CZ399A3 - Polypeptide analogs of cation-active polypeptides - Google Patents

Abstract

The in vivo circulating life and/or absorption of cationic therapeutic proteins, including but not limited to basic proteins such as NT-3 and BDNF, can be increased by generating analogs that have a lower isoelectric point and, preferably, also a lower protein charge relative to the protein of native sequence.

Description

Polypeptide analogues of cationic polypeptides ^from

Field of technology

The invention generally relates to polypeptide analogs of therapeutically active cationic proteins, including (but not limited to) analogs of neurotrophic factors known as neurotrophin-n-33-(-N-T--3-)-a-brain-derived neurotrophic factor (BDNF-factor; brain derived neurotrophic factor). More specifically, the present invention describes cationic polypeptides whose native sequence has been altered such that the resulting analogs have lower isoelectric points and/or exhibit increased in vivo absorption after parenteral administration. The invention also describes materials and methods for the production of said polypeptide analogues, antibodies directed against these analogues and pharmaceutical preparations containing these analogues, where said pharmaceutical preparations can be used to treat a wide variety of diseases and pathological conditions.

Current state of the art

After parenteral application (such as by subcutaneous, intravenous or intramuscular injection) of a therapeutic protein, the individual proteins applied in this way may differ substantially in their pharmacokinetic properties, such as bioavailability, retention time in the circulation or clearance rate (disappearance from the body). Although attempts are being made in many laboratories to develop alternative routes of administration of protein products, very little is currently known about the factors that control the pharmacokinetics of therapeutic proteins after parenteral • « ··· · ·« ··· ·· ·· « « · • t · · · « · · · · v · * · · · · » ·«··· ·· ♦ · · · · » * «»·* V» ·· · ·· application. An increase in the molecular weight of a protein has been shown to result in preferential uptake of such protein by the lymphatic system (rather than blood capillaries); see Supersaxo et al., Pharmaceutical Res., Vol. 7, pp. 167 et seq., 1990. The molecular size of the therapeutic protein also plays a key role in insulin uptake, where the rate-limiting step in insulin uptake has been shown to be the dissociation of zinc-linked insulin hexamers into monomeric form; see Kang et al.,—Diabetes Gare^—Volume 14, pages 942-948, 1991. Clinical trials of monomeric insulin analogs in which the site responsible for molecular association has been removed in diabetic patients have shown a faster uptake of said analogs in these patients leading to substantial improvement in glucose control; see,. Brange et al., Nature, Volume 33, Page 679ff, 1988.

Description of the images on the drawings

Figure 1 shows the amino acid sequence of wild-type human NT-3 (ie, the native sequence). This polypeptide was produced recombinantly in E. coli bacterial cells and expressed with methionine at the N-terminus, i.e. r-metHuNT-3 (SEQ ID NO: 1). Amino acid residue numbering begins in Figure 1 at the first amino acid residue following the starter methionine (Met-1) because the naturally occurring protein is normally expressed in mammalian cells without this methionine. (Note that in the Sequence List Met is counted as +1).

Figure 2 shows the nucleotide sequence (SEQ ID NO: 2 and Figure 2A) and the amino acid sequence (SEQ ID NO: 2

9999

ΦΦΦ 9999

99

9 9 9 9 · Φ Φ Φ Φ • Φ Φ ·9 9 9 Φ φφφφ φ φ Φφφφ Φ Φ ΦφφΦ ΦΦΦ *Φ ΦΦΦΦΦ Φ Φ φφ ΦΦΦ ΦΦ * ·* ·♦

No: 3 and Figure 2B) of the r-metHuNT-3 polypeptide analog of the invention, namely NT-3a-n9)R61A, K64D (with amino acid numbering starting at the first amino acid residue following the starting methionine).

Figure 3 shows the nucleotide sequence (SEQ.

id. NO: 4 and Figure 3A) and the amino acid sequence (SEQ ID NO: 5 and Figure 3B) of another r-metHuNT3 polypeptide analog of the invention, namely NT-3 (in ₇ )R61A, K64D (with amino acid numbering starting at the first amino acid residue following the starting methionine).

Figure 4 shows calibration (standard) curves for ELISA assays for wild-type NT-3 (i.e. with SEQ ID NO: 1; circles) and for NT-3 analogs with SEQ sequences. id. No: 3 (NT-3 ₍₁ . ₁₁₉₎ R61A,K64D; triangles) and SEC. id. No: 5 (NT-3(1-H7JR61A,K64D; squares). The graph shows optical density as a function of sample concentration expressed in nanograms per milliliter (ng/ml). Cross-reactivity with NT-3 analogues in ELISA assays approximately ten percent.Sera samples from pharmacokinetic studies were analyzed by ELISA, and concentrations of wild-type NT-3 and the NT-3 analog determined at baseline were compared to the corresponding calibration curves.

Figure 5 shows a size exclusion high performance liquid chromatogram (SEC-HPLC) chromatogram comparing wild-type NT-3 with NT-3 analogs having the sequences shown in Figures 2 and 3. On the axis y are plotted in absorbance units (AU) and the x-axis shows elution time (in minutes). It can be seen from the figure that the mentioned analogs are eluted at the same time as the wild-type molecule, which indicates that the non-covalent dimeric structure of wild-type NT-3 was not disrupted in either of the analogs.

In none of these preparations were detected aggregates_ *4 44«4 4» »4«· 4« 44 ββ» 44 · · · · * • 4 4 4 4 *4 4 444 4 « 4 444 4 4« *44444 *4 44444 4 4

44444 44 44 44 4 · protein molecules. Legend: ( _ ) wild-type NT-3; ( --- ) NT-3 ₍ i- ₁₁₇ )R61A, K64D; and ( ) NT-3 ₍₁ - ₁₁₉₎ R61A, K64D.

Figure 6 shows a cation exchange high performance liquid chromatography (CEX-HPLC) chromatogram comparing wild-type NT-3 to NT-3 analogs with the sequences shown in Figures 2 and 3. Plotted on the vertical axis are absorbance units (AU). The horizontal axis shows the elution time (in minutes). In this figure, it can be seen that these analogs are eluted earlier than wild-type NT-3, which is consistent with the lower isoelectric points of these analogs. Legend: ( _ ) wild-type NT-3; (----) NT-3 d- ₁₁₇ )R61A, K64D;

and ( ) NT-3 _I1 -i ₁₉ ,R61A,K64D.

Figure 7 shows an electrophoretic chromatogram of a silver-stained SDS polyacrylamide gel. Here, wild-type NT-3 (see Figure 1) is compared to NT-3 analogs with the sequences shown in Figures 2 and 3. All three samples migrated as a single band on electrophoresis of approximately equal molecular weights corresponding to the monomeric forms. In none of the samples is observed a pre- « « an » η μ λ w Vh X -! λ ť λ wt v* λ íí w » ď λ Ί ! Λ ΊΊ-ι λ ν» ^β » Λ TVÍ r-1 *t nVn Ί .

UULLlllkJD UV _ý ώ J Ο J-HO |Ι U ΑΟ Ο L· V J. S-/ XX LLIC X ΙΛ η ι vi-l weights or fragments with lower molecular weights. Lane 1: NT-3 ₍₁ . ₁₁₇ )R61A, K64D, 2.5 μg; lane 2: NT3 (1-119)R61A,K64D, 2.5 μg; lane 3: wild-type NT-3, 2.5 μg; lane 4: wild-type NT-3, 12.5 μg; lane 5: standards of known molecular weights.

Figure 8 shows serum concentration profiles (in nanograms per milliliter) of proteins with SEQ sequences.

id. No: 1 (solid circles), SEC. id. No: 3 (empty circles) and SEC. id. No: 5 (filled rectangles) depending on the time (in hours) after intravenous application (IV) into the body of experimental rats. The administered dose contained 1 milligram of protein per kilogram (mg/kg) of body weight. Concentration profiles

4444

4444

4 444 *4 4 444« · 444 4 44 4 4 4 4 4 4

44444 4 4 «4 444 «4 44 44 4« are two-phase. An initial distribution phase was followed by a slower elimination phase. Each point of the graph represents the average value from three experimental animals.

Figure 9 shows serum concentration curves (in nanograms per milliliter) of proteins with SEQ sequences. id.

No: 1 (solid circles), SEC. id. No: 3 (open circles) and SEK, ID. No: 5 (filled rectangles) depending on the time (in hours) after subcutaneous administration (SC) of protein in the amount of 1 mg/kg into the body of experimental rats. Each point of the graph represents the average value from three experimental animals. The absorption phase is characterized by an increase in serum protein concentration. Wild-type NT3 (SEQ ID NO: 1) shows, after reaching the maximum concentration, the fastest decrease in the serum concentration.

The essence of the invention

2a in order to determine the effect of the value of the isoelectric point (pi) on the pharmacokinetic properties of proteins, analogs of NT-3 and BDNF-factor with relatively lower pi values were created, while the structure and biological activity of the proteins in the "native state" (i.e. proteins with the naturally occurring amino acid sequence as well as their Met' ¹ version (with methionine in the first position); both of these versions are referred to in the application as wild-type proteins)). Based on these studies, it was found that the protein analogs created with a lower pi value and/or a lower charge under physiological conditions (relative to the wild-type molecule) persist longer in the bloodstream after in vivo injection (i.e., their half-life is longer) and show increased absorption. Although this invention is illustrated by the examples of human NT-3 and BDNF-factor, its applicability is of course wider and this invention can be vyu5 ·»··

I * · ··«· «4 44 » 4 » « live in any cation-active protein, and especially in basic proteins with a pi value higher than 7.0.

It should be understood that the terms "protein" and "polypeptide" as used herein are interchangeable and refer to one and the same thing.

Briefly, this invention describes substitution, insertion and deletion analogs of cationically active therapeutic proteins and/or chemically modified versions of said therapeutic proteins. The 'tafeo-anaioga' or 'chemically modified' versions of said therapeutic proteins are characterized by a lower pI value and also show, with respect to unmodified proteins (i.e. proteins with native sequence), increased absorption and/or longer retention in the bloodstream. Protein analogs of the invention are usually human therapeutic proteins which are usually, but not necessarily, basic proteins. In a preferred embodiment, these proteins, compared to unmodified basic proteins, have a lower charge under physiological conditions.

The invention describes materials and methods for the production of said analogues by recombinant techniques (excellent methods for wit? nnr!Ί 3 <=> nrnh ί 1 átlí-v nrnti ť ť *· “ J — —-------J _C -- -prdKuicke ružiteti)· Invention ro ⁷ these analogs and pharmaceutical preparations for use in the treatment of diseases or pathological conditions, containing the mentioned analogs as biologically active substances.

