DE102007063210A1 - Medicines for the treatment of phantom phenomena - Google Patents

Abstract

The present invention relates to a medicament for the treatment of phantom phenomena of acute tinnitus and / or phantom pain, a process for the preparation of such a medicament and a process for the treatment of these phantom phenomena.

Description

The The present invention relates to a pharmaceutical composition for the treatment of phantom phenomena of acute tinnitus and / or phantom pain, a procedure for the preparation of such a medicament and a method for the treatment of these phantom phenomena.

Under The phantom phenomenon of tinnitus is by a patient perceived sounds understood through the ear and the auditory system are generated. Tinnitus, the first since A few weeks to three months is considered acute tinnitus designated. If the tinnitus persists for more than a year, will he calls it chronic. According to epidemiological surveys are in Germany about three million adults. At all ages The numbers of those affected by chronic tinnitus vary according to study between 4.4% and 15%. Globally, it comes in every year About ten million people have tinnitus, which is around 340,000 from an acute to a chronic form, so-called new disease rate.

To belong to the multiple causes of tinnitus chronic noise damage, acute bang injuries of hearing, hearing loss and other diseases, associated with a hearing loss. relationships with inner ear hearing loss as a chronic progressive Form or as noise deafness, followed by Meniere's disease and acute hearing loss are clinical Studies in more than two thirds related to tinnitus. At the origin and maintenance of tinnitus are also diseases the cervical spine as well as the temporomandibular joint and the musculoskeletal system involved. Tinnitus also seems to have a psychic component so talked about psychogenic tinnitus in this context becomes. In many cases, however, can be despite intensive diagnosis does not detect a safe cause of tinnitus.

Currently is tinnitus with psychosomatic treatment, relaxation therapy, Biofeedback, hypnotherapy, electrical stimulation, lidocaine, Iontophoresis or masking therapy. This is it but only symptomatic therapy concepts.

The WO 02/15907 A1 suggests the treatment of tinnitus by the administration of the potassium channel opener flupirtin. This treatment has the disadvantage that flupirtine is additionally a muscle-relaxing analgesic, whereby an application with unacceptable side effects would be associated.

Wang et al. (2000), Evaluating effects of some tinnitus with animal behavioral model in rats, Zhonghua Er. Bi. Yan. Hou. Ke. Za. Zhi. 35 (5) , abstract, suggest the administration of nimodipine for the treatment of tinnitus. Nimodipine is an inhibitor of the Ca ⁺⁺ channel Cav1.3. It has been found, however, that the blockage of the Cav1.3 channel in the auditory system would lead directly to deafness, so that nimodipine is completely unsuitable for the treatment of tinnitus.

In the WO 2004/022069 A1 are described as one of the possible causes of tinnitus-aberrant NMDA (N-methyl-D-aspartate) receptors. These altered so-called glutamate receptor channels, which are expressed among others by auditory nerve cells, lead to increased influx of calcium into the cell. In this document, it is proposed to use NMDA receptor antagonists for the treatment of tinnitus. However, it remains completely unclear whether the acute or chronic situation of tinnitus should be treated with these substances. Furthermore, there are no indications as to how the application of the substances has to be made.

In the DE 101 24 953 A1 A treatment concept for tinnitus is proposed that stimulates the expression of Brain-derived Nerve Growth Factor (BDNF), based on an animal model that describes a decrease in chronic tinnitus in the cochlea and inferior colliculus Therefore, as a therapeutic approach, the stimulation of BDNF expression is suggested, but the authors have specifically and exclusively investigated the situation with chronic tinnitus: For example, the rats used in the animal model were treated with salicylates for three months. which is known to induce chronic tinnitus; Penner MJ, and Jastreboff PJ (1996), Tinnitus: Psycho-physical observations in humans and animal models, in: Van de Water, Popper AN, Fax, RR (Ed.), Clinical Aspects of Hearing, Springer, New York, Heidelberg , Pages 208 to 304 ; and Bauer, CA, et al. (1999), A behavioral model of chronic tinnitus in rats. Otolaryngol. Head Neck Surg. 121, pages 457 to 462 , Not recognized by the authors of the DE 101 24 953 A1 however, there must be significant differences between the treatment of chronic and acute tinnitus.

In the WO 2006/079476 It is suggested that the phantom phenomena of acute tinnitus as well as phantom pain could be treated by the use of a substance interacting with the BDNF signal transduction cascade, such as a GABA receptor agonist.

An overview of the clinical picture of the Tinnitus can be found, for example, in Waddell, A., Canter, R. (2004), Tinnitus, Am. Fam. Physician 69, pages 591 to 592 ,

Under the phantom phenomenon of the phantom pain becomes the projection from sensations into an amputated or z. B. by Plexus damage or Paraplegia denervated body part, a Extremity, the breast, the rectum, a tooth & a. Understood. This part of the body is experienced as present and after limb amputation For example, felt as sitting directly on the stump swollen hand or foot.

figures, in how many cases does it become one after amputation? Phantom pain comes, are patchy, ranging from 5 to 100%.

phantom pain be used in the context of pain therapies, for example, with anticonvulsants, Baclofen or calcitonin. Becoming supportive occasionally used pain-relieving antidepressants. Also Operative methods are used, by means of which, for example, nerves blocked or stimulated. A targeted, causal treatment method does not yet exist, however, especially not because the molecular underlying mechanisms are not fully understood become.

An overview of the clinical picture of phantom pain can be found in Middleton, C. (2003), The causes and treatments of phantom limb pain, Nurs. Times 99, pages 30 to 33 ,

task The present invention is therefore, a new substance or to provide a new therapy concept with which the targeted Phantom phenomena of acute tinnitus and phantom pain can be treated, with the disadvantages of the state the technique should preferably be avoided.

These Task is accomplished by providing a glycine receptor agonist solved.

The Inventors have discovered quite unexpectedly that glycine receptors, so far predominantly in the central nervous system could be localized, also expressed in the inner tube and inhibitory in the binding of a glycine receptor agonist Forward signals to the auditory nerve. The inventors have further recognized that by the application of a glycine receptor agonist and the resulting inhibitory signals in phantom phenomena observed hyperactivity of the auditory nerve can be corrected. Glycine receptor agonists therefore provide new substances with which phantom phenomena are targeted can be treated.

The The object underlying the invention is therefore with the provision completely resolved by glycine receptor agonists.

there For example, it is preferable if a glycine receptor agonist is a substance is provided, which is selected from the group from D-alanine, L-alanine, L-serine, taurine, cannabinoid, tropine, nortropine and derivatives thereof.

