionell zweiteilige Nukleinsäure, die einen Effektor und einen molekularen Kontrollschalter für denselben umfasst, wobei der Kontrollschalter die unabhängige Anwesenheit „maligner Information“, insbesondere spezifischer viraler oder neoplastischer Elemente innerhalb der Zelle erfordert, um den Effektor in seine wirksame Form zu bringen. Damit ist sichergestellt, dass die Nukleinsäure - in der vorliegenden Anmeldung auch als „sensorische Nukleinsäure“ bezeichnet - in gesunden Zellen keine schädlichen Wirkungen entfalten kann, was den therapeutischen Index stark erhöht und grundsätzlich den Einsatz von aggressiveren Effektoren erlaubt. Der Kontrollschalter ist am effektivsten, wenn er in der Lage ist, die zweiteilige Nukleinsäure quantitativ zu kontrollieren, d.h. wenn Kopien oder Transkripte derselben nur in Anwesenheit der abweichenden molekularen Entität produziert werden, anstatt nur ihre Aktivität zu regulieren. Bevorzugt, aber nicht notwendig, ist es hierbei, dass der Effektor seinerseits eine Spezifität für die maligne Information besitzt oder anderweitig von einer Art ist, dass er in gesunden Zellen keine Wirkung entfaltet. Ferner ist eine Ausführungsform bevorzugt, in der die erfindungsgemäße Nukleinsäure vorzugsweise in oder in die Nähe befallener Zellen oder Gewebe abgegeben wird, etwa durch Verwendung von Drug- oder Gene-Delivery-Systemen, wie von Flaig 1997 (Konstruktion pseudoviraler Gentransfersysteme als Grundlage für die Therapie arteriosklerotischer Erkrankungen: Promotionsschrift zur Erlangung des akademischen Grades des Dr. sei. hum., vorgelegt der Universität Heidelberg) und Flaig 2001 (Bdellosomen, ein neuartiges Arzneimitteltransportsystem auf der Basis monomolekularer Polymerpartikel: Promotionsschrift zur Erlangung des akademischen Grades des Dr. rer. nat., vorgelegt der Universität Heidelberg) beschrieben.The present invention achieves this object through a functionally bipartite nucleic acid comprising an effector and a molecular control switch for the same, the control switch requiring the independent presence of "malignant information", particularly specific viral or neoplastic elements within the cell, in order to convert the effector into its to take effective form. This ensures that the nucleic acid - also referred to as "sensory nucleic acid" in the present application - cannot develop any harmful effects in healthy cells, which greatly increases the therapeutic index and basically allows the use of more aggressive effectors. The control switch is most effective when it is able to quantitatively control the bipartite nucleic acid, ie when copies or transcripts thereof are only produced in the presence of the variant molecular entity, rather than merely regulating its activity. Preferred, but not necessary, it is here that the Effector itself has specificity for the malignant information or is otherwise of a nature that it has no effect in healthy cells. Furthermore, an embodiment is preferred in which the nucleic acid according to the invention is preferably released in or in the vicinity of affected cells or tissue, for example by using drug or gene delivery systems, as described by Flaig 1997 (construction of pseudoviral gene transfer systems as a basis for therapy arteriosclerotic diseases: doctoral thesis to obtain the academic degree of Dr. sei. hum., submitted to the University of Heidelberg) and Flaig 2001 (Bdellosomes, a novel drug transport system based on monomolecular polymer particles: doctoral thesis to obtain the academic degree of Dr. rer. nat. , submitted to the University of Heidelberg).

Dementsprechend betrifft die vorliegende Erfindung eine Substanz zur Behandlung eines medizinischen Zustands eines Menschen oder nicht-menschlichen Wirbeltiers, der die Expression eines nicht-physiologischen Proteins umfasst, dadurch gekennzeichnet, dass die Substanz eine Nukleinsäure umfasst, die mindestens (I) eine Kontrollsequenz umfasst, die mit einem nicht-physiologisch exprimierten Protein interagiert, um die Replikation und/oder Expression von (II) einer Effektorsequenz zu ermöglichen, deren Replikation und/oder Expression der Manifestation des medizinischen Zustands entgegenwirkt.Accordingly, the present invention relates to a substance for treating a medical condition in a human or non-human vertebrate comprising the expression of a non-physiological protein, characterized in that the substance comprises a nucleic acid comprising at least (I) a control sequence comprising interacts with a non-physiologically expressed protein to enable the replication and/or expression of (II) an effector sequence, the replication and/or expression of which counteracts the manifestation of the medical condition.

Die vorliegende Erfindung offenbart insbesondere eine Substanz wie oben beschrieben, die dadurch gekennzeichnet ist, dass der Zustand, von dessen Wirkstoff sie abgeleitet ist und für dessen Behandlung sie bestimmt ist, eine akute oder chronische Virusinfektion oder ein Zustand ist, der kausal mit einer akuten oder chronischen Virusinfektion zusammenhängt. Hier kann durch dieAuswahl einer Kontrollsequenz, die als Startsignal für die Replikation durch das Replikationssystem des Virus die nt, eine quantitative Kontrolle erreicht werden. Bei RNA-Viren, die den Großteil der humanpathogenen Viren ausmachen, ist dies vorzugsweise die Erkennungssequenz für die RNA-Replikase, aka. RNA-abhängige RNA-Polymerase, die jedes RNA-Virus benötigt, und die, ohne darauf beschränkt zu sein, in den meisten Fällen am 5'-Ende der viralen genomischen RNA zu finden sein wird. Für DNA-Viren sind deren komplexere und vielfältigere Mechanismen zur Initiierung der Replikation im Stand der Technik beschrieben und können von jeder Person mit durchschnittlichem Fachwissen auf die vorliegende Erfindung übertragen werden.In particular, the present invention discloses a substance as described above, characterized in that the condition from whose active substance it is derived and for the treatment of which it is intended is an acute or chronic viral infection or a condition causally linked to an acute or related to chronic viral infection. A quantitative control can be achieved here by selecting a control sequence that uses the nt as a start signal for replication through the replication system of the virus. For RNA viruses, which make up the majority of human pathogenic viruses, this is preferably the recognition sequence for the RNA replicase, aka. RNA-dependent RNA polymerase which is required by every RNA virus and which, but is not limited to, will in most cases be found at the 5' end of the viral genomic RNA. For DNA viruses, their more complex and varied mechanisms for initiating replication are described in the prior art and can be applied to the present invention by any person of ordinary skill in the art.

Das oben beschriebene Problem einer immunologischen Tarnung des Pathogens kann durch den beschriebenen kurativen Ansatz überwunden werden, indem ein Effektor so gewählt wird, dass er den immunologischen Tarnmechanismus des Virus stört oder überbrückt-eine Möglichkeit, die es bei einem prophylaktischen Ansatz grundsätzlich nicht gibt.The above-described problem of immunological camouflage of the pathogen can be overcome by the described curative approach by choosing an effector such that it disrupts or bypasses the immunological camouflage mechanism of the virus-a possibility that is fundamentally absent in a prophylactic approach.

Im Falle einer antiviral konzipierten Substanz ist es weiterhin bevorzugt, aber nicht notwendig, dass die Nukleinsäure gemäß der vorliegenden Erfindung das vom zugrundeliegenden Wirkstoff verwendete Verpackungssignal umfasst, d.h. eine Nukleotidsequenz, die in der Lage ist, mit anderen viralen Komponenten so zu interagieren, dass eine Nukleinsäure, die diese Sequenz umfasst, in die entstehenden viralen Kapside integriert oder „verpackt“ wird. Ein solches Vorhandensein eines Verpackungssignals bietet je nach den Details des Virus einen oder beide der folgenden Vorteile: (A) Die Nukleinsäure-Bindungsstellen der naszierenden Virionen werden durch die Nukleinsäure der vorliegenden Erfindung besetzt, und die Verpackung der viralen Nukleinsäure wird dadurch kompetitiv gehemmt; und (B) Kopien der Nukleinsäure gemäß der vorliegenden Erfindung werden in die naszierenden Virionen verpackt und verbreiten sich so auf weitere Zellen des Menschen oder nicht-menschlichen Wirbeltiers, die für eine Infektion durch das Virus empfänglich sind, wodurch die schützende Wirkung der Nukleinsäure gemäß der vorliegenden Erfindung in allen Geweben und Organen verbreitet wird.In the case of an antivirally designed substance, it is further preferred, but not necessary, that the nucleic acid according to the present invention comprises the packaging signal used by the underlying active substance, i.e. a nucleotide sequence that is able to interact with other viral components in such a way that a Nucleic acid comprising this sequence is integrated or "packaged" into the resulting viral capsids. Such presence of a packaging signal provides one or both of the following advantages, depending on the details of the virus: (A) The nucleic acid binding sites of the nascent virions are occupied by the nucleic acid of the present invention, and packaging of the viral nucleic acid is thereby competitively inhibited; and (B) copies of the nucleic acid according to the present invention are packaged into the nascent virions and thus spread to other cells of the human or non-human vertebrate susceptible to infection by the virus, thereby reducing the protective effect of the nucleic acid according to present invention is diffused in all tissues and organs.