The principles described in the invention can be applied to any cationically active protein for which a reduction in the pi value (and in some cases the charge of the protein) will result in enhanced biological properties important for therapeutic function. Such properties are, for example, the residence time in the bloodstream and/or absorption after parenteral administration. Examples of such proteins are (the list is not limiting) basic proteins such as, for example, NT-3, BDNF6

9« 99

I «9 «

I 9 999 9 *9 * · 99»» 9 9 999 999 & · 999·· 9 9 >99 99 99 99 99 factor, growth and differentiation factor of macrophages, the various known isoforms of which show basically the same ability to stimulate in vivo and ex in vivo production of platelets (in this application the isoforms of said factor are collectively referred to as "MGDF") and keratinocyte growth factor (KGF). Detailed descriptions of these factors, their biological properties and methods of their preparation and testing are described in patent applications: NT-3 is described in—application—PG-T-W0Ri/-0J56-9-;—BDNF^faktor_v_pahentových_prize:_ US notices 5180820, 5229500, 5438121 and 5453361 and in published PCT application WO95/26745; MGDF in published PCT applications WO95/26745, WO95/21919 and WO95/21920; and KGF in published PCT application WO90/08771.

The objective of the invention is essentially to create one or more modifications of the primary structure of the wild-type protein in such a way that the structure and biological activity of said protein are preserved, but that at the same time there is a decrease in the value of the isoelectric point and a decrease in the charge at physiological pH. The exact method through which these modifications are carried out is not essential, and to achieve the described improved homeland ·* & v 1 I y, Γ ¹ , o ^Ί rnrr 1

111M. ÍJ 'v žit 1 akvkolΊ'J' vpdnnni k vvse udedU _k. in w — —£- — J .

changes. By way of illustration, a method is mentioned that uses targeted mutagenesis to achieve the desired modifications, including the addition of acidic amino acid residues to a given sequence, by inserting acidic amino acid residues and/or substituting other amino acids with acidic amino acid residues and/or removing basic amino acids by deletion and/or their by replacing Another possibility, leading to the achievement of the same goal (i.e. reducing the value of pi and charge while preserving the structure and biological activity), is the addition of chemical groups or parts of the molecules at selected places (i.e. at amino acid residues) in the peptide chain of the wild-type molecule. A specific case is the addition of acid φφ φφφφ • v ··· Φ φφ φφ • φ · · · φφφφ • · ··« · · · φ φ · φ • · φ φ φ φφφφφ φφφ φφ ΦΦΦ·· φ φ φφφφφ φφ φφ ·· ·· amber to selected amino acid residues in the protein chain.

Nucleic acids encoding protein analogs according to the invention (i.e., polypeptides differing from the wild-type polypeptide in one or more amino acid residues) can be created using site-directed mutagenesis or PCR amplification in which the primer(s) contain the desired point mutation. Detailed descriptions of appropriate mutagenesis procedures are available in the published publications of Ambrosia, Mo1ecu1ar— Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor NY, 1989; or Ausubel and others,

Current Protocols in Molecular Biology, Green Publishers lne. and Wiley and Sons, NY, 1994. The chemical synthesis procedures described in Engels et al., Angew. Chem.

Intl. Ed., Volume 28, Pages -716 to -734, 1989.

Said DNA molecules can be used to express polypeptide analogs according to the invention in recombinant systems well known to those skilled in the art. Such production methods include (but not limited to) the methods described in the above-mentioned patent applications for NT-3, BDNF-factor, KGF and MGDF. As an illustration, a procedure may be mentioned where a nucleotide sequence encoding a polypeptide analog according to the invention is inserted into * a suitable of a biologically functional vector (for example, into a circular plasmid or viral DNA) for expression in a suitable host cell. Said vector includes regulatory sequences for the expression of the inserted nucleotide sequence and is chosen to be functional in the host cell used (ie this vector is compatible with the host cell machinery so that amplification and/or expression of the given gene can occur). Said polypeptide may be amplified/expressed in a yeast, prokaryotic, insect (baculovirus system) and/or eukaryotic host cell. The host cell selection will, ales8

4944 · · 0 9 · 44 · 4 4 • ♦ »99« ·· 4 4« ·44 *9 «4*Α

44

4 4 4

4 4 4 4

449 494 * 4 9

99 44 depends, in part, on whether the expressed polypeptide product is to be glycosylated. If glycosylation is desired, yeast, insect or mammalian host cells are preferably used.

Typically, the vectors will contain a sequence (this sequence is also referred to as a "promoter) adjacent to the 5' end of the inserted sequence and other regulatory elements, as well as enhancer(s) of transcription, an origin of replication, a _transcription_terminator_, a_complete_intronovoLL sequence containing the donor and an acceptor splice site, a signal peptide sequence, a ribosome binding site (RBS), a polyadenylation signal, a selectable marker, and a polylinker region used to insert the nucleotide sequence encoding the polypeptide to be expressed.

The sequence adjacent to the 5' end of the inserted gene may be the natural sequence occurring at the 5' end of the wild-type gene or ^: it may be a sequence homologous (i.e. from the same species and/or strain as the host cell), heterologous (i.e. from a species and/or a strain different from the host cell), hybrid (i.e., a combination of sequences from more than one source) or synthetically prepared. The Z-terminal sequence adjacent to the 5' end of the inserted gene may be a unicellular prokaryotic or eukaryotic organism, any vertebrate or invertebrate, or any plant, provided that this 5' sequence is functional in the host cell and can be activated in that host cell.

The origin of replication is usually included in prokaryotic expression vectors purchased commercially and is necessary for amplification of the vector in the host cell. Amplification of a vector to a certain number of copies may in some cases be important for optimal expression of a given polypeptide. If the selected vector does not contain the origin of replication, it can be ·» 444»·.

• 4 * ·4 • a «a • 4 4 4 • 4 4 4

4*4 444

4 • 4 44 this element chemically synthesized on the basis of a known sequence and subsequently ligated into the given vector.

The transcription terminator is usually located in the region adjacent to the 3' end of the sequence encoding the desired polypeptide and serves to end (terminate) the transcription of this polypeptide. In prokaryotic cells, the transcription terminator is usually a fragment with a high content of C-G pairs followed by a poly-T sequence. Although this element can be easily cloned from any library or purchased commercially as part of a vector, it can also be easily synthesized using the nucleic acid synthesis procedures described above.

The selectable marker encodes a protein necessary for the survival and growth of host cells cultured in the selective culture medium. Commonly used selectable marker genes encode proteins that (a) confer resistance to the carrier to antibiotics or other toxins, such as ampicillin, tetracycline, or kanamycin in prokaryotic host cells; (b) complement the auxotrophic deficiencies of the cells; or (c) supply vital substances not available from complex media. In preferred embodiments, the kanamycin resistance gene, the ampicillin resistance gene and the tetracycline resistance gene are used as selection markers.

The site responsible for binding to ribosomes, usually called the Shine-Dalgarn sequence (for prokaryotes) or the Kozak sequence (for eukaryotes), is essential for initiation of mRNA translation. This element is usually located in the region adjacent to the 3' end of the promoter and the 5' end of the coding sequence of the polypeptide to be expressed, the Shine-Dalgarn sequence is diverse, but usually has a high proportion of purine bases (ie, it has a high A-G content). A number of Shine-Dalgarn sequences have been identified so far, and each of these *♦ ·»4* »» »»44 • 4 4 • · 444 · 4

4 4

44«

And 4. ·· ·· ' · · *44· ί J * * 4 4 4 [ · * * ·44 44« ^ø · · * 4 4 ·· 4» «I sequence can be easily synthesized using the procedures described above and subsequently used in a prokaryotic vector.

In cases where it is desired that a given polypeptide be secreted from a host cell, a signal sequence can be used to direct the polypeptide out of the host cell in which it is synthesized. Usually, the signal sequence is located in the coding region of the nucleotide sequence or directly at the 5' end of the coding region. Signaling sequences have been identified so far, and any of them can be used (in this application) in host cells, provided that in those host cells functional. With respect to a given polypeptide, the signal sequence may be homologous or heterologous. In addition, the signal sequence can be chemically synthesized using the procedures described above.

The host cells can be prokaryotic host cells (such as E. coli) or eukaryotic host cells (such as yeast, insect or vertebrate cells). When the host cells are cultured under suitable nutritional conditions, these cells can synthesize the desired polypeptide, which can then be collected from the culture medium (if this protein is secreted into the medium) or directly from the producing host cells (if it is not secreted). Subsequently, this polypeptide can be purified using methods including, for example, gel chromatography, affinity chromatography, and the like. In general, it can be said that if a given polypeptide is expressed in E. coli, this protein will contain a methionine residue at the N-end (ie Met' ¹ ) after isolation. An exception is the situation where the polypeptide is expressed in a strain of E. coli in which the N-terminal methionine is enzymatically cleaved by the host cell.

•4 «444

Suitable host cells or cell lines are also mammalian cells, such as hamster ovary (CHO) cells or 3T3 cells. Methods of transformation, cultivation, amplification, screening (testing) and production and purification of the desired product, as well as the selection of suitable mammalian host cells, are now well known. Other suitable mammalian cell lines are the monkey cell lines COS-1 and COS-7 and the CV-1 cell line. Other examples of mammalian host cells are cell lines derived from primates and cell lines from rodents, including transformed cell lines. Also suitable are normal diploid cells, cells derived from primary tissues cultured in vitro, as well as primary explants. Suitable cells can be genotypically deficient and this deficiency can be used as a selection marker. A dominant gene can also be used as a selection marker. Other suitable mammalian host cells include (but are not limited to) HéLa cells, mouse L-929 cells, Swiss, Balb-c, or ΝΊΗ mouse-derived 3T3 lines, and BHK or HaK hamster cell lines.

Insertion (also referred to as "transformation or "transfection) of the appropriate vector into the chosen host cell can be performed using calcium chloride, electroporation, microinjection, lipofection, or a method using DEAE-dextran. The method of vector insertion chosen will depend in part on the type of host cell used. The aforementioned methods, as well as other suitable methods of transformation, are well known to those skilled in the art and are described, for example, in Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor NY, 1989.

Host cells carrying the appropriate vector can be cultured in standard media well known to those skilled in the art. These media will usually contain all the nutritional components necessary for cell growth and survival. Suitable media ··» for culturing E. coli cells are, for example, Luria Broth (LB) and/or Terrific Broth (TB). Suitable media for eukaryotic cell culture are RPMI 1640, MEM and DMEM; depending on the type of cultured cell line, all these media can be supplemented with serum and/or growth factors.. A suitable medium for culturing insect cells is Grace's medium supplemented (if necessary) with Yeastolate, lactalbumin hydrolyzate and/or fetal calf serum.