This measure has the advantage of providing those agonistic substances which bind to the glycine receptor in a highly affine manner, can be synthesized and formulated simply and inexpensively. Preferred tropins and nortropines are described in Maksay et al. (2007), Synthesis of (nor) tropeine (di) esters and allosteric modulaton of glycine receptor binding, Bioorg. Med. Chem., Online publication of 4 November ; Maksay et al. (2007), Synthesis of tropic and allosteric modulation of ionotropic glycine receptors, J. Med. Chem., 47 (25): 6384-6391 in which esters of 3 alpha and 3 beta-hydroxy (nor) tropanes and amides of 3 alpha-aminotropanes are published; Bíró T. and Maksay G. (2004), Allosteric modulaton of glycine receptors is more efficacious for partial rather than full agonists, Neurochem. Int., 44 (7): 521-527 , The content of the above-mentioned publication is incorporated by reference into the present application.

The Cannabinoid useful as glycine receptor agonist is preferred selected from the group consisting of anandamide, arachidonylglycerol, Tetrahydrocannabinol, WIN 55,212-2.

This measure has the advantage that already such cannabinoids are provided which have proved to be particularly suitable. Iatsenko et al. (2007), The synthetic cannabinoid analogue WIN 55,212-2 potentiates the amplitudes of glycineactivated currents, Article in Ukrainian, Fiziol Zh., 53 (3): 31-37 , describe a cannabinoid designated WIN 55,212-2, which is a particularly effective glycine receptor agonist. The content of the above-mentioned publication is part of the present application.

To an advantageous embodiment of the invention The substance is used locally on or in the ear, preferably over the round window membrane, or applied at the site of amputation.

This measure has the advantage that the substance is administered specifically at the site of action, so that only small amounts of active substance are required. As a result, the body of the treated patient is less stressed and side effects are largely reduced. In the case of treatment of acute tinnitus, this offers Micro dosing system on of Lehner, R. et al. (1996), A new implantable drug delivery system for local therapy of the middle and inner ear, Ear. Nose Throat 76, pages 567 to 570 , is described.

The local application may alternatively be via the use of biodegradable hydrogel, which serves as a carrier matrix for the glycine receptor agonist. Such biodegradable hydrogel has already been successfully used in the animal model for local application of BDNF to the round window of the inner ear; Ito et al. (2005), A new method for drug application to the inner ear, J. Otorhinolaryngol. Relat. Spec., Pages 272-275 ,

Alternatively, for administration via the round window membrane gel pellets products Gelita ^® -Tampons, B. Braun Melsungen AG, Germany can be used, such as.. Alternatively, biocompatible nanoparticles come into question, as described, for example, in US Pat Durán JD et al. (2007), Magnetic colloids as drug vehicles, J. Pharm. Sci, online publication . Mohamed F. and van der Walle CF (2008), Engineering Biodegradable polyester particles with specific drug targeting and drug release properties, J. Pharm. Sci, 97 (1): 71-87, abstract of December, 2007 ; Gupta S. and Moulik SP (2008), Biocompatible microemulsions and their prospective uses in drug delivery, J. Pharm. Sci., 97 (1): 22-45, abstract published online in December 2007 ,

According to a further development of the invention, the medicament has a further substance which is active against phantom phenomena and is selected from the group consisting of GABA receptor agonists, in particular benzodiazepines and substances related to these, baclofen, gamma-vinyl-GABA, gamma-acetylene-GABA , Progabide, muscimol, iboten, sodium valproate and tetrahydroisoxazolopyridine (THIP), MAP kinase inhibitors, in particular U 0126 or PD 98058, cam kinase inhibitors, L-type Ca ⁺⁺ channel antagonists, in particular nicardipine or nifedipine or Isradipine, CREP antagonists, glutamate antagonists, trkB antagonists.

This measure has the advantage that a drug which is particularly potent against phantom phenomena is provided. Specifically, this benefits from the findings of the authors of the WO 2006/079476 who have described that the above substances are suitable for treating phantom phenomena causally.

One Another object of the present invention relates to a method for the manufacture of a medicament for the treatment of phantom phenomena of acute tinnitus and / or phantom pain in a human or animal, comprising the steps of: (a) providing a glycine receptor agonist, and (b) formulation of the glycine receptor agonist in a pharmaceutically acceptable carrier.

Pharmaceutically acceptable carriers and pharmaceutical excipients are well known in the art, cf. for example. Kibbe AH (2000), Handbook of Pharmaceutical Excipients, 3rd Edition, American Pharmaceutical Association and Pharmaceutical Press , the contents of this publication are incorporated herein by reference.

One Another object of the present invention relates to a method to treat the phantom phenomena of acute tinnitus and / or phantom pain in a human being, the comprising the steps of: (a) providing a drug, (b) Apply, possibly locally on or in the ear or at the location of the Amputation, the drug the living thing, and if necessary (c) Repeat of steps (a) and (b), wherein being the drug is the drug the use according to the invention described above is provided.

It it is understood that the above and the following yet to be explained features not only in each case specified combination, but also in other combinations or can be used in isolation, without the scope of the present To leave invention.

The The invention will now be described in more detail with reference to exemplary embodiments which are purely illustrative and from which There are further features and advantages of the invention.

In The enclosed figures show the following:

1 Detection of GlyRα3, GlyRβ and Gephyrin in the rat cochlea. The rat cochlear cDNA was analyzed by RT-PCR in various postnatal stages (P14,> P21). P14 and> P21, amplification of transcripts of GlyRα3 (512 <bp) GlyRβ (732 bp) and gephyrin (573 bp). Noticeable is the double band for GlyRα3 (467 bp / 512 bp, indicated by arrows) in adult animals. Transcripts of GlyRα1 and GlyRα2 were not detected. sc P21, spinal cord from P21 animals was used as a positive control for GlyRα1-3, GlyRβ, gephyrin and β-actin. β-actin (655 bp) was used as a housekeeping gene;

2 Detection of GlyRα3_K and GlyRα3_L splice variants in the adult rat cochlea (> P21). a) GlyRα3 transcripts from the adult rat cochlea were amplified by RT-PCR. Striking is the double band (indicated by Double arrows). b) GlyRα3_K- (467 bp) and GlyRα3_L- (512 bp) splice variants were detected after cloning of PCR fragments into the PCR-II-TOPO vector by insert PCR. c) "alignments" of long and short cDNA sequences (exon 8-10) of human GlyRα3 [GLRA3_L (SEQ ID NO: 13), GLRA_K (SEQ ID NO: 14)] and rat GlyRα3 [Glra3_rn-L (SEQ ID No. 15), Glra3_m_K (SEQ ID NO: 16)]. Identical nucleotides in all four sequences are indicated by an asterisk. The 45 bp stretch of exon 9 (in bold and italics) is missing in the cDNA sequences of GLRA_K and Glra3_rn_K;