Ohne Beschränkung auf oder durch die Theorie wird hierbei angenommen, dass viele Viren, insbesondere solche mit polyedrischen Kapsiden, obere und untere Größengrenzen für die effiziente Verpackung von Nukleinsäure, die das Verpackungssignal trägt, und möglicherweise auch andere Beschränkungen wie Zusammensetzung und Sekundärstruktur haben; dass dort, wo diese Verpackungsanforderungen im Wesentlichen vollständig erfüllt sind, Aspekt B dominiert; dass dort, wo sie nicht erfüllt sind, Aspekt A dominiert, indem eine unvollkommene Erfüllung der Verpackungsanforderungen zur Produktion von „Blindgängern“ oder unvollständigen Kapsiden führt, während eine wesentliche Nichterfüllung der Anforderungen zu einer Gesamthemmung der Virionenproduktion trotz laufender viraler Proteinsynthese führt, wobei in beiden Fällen angenommen wird, dass sie die immunologische Erkennung und damit das Auftreten einer Immunantwort unterstützen. Dabei kann sich das Verpackungssignal an beliebiger Stelle auf der erfindungsgemäßen Nukleinsäure befinden, d.h. entweder in der Kontrollsequenz, der Effektorsequenz, in beiden oder in keiner von beiden enthalten sein oder diese überlappen. Der Stand der Technik offenbart Sequenzen, die als Kontrollsequenzen in der vorliegenden Erfindung geeignet sind, die untrennbar mit Verpackungssignalen verbunden sind; so umfasst z.B. die Promotorregion von Papovaviren deren Verpackungssignal. In Anbetracht seiner gesonderten Funktion ist das Verpackungssignal als Element (III) zu betrachten, selbst wenn es strukturell nicht von anderen Elementen trennbar ist, wenn und soweit es eine gesonderte Funktion ausübt.Without being limited by or by theory, it is believed that many viruses, particularly those with polyhedral capsids, have upper and lower size limits for efficient packaging of nucleic acid carrying the packaging signal, and possibly other constraints such as composition and secondary structure; that where these packaging requirements are substantially fully met, Aspect B dominates; that where they are not met, Aspect A dominates, in that imperfect meeting of packaging requirements results in the production of "duds" or incomplete capsids, while substantial failure to meet requirements results in overall inhibition of virion production despite ongoing viral protein synthesis, with both cases it is assumed that they support immunological recognition and thus the occurrence of an immune response. The packaging signal can be located anywhere on the nucleic acid according to the invention, ie it can be contained either in the control sequence, the effector sequence, in both or in neither of them, or they can overlap. The prior art discloses sequences suitable as control sequences in the present invention which are inextricably linked to packaging signals; thus, for example, includes the promoter region of papovaviruses their packaging signal. In view of its separate function, the packaging signal is to be considered as element (III), even if it is not structurally separable from other elements, if and to the extent that it performs a separate function.

NB - Das Taxon der Papovaviren (Papillomaviren, Polyomaviren und Vakuolisierungsviren) wird von vielen Autoren als nicht mehr gültig angesehen, da SV40, das archetypische Vakuolisierungsvirus, als Polyomavirus neuklassifiziert worden ist. In der vorliegenden Offenlegung verwenden wir der Einfachheit halber noch den alten Begriff.NB - The taxon of papovaviruses (papillomaviruses, polyomaviruses and vacuolation viruses) is considered by many authors to be no longer valid since SV40, the archetypal vacuolation virus, has been reclassified as a polyomavirus. In the present disclosure we still use the old term for the sake of simplicity.

In einer bevorzugten Ausführungsform der vorliegenden Erfindung ist die virale Infektion eine Infektion mit einem RNA-Virus, wie einem Mitglied der Filovirus-Gruppe, z.B. dem Ebola-Virus, oder einem Mitglied der Coronavirus-Gruppe, z.B. einem Virus der SARS/MERS/Covid-Verwandtschaft, und die Kontrollsequenz umfasst eine Erkennungssequenz für die Replikase des RNA-Virus. Es versteht sich von selbst, dass hier die aktive Form der erfindungsgemäßen Nukleinsäure in RNA-Form vorliegen muss; es versteht sich jedoch, dass jede erfindungsgemäße RNA in Form einer DNA implementiert werden kann, aus der die aktive RNA beschrieben werden kann, sowie umgekehrt, wenn eine reverse Transkription beteiligt ist.In a preferred embodiment of the present invention, the viral infection is an infection with an RNA virus, such as a member of the filovirus group, e.g., Ebola virus, or a member of the coronavirus group, e.g., a SARS/MERS/Covid virus -relationship, and the control sequence comprises a recognition sequence for the replicase of the RNA virus. It goes without saying that the active form of the nucleic acid according to the invention must be present here in RNA form; however, it should be understood that any RNA of the invention can be implemented in the form of DNA from which the active RNA can be described, and vice versa when reverse transcription is involved.

In einer spezifischen Ausführungsform der Erfindung wird ein indirektes oder amplifizierendes System verwendet, indem die Kontrollsequenz (a) ein Element, das auf die Anwesenheit abweichender molekularer Einheiten reagiert, (b) eine spezifische Nukleinsäurepolymerase und (c) ein Signal für die spezifische Nukleinsäurepolymerase, z.B. die RNA-Polymerase des Bakteriophagen T7 und einen von dieser adressierten Promotor, am meisten bevorzugt TAATACGACTCACTATAGGGAGA, umfasst. Dies ermöglicht die Verwendung von schwachen oder vorzugsweise streng geregelten Steuersequenzen. In einem solchen Fall kann die Nukleinsäure gemäß der vorliegenden Erfindung gegebenenfalls verschachtelt oder rekursiv sein, indem auf der ersten Ebene die Transkription der ursprünglichen DNA reguliert wird und auf der zweiten Ebene wiederum die Aktivität des RNA-Transkripts reguliert wird.In a specific embodiment of the invention, an indirect or amplifying system is used in which the control sequence comprises (a) an element responsive to the presence of variant molecular entities, (b) a specific nucleic acid polymerase, and (c) a signal for the specific nucleic acid polymerase, e.g. bacteriophage T7 RNA polymerase and a promoter targeted thereby, most preferably TAATACGACTCACTATAGGGAGA. This allows the use of weak or, preferably, tightly regulated control sequences. In such a case, the nucleic acid according to the present invention can optionally be nested or recursive, in that the transcription of the original DNA is regulated at the first level and the activity of the RNA transcript is regulated at the second level.