-Gbvyklej-e—;j as—šup element—added-to-me di a—also ěŽ-nÚU— what antibiotic or other compound usable for selective growth of transformed cells. The use of said compound will depend on the nature of the selection marker present on the plasmid with which the respective host cell has been transformed. If, for example, a gene encoding resistance to kanamycin is used as a selection marker, kanamycin will be the compound added to the medium.

The amount of polypeptide produced by the host cell can be determined using standard methods currently known. Such methods are for example (the list is not limiting) Western blot analysis, electrophoresis on SDSpclyacrylamide gel, separation using HPLC, immunoprecipitation and/or activity determination such as "DNA-binding gel shift assay (note: this is a determination based on different mobilities DNA molecules alone and DNA molecules with bound proteins, where this determination is performed by electrophoresis in a non-denaturing polyacrylamide gel).

If a polypeptide is designed to be secreted out of the host cell, most of the polypeptide is likely to be found in the culture medium. However, if a given polypeptide is not secreted, it will be present in the cytoplasm (in eukaryotic host cells, Gram-positive bacteria and insect host cells) or in the periplasm (in Gram-negative bacterial host cells).

·* ···· *· «·*· ·· ···· ·* · , s _s . · · · ' · ·

I ···· · · · · · · · · a » » · ·· ······ * *»·· · · · ··· ·· «· ·· ··

For the production of intracellular peptides, host cells are usually first disrupted mechanically or by osmotic shock, releasing the cytoplasmic contents into a buffered solution. Subsequently, the polypeptide is isolated from this solution. The subsequent purification of the polypeptide from the solution can be carried out in various ways. If the polypeptide has been synthesized with an anchor such as hexahistidine or other small polypeptide at its C-terminus or N-terminus, it can be purified in one step. the polypeptide loaded onto an affinity column filled with a carrier that has a high affinity to the anchor used or directly to the polypeptide (ie, a monoclonal antibody). Polyhistidine, for example, specifically binds to nickel with high affinity, and therefore an affinity column with nickel ions can be used for purification (such as affinity columns with bound nickel ions from Qiagen); see ^: for example Ausubel. and others, Current Protocols in Molecular Biology, Green Publishers lne. and Wiley and Sons, NY, 1994.

On the other hand, if there is no anchor attached to a given polypeptide and no antibodies are also available, other well-known methods can be used for purification. Such procedures include (but are not limited to) ion exchange chromatography, gel chromatography, HPLC, gel electrophoresis of proteins in the native state combined with subsequent elution from the gel, and preparative isoelectric focusing (Isoprime apparatus/method, Hoefer Scientific).

In some cases, two or more of the above purification techniques may be used to achieve higher purity.

If a given polypeptide is predicted to be primarily found in the periplasmic space of bacteria or the cytoplasm of eukaryotic cells, the contents of the periplasm or cyto14

»»« • « ·· · · plasma, including inclusion bodies (for example, in Gram-negative bacteria, if said polypeptide forms such complexes) of host cells extracted using any standard procedure known to those skilled in the art. For example, host cells can be lysed (to release periplasmic contents) using a French press, homogenization, and/or sonication. The obtained homogenate is then centrifuged.

In addition to the preparation of polypeptide analogs of the invention by combinatorial techniques, these polypeptides may be prepared using methods of chemical synthesis currently known (such as solid phase peptide synthesis), including procedures described in Merrifield et al., J. Am.

Chem. Soc., vol. 85, page 2149, 1964; Houghten and others, Why. Nati. Acad. Sci, USA, Volume 82, Page 5132, 1985; and Stewart and Young in Solid Phase Peptide Synthesis, Pierce Chem. Co., Rockford, IL, 1984. To form disulfide bridges, polypeptides prepared by chemical synthesis can be oxidized using the procedures described in the above publications.

The pi values and charge of protein analogs prepared by any of the above methods can be measured using standard techniques such as those described below in connection with the examples of the invention.

The scope of the invention also includes chemically modified polypeptides (i.e. derivatives) in such a way that said polypeptide is attached to a polymer, thereby affecting the properties of this polypeptide. The polymer used is usually water soluble so that the protein to which the polymer is attached does not precipitate in an aqueous environment such as a physiological environment. In order to control the degree of polymerization, said polymer may have one reactive group, such as an active_ester (for acylation reaction) or • · « · · « ♦ · · • » · > fl · · · · · · · * aldehyde { for alkylation). A preferably used reactive aldehyde is polyethylene glycol propionaldehyde, which is stable in an aqueous environment, or its mono Cl to C10 alkyloxy- or aryloxy-derivatives (see patent application US 5252714). Said polymer may be branched or unbranched. In a preferred embodiment, due to the therapeutic use of the prepared end product, said polymer will be pharmaceutically acceptable. A water-soluble polymer or, if desired, a mixture of such polymers, may be selected from the group consisting of, for example, polyethylene glycol (PEG), monomethoxy polyethylene glycol, dextran, cellulose or other sugar-based polymers, poly(N-vinylpyrrolidone) polyethylene glycol, propylene glycol homopolymers, polypropylene oxide/ethylene oxide copolymer, polyoxyethylated polyols (eg glycerol) and polyvinyl alcohol.

In general, the polypeptide analogs of the invention will be useful for the same purposes as the wild-type proteins from which the analogs are derived. NT-3, for example, is undergoing a clinical study mapping its usefulness in the treatment of peripheral nerve neuropathies (including diabetic neuropathy), and 2DNF-factor is undergoing a clinical study assessing the treatment options for amyotrophic lateral sclerosis (ALS). 0 KGF-factor is known to be active in tissue growth and regeneration of damaged tissues, and there is currently an effort in clinical practice to develop a method of using the mentioned factor in the treatment of mucosal inflammation induced by chemotherapy or ionizing radiation. MGDF (in the form with bound polyethylene glycol) is undergoing clinical studies regarding the stimulation of platelet formation in thrombocytopenia (lack of platelets) induced by the action of chemotherapeutic agents. It is assumed, however, that the analogs according to the invention will be more advantageous, compared to the unmodified forms, namely • 44 · · 4 4 * * · ·«·«« · · · 4 · · · »4 444» ·· ··· · ·· • 4 ««444 4 4

444 4 4 *4 4 · * · due to their longer therapeutic half-life and higher absorption.

For therapeutic purposes, the analogs according to the invention will be formulated in the form of suitable pharmaceutical preparations adapted for therapeutic application. This fact also falls within the scope of the invention. Said pharmaceutical preparations will usually contain a therapeutically effective amount of the polypeptide analog either alone or together with one or more excipients, carriers or other additives used standardly in the formulation of pharmaceutical preparations. Water for injection can be used as a vehicle (carrier), which is preferably supplemented with other substances usually used in the application to the organism of mammals. A polypeptide analog will usually be administered in the form of a preparation containing a purified form of said polypeptide (which may be chemically modified) together with one or more physiologically acceptable vehicles, excipients or solvents. Examples of suitable vehicles are saline of neutral pH or saline with serum albumin. If desired, other standard vehicles, excipients or solvents may be used,

Pharmaceutical preparations according to the invention can be prepared for storage by mixing the selected substance (mixture of substances) of the desired degree of purity with physiologically acceptable vehicles, excipients, substances or stabilizers (Remington's Pharmaceutical Sciences, 18th edition, Mack Publishing Company, editor A.R. Gennaro, 1990) in in the form of a lyophilisate or an aqueous solution. Suitable vehicles, excipients and stabilizers are non-toxic to the recipient's body and are preferably inert in the doses and concentrations used and include: buffer solutions such as phosphate, citrate, acetate, succinate and other organic acid salts; antioxidants such as ascorbic acid; polypeptides • 4 «4 4 4 · 4 4

4 4 4 4 4 · » 4 · · 4

4444 · ·· 444444

44444 · 4

444 44 «4 44 44 of low molecular weight; proteins such as serum albumin, gelatin or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, arginine and lysine, · monosaccharides, disaccharides and other carbohydrates including glucose, mannose or dextrins; alcoholic sugars such as mannitol or sorbitol; oppositely charged salt-forming ions such as sodium ions; and/or non-ionic surfactants such as urween or polyethylenglycol(PEG).

Any preparation according to the invention for application in vivo must be sterile. Sterilization is easily performed by filtration through sterile filter membranes. If the preparation is lyophilized, the sterilization performed by the aforementioned procedures is carried out before or after lyophilization and reconstitution. A preparation for parenteral administration will usually be stored in lyophilized form or in solution form.

The amount of a polypeptide that will be effective in treating a given disease or pathological condition will depend on the chemical nature of the polypeptide as well as the age and general health of the recipient. This amount can be determined by standard clinical methods. If possible, before the actual testing on humans, it will be desirable to determine the response curve to the administered dose of the pharmaceutical preparation first in vitro and then on a suitable animal model in vivo. In general, appropriate amounts used in vivo can be derived from known therapeutically effective doses of the wild-type proteins from which the respective analogs are derived. An experienced physician will be able, taking into account the context of the treatment, the type of disease being treated, etc., to determine the appropriate dosage without undue effort.

Methods of application of the product include intradermal, intramuscular, intraperitoneal, intravenous and • ♦ * ·' · « · · · « • * * • · « *« • « · «· ·» • · ♦ · * · * · « v · · · · • · • · · · subcutaneous. In addition, the scope of the invention includes polypeptide analogs administered via liposomes, microparticles or microcapsules; this kind of application is particularly advantageous for achieving sustained release.

In cases of use of certain polypeptide analogues such as NT-3 analogues, BDNF-factor and other neurotrophic factors intended for the treatment of neurological conditions associated with the brain or other areas of the central nervous system, it may be necessary to use special application devices— Examples of such devices include implants and osmotic pumps for intrathecal and intracranial administration:

The analogs according to the invention can be used in standard procedures for the production of antibodies useful for medical purposes, such as monitoring the level of the corresponding analog in the blood of a patient undergoing treatment.

A variety of currently known methods can be used to produce polyclonal antibodies recognizing the epitopes of given polypeptides. Various animal hosts including (but not limited to) rabbits, mice, rats, etc. can be immunized (by injection of a polypeptide analog or a fragment or derivative thereof) for antibody production. Depending on the host species, a wide variety of adjuvants can be used to enhance the host's immunological response including (but not limited to) Freund's adjuvant, mineral gels such as aluminum hydroxide (alum), surfactants such as lysolecithin, Pluronic polyols, polyanions, peptides, oil emulsions, hemocyanins from the species Megathura crenulata, dinitrophenol and adjuvants used in human medicine such as Calmette - Guerin's bacillus and Corynebacterium parvum.