3 mRNA expression of GlyRα, GlyRβ and gephyrin in the neurons of spiral ganglia of the adult rat cochlea (> P21). a), b) Expression of the mRNA of GlyRα3 in neurons of spiral ganglia (SG, arrow) at various magnifications using the whole-mount in situ hybridization of the adult rat cochlea (> P21). The overview (a) also shows a marking of the outer hair cells ("OHC"). c), d) the expression of GlyRβ mRNA in spiral ganglion neurons (SG, arrow). e), f) expression of the mRNA of gephyrin in neurons of the spiral ganglia (SG, arrow). Higher magnifications show the cytoplasmic staining of the mRNA of GlyRα3 (b), the mRNA of GlyRβ (d), and the mRNA of gephyrin (f) in SG. No signals were detected upon hybridization with the corresponding "sense" molecules (insertings a to f). Scale bars in a), c), e) 200 μm, in b), d), f) 20 μm;

4 The expression of the mRNA of GlyRα3, GlyRβ and gephyrin in the adult organ of Corti (> P21). a) GlyRα3 transcripts were detected in the outer hair cells (OHC, solid arrows) by whole-mount in situ hybridization. No signal was detected for inner hair cells (IHC), open arrows). b) OHC (solid arrows) but not IHC (open arrows) showed a signal for GlyRβ transcripts in the adult rat cochlea. c) In IHC (open arrows) and OHC (solid arrows), gephyrin showed a strong hybridization signal. No signal was detected after hybridization with the corresponding "sense" molecules (insertions included). Scale bar 20 μm;

5 GlyRα / GlyRα3 protein expression at the level of IHC. a), b) Using the monoclonal antibody mAb4a, which detects all GlyRα subunits, the GlyRα protein was detected in rat cochlear cryosections at P8 among the IHC (open arrowheads) shown for the apical as well as the central basal cochlear Bow. At this stage, no GlyRα protein was detected at the OHC level. c) to e) Using the polyclonal GlyRα3-specific antibody, GlyRα3 protein was detected at the level of IHC (*) in the whole mount in situ hybridization of the adult rat cochlea [> P21) (c) e)]. An antibody to neurofilament 200, a marker of afferent nerve fibers, was co-immunostained (NG 200, filled arrowhead). The samples were counterstained with DAPI, which marks the cell nuclei. Scale bars in a), b) 20 μm, in c) to e) 50 μm;

6 GlyRα3 protein expression at the level of OHC in the adult organ of Corti (> P21). a) to c) GlyRα3 protein (*) was detected in OHC (solid arrows) by whole-mount immunohistochemistry. The samples were co-immunoprecipitated with anti-neurofilament 200 (NF 200, filled arrowhead). NF 200 stained the nerve fibers that terminate at the OHC. Nuclei were counterstained with DAPI. d) to f) Higher magnifications from a) to c). Remarkable is the localization of the GlyRα3 protein (*) in the cell membrane of the OHC (filled arrows) towards the ends of the nerve fibers (filled arrowheads). Scale bars in a) to c) 50 μm, in d) to f) 20 μm;

7 Schematic representation of the postulated glycinergic innervation of the inner (IHC) and outer hair cells (OHC) after the onset of hearing. The afferent dendrites (AF) of spiral ganglia (SG) neurons below the IHC are contacted by efferent fibers of the lateral oliviocochlear bundle (EF-LOCF), which form axiodendritic synapses. GlyRα3 (dots) is transported by the SG into the afferent dendrites below the IHC where the protein was detected (cf. 5 ). GlyRα3 protein was detected in the OHC (cf. 6 ) which form axosomatic synapses with the afferent fibers of the medial oliviocochlear (MOC) bundle (ES-MOC);

8th Schematic representation of increased expression of BDNF and decreased expression of Arg3.1 / Arc in the periphery of the cochlea (A) observed in tinnitus, and correction by glycine receptor agonists ("glycine") or GABA receptor agonists ("GABA ") (B).

1. Material and methods

1.1 animals

In Wistar rats (Charles River, Sulzfeld, Germany) used. Dealing with and using the animals and the experimental protocol was provided by the Animal Welfare Officer and the Regional Committee of Scientific Animal Experiments examined and approved in Tübingen.

1.2 Tissue preparation

For the purpose of RNA isolation, the cochlea was chopped and immediately frozen in liquid nitrogen. For in situ hybridization and immunohistochemistry, the cochlea was isolated and prepared as previously described; see. Knipper et al (2000), Thyroid hormone deficiency before the onset of hearing causes irreversible damage to peripheral and central auditory systems, J. Neurophysiol. 83: 3101-3112 , Briefly, the cochleas were injected into the round and 2 ml paraformaldehyde / 2% sucrose (all chemicals were from SIGMA-Aldrich, Munich, Germany, unless otherwise stated) in 50 mM phosphate buffered saline (pH 7.4) fixed oval windows. The cochlea of animals older than P10 were decalcified after fixation for ten minutes to two hours in RBD (rappid bone decalcifier, Eurobio, Les Ulis Cedex, France). After injection of 25% sucrose and 1 mM protease inhibitor (Pefabloc, Roche Diagnostics, Mannheim, Germany) in HEPES-Hanks solution, the cochlea was embedded in OCT compound (Miles Laboratories, Elkhart, IN, USA), at 10 mM cryo-cut, "mounted" onto SuperFrost / plus slides, dried for one hour and stored at -20 ° C before use. At least three animals of the indicated age were used for each experiment (n = 3).