In einer weiteren bevorzugten Ausführungsform der vorliegenden Erfindung ist die virale Infektion eine Infektion mit einem Papovavirus, und die Kontrollsequenz umfasst den späten Genpromotor des Papovavirus, vorzugsweise auch den papovaviralen Replikationsursprung. Ohne Beschränkung auf oder durch die Theorie wird in dieser Ausführungsform angenommen, dass die viralen und neoplastischen Aspekte konvergieren und sowohl in akut infizierten Zellen als auch in den daraus abgeleiteten Neoplasmen die viralen T-Proteine exprimiert werden, die die Zelle in den Wachstumsmodus schalten, ursprünglich mit dem Zweck, Bausteine für die virale Nachkommenschaft zu liefern, und regelmäßig die Replikation induzieren und die „späten“ Gene des Virus aktivieren, nämlich die Gene, die für die Kapsidproteine kodieren, die in Papovavirus-induzierten Neoplasmen normalerweise durch Rekombination deletiert werden. Eine cccDNA, die in der Lage ist, unter dem Einfluss der papovaviralen T-Proteine repliziert und in papovavirale Kapsiden verpackt zu werden, wie von Flaig 1997 beschrieben, kann also sowohl zur Unterdrückung einer papovaviralen Infektion als auch zur immunologischen Eliminierung neoplastischer Zellen eingesetzt werden. Nebenbei bemerkt wurde auch vorgeschlagen, dass das von Flaig 1997 beschriebene ψSV40-System so eingestellt werden kann, dass es genetisches Material an professionelle antigenpräsentierende Zellen liefert und so eine Immunreaktion mit Schwerpunkt auf dem zytotoxischen und nicht auf dem antikörperabhängigen Zweig, der gegen Viren zweckmäßig ist, induziert; diese Funktionen können kombiniert werden.In a further preferred embodiment of the present invention, the viral infection is an infection with a papovavirus and the control sequence comprises the papovavirus late gene promoter, preferably also the papovaviral origin of replication. Without being limited by or by theory, it is believed in this embodiment that the viral and neoplastic aspects converge and both acutely infected cells and the neoplasms derived therefrom express the viral T-proteins that switch the cell into the growth mode originally with the purpose of providing building blocks for viral progeny and regularly inducing replication and activating the virus' "late" genes, namely the genes encoding the capsid proteins that are normally deleted by recombination in papovavirus-induced neoplasms. A cccDNA capable of being replicated under the influence of papovaviral T-proteins and packaged into papovaviral capsids, as described by Flaig 1997, can thus be used both to suppress papovaviral infection and to immunologically eliminate neoplastic cells. As an aside, it has also been suggested that the ψSV40 system described by Flaig 1997 can be engineered to deliver genetic material to professional antigen presenting cells and thus an immune response focused on the cytotoxic rather than the antibody dependent branch useful against viruses , induced; these functions can be combined.

In einer weiteren bevorzugten Ausführungsform der vorliegenden Erfindung ist der Zustand neoplastisch; hier ist es bevorzugt, dass die Kontrollsequenz ein Element umfasst, von dem bekannt ist, dass es an einem Prozess der genetischen Hochregulierung beteiligt ist, der für die interessierende Neoplasie spezifisch ist. Solche Elemente sind aus der Technik bekannt.In another preferred embodiment of the present invention, the condition is neoplastic; here it is preferred that the control sequence comprises an element known to be involved in a process of genetic upregulation specific to the neoplasia of interest. Such elements are known from the art.

Die vorliegende Erfindung offenbart insbesondere eine Substanz wie oben beschrieben, die eine Effektorsequenz umfasst, die aus den folgenden ausgewählt ist:

  • - Gegensinnsequenzen zu dem betreffenden Virus oder Onkogen, insbesondere Sequenzen, die als siRNAs wirken und dadurch virale genomische RNA zerstören, die Expression einzelner viraler Gene selektiv hemmen oder beides;
  • - kodierende Sequenzen für Zelloberflächenproteine, die die Erkennung der Zelle mit unphysiologischer Proteinexpression durch T-Zellen und/oder natürliche Killerzellen erhöhen;
  • - Gegensinnsequenzen zu kodierenden Sequenzen für Zelloberflächenproteine, die die Erkennung der Zelle mit unphysiologischer Proteinexpression durch T-Zellen und/oder natürliche Killerzellen hemmen;
  • - kodierende Sequenzen für Interferone, Tumorsuppressor-Gene und/oder pro-apoptotische Proteine;
  • - Gegensinnsequenzen zu kodierenden Sequenzen für anti-apoptotische Proteine;
  • - kodierende Sequenzen für DNAsen, RNAsen und/oder Proteasen, wobei DNAsen, RNAsen und/oder Proteasen mit Spezifität für virale Komponenten besonders bevorzugt sind;
  • - kodierende Sequenzen für immunogene Proteine;
  • - kodierende Sequenzen für Antikörper oder antikörperähnliche Proteine, wobei Antikörper oder antikörperähnliche Proteine mit Spezifität für virale Komponenten besonders bevorzugt sind;
  • - kodierende Sequenzen für Enzyme, die in der Lage sind, ein unwirksames Prodrug in ein antiviral, antineoplastisch oder anderweitig therapeutisch wirksames Medikament umzuwandeln;
sowie Fusionen der oben genannten mit einander oder anderen Sequenzen.In particular, the present invention discloses a substance as described above, comprising an effector sequence selected from the following:
  • - sequences antisense to the virus or oncogene of interest, particularly sequences that act as siRNAs, thereby destroying viral genomic RNA, selectively inhibiting the expression of individual viral genes, or both;
  • - coding sequences for cell surface proteins that increase recognition of the cell with non-physiological protein expression by T cells and/or natural killer cells;
  • - Antisense sequences to coding sequences for cell surface proteins that inhibit recognition of the cell with unphysiological protein expression by T cells and/or natural killer cells;
  • - coding sequences for interferons, tumor suppressor genes and/or pro-apoptotic proteins;
  • - Antisense sequences to coding sequences for anti-apoptotic proteins;
  • - coding sequences for DNAses, RNAses and/or proteases, DNAses, RNAses and/or proteases with specificity for viral components being particularly preferred;
  • - coding sequences for immunogenic proteins;
  • - coding sequences for antibodies or antibody-like proteins, wherein antibodies or antibody-like proteins with specificity for viral components are particularly preferred;
  • - coding sequences for enzymes capable of converting an inactive prodrug into an antiviral, antineoplastic or otherwise therapeutically active drug;
and fusions of the above with each other or other sequences.

Unter Gegensinnsequenz ist hierbei jede zu einer gegebenen Sequenz im Sinne des Watson-Crick-Basenpaarungsmodells komplementäre Sequenz zu verstehen, unabhängig von einem etwaigen Mechanismus der Suppression und/oder Inaktivierung; in einer bevorzugten Ausführungsform umfasst die Gegensinnsequenz eine siRNA.Antisense sequence is to be understood here as meaning any sequence which is complementary to a given sequence in the sense of the Watson-Crick base-pairing model, regardless of any mechanism of suppression and/or inactivation; in a preferred embodiment, the antisense sequence comprises an siRNA.

Insbesondere bei Neoplasien umfassen die Effektorsequenzen darüber hinaus kodierende Sequenzen für Marker- oder Reporterproteine, insbesondere fluoreszierende Proteine, die eine qualitative und quantitative Bestimmung von neoplastischen Zellen ermöglichen. Viele geeignete Effektorsequenzen sind im Wesentlichen aus dem Stand der Technik bekannt, und die hier beschriebenen Methoden können verwendet werden, um weitere zu identifizieren und ihre Eignung im Zusammenhang mit einem System gemäß der vorliegenden Erfindung zu ermitteln.In the case of neoplasms in particular, the effector sequences also include coding sequences for marker or reporter proteins, in particular fluorescent proteins, which enable a qualitative and quantitative determination of neoplastic cells. Many suitable effector sequences are essentially known in the art and the methods described herein can be used to identify others and determine their suitability in the context of a system according to the present invention.