Any procedure leading to antibody molecules produced by continuous

» · · • · ·

cell lines in cell cultures. Suitable procedures for the production of monoclonal antibodies include, for example, the hybridoma preparation originally developed by Kohler and Milstein and described in Nature, Volume 256, pages 495 to 497,

1975; preparation of triomas, preparation of human B-cell hybridomas described in Kozbor et al., Immunology Today, Volume 4, Page 72, 1983; preparation of EBV-hybridomas producing monoclonal antibodies as described in Cole et al.,

Monoclonal Antibodies and Cancer Therapy, .Alan R.—L-iss-,lne., pages 77 to 96, 1985.

A clone of an antibody directed against an epitope or epitopes of a given polypeptide can be prepared using known procedures. To create nucleotide sequences encoding a monoclonal antibody molecule or its antigen-binding region, the use of recombinant techniques is particularly advantageous; see, for example, Maniatis et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, 1982.

Antibodies are useful for both in vivo and in vitro diagnosis, especially if these antibodies are known A Λ w Λ R I X í* -r -r—t ^-1 Á 1* J Λ ! & 4 ΛΙΎ1Υ1 O +

L.C11C CL pUUó XV CU.JC n. «uXCÍ J. io ti <7Vn νχι'Άΐ irr^dZiTťl ^- π ζ*1ι ^ο ι άγο samples of fluids and tissues.

Examples of embodiments of the invention

The invention is further described in detail with reference to the following material, methods, procedures and experimental results. Amino acid residues of proteins are indicated in the text in the usual way using three-letter abbreviations (for example, "met stands for methionine, "val for valine, etc.) or in some cases using established one-letter abbreviations (for example, "M stands for methionine, "R for arginine, etc.)._____ «»» 4 · * 4 · · ·

4 ·«· 4 4 4 · 4 4 4 •4 4444 4» 444 ·44

44444 · 4

4 44 4 4· ·4 · · 44

Material and methods:

Preparation of NT-3 analogues

Substituted amino acid residues from the native sequence of human NT-3 were chosen in order to preserve the basic structure, and biological/therapeutic activity (see Holland et al., J. Mol. Biol., vol. 239, pages 385-400, 1994; Ibanez et al. , Cell, vol. 69, pages 329 to 341, 1992; EMBO Journal Vol. The substitutions actually made in the native sequence of human NT-3 are shown in Figures 2 and 3.

In the analog shown in Figure 2, the following two substitutions were made: arginine at position 61 (arg ₆₁ ) was replaced by alanine (ala) and lysine at position 64 (lys _e4 ) was replaced by aspartic acid. This analog was designated “NT-3(ih9)R61A,K64D. In the second analog shown in Figure 3, the same amino acid substitutions were made as in the first analog, and in addition, the polypeptide chain was terminated after amino acid residue 117 (therefore amino acids argn ₈ and thr ₁₁₉ were removed). This analog was designated “NT-3(i ₁₁₇ )RS1A, K64D. In order to create the mentioned analogs, corresponding mutations were introduced into the sequence of human NT-3 by polymerase chain reaction (PCR). For the analogue NT-3(i _n9 )R61A,K64D, pairs of chemically synthesized oligonucleotides were used, and using them, fragments of the NT-3 gene were created including (1) the initial region up to the site of mutations in codons corresponding to amino acid positions 61 and 64 and (2) the terminal region of the mentioned gene from the site of mutations to the end of the sequence. To generate the entire nucleic acid molecule encoding both mutations at positions 61 and 64, a second PCR reaction was performed that merged the start and end regions prepared earlier. For the NT-3d analogue ₇ )R61A,K64D, the above-mentioned procedure was repeated, except that from the end region ·* the codons for arginine and threonine at positions 118 and 119 have been omitted.

Expression in E. coli

In order to express the mentioned analogues in E. coli, a sequence coding for methionine was introduced to the 5' end of the DNA molecules prepared by the procedure described above, and then a stop codon was introduced to the 3' end. In addition, the sequence responsible for binding to the ribosome was placed at a suitable distance upstream of the transcriptional starting methionine site, and sites recognized by the restriction enzymes XbaI (5' end) and HindII (3' end) were introduced to the 5' and 3' ends of the gene. The resulting synthetically prepared gene fragments were bordered at the 5' end by an XbaI restriction site and at the 3' end by a HindII restriction site, they contained a site responsible for binding to ribosomes, an ATG start codon (encoding methionine), a sequence encoding the relevant analogue and a stop codon. The fragments were digested with restriction endonucleases NdeI and BamHI and ligated into the pAMG12 vector.

The expression plasmid pAMG12 can be derived from plasmid pCFMl656 (ATCC accession number 69576, deposited 24 February

Ί O O 71 τολΙ τ* τη γππγ\γ7Ο+-ιτί mí ·Ρ Ί 7^ Virgin *7 3 ΓΠΖ&ΤΊ

V iiluvíj »— V í -J vi ~ Ci 4, JL carried out by DNA sequence substitution and mutagenesis by the PCR method using overlapping oligonucleotides. From the BglII restriction site (bp 180), located at the 5' end of the P _copB replication origin of plasmid pCFM1656, the following base pair (bp) swaps were made in the direction of the replication genes of the plasmid:

4*4 · · 4 4 · · · • 4 4 4 · * · · »444

4 44» · · 4 444 44 4

4 4 «*· * ·

4* 444 4* 44 *4 *4

a couple wants a number (in pAMG12) a couple wants In pCFM1656 the pair is exchanged for (v pAMG12) 204 THE C/G 428 G/C 509 G/C yes/no ^- 617 - - advertisement of two pairs of mudflats G/C 6 zy G/C THE 980 THE C/G 994 g7 no A/T 1004 A/T c7g 1007 C/G THE 1028 A/T THE 1047 C/G THE 1178 G/No THE 1466 G/C THE 2028 deletion of the pair is desired 2187 No. 7g ť7th 2480 A/T THE 2499 - 2502 AGTG.......... TCAC .......GTCA-------------- CAGT 2642 TCCGAGC AGGGTCG deletion of the pairs is desired 3435 G/C . A/T 3446 G/C A/T 3643 А7Т

In addition, the DNA sequence located between the unique AatI restriction sites (position 4364 in plasmids pCFM1656) and • · • ··· * · «

• ·

··

Sadí (position 4585 in plasmid pCFM1656) was replaced by the following DNA sequence:

[cohesion end AatlI] ' CGTAACGTATGCATGGTCTCCCCATGCGAGAGTAGGGAACTGCCAGGCATCAA3 ' GCACGCATTGCATACGTACCAGGGGTACGCTCTCCATCCCTTGACGGTCCAGTCGAAAGACTGGGCTTTCGTTTATCTGTTGTTTGTCGGTG -ATTTTGCTTTCCGAGTCAGCTTCTGACCGGAAAGCAAAATAGACAAACAGCCAC-ACGCTCCTGAGTAGGACAAATCCGCGGAGCGGATTTGAACGTTGCGAAGCAACGG - TGCGAGAGGACTCATCCTGTTTAGGCGGCCCTGCCCTAAACTTGCAACGCTTCGTTGCC -CCGGAGGGTGGCGGGCAGGACGCCCGCCATAAACTGCCAGGCATCAAATTAAGCAGAAG-GGCCTCCCACCGCCCGTCCTGCGGGCGTATTTGACGGTCCGTAGTTTAATTCGTCTTC-CCATCCTGACGGATGGCCTTTTTGCGTTTCTACAAACTCTTTGTTTATTTTTCTAAAT-CGGTAGGACTGCCTACCGGAAAACGCAAAGATGTTTGAGAAAAACAAATAAAAAGATTTAAatlI

- AC ATTC ÁAAT AT.GG ACGTCTC AT AATTTTT AAAAAATTC ATTTGACAAATGCT AAAATTC - tgtaagtttátacctgcagagtattaaaaatttttaac-taaactGtttacgattttaag -TTGATTAATATTCTCAATTGTGAGCGCTCACAATTTATCGATTTGATTCTAGATTTGAGT- AACTAATTATAAGAGTTAACACTCGCGAGTGTTAAATAGCTAAACTAAGTCTAAACTCA -TTTAACTTTTAGAAGGGAATAACATATGTTAACGGTTGGAATTCGAGCTCACTAGT GAAAATCTTCCTCCTTAŤTGTATCCAATTGCGCAACCTTAAGCTCGAGTGATCASAcII-GTCGACCTGCAGGGTACCATGGÁAGCTTACTCGAGGATCCGCGGAAAGAAGAAGAAGAAG-CAGCTGGACGTCCCATGGTACCTTCGAATGAGCTCCTAGGCGCCTTTTCTTCTTCTTTC-AAGAAAGCCCGAAAGGAAGCTGAGTTGGCTGCTGCCACCGCTGAGCAATAACTAGCATAA-TTCTTTCGGGCŤTTCCTTCGACTCAACCGACGACGGTGGCGACTCGTTATTGATCGTATT-CCCCTTGGGGCCTCTAAAC GGGTCTTGAGGGGTTTTTTGCTGAAAGGAGGAACCGCTCTT- GGGG AAC C CCGGAGATTTGC CCAGAACTCCC C AAA AAACG ACTTTC GTCCTTGGCGAGAA-CACGCTCTTCACGC 3'

-GTGCGAGAAGTG 5' [SacII cohesive end]

Competent cells of E. coli strain FM15 were transformed with the product of the ligation reaction. For grown colonies, it was test24

4444 ·4 ·♦·♦ »· ·♦

4* 4* 4 4 4 4 4 ····· · 4 4 4 · · 4

444* 4 4 44· ··*

44444 4 4

444 44 44 44 44 to produce the recombinant protein, and for colonies producing protein of the correct size, the DNA sequence of the inserted gene was determined. The strain carrying the "correct gene" was inoculated into Luria Broth culture medium (10 g/1 Trypticase-Peptone, 10 g/1 yeast autolysate, 5 g/1 sodium chloride) and cultured for 16 hours at 37°C with constant stirring at an intensity of 250 rotations per minute. The culture obtained in this way was transferred to a sterile medium (sterilized directly in the fermenter) and with a constant supply of glucose and organic nitrogen, the cells were multiplied and subsequently induced through lactose. After induction, the fermentation was stopped, the cells were centrifuged, the supernatant after centrifugation was removed and the remaining cell paste was frozen.

Protein purification

Cells from the cell paste were disrupted by high pressure homogenization and inclusion bodies were isolated by centrifugation. The inclusion bodies thus obtained were dissolved in a guanidine-HCl solution and then diluted into a urea solution. After standing for a few days, the pH of the solution was adjusted to 3, followed by chromatography on a cathexis column and then chromatography on a hydrophobic column. Fractions containing the desired protein were pooled and sterilized by filtration.

Isoelectric point.and charge of the protein.