1.3 RT-PCR

With the RNeasy Mini Kit (Qiagen, Hilden, Germany) the total RNA was extracted from the rat cochlea. Reverse transcription (RT) into cDNA was performed using the "Sensiscript Reverse Transcription Kit" (Qiagen, Hilden, Germany) and oligo dT ₁₅ primers (Roche, Penzberg, Germany) according to the manufacturer's instructions. For the polymerase chain reaction (PCR), the following primers were used (the size of the PCR product is given in parentheses). Glra1, forward: 5 'CCTTCTGGATCAACATGGATGCTG 3' (SEQ ID NO: 1), reverse: 5 'CGCCTCTTCCTCTAAATCGAAGCAGT 3' (SEQ ID NO: 2), (243 bp); Glra2, forward: 5 'ATCCCTCGCAGACCCTATCT 3' (SEQ ID NO: 3), reverse: 5 'TAAACTGGGGCAAGGTGAGT 3' (SEQ ID NO: 4), (553 bp); Glra3, forward: 5 'GGCTGAAGGACTCACTTTGC 3' (SEQ ID NO: 5), backward; 5 'TGAATCGACTCTCCCTCACC 3' (SEQ ID NO: 6) (Glra3 primers were designed to detect possible splice variants corresponding to the human GLRA3 splice variants α3_L and α3_K; α3_L: 513 bp, α3_K: 468 bp); Glrb, forward: 5 'CGGGATCCATTCAAGAGACA 3' (SEQ ID NO: 7), reverse: 5 'GCTCGAGCCACAC-ATCCAGTGCCTT 3' (SEQ ID NO: 8) (732 bp); Gephyrin, forward: 5 'CAAGGTGGCTAGAAGACATC 3' (SEQ ID NO: 9), reverse: 5 'ACCACTGGAAACTTATTAACTTC 3' (SEQ ID NO: 10) (573 bp); β-actin, forward: 5 'TGAGACCTTCAACACCCCAG 3' (SEQ ID NO: 11), reverse: 5 'CATCTGCTGGAAGGTGGACA 3' (SEQ ID NO: 12) (655 bp). Distilled water served as a negative control.

The PCR was performed with "PuReTaq Ready-To-Go" PCR beads (Amersham Biosciences, Freiburg, Germany). The PCR program consisted of an initial denaturation phase of 3 min at 94 ° C, 35-40 cycles of denaturation at 94 ° C (30 sec), annealing at 58 ° C (30 sec), extension at 72 ° C (90 sec ) and a final synthesis step of 10 min at 72 ° C. The resulting PCR products were separated on agarose gels and stained with ethidium bromide. The PCR products of GlyRα3, GlyRβ and gephyrin were sequenced and compared to the corresponding sequence data from GeneBank using BLAST ( www.ncbi.nlm.nih.gov ). The names of the GlyRα3 exons refer to the automatic gene designation system Ensembl ( www.ensembl.org ) and differ from the original description of Nikolic et al. (1998), The human glycine receptor subunit alpha3. Glra3 gene structure, chromosome localization, and functional characterization of alternative transcripts, J. Biol. Chem. 273: 19708-19714 ,

1.4 Synthesis of riboprobe and hybridization in situ

For the specific riboprobes became the PCR fragments of GlyRα3_L (513 bp) GlyRβ (732 bp) and gephyrin (573 bp) into the pCR II topo vector (Invitrogen, Karlsruhe, Germany) and for transcription used in vitro. The complementary strands for the sense and antisense probes were in the presence of Digoxigenin-labeled mix (DIG; Roche Diagnostics) either from the SP6 or T7 promoter site transcribed.

Whole-mount in situ hybridizations with GlyRα3L, GlyRβ and gephyrin riboprobes were performed as described; see. Engel et al. (2006), Two classes of outer hair cells along the tonotopic axis of the cochlea, Neuroscience 143: 837: 849 , Briefly, the cochleas from rats of the indicated age were fixed with 2% paraformaldehyde for 30 min, followed by dehydration in 100% methanol overnight at -20 ° C. After rehydration and digestion with proteinase K (2 μg / ml) at 37 ° C for 3 min, the cells were post-fixed in 2% paraformaldehyde for 15 min. DIG-labeled antisense or sense samples were diluted in hybridization solution containing 25% microarray hybridization buffer (Amersham Biosciences, Freiburg, Germany), 25% nuclease-free water and 50% formamide held. Hybridization was performed overnight at 55 ° C. The following washing and detection steps were carried out as described, cf. Knipper et al. (1999), Distinct thyroid hormone-dependent expression of TrKB and p75NGFR in nonneuronal cells during the critical TH-dependent period of the cochlea, J. Neurobiol. 38: 338-356 ; Knipper et al. (2000, loc. Cit.) , Each hybridization was done in at least three different animals of the indicated age.

1.5 Fluorescent immunohistochemistry

For immunohistochemistry, the sections of the rat cochlea were stained and displayed as described; see. Knipper et al. (2000, loc. Cit.) and Knipper et al. (1998), Thyroid hormone Schwann cell and oligodendrocyte gene expression at the glial transition zone of the VIIIth nerve prior to cochlear function, Development 125: 3709-3718 , The mouse monoclonal antibody mAb4a directed against a common N-terminal epitope of the GlyRα1-4 subunits was obtained as a hybridoma supernatant. For the specific detection of the GlyRα3 subunit a polyclonal rat antibody (SIGMA-Aldrich) was used. Mouse monoclonal antibodies to gephyrin (BD Transduction Laboratories, Heidelberg, Germany) and Neurofilament 200 (NF200, The Einding Site, Heidelberg, Germany) were used. Primary antisera were visualized with Cy3 (Jackson ImmunoResearch Laboratories, West Grove, PA, USA) or Alexa488 conjugated secondary antibodies (Molecular Probes, Leiden, The Netherlands). The sections were fixed in Vectashield mounting medium containing DAPI nuclear stain (Vector Laboratories, Burlingame, CA, USA). The samples were photographed using an Olympus AX70 microscope equipped with epifluorescence illumination and 40x (numerical aperture 1.0) or 100x oil immersion objectives (numerical aperture 1.35). The images were taken using a CCD Color View 12 camera and an imaging system analysis (SIS, Münster, Germany). Each staining was performed at least in triplicate in three animals of the respective age and genotype. Immunohistochemical analyzes were performed on postnatal day 8 (P8) or in the adult (> P21) rat cochlea. For whole-mount immunohistochemistry, preparation and fixation of the cochlea were performed as described in US Pat Engel et al. (2006, loc. Cit.) and the immunohistochemistry protocols as described above were followed.

2 results

2.1 Amplification of the cDNA of the glycine receptors and of the anchor protein gephyrin in the mammalian cochlea

Using RT-PCR, the transcripts of GlyRα3 (512 bp), GlyRβ (732 bp) and gephyrin (573 bp) from the rat cochlea were amplified at P14 ( 1 , P14). β-actin (655 bp) was used as a housekeeping gene. The GlyRα3 primers were designed to detect potential splice variants according to the isoforms of the subunits GLRA3 short (GlyRα3_K) and GLRA3 long (GlyRα3_L) in humans. RT-PCR from the adult cochlea (> P21) revealed a double band for the GlyRα3 transcripts indicated by arrows in 1 (> P21). The transcripts of GlyRα1 and GlyRα2 could not be amplified in any of the analyzed stages. Spinal cord cDNA ( 1 , sc P21) was used as a positive control for GlyRα1-3, GlyRβ, gephyrin and β-actin.