Der Fachmann versteht, dass das erfindungsgemäße System auch seine eigenen Screening-Systeme zur Identifikation geeigneter Kontrollsequenzen, Effektorsequenzen und/oder Verpackungssignale umfasst. In einer besonderen Ausführungsform umfasst die Erfindung daher ein System zur Identifizierung einer Effektorsequenz für ein isoliertes, jedoch noch nicht charakterisiertes RNA-Virus, in welchem eine Bibliothek von Fragmenten der genomischen RNA des Virus, insbesondere ihres S'-Endes, in eine Bibliothek von cDNA-Fragmenten reverstranskribiert wird, welche in ein Plasmid stromabwärts eines CMV- oder RSV-Promotors zwischen einem Leserahmen für RFP (rotes Fluoreszenzprotein) und einem Leserahmen für GFP (grünes Fluoreszenzprotein) eingefügt wird. Nach Transfektion der Zielzellen mit der so erhaltenen Plasmidbibliothek werden die eukaryontischen Zielzellen mit dem zu untersuchenden Virus infiziert, und die Zellen mit dem höchsten Verhältnis von grüner zu roter Fluoreszenz werden durch Zytometrie (Laserfluoreszenzmessung, „FACS“) isoliert und aus ihnen die Plasmide zurückgewonnen: In normalen Zellen findet aufgrund der monocistronischen Natur von eukaryontischer RNA keine nennenswerte Expression des grünen, nur des roten Fluoreszenzproteins statt; in Zellen, die eine für das zu untersuchende Virus geeignete Replikase-Erkennungssequenz zwischen dem RFP- und dem GFP-Leserahmen tragen, wird hingegen durch die Wirkung der Replikase der GFP-Leserahmen herauskopiert und gegenüber dem RFP-Leserahmen vervielfacht, so dass sich eine weit stärkere grüne Fluoreszenz ergibt.The person skilled in the art understands that the system according to the invention also includes its own screening systems for identifying suitable control sequences, effector sequences and/or packaging signals. In a particular embodiment, the invention therefore includes a system for identifying an effector sequence for an isolated but not yet characterized RNA virus, in which a library of fragments of the genomic RNA of the virus, in particular its S' end, in a library of cDNA fragments inserted into a plasmid downstream of a CMV or RSV promoter between an RFP (red fluorescent protein) reading frame and a GFP (green fluorescent protein) reading frame. After transfection of the target cells with the plasmid library thus obtained, the eukaryotic target cells are infected with the virus to be examined, and the cells with the highest ratio of green to red fluorescence are isolated by cytometry (laser fluorescence measurement, "FACS") and the plasmids are recovered from them: In normal cells, due to the monocistronic nature of eukaryotic RNA, there is no appreciable expression of the green fluorescent protein, only the red one; in cells that carry a replicase recognition sequence suitable for the virus to be examined between the RFP and the GFP reading frame, the GFP reading frame is copied out by the effect of the replicase and multiplied in relation to the RFP reading frame, so that a far gives stronger green fluorescence.

In einer besonderen Ausführungsform umfasst die erfindungsgemäße Nukleinsäure codierende Sequenzen für zwei verschiedenfarbige, d.h. sich hinsichtlich ihrer Emissionsspektren unterscheidenden, Fluoreszenzproteine, wovon eines auf der 5'- und das andere auf der 3'-Seite der Kontrollsequenz, wobei das Verhältnis der beiden Fluoreszenzen, z.B. durch Cytometrie oder Lasermikroskopie gemessen, ein Maßstab für die Präsenz und Aktivität des auf die Kontrollsequenz wirkenden Faktors ist, indem ein hohes Verhältnis von 3'-Fluoreszenz zu 5'-Fluoreszenz ein hohes Maß an Präsenz und Aktivität anzeigt und umgekehrt. In einer bevorzugten Ausführungsform umfasst die erfindungsgemäße Nukleinsäure hierbei Kontrollsequenzen aus neoplastischen Phänomenen oder subklinischen und/oder im Organismus persistierenden Viren. Der Fachmann erkennt, dass bei hinreichender Verfügbarkeit von charakterisierten Effektorsequenzen sich dies auch für ein Kit zur Schnellklassifizierung emergenter Viren anhand ihrer Replikasen einsetzen lässt.In a particular embodiment, the nucleic acid according to the invention comprises coding sequences for two differently colored fluorescent proteins, i.e. differing in terms of their emission spectra, one of which is on the 5' side and the other on the 3' side of the control sequence, the ratio of the two fluorescences, e.g. measured by cytometry or laser microscopy, is a measure of the presence and activity of the factor acting on the control sequence, in that a high ratio of 3' fluorescence to 5' fluorescence indicates a high level of presence and activity and vice versa. In a preferred embodiment, the nucleic acid according to the invention comprises control sequences from neoplastic phenomena or subclinical viruses and/or viruses persisting in the organism. The person skilled in the art recognizes that if characterized effector sequences are sufficiently available, this can also be used for a kit for the rapid classification of emergent viruses on the basis of their replicases.

In einer besonderen Ausführungsform der Erfindung ist die Effektorsequenz entweder funktional Null oder umfasst keine weiteren funktionalen Elemente außer der Verpackungssequenz; diese minimalistische Ausführungsform ist dafür vorgesehen, ausschließlich durch Kompetition um die RNA-Replikase bzw. ausschließlich durch Kompetition um die RNA-Replikase und die entstehenden Kapside die Vermehrung des Virus zu unterdrücken. Ohne Beschränkung durch oder auf die Theorie werden hierbei in dem Fehlen einer wie auch immer gearteten Wirkung auf die Zelle des Menschen oder nichtmenschlichen Säugers praktische, zulassungsrechtliche und psychologische Vorteile gesehen, ebenso wie die geringe Länge einer solchen Sequenz die schnelle Massenproduktion mit chemischen Mitteln erleichtert.In a particular embodiment of the invention, the effector sequence is either functionally zero or comprises no further functional elements apart from the packaging sequence; this minimalist embodiment is intended to suppress the replication of the virus solely through competition for the RNA replicase or solely through competition for the RNA replicase and the resulting capsids. Without being limited by or limited to theory, the lack of any human or non-human mammalian cell effect is seen as having practical, regulatory and psychological advantages, as well as the short length of such a sequence facilitating rapid mass production by chemical means.

In einer besonderen Ausführungsform der Erfindung ist die Effektorsequenz konterintuitiv, indem sie immunologische Tarnmechanismen des Virus verstärkt. Dieser Ausführungsform liegt der Umstand zugrunde, dass das Immunsystem „single points of failure“ weitgehend vermeidet, indem z.B. eine vollständige Unterdrückung der Peptidpräsentation auf MHCs und damit Tarnung gegenüber dem T-Zell-System ersatzweise zu einem Angriff von NK-Zellen auf die virusinfizierten Zellen im Sinne des „missing self“ führt; es ist für das Virus daher essentiell, die zellulären Mechanismen genau in einem solchen Maß zu manipulieren, dass es in die Wahrnehmungslücke zwischen zwei Mechanismen fällt. Besonders bevorzugt ist hierbei eine Effektorsequenz, die die Peptidpräsentation auf MHCs unterdrückt und gleichzeitig die Expression von NK-aktivierenden Zeiloberflächenmolekülen steigert.In a particular embodiment of the invention, the effector sequence is counter-intuitive in that it uses immunological camouflage mechanisms of the virus amplified. This embodiment is based on the fact that the immune system largely avoids “single points of failure”, for example by completely suppressing peptide presentation on MHCs and thus camouflage from the T cell system, instead of attacking NK cells on the virus-infected cells in terms of the “missing self”; it is therefore essential for the virus to precisely manipulate the cellular mechanisms to such an extent that it falls into the perceptual gap between two mechanisms. An effector sequence that suppresses peptide presentation on MHCs and at the same time increases the expression of NK-activating cell surface molecules is particularly preferred.

In einer besonderen Ausführungsform der Erfindung ist die Effektorsequenz darauf ausgelegt, speziell aktivierte T- oder NK-Zellen anzusprechen. Hierbei ist es bevorzugt, dass entsprechende Zellen dem Patienten selber entnommen werden, durch physiologische Aktivierung oder Transfektion in einen aktivierten Zustand versetzt und in den Patienten refundiert werden.In a particular embodiment of the invention, the effector sequence is designed to address specifically activated T or NK cells. It is preferred here that corresponding cells are removed from the patient himself, brought into an activated state by physiological activation or transfection and returned to the patient.

Die vorliegende Erfindung bezieht sich ferner auf eine pharmazeutische Zusammensetzung zur Diagnose oder Behandlung eines medizinischen Zustands eines Menschen oder eines nicht-menschlichen Wirbeltiers, dadurch gekennzeichnet, dass sie eine Substanz gemäß der vorliegenden Erfindung und Liposomen, insbesondere Liposomen mit positiver Oberflächenladung, umfasst, und ein Arzneimittel zur Behandlung eines medizinischen Zustands eines Menschen oder eines nicht-menschlichen Wirbeltiers, dadurch gekennzeichnet, dass sie eine Substanz gemäß der vorliegenden Erfindung und Liposomen, insbesondere Liposomen mit positiver Oberflächenladung, umfasst. Geeignete Liposomen sowie Materialien und Verfahren zu deren Herstellung sind aus dem Stand der Technik bekannt.The present invention further relates to a pharmaceutical composition for the diagnosis or treatment of a medical condition in a human or non-human vertebrate, characterized in that it comprises a substance according to the present invention and liposomes, in particular liposomes with a positive surface charge, and a A pharmaceutical composition for the treatment of a medical condition in a human or non-human vertebrate, characterized in that it comprises a substance according to the present invention and liposomes, in particular liposomes with a positive surface charge. Suitable liposomes and materials and processes for their production are known from the prior art.