Isoelectric point values of wild-type human NT-3 (r-metHuNT-3, SEQ ID NO: 1) and its analog (i.e. SEQ ID NO:

and SEC. id. No: 5) were calculated using the protein/DNA sequence analysis software package designated “CGC from Genetics Computer Group, Inc., Madison, Wis. The charge of the mentioned molecules at physiological pH (presumed pH .,7,4) was estimated, using the same

9444 44 ·*·» ·* 4» • 9 · «4 4 444«

44444 44 4 4444

4* 449* 49444 944

44444 4 4 • 4 44« 4» «4 44 44 of the program package. The pI value of the first analog (NT-3 ₍₁ . ₁₁₉ )R61A, K64D, SEQ ID NO: 3) was calculated to be approximately 0.9 pH units lower than that of wild-type NT-3 (8.5 compared to 9.4). The charge for this analog at physiological pH (7.4) was reduced by approximately 2.5 pH units relative to wild-type NT-3 (ie, from approximately +7 to +4.5). The calculated pi value of the second analog (NT3 (1-117)R61A, K64D, SEQ. ID. NO: 5) was 8.2, which was about—1-.-2—unit—pH—less— than-is-the-value-of-pI-NT^3-wild-type (9.4). The charge for this (second) analog at physiological pH (7.4) was reduced by approximately 3.5 pH units (to a value of approximately +3.5) relative to that for wild-type NT-3 (+7).

Determination by ELISA method

Determination by the ELISA method was performed on 96-well plates covered with a monoclonal antibody against .. human NT-3. A rabbit polyclonal antibody conjugated with horseradish peroxidase was used as a secondary antibody. Serum samples, calibration standards, and quality control samples were diluted with phosphate buffer prior to the assay and contained approximately 50% serum prior to assay.

The volume of samples used was 100 microliters (μ1) per well. Each sample was analyzed in two parallel determinations. The cutoff limits for quantification were 0.65 ng/ml (NT.3 wild type), 4.00 ng/ml (NT-3(in ₉ )R61A,K64D) and 4.05 ng/ml (NT-3 _{(1 .117)} R61A,K64D) .

Gel Chromatography (SEC-HPLC)

Gel chromatography of each sample was performed using a Waters 600 system with a G2000SWXL column (TosoHaas). The samples were eluted at a flow rate of 0.7 milliliters per minute (ml/min) with a buffer containing 100 mM sodium phosphate26 ««4 44 4 ι*44

44444 44 4 »444

4,444 4 « « *14444

44444 4 4

4*4 44 44 14 1» new, 0.5 M NaCl, pH 6.09. Peaks were detected at a wavelength of 230 nanometers (nm).

Cathexis chromatography (CEX-HPLC)

Cathexis chromatography was performed using a Waters 625 system with a Resource S column (Pharmacia, Uppsala, Sweden). Samples were eluted at a flow rate of 1 milliliter per minute through a 0 to 1 M sodium chloride gradient in a buffer containing 20 mM Tris-HCl, pH 8.5.—Peaks—were—detected—at a wavelength of 220 nanometers (nm).

Silver-stained SDS-PAGE

Proteins were diluted with 2% SDS solution, mixed with sample buffer and heated in boiling water for five minutes. Custom electrophoretic separation was performed according to the manufacturer's recommended procedure using precast TRIS-Tricin gradient gels, 10 to 20%, purchased from ISS (Integrated Separation Systems, Natick, MA). Silver staining was performed according to the procedure described in Blum et al., Electrophoresis, Volume 8, pages 93-99,

Biological determination of mitogenic activity using 3T3trkC cells

The biological activity of r-metHuNT-3 as a reference standard is determined by a mitogenic activity bioassay using 3T3trkC cells. These cells are obtained by transfecting 3T3 cells (ATCC), which do not normally express the trkC receptor on their surface, with the plasmid pcDNAl/neo (Invitrogen, San Diego, CA) modified to contain the sequence encoding the human trkC receptor protein. The sequence of the trkC gene is described in Shelton et al., Journal of Neuroscience, Volume 15, Pages 477-491, 1995; and an example φφφ Φ φ ΦΦΦΦ· • * φ φφ φ · » · φ · φ • φ φφφ· · φ φφφ φφφ φφ «φφφφ φ φ φφ φφφ φφ φφ φ» φφ is described in Valenzuela et al., Neuron. volume 10, pages 963 to 974, 1993. Transfected cells are cultured at 37 + 2°C in a high humidity incubator in an atmosphere containing 5.5 + 1.0% CO ₂ in Dulbecco's minimal medium supplemented with fetal bovine serum and G- 418 with sulfate anion. For each determination, cells were divided into 96-well plates. After approximately 24 hours of incubation under the same conditions, the tested samples were added to the medium-replaced-medium RPMI-leAO-ak-cellnubyXy. Standard and tested samples of rmetHuNT-3 were prepared at different concentrations in RPMI 1640 medium, and the obtained mixture was added to the respective wells. The tissue culture plates were placed back into the incubator and after approximately 24 hours the number of viable cells was determined by staining with 3-(4,5-dimethylthiazol-2-yl)-5-(3carboxymethoxyphenyl)-2-(4-sulfophenyl)2H tetrazole salts , the compound tetrazole (MTS). Subsequently, the tissue culture plates were placed back into the incubator and after approximately 5 hours the optical density was measured in each well at a wavelength of 490 nm. A standard curve of dependence of optical density on the dose of added polypeptide was created and the linear section of this standard curve was subjected to linear regression analysis. After that, the concentrations of the tested samples were determined at dilutions whose measured optical density falls within the linear section of the standard curve.

In vivo biological testing

The effect of amino acid substitutions on the biological properties of molecules was determined in vivo on male Sprague Dawley rats in a crossover experiment. More specifically, nine experimental animals were divided into three groups of three, and each rat in the group was administered a dose of 1 milligram per kilogram of body weight (mg/kg) of wild-type NT-3 polypeptide • * ··· * * * · · · · • « · · · u· «· *···♦· » « · · · · · · ·· 999 *· ·» ·· ·· type (3 rats), NT-3 ₍₁ . _lig )R61A , K64D (other 3 rats) or NT-3(i.h7)R61A,K64D (remaining 3 rats). The test material was administered either (1) intravenously (IV) as the first dose and then subcutaneously (SC) 24 hours after the first dose; or (2) in the reverse order. Blood samples were collected before administration and at 1, 5, 15, and 30 minutes and 1, 2, 4, and .8 hours after intravenous administration. NT-3 concentrations in blood serum were determined by the ELISA method (see above). Antibodies used for quantification of wild-type NT-3.

Although the conditions of the experiment were not fully optimized, the mentioned antibodies showed sufficient cross-reactivity with NT-3 _{1 . ₁₁ 9)R61A, K64D and NT-3 ₍₁ - ₁ i ₇ )R61A, K64D, which also enabled the quantification of these analogs. Standard curves were created for individual proteins (see Figure 4).

Test results:

Characterization of NT-3 polypeptide analogs

In the bioassay performed in vitro on PC-12 cells, it was observed that both analogs (both with NT-3 (in ₉ )R61A, K64D and NT-3 ₍₁ . _117! R61A,K64D) retain the activity of the wild-type NT-3 protein type (r-metHuNT-3) (Table 1).In fact, the biological activity of said analogs (as measured in this assay) appears to be somewhat higher than that of wild-type NT-3, perhaps indicating their increased affinity for. of the trkC receptor (NT-3 receptor).

• ·

Table 1. Biological activity of NT-3 proteins determined in vitro

4' An analogue of NT-3 Applied concentration (mg/ml) Measured concentration (mg/ml) Expected activity (In percent) NT-3 wild type 0.32 0.23 72 h ........... NT-3 _at ....... ₁₁₇₎ R61A, K64D 0.36 1.18 328 NT-3 ₍₁ . ₁₁₉₎ R61A, K64D 0.25 1.31 524

Both analogs were eluted as non-covalently linked dimers by HPLC gel exclusion chromatography, as well as wild-type NT-3 (see Figure 5). As expected, no significant difference was observed in the molecular weights of the individual proteins. No significant aggregation of protein molecules was detected for any of the analogs. HPLG results on the cathexis column (see Figure 6) were consistent with the reduced pi value of both analogs. The slight shift in SDS-PAGE (see; Figure 7) is probably the result of...

changes in analog charge relative to wild-type NT-3. Both analogs retain the biological activity and structure of non-covalently linked dimers of the wild-type NT-3 polypeptide.

Pharmacokinetic behavior

The serum concentration curves after intravenous administration were observed to be biphasic (see Figure 8). There were substantial differences in the initial distribution phase between individual NT-3 types. The half-lives (ocTi/ ₂ ) were 3.3 minutes for wild-type NT-3, 5.4 minutes for NT-3 ₍₁ .i ₁₉ )R61A,K64D, and 7.6 minutes * « 9 · 9 · *

9 9 4 4 ·

9 * · · 4 «'* 9·· 4 9 · «>

4 9 •99 4·9

9

94 for NT-3 (ii ₁₇ )R61A, K64D (see table 2). The observed decrease in clearance after intravenous administration can only be caused by the slower distribution of NT-3 analogues. The most pronounced decrease in concentration during this phase was observed for wild-type NT-3. The half-lives of the terminal phase (βΤι/ ₂ ) were similar for all three mentioned types and ranged from 0.9 to 1.0 hour, indicating that the elimination mechanism may be identical for all mentioned types. The areas under the time-concentration curves (tTAUCinf)" were approximately 1.2 to 2 times greater for NT-3 ₍ in ₇ )R61A,K64D and NT-3 ₍₁ . ₁₁₉₎ R61A,K64D analogs than for NT- 3 wild type.

Table 2. Pharmacokinetic parameters obtained in rats administered a single dose of NT3 proteins in concentrations of 1 mg/kg intravenously.

Type NT-3 t-AUC(inf) ¹ (ng-hr/ml) CL ² [ml/kg-hour) CtT _1/2 ³ (min) βτ _1/2 ⁴ (hours) NT-3 wild type 724.1 + 151.0 1411.7 + 294.4 3.3 ± 0.3 1.0 + 0.6 НТ- _3α . _U> .)R61A, K64D .880., 7 .+..320.,.3 1276.2 +.581.8 5.,4 + .1,.9.. 0.9. +. 0.6. NT-3 ₍₁ . ₁₁₇₎ R61A, K64D 1420.7 ± 117.9 706.3 + 58.7 7.6 + 0.0 1.0 ± 0.0

¹ Area under the curve of time dependence of serum concentration at times zero to infinity. The area is calculated using the trapezoidal method.