The two PCR products of the GlyRα3 double band ( 2a ) were cloned into the pCRII-TOPO vector. The sequencing of the insert PCR products gave two GlyRα3 transcript variants ( 2 B ). The longer transcript consisting of 512 bp (Glra3_rn_L) showed 99% identity with the rat Glra3 cDNA sequence from GeneBank (accession number: NM_053724). The shorter transcript consisting of 467 bp (Glra3_rn_K) carried a 45 bp deletion between nucleotides 1120 and 1164 of the coding sequence (FIG. 2c , in bold and in italics). Analysis of human nucleotide sequences Glra3 and human GLRA3 with the ensemble automatic gene annotation system revealed highly conserved exon-intron boundaries The 45 bp deletion in Glra3_rn_K corresponds to the missing exon 9 (45 bp) of the human cDNA Sequence of GLRA3_K ( 2c , Exon 9). The two Glra3 transcripts amplified from the rat cochlea showed the features of the previously described human GLRA3 short (α3_K) and long (α3_L) splice variants and are therefore referred to below as GlyRα3_K and GlyRα3_L. Sequence data from the GlyRβ and gephyrin PCR fragments confirmed the identity of the amplified transcripts with the corresponding rat CNS sequences in GeneBank (Glrb: NM_053296; gephyrin: NM_022865, data not shown). In summary, the RT-PCR results indicate that GlyRα3, GlyRβ and gephyrin transcripts are expressed in the adult rat cochlea at the onset of hearing (~ P12).

2.2 Localization of mRNA from glycine receptors and Gephyrin by in situ hybridization

To localize the mRNA of the To identify GlyR subunit in the rat cochlea, riboprobes directed against GlyRα3_L, GlyRβ and gephyrin transcripts were prepared and in situ hybridization was performed on the adult (> P21) rat cochlea. Since sufficient signals were not obtained after decalcification on cryosections (data not shown), whole-mount in situ hybridizations were performed. In 3 is a review of a single cochlear arc signals from GlyRα3- ( 3a ), GlyRβ- ( 3c ) and gephyrin transcripts ( 3e ) in neurons of the spiral ganglia (SG). A higher magnification of the region of the SG indicates cytoplasmic localization of the mRNA of GlyRα3 ( 3b ), GlyRβ ( 3d ) and gephyrin ( 3f ). The corresponding "sense" samples ( 3a -F, inserted images) showed no signal.

In 4 The area of hair cells in the adult rat cochlea was examined at higher magnification. Transcripts of GlyRα3 ( 4a ), GlyRβ ( 4b ) and gephyrin ( 4c ) were identified in the OHC (filled arrows). While in addition to the level of IHC, the mRNA of gephyrin was detected ( 4c , open arrows), no hybridization signal was obtained in the IHC for the mRNA of GlyRα3 and GlyRβ ( 4a , b, unfilled arrows). The corresponding "sense" probes gave no signal (inserted images in 4a c). Before starting the hearing, the mRNA of GlyRα3, GlyRβ and gephyrin was expressed in the inner (ICH) but not outer hair cells (OHC) (data not shown).

2.3 Protein Detection and Localization of glycine receptors and of gephyrin in the cochlea of the rat

In The next step should be the GlyRα3 and gephyrin proteins using a monoclonal antibody mAb4a, which recognizes all GlyRα subunits, one for GlyRα3-specific polyclonal antibody and a monoclonal antibody against the anchor protein gephyrin visualized on hair cell level.

Prior to commencement of hearing, mAb4a directed against a common N-terminal epitope of the GlyRα1-4 subunits detected weak punctate signals below the inner hair cells as shown for the apical and central basilar arch of the cochlea in rat sections at P8 (FIG. 5a , b). At P8, no protein could be detected for the GlyRα protein at the level of the outer hair cells. In contrast to GlyRα, in cryosections gephyrin polypeptides could not be detected, either in decalcified or non-decalcified tissue. In parallel, whole-heat immunochemistry was used to circumvent the decalcification of the samples and to improve protein detection. Only positive results were obtained for the GlyRα3-specific antibody. For the GlyRα3 protein, at the level of IHC ( 5c , Star), near the NF200 immune-positive nerve projections ( 5c , filled arrowhead) observed a dot-like staining pattern, shown for rat cochlea> P21. The position of the GlyRα3 staining is shown in comparison to the IHC cores stained with DAPI ( 5d ) or in comparison to the staining of the cores and NF200 as triple staining ( 5e ).

The expression of GlyRα3 protein on rat OHC> P21 is in 6 shown. For the GlyRα3 polypeptide (star), a signal was detected in the three levels of the OHC ( 6a , d, solid arrows). The nuclei of the OHC were labeled with DAPI ( 6b , c, e, f) and the nerve fibers that terminate at the OHC were stained with an antibody against NF200 ( 6a -F, filled arrowhead). Typical clusters of GlyRα3 protein were located at the cell membrane of OHC in close proximity to NF200-positive nerve terminals ( 6c , d, f). Elimination of the primary antibodies did not give any signals (data not shown).

3 conclusion

In In the present study, glycine receptors and the anchor protein were used Gephyrin detected in the cochlea of the rat and its distribution through Whole-mount in situ hybridization and fluorescence immunohistochemistry analyzed. It has been demonstrated that by means of glycine receptor agonists phantom phenomena, such as acute tinnitus, can be treated causally.

3.1 glycine receptor isoforms found in the Cochlea were detected

The investigations carried out showed expression of transcripts of GlyRα3, GlyRβ and gephyrin in the rat cochlea. In contrast, transcripts of GlyRα1 and GlyRα2 were detected neither in the analyzed postnatal nor in mature stages (see 1 ).