In einer besonderen Ausführungsform der vorliegenden Erfindung wird für die räumlich fokussierte Verabreichung der Nukleinsäure gemäß der vorliegenden Erfindung ein virales oder pseudovirales System, z.B. das von Flaig 1997 beschriebene ψSV40-System, insbesondere ein System, das auf einem anderen Virus als dem zu behandelnden basiert, verwendet.In a particular embodiment of the present invention, a viral or pseudoviral system, e.g. the ψSV40 system described by Flaig 1997, in particular a system based on a virus other than the one to be treated, is used for the spatially focused administration of the nucleic acid according to the present invention. used.

In einer bevorzugten Ausführungsform der vorliegenden Erfindung wird ein Bakteriophage als Träger für die Nukleinsäure gemäß der vorliegenden Erfindung verwendet. In a preferred embodiment of the present invention, a bacteriophage is used as a carrier for the nucleic acid according to the present invention.

Hierbei ist es besonders bevorzugt, dass der Bakteriophage in der Lage ist, Bakterien zu infizieren, die im Darm als Teil der normalen Flora vorhanden sind, und dass der Bakteriophage zusätzlich zu der erfindungsgemäßen Nukleinsäure ein Expressionskonstrukt für ein Protein umfasst, das in der Lage ist, die erfindungsgemäße Nukleinsäure oder ein Transkript oder eine Kopie davon in ein pseudovirales Kapsid zu verpacken, das in der Lage ist, in die Darmzellen einzudringen und die erfindungsgemäße Nukleinsäure oder das Transkript oder eine Kopie davon dorthin abzugeben, wobei das Expressionskonstrukt Promotoren umfasst, die die Transkription und Translation in prokaryotischen, aber nicht in eukaryotischen Zellen vermitteln. Dabei ist es besonders bevorzugt, dass das Expressionskonstrukt zur Expression der Proteine des Enterovirus-Kapsids fähig ist, und dass die Substanz in einer magensaftresistenten Darreichungsform verabreicht wird, am zweckmäßigsten zur Behandlung einer viralen oder neoplastischen Erkrankung des Darmtraktes.Here, it is particularly preferred that the bacteriophage is capable of infecting bacteria present in the gut as part of the normal flora and that the bacteriophage comprises, in addition to the nucleic acid of the invention, an expression construct for a protein capable of , to package the nucleic acid according to the invention or a transcript or a copy thereof in a pseudoviral capsid which is capable of penetrating into the intestinal cells and delivering the nucleic acid according to the invention or the transcript or a copy thereof there, the expression construct comprising promoters which the Mediate transcription and translation in prokaryotic but not in eukaryotic cells. It is particularly preferred that the expression construct is capable of expressing the proteins of the enterovirus capsid and that the substance is administered in an enteric-coated dosage form, most expediently for the treatment of a viral or neoplastic disease of the intestinal tract.

In einer besonders bevorzugten Ausführungsform der vorliegenden Erfindung ist das Virus das Covid-19-Virus; die relevante Nukleinsäure ist eine RNA, umfassend eine Sequenz mit der folgenden Struktur: I. Die Erkennungssequenz für die Replikase des Covid-19-Virus; II. Die Verpackungssequenz des Covid-19-Virus; III. Eine zweite Instanz der Erkennungssequenz für die Replikase des Covid-19-Virus; IV. Eine kodierende Sequenz für das CD48-Protein; V. Eine dritte Instanz der Erkennungssequenz für die Replikase des Covid-19-Virus; VI. Eine siRNA-Sequenz für das E-Protein des Covid-19-Virus; und die Liposomen umfassen positive Oberflächenladungen. Ohne durch die Theorie eingeschränkt zu sein, wird angenommen, dass in diesem Fall und nur in Gegenwart des Covid-19-Virus in der Zelle das System eine begrenzte Anzahl von Kopien in voller Länge liefert, die in Covid-19-Virionen verpackt werden können und sich so im Gewebe ausbreiten; eine mäßige Menge von III.-IV.-V-VI.-Kopien, die CD48 exprimieren und so die durch das Virus verursachte immunologische „Tarnung“ überwinden; und eine reichliche Menge von V.-Vl.-Kopien, die an virale RNA binden und diese inaktivieren, die das Leseraster für das E-Protein umfasst, wodurch seine Expression blockiert und die Bildung reifer Virionen behindert wird, ohne die Synthese anderer Strukturproteine wie des Spike-Proteins zu stören, die so vom Immunsystem angegriffen werden können.In a particularly preferred embodiment of the present invention, the virus is the Covid-19 virus; the relevant nucleic acid is an RNA comprising a sequence having the following structure: I. The recognition sequence for the replicase of the Covid-19 virus; II. The packaging sequence of the Covid-19 virus; III. A second instance of the recognition sequence for the replicase of the Covid-19 virus; IV. A coding sequence for the CD48 protein; V. A third instance of the recognition sequence for the replicase of the Covid-19 virus; VI. A siRNA sequence for the E protein of the Covid-19 virus; and the liposomes include positive surface charges. Without being limited by theory, it is believed that in this case, and only in the presence of Covid-19 virus in the cell, the system provides a finite number of full-length copies that can be packaged into Covid-19 virions and thus spread in the tissue; a moderate amount of III-IV-V-VI copies expressing CD48, thus overcoming the immunological "cloaking" caused by the virus; and an abundance of V.-Vl. copies that bind to and inactivate viral RNA comprising the E protein reading frame, thereby blocking its expression and impeding the formation of mature virions without the synthesis of other structural proteins such as of the spike protein, which can then be attacked by the immune system.

In einer alternativen Ausführungsform sind die obigen Elemente I.-IV.-V.-VI.-II. angeordnet, wobei jede einzelne Kopie, auch die Teilkopien, ein Verpackungssignal trägt, wobei der Aspekt A, kompetitive Hemmung der Virionenbildung, gegenüber dem Aspekt B, Ausbreitung der erfindungsgemäßen Nukleinsäure, hervorgehoben wird. Viele andere Anordnungen sind ebenfalls möglich und erfindungsgemäß.In an alternative embodiment, the above elements I.-IV.-V.-VI.-II. arranged, with each individual copy, including the partial copies, carrying a packaging signal, with aspect A, competitive inhibition of virion formation, being emphasized over aspect B, propagation of the nucleic acid according to the invention. Many other arrangements are also possible and in accordance with the invention.

In einer besonders bevorzugten Ausführungsform der vorliegenden Erfindung wird die Substanz mit Liposomen mit positiven Oberflächenladungen gemischt und als Aerosol zur direkten Applikation in die Atemwege des Menschen oder nicht-menschlichen Wirbeltieres formuliert.In a particularly preferred embodiment of the present invention, the substance is mixed with liposomes having positive surface charges and formulated as an aerosol for direct administration to the respiratory tract of humans or non-human vertebrates.

Die vorliegende Erfindung bezieht sich ferner auf ein Verfahren zur Entwicklung einer Substanz nach Anspruch 1, dadurch gekennzeichnet, dass es die Auswahl der Effektorsequenz aus einem Pool von Kandidaten durch den „Shotgun-Ansatz“ und den vierfachen Vergleich der zytotoxischen Aktivität von T-Zellen und/oder NK-Zellen in An- und Abwesenheit der Substanz und in An- und Abwesenheit des Virus unter Verwendung eines aus dem Stand der Technik bekannten Zytolyseassays umfasst. + Substanz - Substanz + Virus A B - Virus C D Somit ist (A-D)/(B-D) die Wirksamkeit und (A-D)/(C-D) die Spezifität der Nukleinsäure gemäß der vorliegenden Erfindung.The present invention further relates to a method for developing a substance according to claim 1, characterized in that it involves the selection of the effector sequence from a pool of candidates by the "shotgun approach" and the fourfold comparison of the cytotoxic activity of T cells and /or NK cells in the presence and absence of the substance and in the presence and absence of the virus using a cytolysis assay known from the prior art. + substance - substance + virus A B - Virus C D Thus (AD)/(BD) is the potency and (AD)/(CD) is the specificity of the nucleic acid according to the present invention.