² Clearance rate calculated as: dose : AUC ³ Half-life of the distribution phase (αΤι/ ₂ ) ⁴ Half-life of the terminal phase (βΤι/ ₂ )

After subcutaneous injection of wild-type NT-3, there was a rapid increase in the serum concentration of this peptide (see Fig.

» in « - in - - . I i • · » · · · · · ·· ··· .· ·· ·· ·· figure 9) . The maximum concentration was reached in a time (Tmax) of approximately 0.17 hours (see Table 3). A slower absorption profile was observed for the modified polypeptides. More specifically, the Tmax values were 0.67 hours for NT-3(i ₁₁₉₎ R61A, K64D and 1.33 hours for NT-3 _{(1 117)} R61A, K64D. The maximum observed serum concentrations of NT-3 ₍₁ . ₁₁₉₎ R61A, K64D and NT-3(i-h7)R61A,K64D polypeptides were 6- to 10-fold higher compared to wild-type NT-3, suggesting that that. the mentioned analogue shows a higher degree of absorption in the functional application. The degree or extent of absorption (bioavailability) is usually determined from the ratio of areas under the curves of time dependences of serum concentrations for subcutaneous and intravenous administration (Table 3). Bioavailabilities were 2.2% for wild-type NT-3, 28.2% for NT-3 ₍₁ .ii ₉ )R61A,K64D and 43.22% for NT-3d-uvjRG1A,K64D. The terminal half-lives for said analogs appeared longer compared to the wild-type polypeptide.

Table 3 Pharmacokinetic parameters obtained in rats that received a single dose of NT-3 proteins in concentrations of 1 mg/kg = '4 subcutaneously

Type NT-3 t-AUC (inf) ¹ (ng-hr/ml) ^F2 (%) CMAX ³ (ng/ml) T ⁴ J-MAX (hours) βτ _1/2 ⁵ (hr) NT-3 wild- type him 15.2±9.5 2.2±1.3 17.8+11.6 0.2±0 _t 0 0.4+0.0 NT-3 ₍₁ . ₁₁₉₎ R61A, K64D 241.3±74.8 28.5+6.3 106.5±47.1 0.7+0.3 1.4+0.6 NT-3 ₍₁ . ₁₁₇₎ R61A, K64D 632.9+38.0 43.2+2.0 180.1+51.2 1.3±0.6 1.4+0.8

• 44 4 4 * · · · · « 444 4 · · 4 · 4 *

4,444 · · 4 ·»♦*·♦

4 4 ··· · *

444 44 «· *· * · ¹ Area under the curve of time dependence of serum concentration at times zero to infinity. The area is calculated using the trapezoidal method.

² Bioavailability (P) is calculated as: (t-AUCsc / t-AUCiv) x 100% where both areas were obtained from the same animal.

³ Ckax is the maximum concentration ⁴ Tmax is the half-time to reach the maximum concentration

-Half-time—end-phase—í-pTr/ž*)-Results from these experiments show that by reducing the pi value of the NT-3 polypeptide, a decrease in the clearance rate after intravenous administration (at least initially) can be achieved and also increased absorption after subcutaneous administration. The obtained results also show that the charge of the given protein plays an important role in determining the pharmacokinetic properties. In the case of basic proteins such as NT-3 as well as other cationic proteins, a reduction in the isoelectric point (or charge at physiological pH) can result in a substantial improvement in the absorption and bioavailability of the given molecule after subcutaneous administration. This knowledge and the description provided in this application allow the design of new molecules with improved therapeutic properties.

It should be understood that the analogs described in the preceding text are given as examples only, and that it is possible, using the description provided in this application, to make other analogs of NT-3, as well as analogs of other proteins, characterized by a lower value of the isoelectric point and longer retention in the bloodstream and/or higher absorption. In one variant, for example, analogs of SEK proteins can be created. id. No: 3 and 5 by expressing in mammalian cells or secreting bacterial cells in such a way that the product "Met" (ie the methionine residue at the N-terminus is "M" is obtained)

removed and result in polypeptides with SEQ sequences. id. No: 6 and 7). The same will apply in the case of the BDNF-factor analogs described in the following text.

BDNF-factor analogue

Using the procedures described above (for the NT-3 polypeptide), a BDNF-factor analog was prepared and purified from E. coli. For each of these analogs, the value of the isoelectric point was determined at physiological pH (7.4). The values are also given for comparison isoelectric point and charge at physiological pH for wild-type BDNF-factor (ie, BDNF-factor of naturally occurring sequence; see US Patent Application 5180820, Figure 5; SEQ ID NO: 8).Substitution sites are numbered beginning at the first amino acid residue following methionine in the mature form of the protein expressed in E. coli (ie, the initial methionine residue is not counted).

BDNF-factor K65D,K73D,K95A,R97A

Px^veudiyíllj. Su.t>stj-tu.Ccuij_ j sou ΖαΠΐβΠα iysirm asparagus in positions 65 and 73, substitution of lysine for alanine in position 95 and substitution of arginine for alanine in position 97. (SEQ ID NO: 9)

Calculated value of pi: 8.46

Charge: +4.0

BDNF-factor P60E,K65D,K73D,K95A

The substitutions made are the exchange of proline for glutamic acid in position 60, the exchange of lysine for aspartic acid in positions 65 and 73, and the exchange of lysine for alanine in position 95. (SEQ ID NO: 10) • φφφφ φ Β φφφ φ φ φφφ φ · ΦΦΦ φ φ φ Φφφ « φ φ φ

Φ «4

Calculated value of pi: 8.45

Charge : +4.0

BDNF-wild-type factor Calculated pi: 10.23

Charge: +9.5

Description- 3“ν-γ3-1θ€ΐλ-γ·“^ίθ-1-©5Ϊθ^γθ1ΐ-”&β8&ύ--”

1) Determination of biological activity in vitro; biological determination of mitogenic activity using 3T3trkC cells

In this experiment, the biological activity of wild-type BDNF-factor and the biological activity of BDNF-factor analogues is determined quantitatively by measuring the incorporation (MTS) into PC-12 cells (ATCCj that have been transformed to express the receptor trkB (high-affinity receptor for BDNF-factor) .

These transformed cells were cultured in Dulbecco's minimal medium containing fetal bovine and horse serum and 1% L-glutamine. Cultivation took place at a temperature of 37°C + 2°C in an incubator with high air humidity and a carbon dioxide content of 7.5 ± 1%. For the actual experiment, the cells were transferred to tissue culture plates and further cultured. After approximately 48 hours, the culture medium was replaced with RPMI 1640 medium, test samples were added to the cells, and incubation was continued under the same conditions for another 48 hours. Subsequently, the cells were stained with MTS, incubated for another five hours under the same conditions, and the optical density at a wavelength of 490 nm was measured in each well using a plate reader. The obtained results of the biological activity of the mentioned two BDNF-factor analogues (compared to the wild-type BDNF-factor) are shown in Table 4.

• 4 44

4 4 4 * 4 44

Table 4. Biological activity of BDNF-factors determined in vitro

Biological activity (mg/mg) BDNF-wild-type factor 0.61 BDNF-factor K65D, K73D, K95A, R97A 1.24 BDNF-factor P60E, K65D, K73D, K95A 0.61

2) In vivo biological testing and obtained results The biological properties of the mentioned analogs were evaluated in vivo on male Sprague Dawley rats at doses of 3.0 milligrams per kilogram of body weight for the BDNF factor K65D, K73D, K95A, R97A and 1.7 milligrams per kilogram of body weight for BDNF-factor P60E, K65D, K73D, K95A. Test substances were administered intravenously and subcutaneously, followed by serum sampling and measurement of concentrations of said analogs in blood serum (the same procedure as for NT3 and NT-3 analogs was applied). The pharmacokinetic properties of the individual proteins are listed below for each form of administration.

Table 5. Pharmacokinetic properties measured in rats; one intravenous dose of BDNF-factors. - .

Type of BDNF-factor t-AUC (inf) (ng-hr/ml) BDNF-wild-type factor 8652.8 + 833.6 BDNF-factor K65D, K73D, K95A, R97A . 12932.8 ± 913.0 BDNF-factor P60E, K65D, K73D, K95A 14097.2 ± 949.8

»«·«· 9 9 · »999 * t ··«* · « ··· 999

9« » · · 9 » * * •9 9·« *> 9·' 9« 9·

Table_6. Pharmacokinetic properties measured in rats; one subcutaneous dose of BDNF-factors

Type of BDNF-factor t-AUC (inf) (ng-hr/ml) F (%) BDNF-wild-type factor 462.5 +1 30.3 4.7 + 2.0 BDNF-factor K65D, K73D, K95A, R97A 2401.6 ± 297.1 16.8 + 0/1 BDNF-factor P60E, K6SD, K73D, K95A 2049.2 + 357.4 13.9 + 2.0

The obtained results show that the introduction of mutations into the wild-type BDNF factor has a measurable effect on the pharmacokinetic properties. This is particularly the achievement of greater bioavailability of the mentioned two BDNF-factor analogs (compared to BDNF-factor) in vivo, which is reflected in higher values of t-AUC(inf) after intravenous administration of these analogs and higher values of t-AUC(inf ) and F% after subcutaneous administration.

This invention is defined by the appended claims.

··· · · * ♦ · * · * » « · · * ·*·· • » · 9 « · »» ·»·»« «· · · » · » * « »t ··« · · « · ·· · *

LIST OF SEQUENCES (1) GENERAL INFORMATION:

(i) APPLICANT: Boone, Thomas C.

Cheung, Ellen N.

Hershenson, Susan I.

Young, John D.

(ii) NAME OF THE INVENTION: Polypeptide analogues of cation-active polypeptides (iii) NUMBER OF SEQUENCES: 10 (iv) ADDRESS FOR CORRESPONDENCE:

(A) ADDRESSEE: ČERMÁK-HOŘEJŠ-VRBA, Advocacy and patent can- the cell (B) STREET: National 32 (C) CITY: Prague 1 (D) STATE: Czech Republic (E) Postal code: 116 66

(v) MACHINE READABLE FORM:

(A) MEDIA TYPE: Floppy disk (B) COMPUTER: IBM PC compatible . .. .. (C) OPERATING SYSTEM: PCr.DOS./MS-DOS. .. . .....

(D) SOFTWARE: Patentln Release No. 1.0, Version No. 1.25 (vi) DATA ON CURRENT APPLICATION:

(A) APPLICATION NUMBER:

(B) FILING DATE:

(C) CLASSIFICATION:

(viii) REPRESENTATIVE INFORMATION:

(A) NAME: Mazza, Richard J.