Among the specific variants of the GlyRα subunits, the function of the GlyRα3 subunit was unclear for a long time. GlyRα3 transcripts were detected in the olfactory bulb and cerebellum, the auditory brainstem, and the dorsal horn of adult spinal cord spinal cord. Increasing evidence for expression of GlyRα3 in brain regions associated with sensory processing suggests a crucial role for GlyRα3 in sensory integration. This understanding is supported by the detection of GlyRα3 in the dorsal horn of the back where it was identified as a key factor in the transmission of pain signals from the periphery to the brain. At the level of the auditory brainstem, glycine receptors play a crucial role in the central sensory processing of acoustic signals, including lateral inhibition and localization of noise sources. The identification of GlyRα3 in the rat cochlea further supports the concept of GlyRα3 as the "sensory" variant of the GlyRα subunit. To date, it is not understood how the specific kinetics of GlyRα3 are related to this role. Recombinant GlyRα3 channels show fast kinetics, but have a lower affinity for glycine than GlyRα1 channels.

The inventors detected GlyRα3 splice variants in the rat cochlea that corresponded to the human isoforms GlyRα3_K and GlyRα3_L (see 2 ). So far, alterant splicing of GlyRα3 mRNA has been described only for humans and mice. The short GlyRα3_K isoform lacks the 45 bp stretch of exon 9, corresponding to a loss of 15 amino acids in the channel protein. Recombinant internal channels of the two splice variants show different channel kinetics. The long GlyRα3_L isoform shows a higher affinity for glycine and desensitizes much more slowly and to a lesser extent than GlyRα3_K. The screening of cochlear cells for a possible differential subcellular distribution of the GlyRα3 isoforms might be useful to further elucidate the role of these splice variants. In addition, electrophysiological recordings of native glycine receptors in isolated hair cells and of recombinant cochlear GlyRα3_K and GlyRα3_L channels could be useful for characterizing the channel properties of glycine receptor isoforms in the cochlea and for understanding their specific roles in hearing.

In addition to the ligand-binding GlyRα3 subunit, GlyRβ transcripts were detected in the rat cochlea by RT-PCR and in situ hybridization. To date, it is unclear whether native GlyRα3 channels form α3 homopentamers or α3β heteropentamers. Further investigation is needed to elucidate the molecular composition of glycine receptors in the cochlea. Presumably, by binding to the β-subunit, gephyrin anchors the cochlear glycine receptors in the cytoskeleton and is critical for postsynaptic clustering of glycine receptors, as previously described for the central nervous system and retina. This is supported by the observation that GlyRα3 protein forms clusters in immunohistochemical staining of the rat immature cochlea. The same distribution of mRNA of GlyRα3, GlyRβ and gephyrin in OHC and SG neurons documented by the inventors ( 3 . 4 ), supports the possibility of α3β heteropentamers in the rat cochlea (see also below).

In the inner hair cells of the mature inner ear, however, only the mRNA of gephyrin was detected by whole-mount in situ hybridization, whereas no signal for the mRNA of GlyRα3 and GlyRβ was detected (see 4c ). The expression of gephyrin in areas that have largely no glycinergen synapses, is already described for the CNS and the retina of rodents. There is increasing evidence that gephyrin is involved in these posts in the postsynaptic clustering of GABA _A receptors. While it is necessary to examine in more detail the expression of gephyrin transcripts in IHC, it is of considerable interest to consider a role of gephyrin as an anchor protein for an IHC-specific ion channel.

3.2 Glycine receptors in the peripheral sensory organs: retina and cochlea

In In recent years there has been increasing evidence that glycine receptors into sensory integration in the central nervous system (CNS) are involved. It also strengthens the detection and Characterization of glycine receptors in the retina the hypothesis that glycinerge neurotransmission also into the peripheral sensory Information processing could be involved.

In the retina of rodents were transcripts of GlyRα1-4, GlyRβ and gephyrin in specific retinal cell types detected both at the level of the mRNA and the protein level, suggesting that glycinerge streams in processing of visual information in the outer retina play a role. The detection of glycine receptors in the cochlea supports the concept of a modulatory role of glycinerger Neurotransmission in the peripheral sensory organs.

3.3 Glycine receptors in the cochlea: target molecules for efferent innervation

The Distribution of GlyR mRNA and protein in the cochlea leave the Conclusion that it is the inhibitory glycine receptors and gephyrin around target molecules of the efferent oliviocochlear Bundle acts.

Lateral oliviocochlear (LOC) bundle: The efferent system LOC modulates auditory nerve excitability and balances interaural sensitivity. ACh, GABA, dopamine and CGRP were identified as transmitters of the LOC system. Before starting listening, IHC will initially be used by olivio cochlear efferent fibers contacted. In the adult cochlea, these efferent fibers directly contact OHC and form axosomatic synapses with the afferent dendrites below the IHC. Therefore, it is believed that the putative inhibitory receptors are localized by efferent transmitters at the time of axosomatic synapse formation. These receptors are thought to be located in the neurons of the spiral ganglia and afferent dendrites after the onset of hearing.

Accordingly, the inventors identified transcripts of GlyRα3, GlyRβ and gephyrin in adult cochlear SG neurons (see 3 ) and detected GlyRα3 protein at the IHC level of neurofilament positive putative afferent fibers (see 5 ). Furthermore, GlyRα3 protein was localized at the base of IHC prior to onset of hearing. The dot-like staining pattern not only indicated the characteristic GlyR clusters in the cell membrane, it also reminds the localization of the SK2 channel protein in IHC at the same time. For SK2 proteins, it is believed that these efferent controls, mediated by nicotinic cholinergic receptors (AChα, α10), pass to IHC at this early stage of development.

The Inventors have recognized that the glycine receptor in the cochlea of great clinical and scientific interest. Specifically, he found out that phantom phenomena, such as acute tinnitus and phantom pain, by stimulating glycine receptors are treatable in the cochlea by means of glycine receptor agonists.

Medial oliviocochlear (MOC) bundle: It is possible that inhibitory GlyR in OHC may be involved in efferent signaling of the MOC bundle. After the onset of hearing, nerve fibers of the MOC system contact the basolateral end of OHC with axosomatic synapses. The MOC bundle works as a noise-evoked feedback loop that reduces the OHC's contribution to cochlear amplification and protects the inner tube from acoustic trauma. So far, ACh and GABA have been identified as inhibitory transmitters of the MOC system. The binding of ACh to the nicotinic α9-ACh receptor (nAChR) of the basolateral ends of OHC leads to an influx of Ca ⁺⁺ ions, which opens Ca ⁺⁺ -activated SK2-K ⁺ channels. The hyperpolarizing K ⁺ efflux causes an inhibitory postsynaptic current (IPSC) that reduces OHC electro-motility. There has been increasing evidence in recent years that GABA is another transmitter of the MOC system. α and β subunits of the GABA _A receptor were detected at the basolateral end of isolated OHC. Total cellular uptake of isolated OHC showed hyperpolarization and elongation of OHC after administration of GABA. These effects could be blocked by the GABA _A receptor antagonist picrotoxin.