Ohne Beschränkung auf oder durch die Theorie wird in Betracht gezogen, dass der Fachmann aus dem Stand der Technik bekannte Werkzeuge verwendet, um zunächst eine geeignete Kontrollsequenz zu identifizieren, z.B. indem er ein Reportergen wie Luziferase oder GFP oder ein Derivat davon stromabwärts eines beliebigen viralen Fragments bereitstellt und die Expressionsstärke in An- und Abwesenheit der relevanten viralen Komponente testet, im Falle eines RNA-Virus vorzugsweise eine Bibliothek von Fragmenten aus dem 5'-Ende der viralen RNA, wobei für jedes Bibliothekselement eine qualitative oder vorzugsweise quantitative Korrelation mit der Anwesenheit der viralen RNA-Replikase hergestellt wird. Mutatis mutandis kann derselbe Ansatz verwendet werden, um gewünschtenfalls ein Verpackungssignal zu identifizieren. Sobald der „Kiel“ des Systems gemäß der vorliegenden Erfindung gelegt ist, können wohldefinierte Komponenten schrittweise zugegeben und auf Expression in An- und Abwesenheit der jeweiligen viralen Komponente getestet werden, z. B. CD48 durch zytometrische Analyse in Zellen, die unterschiedliche Mengen der viralen RNA-Replikase exprimieren, oder pro-apoptotische Genprodukte durch Anwendung eines beliebigen bekannten Testkits für Apoptose in Zellen, die unterschiedliche Mengen der viralen RNA-Replikase exprimieren. Schließlich können schlecht definierte Komponenten durch einen weiteren Shotgun-Ansatz selektiert werden, z. B. durch Hinzufügen beliebiger Schnipsel des Zielvirus als Kandidaten für eine gegensinnbasierte Inhibition, wobei zu verstehen ist, dass hier alle Arten der gegensinnbasierten Inhibition eingesetzt werden können, unabhängig vom genauen molekularen Mechanismus, und der so erhaltene Pool kann dem oben beschriebenen Zytolyse-Assay unterzogen werden, um Kandidaten mit herausragenden Wirksamkeits- und Spezifitätswerten für die weitere Charakterisierung zu erhalten.Without being limited by or by theory, it is contemplated that one skilled in the art could use tools known in the art to first identify an appropriate control sequence, e.g. by placing a reporter gene such as luciferase or GFP or a derivative thereof downstream of any viral fragment provides and tests the level of expression in the presence and absence of the relevant viral component, in the case of an RNA virus preferably a library of fragments from the 5' end of the viral RNA, for each library element a qualitative or preferably quantitative correlation with the presence of viral RNA replicase is produced. Mutatis mutandis, the same approach can be used to identify a packaging signal if desired. Once the "keel" of the system according to the present invention has been laid, well-defined components can be added stepwise and tested for expression in the presence and absence of the respective viral component, e.g. B. CD48 by cytometric analysis in cells expressing different levels of viral RNA replicase, or pro-apoptotic gene products by application of any known assay kit for apoptosis in cells expressing different levels of viral RNA replicase. Finally, ill-defined components can be selected by another shotgun approach, e.g. by adding any snippet of the target virus as a candidate for antisense-based inhibition, it being understood that all types of antisense-based inhibition can be employed here, regardless of the precise molecular mechanism, and the resulting pool can be subjected to the cytolysis assay described above to obtain candidates with outstanding efficacy and specificity values for further characterization.

Diese Schritte eignen sich zur Automatisierung, und es ist denkbar, dass die vorliegende Erfindung letztendlich zu einem Reaktionskit für emergente Viruserkrankungen führt, das in der Lage ist, automatisch eine Reihe von Nukleinsäuren gemäß der vorliegenden Erfindung zu erzeugen, wenn es mit einem neuartigen Pathogen konfrontiert wird. Im Idealfall führt dieses Kit eine subtraktive Hybridisierung gegen gesundes Gewebe durch und nutzt Datenbanken und Kl-Methoden, um unter den vielen Nukleinsäuren, die in einer unbearbeiteten Probe vorhanden sind, diejenigen zu identifizieren, die einem Erreger zugeordnet werden können, wodurch die mühsame und risikoreiche manuelle Bearbeitung von infektiösen Proben entfällt.These steps lend themselves to automation, and it is conceivable that the present invention will ultimately result in an emergent viral disease reaction kit capable of automatically generating a variety of nucleic acids according to the present invention when confronted with a novel pathogen becomes. Ideally, this kit performs subtractive hybridization against healthy tissue, and uses databases and AI methods to identify those that can be assigned to a pathogen from among the many nucleic acids present in an unprocessed sample, eliminating the tedious and risky process manual processing of infectious samples is no longer necessary.

Alle hier angeführten Beispiele sind so zu verstehen, dass sie den Umfang der vorliegenden Erfindung nicht einschränken, und alle Verweise auf hier nicht näher erläuterte Konzepte oder Einheiten als Verweise auf den einschlägigen Stand der Technik, auch wenn dies nicht ausdrücklich erwähnt wird. Es wird ausdrücklich auf frühere Anmeldungen der vorliegenden Erfinder, insbesondere DE 10 2008 062 965.0 , verwiesen, die unter anderem ein System zur Erzeugung von Antikörpern oder anderen Interaktionspartnern für Proteine bekannter Sequenz offenbaren.All examples provided herein are to be understood as not limiting the scope of the present invention, and all references to concepts or entities not further detailed herein are to be considered as references to the relevant prior art, even if not specifically mentioned. Reference is expressly made to previous applications by the present inventors, in particular DE 10 2008 062 965.0 , referenced, which disclose, inter alia, a system for generating antibodies or other interaction partners for proteins of known sequence.

Ohne Beschränkung und zu rein illustrativen Zwecken sind verschiedene Aspekte der vorliegenden Erfindung durch die beigelegten, stark vereinfachten Zeichnungen näher erläutert:

  • Zeichnung 1 - Grundsätzliche Darstellung einer möglichen Ausführungsform zur Behandlung einer durch RNA-Viren ausgelösten Infektionskrankheit. Hierbei ist die Darstellung im Interesse leichterer Verständlichkeit zum einen (Zeichnung 1a) in die beiden Teilaspekte der viralen Funktionsweise und der Funktionsweise der erfindungsgemäßen Nukleinsäure aufgeteilt, zum anderen (Zeichnung 1b) im Zusammenhang dargestellt.
  • Zeichnung 2 - Exemplarische Darstellung möglicher erfindungsgemäßer Nukleinsäuren, zum einen (Zeichnung 2a) einer erfindungsgemäßen Nukleinsäure zur Behandlung einer Infektion mit dem Covid-Virus und zum anderen (Zeichnung 2b) einer erfindungsgemäßen Nukleinsäure in Form eines bakteriell vermehrbaren Plasmids zur Identifikation einer geeigneten Kontrollsequenz im Sinne der Erfindung aus einem noch uncharakterisierten Virus, wobei zur Suche nach der Kontrollsequenz Reverstranskripte (cDNAs) viraler Fragmente in den sog. Polylinker eingesetzt werden. Die erforderlichen Verfahren sind im Stand der Technik eingehend beschrieben.
  • Zeichnung 3 - Beispielhafte schematische Darstellung des prinzipiellen Arbeitsgangs zur Identifikation von wirksamen Teilsequenzen der Verpackungssequenz und des immunsuppressiven Teils eines Virus durch zweifache „Shotgun-Klonierung“ und anschließende Durchmusterung auf zytolytische Wirkung von NK-Zellen in Anwesenheit des Virus und des jeweiligen Klons.
Without limitation and for purely illustrative purposes, various aspects of the present invention are explained in more detail by the attached, greatly simplified drawings:
  • Drawing 1 - Basic representation of a possible embodiment for the treatment of an infectious disease triggered by RNA viruses. In the interest of easier comprehension, the representation is on the one hand (drawing 1a) divided into the two partial aspects of viral functioning and the functioning of the nucleic acid according to the invention, and on the other (drawing 1b) shown in context.
  • Drawing 2 - Exemplary representation of possible nucleic acids according to the invention, on the one hand (drawing 2a) a nucleic acid according to the invention for the treatment of an infection with the Covid virus and on the other hand (drawing 2b) a nucleic acid according to the invention in the form of a bacterially reproducible plasmid for identifying a suitable control sequence in the sense the invention from a still uncharacterized virus, whereby reverse transcripts (cDNAs) of viral fragments are inserted into the so-called polylinker to search for the control sequence. The necessary processes are described in detail in the prior art.
  • Drawing 3 - Exemplary schematic representation of the basic workflow for identifying effective partial sequences of the packaging sequence and the immunosuppressive part of a virus by double "shotgun cloning" and subsequent screening for cytolytic effects of NK cells in the presence of the virus and the respective clone.