(B) REGISTRATION NUMBER:

(C> FILE NUMBER: A-411 (ix) TELECOMMUNICATION INFORMATION:

« 4

444 · 4 « 4

4 · 4 «4 ·<<

4 4 4 * · 4 «4 · 44 4 (A) TELEPHONE:

(B) TELEFAX: 0422 242 141 87 (C) TELEX:

(2) INFORMATION 0 SEC. id. No.:l:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 120 amino acid residues

'....."(B')"TYPE"polypeptide (C) NUMBER OF CHAINS: one (D) TOPOLOGY: unknown (ii) TYPE OF MOLECULE: protein (xi) SEQUENCE DESCRIPTION: SEC. id. No.:l:

Met Tire Alas Gosh His Fox Ser His Arg Glee Gosh Tire Ser Wall Cys Asp 1 5 10 15 Ser Gosh Ser Leo Suffering Wall Thr Asp Fox Ser Ser Alas How many Asp How many Arg 20 23 30 Glee His 01 n Wall Thr Wall Lcj. Glee Gosh How many TV ··j Thr Πΐΐ7 Association Ser Pxo 35 40 ~45 - Wall Fox Gin Tire Phew Tire Gosh Thr Arg Cys Fox Gosh Alas Arg For Wall 50 55 60 Fox Association Glee Cys Arg Glee How many Asp Asp Fox His Suffering Association Ser Gin Cys 65 70 75 80 Fox Thr Ser Gin Thr Tire wall Arg Alas Leo Thr Ser Glu Association Association Fox 85 90 95 Leo Wall Glee Suffering Arg Suffering ile Arg How many ASP Thr Ser Cys Wall Cys Alas 100 105 110 Leo Ser Arg Fox How many Glee Arg Thr 11S 120

* »»»· ·· 4*44 4* 4« • 4 4 44 . 4 «4*4

444· 4 · « 4 · 4 4 44 4 4 « 4 44 *44 444

4 44444 4 4

444 44 44 4· 44 (2) INFORMATION ABOUT SEC. id. No.: 2:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 360 base pairs (B) TYPE: nucleic acid (C) NUMBER OF CHAINS: one (D) TOPOLOGY: linear (ij) TYPE OF MOLECULE: cDNA_ ______________ (xi) SEQUENCE DESCRIPTION: SEC. id. C.:2:

aegtacgcfcg aacacaaatc tcaccgtgge gaatactctg. tttgcgactc tgaatctctg 60 :tgggttaccg acaaatcttc tgctatcgac atccgtggtc accaggctac cgttctgggt 120 .gaaaccaaaa ccggtaactc tecggttaaa footacttct acgaaacccg ttgcaaagaa .180 gctgcácgg ttgacaacgg ttgccgtggt atcgacgaca aacactggaa ctctcagtgc 240 ^! naaacctctc agacctacgt tcgtgctctg acctctgaaa acaacaagct tgttggttgg 300 cgttggattc gtatcgacac ctcttgcgtt tgcgctctgt ctcgtaaaat cggtegtacc 360 (2) INFORMATION ABOUT SEC. id. No.:3:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 120 amino acid residues (B) TYPE: polypeptide (C) NUMBER OF CHAINS: one (D) TOPOLOGY: unknown (ii) TYPE OF MOLECULE: protein « 4 4 44 4 · · 4 4 4 4

In 4444 44 444 444

4444 4 4 4

4 444 44 44 44 ··

(xii) DESCRIPTION OF THE SEQUENCE: SEC. id. C.: 3 : Met 1 Tyr Ala Glu His Lys Ser His Arg Gly 5 10 Gosh Tire Ser Val Cys 15 Asp Ser. Glu Ser Leu Trp Val Thr Asp Lys Ser 20 25 Ser Alas Ile Asp 30 How many Arg Glee His Gin Val Thr Val Leu Gly Glu Ile 35 40 Fox Thr Gly Asn 45 Ser For Wall Lys Gin Tyr Phe Tyr Glu Thr Arg Cys 50 55 AsnGlyCys 'Arg Gly Ile 'AspA'spLys 70 Fox 'His 75 Gosh 60 Ala Ala For wall ASP' 65 Trp Asn ser u±n cys 80 Fox Thr Ser Gin Thr Tyr Val Arg Ala Leu 85 90 Thr Ser Glu Assn Association 95 Fox Leo Leo Val Gly Trp Arg Trp ile Arg Ile Asp 100 105 Ser Arg Lys Ile Gly Arg Thr Thr Ser Cys Val 110 Cys Alas

115 120 (2) INFORMATION ABOUT SEC. id. No.: 4:

(i) SEQUENCE CHARACTERISTICS:

f Ti \ πτ?τ ΤΛΤΙ . -Λ f“ A — £. -AND-·. V. A. ~ f i O3*± U. Ud2,_L (B) TYPE: nucleic acid (C) NUMBER OF CHAINS: one (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: cDNA (xi) SEQUENCE DESCRIPTION: SEC. id. No.: 4:

atgtacgctg aacacaaatc tcaccgtggt gaatactctg tttgcgactc tgaatecttg 60 tgggttaccg acaaatcttc tgctatcgac atccgtggtc accaggttac cgttctgggt 120 gaaatcaaaa ccggtaactc tccggttaaa ctctct acgaaacccg ttgcaaagaa 160 gctgcadcgg ttgacaacgg ttgccgtggt atcgacgaa aacactggaa ctc tcagtgc 240 aaaacctctc agacctacgt tcgtgctctg acctctgaaa acaacaagct tgttggttgg 300 ^: cgttggattc gtatcgacac ctcttgcgtt tgcgctctgt ctcgtaaaat cggt 354.

i · B B « · B B B

B 4 4 4 4 * · ♦ ··· ··· • > B * · · B · B «Β ♦♦· ·♦ ·♦ ·« ·· (2) INFORMATION ABOUT SEC. id. C*:5:

(and). CHARACTERISTICS OF THE SEQUENCE:

(A) LENGTH: 118 amino acid residues (B) TYPE: polypeptide (C) NUMBER OF CHAINS: one

-CD )“TOPOLOGTE-:—unknown---(ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEC. id. No.:5:

Met Tyť Ala Glu His Lys Ser His Arg Gly Glu Tyr Ser Val Cys 15 Asp 1 5. 10 Ser Gosh Ser Leo Suffering Wall Thr Asp Fox Ser Ser Alas. How many ASp Huh Arg 20 25 30 Glee His Gin wall Thr Wall Leo Glee Gosh How many Fox Thr Glee Association Ser For 35 40 45 Wall Fox Gin Tire Phew Tire Gosh Thr Arg Cya Fox Gosh Alas Alas For Wall 50 55 60 'Asp Association Glee Cys Arg Glee How many Asp - Asp Fox His Suffering Association Ser Gin Cys .65 70 75 80 Fox Thr Ser Gin Thr Tire Wall Arg Ala Leo Thr Ser Gosh Association Association Fox 85 $0 95 Leo Wall Gly Trp Arg Suffering How many Arg How many Asp Thr Ser Cys Wall Cys Alas 100 105 110

Leu Ser Arg Lys Ile Gly 115

9, • · ι • ·Μ » 9 · • · · »9 · ··· (2) INFORMATION ABOUT SEC. id. No.:6:

(and). CHARACTERISTICS OF THE SEQUENCE:

(A) LENGTH: 119 amino acid residues (B) TYPE: polypeptide (C) NUMBER OF CHAINS: one

-(-D)—T0POLOOíE-:—unknown (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEC. id. No.:6:

Tire 1 Alas Gosh His Fox 5 Ser His Arg Glee Gosh 10 Tire Ser Wall Cys Asp .15 Ser Gosh Ser Leo Suffering 20 Wall Thr Asp Fox Ser 25 Ser Alas How many Asp ile 30 Arg Glee His Gin Wall 35 Thr Wall Leo Glee Gosh 40 How many Fox Thr Glee Association 45 Ser For Wall you with Gin c.n and in Tire Phew Tire Gosh Thr CC it* it* Arg Cys Fox Gosh Alas 50 Alas For Wall Asp Association 65 Glee Cys Arg Glee ile 70 Asp Asp Fox His Suffering 75 Association Ser Gin Cys Fox 80 Thr Ser Gin Thr Tire 85 Wall Arg Alas Leo Thr 90 Ser Gosh Association Association Fox 95 LeU Wall Glee Suffering Arg 100 suffer How many Arg How many Asp 105 Thr Ser Cys Wall Cys 110 Alas Leo Ser Arg you with 115 How many Glee Arg Thr

4 4 4 * 4 · 44 4 · « 4, 4 • » *4

444 ··· 44 4 (2) INFORMATION ABOUT SEC. id. No.:7:

(and). CHARACTERISTICS OF THE SEQUENCE:

(A) LENGTH: 117 amino acid residues (B) TYPE: polypeptide (C) NUMBER OF CHAINS: one ' (ό·)““ΤΟΡΟΕΟΟιετ~ unknown (ii) TYPE OF MOLECULE: protein (xi) SEQUENCE DESCRIPTION: SEC. id. No.:7:

¹ Tyr Alas Gosh His you with Ser His Arg Glee Gosh Tire sir Wall Cys Asp Ser and 1 5 10 15 Gosh Ser LčU. Suffering Wall Thr ASp Fox Ser Ser Alas How many Asp How many Arg Glee 20 25 30 HÍS Gin Wall Thr wall Leo Glee Gosh Πο Fox Thr Glee Association Ser For wall 35 40 45 Lvs Gin Assert Phew Tv.if Gosh Thr Arcr Cvs Lvs Gosh Alas Alas For Wall Association -50 55 - 60 Association Glee Cys Arg Glee lle ASp Asp Fox Game Suffering Association Ser Gin Cys Fox 65 70 75 80 Thr Ser Gin Thr Tire Wall Arg Alas Leo Thr Ser Gosh Association Association Fox Leo 85 90 95 Wall Glee Suffering Arg Suffering How many Arg ile Asp Thr Ser Cys Wall Cys Alas Leo 100 105 110 Ser Arg Fox How many Glee 115

φ · φ Φ φ a > > * φ φ φφφ φφφ • φφφ φ φ φφ ·· · · φ« (2) INFORMATION Ο SEC. id. No.: 8:

(ί)· CHARACTERISTICS OF THE SEQUENCE:

(A) LENGTH: 120 amino acid residues (B) TYPE: polypeptide (C) NUMBER OF CHAINS: one ('Εί^ΤΟΡΟΕΟΘΤΕΊ—ηε known-----(ii) TYPE OF MOLECULE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO. No.: 8:

Met His 1. Ser Asp Pro 5 Ala-Arg Arg Gly Glu Leu Ser val Cys Asp Ser 10 15 How many Ser Gosh Suffering wall Thr Alas Alas Asp Fox Fox Thr Alas Wall Asp Met 20 25 30 Ser Glee Glee Thr Wall Thr Wall Leo Gosh Fox Wall For wall Ser Fox Glee 35 40 45 Gin. Leo Fox Gin Tire Phew Tire Gosh Thr you with Cys Λ&Π T\_ rx «OL drank U-Jt ΓΡι * J * 50 55 60 Thr Fox Gosh Glee Cys Arg Glee How many Asp Fox Arg His Suffering Association Ser Gin 65 70 75 80 Cys Arg Thr Thr Gin 85 Ser Tire Wall Arg Alas 90 Leo Thr Met Asp Ser 95 Fox you with Arg How many Glee Suffering Arg Phew How many Arg How many Asp Thr Ser Cys Wall Cys 100 105 110 Thr Leo Thr How many Fox Arg Glee Arg 115 120

*« «»· • · · · • · 4 «* * · * · · · » · a a a a ·· a·· »· a« aaaa » ♦ *

aa ·· 99 • 9 9 9 a a a 9

999 9 99 • · a· áa (2) INFORMATION ABOUT SEC. id. No.: 9:

(and). CHARACTERISTICS OF THE SEQUENCE:

. (A) LENGTH:. 120 amino acid residues (B) TYPE: polypeptide (C) NUMBER OF CHAINS: one

--(-£) )—TOPOLOGY-:—not known--(ii) TYPE OF MOLECULE: protein (xi) SEQUENCE DESCRIPTION: SEC. id. C.:9:

Met 1. His Ser Asp Pro with Ala Arg Arg Gly Glu Leu Ser Val Cys Asp Ser 10 15 How many Ser Gosh Suffering Wall Thr Alas Alas Asp Fox Fox Thr Alas Wall Asp Met 20 25 30 Ser Glee Glee Thr Wall Thr Wall Leo Gosh Fox Wall For Wall Ser Fox Glee 35 40 45 Gin Leo Fox Gin Tire Phew Tire Gosh Thr Fox CyS Association For Met Glee Tire 50 55 60 Thr Asp Gosh Glee Cys Arg Glee How many Asp Asp Arg His Suffering Association Ser Gin 65 70 75 80 Cys Arg Thr Thr Gin Ser Tire Wall Arg Alas Leo Thr Met Asp Ser Alas 05 90 95 Fox Alas ilc Glee Suffering Arg Phew How many Arg How many Asp Thr Ser Cys Val Cys 100 105 •110 Thr Leo Thr How many Fox Arg Glee Arg 115 120

• · • ♦·· « · · · · · « • v · · · · · ·· ··« »· · »· * »· · ♦ t« (2) INFORMATION ABOUT SEC. id. No.: 10:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 120 amino acid residues (B) TYPE: polypeptide (C) NUMBER OF CHAINS: one (DjTOPOL'OUIETližňaina) TYPE OF MOLECULE: protein

xi) DESCRIPTION SEQUENCE CE: SEC. AND :D No. : 10 : Met His Ser Asp For Alas Arg Arg Glee Gosh Leo Ser Wall Cys Asp Ser 1 5 10. 15 How many Ser Gosh Suffering Wall Thr Alas Alas Asp Fox Fox Thr Alas Wall Asp Met 20 25 30 Ser Glee Glee Thr Wall Thr Wall Leo Gosh Fox Wall For wall Ser Fox Glee 35 40 45 Gin Leo Fox Gin Tire Phew Tire Glu Thr Fox cye Association Gosh Met Glee Tire 50.. 55 60 Thr Asp Glu Glee cys Arg Glee How many Asp Asp Arg His Suffering Association sir Gin 65 70 75 80 Cy<3 Arg Thr Thr Gin Ser Tire Wall Arg Alas Leo Thr Met Asp Ser Alas 85 90 95 Fox Arg How many Glee Suffering Arg Phew How many Arg How many Asp Thr Ser Cys Wall Cys 100 105 110 Thr Leo Thr How many Fox Arg Glee Arg

115 120

Claims (44)

A polypeptide analog of a cationic polypeptide, wherein said analog has an amino acid sequence that differs from the native sequence of the original polypeptide in one or more amino acid residues or differs from the native sequence of the original polypeptide by chemical modification of one or more amino acid residues of the native sequence. ............. isoelectric point values and an increase in circulating residence time in vivo and / or an increase in absorption of said analog with respect to these properties of the unmodified cationic polypeptide. The polypeptide of claim 1, wherein the polypeptide is also characterized, compared to an unmodified cationic polypeptide, with a lower charge under physiological conditions. The polypeptide of claim 1, wherein the polypeptide is an ana.log of a cationic polypeptide selected from the group consisting of neurotrophic factor-3 (NT-3), brain-derived neurotrophic factor (BDNF-factor), macrophage growth factor and differentiation factor (MGDF-factor) ) and keratinocyte growth factor (KGF). The polypeptide of claim 3, wherein the polypeptide is an NT-3 analog. The polypeptide of claim 4, wherein the polypeptide has the amino acid sequence described as SEQ. ID No: 3. 44 444 4 4444 4 4 4 4 4 4 · 4 4 * 44 • * * ·· 4 · 4 4 4 4 4 44 4 * 44 44 44 44445 4 4 44 40 «44 44 44 The polypeptide of claim 4, wherein the polypeptide has the amino acid sequence described as SEQ. ID No: 5. The polypeptide of claim 4, wherein the polypeptide has the amino acid sequence described as SEQ. ID No: 6. The polypeptide of claim 4, wherein the polypeptide has the amino acid sequence described as SEQ. ID No: 7. The polypeptide of claim 3, wherein the polypeptide is an analogue of BDNF-factor. The polypeptide of claim 9, wherein the polypeptide has the amino acid sequence described as SEQ. ID No: 9. The polypeptide of claim 9, wherein the polypeptide has the amino acid sequence described as SEQ. ID No: 10. A DNA molecule encoding a polypeptide analog of a cationic polypeptide, wherein the encoded analog has an amino acid sequence that differs from the native sequence of the original polypeptide in one or more amino acid residues or differs from the native sequence of the original polypeptide by chemical modification of one or multiple amino acid residues of the native sequence, which result in a decrease in isoelectric point value and an increase in circulating residence time in vivo and / or an increase in absorption of said analog with respect to these properties of the unmodified cationic polypeptide. 13. The DNA molecule of claim 12, wherein the molecule encodes an analog of a cationic polypeptide selected from the group of &lt; RTI ID = 0.0 &gt; 4. &Lt; / RTI &gt; 44 including NT-3, BDNF-factor MGDF and KGF. The DNA molecule of claim 13, wherein the molecule encodes a polypeptide analog of NT-3. The DNA molecule of claim 14, wherein the molecule encodes a polypeptide having the amino acid sequence described as SEQ. ID No: 3. 16. The DNA molecule of claim 14, wherein the molecule encodes a polypeptide having the amino acid sequence described as SEQ. ID No: 5. The DNA molecule of claim 15, wherein the molecule has the nucleotide sequence described as SEQ. ID No: 2. The DNA molecule of claim 16, wherein the molecule has the nucleotide sequence described as SEQ. ID No: 4. The DNA molecule of claim 13, wherein the molecule encodes a polypeptide analog of BDNF-fakcora. The DNA molecule of claim 19, wherein the molecule encodes a polypeptide having the amino acid sequence described as SEQ. ID No: 9. The DNA molecule of claim 19, wherein the molecule encodes a polypeptide having the amino acid sequence described as SEQ. ID No: 10. A biologically functional expression vector, wherein the vector comprises the DNA molecule of claim 12, which is functionally 9 9 9 9 9 «9 · · ► 9 9 9 9 9 9 * linked to expression control sequences. A prokaryotic or eukaryotic host cell transformed or transfected with an expression vector according to claim 22, such that the host cell is allowed to express the polypeptide encoded by said DNA molecule. 24 '. Třáňsřormo va'ňé "NEBB" tr ANSF EKO Vane ^ ^_ Bak teriálňí Host the Γ ⁷ cell type as claimed in claim 23rd Transformed or transfected E.coli host cells according to claim 24. Transformed or transfected mammalian 'host' cells according to claim 23. Transformed or transfected CHO cells according to claim. 26. Transformed or transfected COS cells according to claim 26. 29. A method for producing a polypeptide analog of a cationic polypeptide, wherein said analog has an amino acid sequence that differs from the native sequence of the original polypeptide in one or more amino acid residues, resulting in a decrease in isoelectric point value and an increase in residence time. circulating in vivo and / or enhancing the absorption of said analog with respect to these properties in unmodified cationic polypeptides, the method comprising culturing { 445 ··· • · * * 4 « 4) .4444 (44) (4) suitable prokaryotic or eukaryotic host cells transformed or transfected with an expression vector comprising a DNA molecule encoding said polypeptide so that said host cell can express the polypeptide, and wherein the method may also comprise isolating the expressed polypeptide product. The process of claim 29, wherein said polypeptide is an NT-3 analogue. 31. The method of claim 30, wherein the DNA molecule has been prepared by site-specific mutagenesis. 32. The method of claim 30, wherein said analog has the amino acid sequence described as SEQ. ID No: 3, 33. The method of claim 30, wherein said analog has the amino acid sequence described as SEQ. ID No: 5. 34. The method of claim 30, wherein said analog has the amino acid sequence described as SEQ. ID No: 6. 35. The method of claim 30, wherein said analog has the amino acid sequence described as SEQ. ID No: 7. »4 · 4 ♦ · ♦ 4 4 4 4444 4444 4444 4444 4444 4444 44 44444 * 44 444 · 44 44 · 4 36. The method of claim 29, wherein said polypeptide is a BDNF-factor analog. 37. The method of claim 36, wherein the DNA molecule has been prepared by site-specific mutagenesis. 38. Process according to claim 30, characterized in that-said --- "analog has ^{_ -} ^ Bínová the amino sequence SEQ. ID No: 9. 39. The method of claim 30, wherein said analog has the amino acid sequence described as SEQ. ID No: 10. 40. The method of claim 29, wherein: wherein said host cell is a bacterial cell. 41. The method of claim 40, wherein said bacterial E.coli host cell. 42. A polypeptide product expressed in a eukaryotic or prokaryotic host cell from the DNA molecule of claim 12. ' The antibody against the polypeptide of claim 1. The antibody of claim 43, wherein the antibody is polyclonal. • · · · · The antibody of claim 43, wherein the antibody is monoclonal. The polypeptide derivative according to claim 1 with the polyethylene glycol molecule (s) bound. 47. A pharmaceutical composition comprising a therapeutically effective amount of the polypeptide of claim 1 and a pharmaceutically acceptable salt thereof. A method of treating peripheral nerve neuropathies comprising administering to a patient afflicted with the disorder a therapeutically effective amount of the polypeptide of claims 4 or 9.