In the investigations, the inventors were able to detect transcripts of GlyRα3, GlyRβ and gephyrin on OHC by "whole mount" in situ hybridization (see 4 ). In addition, GlyRα3 protein could be detected in all three levels of the OHC (see 6 ). These findings indicate that inhibitory glycine receptors in OHC are target molecules of the efferent MOC system ( 7 , EF-MOC) and protection of the inner ear against acoustic overexposure. This is supported by the effects of strychnine, the competitive agonist of the inhibitory glycine receptor. One of the prodromal symptoms of strychnine intoxication is Hyperacusis. However, it has not been known to date whether this phenomenon is due to central or peripheral disinhibition or both. The observations of the inventors show that the inhibitory glycine receptor is (co-) responsible for protection against acoustic overexposure. Chronic topical administration of strychnine into guinea pig inner ear interrupts efferent activity and results in a permanent shift in the high frequency threshold after acoustic trauma. Currently, these observations are attributed to strychnine, which acts as an antagonist to the α9 nAChR. In addition, recent findings indicate a novel AChRα9-mediated strychnine-sensitive component of OHC-related efferent activity due to high-frequency acoustic stimuli. However, the detection of GlyR in the inner ear provides a new building block for the interpretation of strychnine intoxication and suggests that glycine receptors also contribute to the observed effects of strychnine in addition to α9-nAChR in the cochlea.

3.4 Treatment of Phantom Phenomena by glycine receptor agonists and GABA receptor agonists

The authors of the WO 2006/079476 showed a direct correlation of the altered expression of BDNF in the periphery of the cochlea with the induction of tinnitus. The increased expression of BDNF in the periphery of the cochlea is accompanied by down-regulation of the cortical plasticity gene Arg3.1 / Arc; see. Tan et al. (2007), Tinnitus behavior and hearing function correlates with the reciprocal expression patterns of BDNF and Arg3.1 / arc in auditory neurons following acoustic trauma, Neuroscience 145 (2): 715-726 ,

Both upregulation of BDNF in the cochlea and downregulation of Arg3.1 / Arc in the auditory cortex are directly correlated with animal model-induced tinnitus; see. Panford-Walsh et al. (2007) , submitted.

Both phenomena of the expression shift of the genes BDNF and Arg3.1 / Arc in the cochlea and the auditory cortex as well as the tinnitus behavior itself are blockable by the activation of an inhibitory efferent projection projecting axodendritically on the afferent auditory nerves of the inner hair cell; see. WO 2006/079476 ,

The Inventors could now have a completely new inhibitory Transmitter, namely glycine, discover in the inner ear. So Specifically, the glycine receptors GlyRα3, GlyRβ and the anchor protein gephyrin in the adult cochlea below the IHC and detected in OHCs.

The expression locus of the glycine receptors below the inner hair cells (IHC) shows that, analogous to the GABAergic feedback loop, glycine is secreted by efferents of the medial upper olive complex (MOC) in the brain stem ( 8B ) and is typically inhibitory to the afferents of IHCs. Belonging to the same receptor type of the "group I" or "Cys-loop" family as the GABA receptors, activation of the glycine receptor via the influx of Cl anions leads to hypo-polarization of the neurite. This leads to a constant tonic inhibition of the afferent auditory nerve, apparently an essential parameter for the balance of nerve activity of central auditory projections.

A excitocytosis caused by a tinnitus-inducing trauma (too much Glutamate) or a dislocation of the inhibiting "balancing" efferent inputs, leads to the already described hyperpolarization of the auditory nerve or to increase the BDNF level in spiral ganglia.

According to the inventors, the increase in BDNF expression represents the primary trigger for the induction of tinnitus, which bridges the pathophysiological change in nerve activity in the central auditory system via the pathological transport of the BDNF protein in the auditory nerve to the first synapse in the brain stem , Depending on the time and duration and amount of released peptide, BDNF acts on the first postsynapses of the first central auditory switching station in the brain stem, the synapses in the ventral and dorsal nucleus of the cochlear nerve. Here, the tinnitus-associated increase in BDNF in the spiral ganglia may be directly involved in the increase of activity in the dorsal and ventral nucleus cochlear and in the inferior colliculus, apparently via a detectable increase in inhibitory transmitters, such as GABA, the subsequent reduction of Arg3.1 / Arc conditioned in the auditory cortex. This is accompanied by a reduction of field potentials in the auditory cortex, an indication of a reduced thalamo-cortical input; see. 8A ,

A Reduction of Arg3.1 / Arc in the auditory cortex could Immediately those already in different studies with Tinnitus in the Human and animal proven hyperpolarization - or Explain excitocytosis of cortical neurons. Exzitocytose Cortical neurons have long been considered the cause of cortical Reorganization processes are postulated, which ultimately leads to phantom perceptions to lead. Various studies have shown that upregulation of Arg3.1 / Arc proteins in neuronal postsynapses at a reduced rate excitatory postsynaptic potential (EPSP), a downregulation conversely leads to an increased EPSP. Ie. the overall model of an increase in BDNF in the auditory nerve after tinnitus induction can explain phenomena directly known for a long time in humans and animals correlated with tinnitus.

After that should be any correction of a pathological increase of BDNF in spiral ganglia to be therapeutically effective. GABA receptor agonists would be effective in this model as glycine receptor agonists.

Indeed, glycine receptor agonists, like GABA receptor agonists, correct for a pathological increase in BDNF levels. As in 8B sketched, correct glycine receptor agonists just like GABA agonists the reduction of cortical expression of Arg3.1 / Arc and thus counteract a pathophysiological reorganization cortical projections and tinnitus; see. 8B ,

In summary: Tinnitus accompanying acute increase in BDNF levels in the cochlea can be inhibitory about agonists acting inputs, such as GABA receptor agonists and glycine receptor agonists, on the auditory nerves directly and locally applied, encountered become. A curative avoidance of increasing BDNF in the Hörnerven leads to findings of the Inventor to avoid a pathophysiological reorganization cortical projections, which in the animal model by a reduction Arg3.1 / Arc expression in elevated cortical neurons EPSP reflects.

It follows Sequence listing according to WIPO St. 25. This can be obtained from the official publ be downloaded from the DPMA.

QUOTES INCLUDE IN THE DESCRIPTION

This list The documents listed by the applicant have been automated generated and is solely for better information recorded by the reader. The list is not part of the German Patent or utility model application. The DPMA takes over no liability for any errors or omissions.