Es sei darauf hingewiesen, dass der Verständlichkeit halber in den Zeichnungen die Kontrollsequenz zumeist am 5'-Ende der erfindungsgemäßen Nukleinsäure dargestellt ist, dies jedoch nicht erforderlich ist. In einer besonderen Ausführungsform schließt sich auf der 5'-Seite der Kontrollsequenz ein Leserahmen für ein irrelevantes Peptid an, z.B. eine Sequenz, die die Nukleotidfolge AUGAUGUAAUAGUGA enthält, von der ohne Beschränkung auf oder durch die Theorie angenommen wird, dass ihre Aufeinanderfolge von zwei Startcodons und drei verschiedenen Stopcodons wirksam zu Initiation und Beendigung der Translation führt und damit 3'-seitige Leseraster vor Translation schützt, so dass in Abwesenheit des auf die Kontrollsequenz wirkenden Virus- oder Tumorfaktors eine Translation der Effektorsequenz durch einen zusätzlichen Sicherungsmechanismus verhindert wird.It should be pointed out that, for the sake of comprehensibility, the control sequence is mostly shown in the drawings at the 5' end of the nucleic acid according to the invention, but this is not necessary. In a particular embodiment, the 5' side of the control sequence is followed by a reading frame for an irrelevant peptide, e.g. a sequence containing the nucleotide sequence AUGAUGUAAUAGUGA, which is believed, without limitation to or by theory, to have its sequence of two start codons and three different stop codons effectively leads to the initiation and termination of translation and thus protects 3'-side reading frames from translation, so that in the absence of the viral or tumor factor acting on the control sequence, translation of the effector sequence is prevented by an additional safety mechanism.

Abschließend sei darauf hingewiesen, dass das Hauptaugenmerk der beschriebenen Erfindung auf viralen und neoplastischen Erkrankungen liegt, hinsichtlich des Niveaus der Erreger jedoch nach beiden Seiten offen ist. Der Stand der Technik legt nahe, dass sowohl bei manchen Infektion durch zelluläre Organismen als auch bei Krankheiten durch subvirale Erreger wie Prionen unübliche Genaktivitäten in befallenen Zellen und Geweben auftreten. Auch auf diese können gegebenenfalls die erfindungsgemäßen Substanzen und Verfahren angewendet werden.Finally, it should be pointed out that the main focus of the invention described is on viral and neoplastic diseases, but the level of the pathogens is open to both sides. The state of the art suggests that in some infections by cellular organisms as well as in diseases by subviral pathogens such as prions, unusual gene activities occur in affected cells and tissues. If appropriate, the substances and methods according to the invention can also be applied to these.

ZITATE ENTHALTEN IN DER BESCHREIBUNGQUOTES INCLUDED IN DESCRIPTION

Diese Liste der vom Anmelder aufgeführten Dokumente wurde automatisiert erzeugt und ist ausschließlich zur besseren Information des Lesers aufgenommen. Die Liste ist nicht Bestandteil der deutschen Patent- bzw. Gebrauchsmusteranmeldung. Das DPMA übernimmt keinerlei Haftung für etwaige Fehler oder Auslassungen.This list of documents cited by the applicant was generated automatically and is included solely for the better information of the reader. The list is not part of the German patent or utility model application. The DPMA assumes no liability for any errors or omissions.

Zitierte PatentliteraturPatent Literature Cited

  • DE 102008062965 [0042]DE 102008062965 [0042]

Claims (10)

Substanz zur Diagnose oder Behandlung eines medizinischen Zustands eines Menschen oder eines nicht-menschlichen Wirbeltiers, der die Expression eines nicht-physiologischen Proteins beinhaltet, dadurch gekennzeichnet, dass die Substanz eine Nukleinsäure umfasst, die mindestens (I) eine Kontrollsequenz umfasst, die mit einem nicht-physiologisch exprimierten Protein interagiert, um die Replikation und/oder Expression von (II) einer Effektorsequenz zu ermöglichen, deren Replikation und/oder Expression der Manifestation des medizinischen Zustands entgegenwirkt.Substance for the diagnosis or treatment of a medical condition in a human or a non-human vertebrate involving the expression of a non-physiological protein, characterized in that the substance comprises a nucleic acid comprising at least (I) a control sequence comprising a non - interacts with the physiologically expressed protein to allow the replication and/or expression of (II) an effector sequence, the replication and/or expression of which counteracts the manifestation of the medical condition. Substanz nach Anspruch 1, dadurch gekennzeichnet, dass der Zustand eine akute oder chronische Virusinfektion oder ein Zustand ist, der kausal mit einer akuten oder chronischen Virusinfektion verbunden ist.substance after claim 1 characterized in that the condition is an acute or chronic viral infection or a condition causally related to an acute or chronic viral infection. Substanz nach Anspruch 2, dadurch gekennzeichnet, dass die virale Infektion eine Infektion mit einem RNA-Virus ist und die Kontrollsequenz eine Erkennungssequenz für die Replikase des RNA-Virus umfasst.substance after claim 2 , characterized in that the viral infection is an infection with an RNA virus and the control sequence comprises a recognition sequence for the replicase of the RNA virus. Substanz nach Anspruch 2, dadurch gekennzeichnet, dass die virale Infektion eine Infektion mit einem Papovavirus ist und die Kontrollsequenz den Promotor der späten Gene des Papovavirus umfasst.substance after claim 2 , characterized in that the viral infection is an infection with a papovavirus and the control sequence comprises the promoter of the papovavirus late genes. Substanz nach Anspruch 2, dadurch gekennzeichnet, dass sie (III) das Verpackungssignal des Virus enthält.substance after claim 2 , characterized in that it contains (III) the packaging signal of the virus. Substanz nach Anspruch 1, dadurch gekennzeichnet, dass der Zustand neoplastisch ist.substance after claim 1 , characterized in that the condition is neoplastic. Substanz nach Anspruch 1, dadurch gekennzeichnet, dass eine Effektorsequenz ausgewählt ist aus - Gegensinnsequenzen zu dem entsprechenden Virus oder Onkogen; - kodierenden Sequenzen für Zelloberflächenproteine, die die Erkennung der Zelle mit unphysiologischer Proteinexpression durch T-Zellen und/oder natürliche Killerzellen erhöhen; - Gegensinnsequenzen zu kodierenden Sequenzen für Zelloberflächenproteine, die die Erkennung der Zelle mit unphysiologischer Proteinexpression durch T-Zellen und/oder natürliche Killerzellen hemmen; - kodierenden Sequenzen für Interferone, Tumorsuppressor-Gene und/oder pro-apoptotische Proteine; - Gegensinnsequenzen zu kodierenden Sequenzen für anti-apoptotische Proteine; - kodierenden Sequenzen für DNAsen, RNAsen und/oder Proteasen; - kodierenden Sequenzen für immunogene Proteine; - kodierenden Sequenzen für Enzyme, die in der Lage sind, ein unwirksames Prodrug in ein antiviral, antineoplastisch oder anderweitig therapeutisch wirksames Medikament umzuwandeln; - kodierenden Sequenzen für Antikörper oder antikörperähnliche Proteine; sowie Fusionen der oben genannten mit einander oder anderen Sequenzen.substance after claim 1 , characterized in that an effector sequence is selected from - antisense sequences to the corresponding virus or oncogene; - coding sequences for cell surface proteins that increase recognition of the cell with non-physiological protein expression by T cells and/or natural killer cells; - Antisense sequences to coding sequences for cell surface proteins that inhibit recognition of the cell with unphysiological protein expression by T cells and/or natural killer cells; - coding sequences for interferons, tumor suppressor genes and/or pro-apoptotic proteins; - Antisense sequences to coding sequences for anti-apoptotic proteins; - coding sequences for DNAses, RNAses and/or proteases; - coding sequences for immunogenic proteins; - coding sequences for enzymes capable of converting an inactive prodrug into an antiviral, antineoplastic or otherwise therapeutically active drug; - coding sequences for antibodies or antibody-like proteins; and fusions of the above with each other or other sequences. Pharmazeutische Zusammensetzung zur Diagnose oder Behandlung eines medizinischen Zustands eines Menschen oder eines nicht-menschlichen Wirbeltiers, dadurch gekennzeichnet, dass sie eine Substanz nach Anspruch 1 und Liposomen umfasst.A pharmaceutical composition for diagnosing or treating a medical condition in a human or non-human vertebrate, characterized in that it comprises a substance according to claim 1 and liposomes. Pharmazeutische Zusammensetzung nach Anspruch 8, dadurch gekennzeichnet, dass das Virus das Covid-19-Virus ist; die Nukleinsäure eine RNA ist, die eine Sequenz mit der folgenden Struktur umfasst: I. Die Erkennungssequenz für die Replikase des Covid-19-Virus; II. Die Verpackungssequenz des Covid-19-Virus; III. Eine zweite Instanz der Erkennungssequenz für die Replikase des Covid-19-Virus; IV. Eine kodierende Sequenz für das CD48-Protein; V. Eine dritte Instanz der Erkennungssequenz für die Replikase des Covid-19-Virus; VI. Eine siRNA für das E-Protein des Covid-19-Virus; und die Liposomen positive Oberflächenladungen umfassen.Pharmaceutical composition according to claim 8 , characterized in that the virus is the Covid-19 virus; the nucleic acid is an RNA comprising a sequence having the following structure: I. The recognition sequence for the replicase of the Covid-19 virus; II. The packaging sequence of the Covid-19 virus; III. A second instance of the recognition sequence for the replicase of the Covid-19 virus; IV. A coding sequence for the CD48 protein; V. A third instance of the recognition sequence for the replicase of the Covid-19 virus; VI. An siRNA for the E protein of the Covid-19 virus; and the liposomes comprise positive surface charges. Verfahren zur Entwicklung einer Substanz nach Anspruch 1, dadurch gekennzeichnet, dass es die Auswahl der Effektorsequenz aus einem Pool von Kandidaten durch den „Shotgun-Ansatz“ und den vierfachen Vergleich der zytolytischen Aktivität von T-Zellen und/oder NK-Zellen in An- und Abwesenheit der Substanz und in An- und Abwesenheit des Virus umfasst.Process for developing a substance claim 1 , characterized in that it is the selection of the effector sequence from a pool of candidates by the "shotgun approach" and the four-fold comparison of the cytolytic activity of T cells and / or NK cells in the presence and absence of the substance and in the presence and absence of the virus.
DE102021001841.9A 2021-04-11 2021-04-11 Sensory nucleic acids for the diagnosis and treatment of viral and neoplastic diseases Withdrawn DE102021001841A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
DE102021001841.9A DE102021001841A1 (en) 2021-04-11 2021-04-11 Sensory nucleic acids for the diagnosis and treatment of viral and neoplastic diseases

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
DE102021001841.9A DE102021001841A1 (en) 2021-04-11 2021-04-11 Sensory nucleic acids for the diagnosis and treatment of viral and neoplastic diseases

Publications (1)

Publication Number Publication Date
DE102021001841A1 true DE102021001841A1 (en) 2022-10-13

Family

ID=83361555

Family Applications (1)

Application Number Title Priority Date Filing Date
DE102021001841.9A Withdrawn DE102021001841A1 (en) 2021-04-11 2021-04-11 Sensory nucleic acids for the diagnosis and treatment of viral and neoplastic diseases

Country Status (1)

Country Link
DE (1) DE102021001841A1 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE102021002567A1 (en) 2021-05-17 2022-11-17 Rüdiger Marcus Flaig Other sensory nucleic acids for the diagnosis and treatment of viral and neoplastic diseases
DE102021005748A1 (en) 2021-11-21 2023-05-25 Rüdiger Marcus Flaig Replicase chain reaction (RCR) and its use in the diagnosis and treatment of viral diseases

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE102008062965A1 (en) 2008-08-13 2010-02-25 Flaig, Rüdiger Marcus, Dr. Dr. System, useful e.g. to produce a medicament to treat malignant diseases and metastatic tumors and for the isolation of a specific element of a molecular library, comprises a reaction chamber partitioned into a number of compartments

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE102008062965A1 (en) 2008-08-13 2010-02-25 Flaig, Rüdiger Marcus, Dr. Dr. System, useful e.g. to produce a medicament to treat malignant diseases and metastatic tumors and for the isolation of a specific element of a molecular library, comprises a reaction chamber partitioned into a number of compartments

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE102021002567A1 (en) 2021-05-17 2022-11-17 Rüdiger Marcus Flaig Other sensory nucleic acids for the diagnosis and treatment of viral and neoplastic diseases
DE102021005748A1 (en) 2021-11-21 2023-05-25 Rüdiger Marcus Flaig Replicase chain reaction (RCR) and its use in the diagnosis and treatment of viral diseases

Similar Documents

Publication Publication Date Title
Kroner et al. Role of microglia in spinal cord injury
DE69839359T2 (en) Methods and Reagents for Generating a CD8 + T Cell Immune Response to Hepatitis B or C
DE69628838T2 (en) CHEMOKIN BINDING PROTEIN AND METHOD FOR USE THEREOF
DE102021001841A1 (en) Sensory nucleic acids for the diagnosis and treatment of viral and neoplastic diseases
CN106265679A (en) Bromine domain protein inhibitor is preparing the purposes that anti-HIV-1 is hidden in medicine
EP1617858B1 (en) Caspase 3, 8, 9 or 10 inhibitors in combination with MEK inhibitors for the treatment of influenza
DE102010004957A1 (en) Biologically active molecules for influencing virus, bacterial, parasite-infected cells and / or tumor cells and methods for their use
EP1303286B1 (en) Use of strains of the parapox ovis virus for producing antiviral pharmaceuticals and anticancer pharmaceuticals
EP1171587B1 (en) Peptide from antigen muc-1 for triggering an immune response to tumor cells
DE10239531A1 (en) Prophylaxis and therapy of infectious diseases
EP1185279A2 (en) Agents for treating malignant diseases using e1a-deficient adenoviruses with yb-1 protein-dependent replication
EP1056467A2 (en) Method for the treatment of diseases or disorders of the inner ear
EP1841461B1 (en) Injectable agent for the targeted treatment of retinal ganglion cells
DE69433996T2 (en) Use of pharmaceutical compositions for the treatment of neurodegenerative diseases
DE102021002567A1 (en) Other sensory nucleic acids for the diagnosis and treatment of viral and neoplastic diseases
DE102014001771A1 (en) Optimized pseudovirions (Ω-virions) as a basis for vaccines and individualized tumor therapy
DE69434564T2 (en) PHARMACEUTICAL COMPOSITIONS AND THEIR USE, IN PARTICULAR IN THE TREATMENT OF NEURODEEGENERATIVE DISEASES
DE102018215551A1 (en) Process for the production of an antitumoral arenavirus and arenavirus mutants
DE19922407A1 (en) Preparing medicament for treating viral infections, liver diseases or cancer, comprising recombinant parapoxvirus targeted towards specific organs, cells or tissues
DE10056059A1 (en) Differentiation-triggering substances
DE4305736C1 (en) Evolutive vaccination
WO2000014215A1 (en) Method for selecting peptides for the targeted transport of drugs and markers, and peptides discovered using said method
DE19940748A1 (en) Medicaments containing xenogenic oligo- and / or polyribonucleotides
WO1993022433A2 (en) Medicament for the gene-therapeutic treatment of human beings, animals and plants, especially to block virus multiplication and carcinogenes and process for producing the medicament
Li et al. INCREASED DIFFERENTIAL GENE EXPRESSION AND NETWORK OF DOPAMINE NEURONS IN SCHIZOPHRENIA BASAL GANGLIA BY SPLIT-SEQ

Legal Events

Date Code Title Description
R086 Non-binding declaration of licensing interest
R119 Application deemed withdrawn, or ip right lapsed, due to non-payment of renewal fee