Cited patent literature

• WO 02/15907 A1 [0005]
• WO 2004/022069 A1 [0007]
• - DE 10124953 A1 [0008, 0008]
• - WO 2006/079476 [0009, 0028, 0071, 0073]

Cited non-patent literature

• - Wang et al. (2000), Evaluating effects of some tinnitus with animal behavioral model in rats, Zhonghua Er. Bi. Yan. Hou. Ke. Za. Zhi. 35 (5) [0006]
• - Penner MJ, and Jastreboff PJ (1996), Tinnitus: Psycho-physical observations in humans and animal models, in: Van de Water, Popper AN, Fax, RR (Ed.), Clinical aspects of hearing, Springer, New York, Heidelberg, pages 208 to 304 [0008]
• Bauer, CA, et al. (1999), A behavioral model of chronic tinnitus in rats. Otolaryngol. Head Neck Surg. 121, pages 457 to 462 [0008]
• - Waddell, A., Canter, R. (2004), Tinnitus, Am. Fam. Physician 69, pages 591 to 592 [0010]
• - Middleton, C. (2003), The causes and treatments of phantom limb pain, Nurs. Times 99, pages 30 to 33 [0014]
• Maksay et al. (2007), Synthesis of (nor) tropeine (di) esters and allosteric modulaton of glycine receptor binding, Bioorg. Med. Chem., Online publication of November 4 [0020]
• Maksay et al. (2007), Synthesis of tropic and allosteric modulation of ionotropic glycine receptors, J. Med. Chem., 47 (25): 6384-6391 [0020]
• - Bíró T. and Maksay G. (2004), Allosteric modulaton of glycine receptors is more efficacious for partial rather than full agonists, Neurochem. Int., 44 (7): 521-527 [0020]
• - Iatsenko et al. (2007), The synthetic cannabinoid analogue WIN 55,212-2 potentiates the amplitudes of glycineactivated currents, Article in Ukrainian, Fiziol Zh., 53 (3): 31-37 [0022]
• Lehner, R. et al. (1996), A new implantable drug delivery system for local therapy of the middle and inner ear, Ear. Nose Throat 76, pages 567 to 570 [0024]
• - Ito et al. (2005), A new method for drug application to the inner ear, J. Otorhinolaryngol. Relat. Spec., Pp. 272-275 [0025]
• Durán JD et al. (2007), Magnetic Colloids as Drug Vehicles, J. Pharm. Sci, Online Publication [0026]
• Mohamed F. and van der Walle CF (2008) Engineering Biodegradable polyester particles with specific drug targeting and drug release properties, J. Pharm. Sci, 97 (1): 71-87, abstract of December 2007 [0026]
• - Gupta S. and Moulik SP (2008), Biocompatible microemulsions and their prospective uses in drug delivery, J. Pharm. Sci., 97 (1): 22-45, abstract published online in December 2007 [0026]
• Kibbe AH (2000), Handbook of Pharmaceutical Excipients, 3rd Edition, American Pharmaceutical Association and Pharmaceutical Press [0030]
• - Knipper et al (2000), Thyroid hormone deficiency before the onset of hearing causes irreversible damage to peripheral and central auditory systems, J. Neurophysiol. 83: 3101-3112 [0044]
• - www.ncbi.nlm.nih.gov [0046]
• - www.ensembl.org [0046]
• Nikolic et al. (1998), The human glycine receptor subunit alpha3. Glra3 gene structure, chromosome localization, and functional characterization of alternative transcripts, J. Biol. Chem. 273: 19708-19714 [0046]
• - Engel et al. (2006), Two classes of outer hair cells along the tonotopic axis of the cochlea, Neuroscience 143: 837: 849 [0048]
• Knipper et al. (1999), Distinct thyroid hormone-dependent expression of TrKB and p75NGFR in nonneuronal cells during the critical TH-dependent period of the cochlea, J. Neurobiol. 38: 338-356 [0048]
• Knipper et al. (2000, supra). [0048]
• Knipper et al. (2000 supra). [0049]
• Knipper et al. (1998), Thyroid hormone Schwann cell and oligodendrocyte gene expression at the glial transition zone of the VIIIth nerve prior to cochlear function, Development 125: 3709-3718 [0049]
• - Engel et al. (2006, supra) [0049]
• - Tan et al. (2007), Tinnitus behavior and hearing function correlates with the reciprocal expression patterns of BDNF and Arg3.1 / arc in auditory neurons following acoustic trauma, Neuroscience 145 (2): 715-726 [0071]
• - Panford-Walsh et al. (2007) [0072]

Claims (8)

Use of a glycine receptor agonist for Preparation of a medicament for the treatment of phantom phenomena of acute tinnitus and / or phantom pain in a human or animal life. Use according to claim 1, characterized that as glycine receptor agonist, a substance is provided, the is selected from the group consisting of: D-alanine, L-alanine, L-serine, taurine, cannabinoid, tropine, nortropine and derivatives hereof. Use according to claim 2, characterized that the cannabinoid is selected from the group from: anandamide, arachidonylglycerol, tetrahydrocannabinol, WIN 55,212-2. Use according to one of claims 1 to 3, characterized in that the substance for local application is formed on or in the ear or at the site of the amputation. Use according to claim 4, characterized that the local application in the ear over the round window membrane he follows. Use according to any one of claims 1 to 5, characterized in that the medicament has another substance active against phantom phenomena selected from the group consisting of: GABA receptor agonists, in particular benzodiazepines and substances related to these, baclofen, gamma Vinyl-GABA, gamma-acetylene-GABA, progabide, muscimol, iboten, sodium valproate and tetrahydroisoxazolopyridine (THIP), MAP kinase inhibitors, in particular U 0126 or PD 98058, cam kinase inhibitors, L-type Ca ⁺⁺ Channel antagonists, especially nicardipine or nifedipine or isradipine, CREP antagonists, glutamate antagonists, trkB antagonists. Process for the preparation of a medicament for Treatment of phantom phenomena of acute tinnitus and / or phantom pain in a human or animal being, which has the following steps: (a) providing a glycine receptor agonist, and (b) formulation of the glycine receptor agonist into a pharmaceutically acceptable carrier. Process for the treatment of phantom phenomena of acute tinnitus and / or phantom pain in a human Living being, which has the following steps: (a) Provide a drug, (b) Apply, possibly locally on or in Ear or at the site of the amputation, the drug the living being, and possibly (c) repeating steps (a) and (b), thereby characterized in that the drug is the drug of use is provided according to one of claims 1 to 6.