CZ302670B6 - Method of diagnosing invasive aspergillosis and oligonucleotides used in this method - Google Patents

Abstract

In the present invention, there is disclosed a method for in vitro diagnostics of invasive aspergillosis by means of isolation and detection of Aspergillus fumigatus DNA in biological samples taken from the body of a patient, said method being characterized in that it contains the following steps: a) isolation of DNA from the clinical samples, b) preamplification of fungal DNA using primers targeting conservative parts of Aspergillus fumigatus ribosomal DNA (rDNA) genes, c) quantitative real-time PCR detection of species specific region of the internal transcribed spacer 2 (ITS2) part of rDNA genes of an Aspergillus species wherein the step c) is performed using as forward primer an oligonucleotide having at least 85 percent homology to the sequence GGCTTTGTCACCTGCTCTGTAG (SEQ ID NO.2), as reverse primer an oligonucleotide having at least 85 percent homology to the sequence CTGATCCGAGGTCAACCTTAGAAA (SEQ ID NO.3) and as a probe an oligonucleotide having at least 85% homology to a sequence selected from the group comprising CCGACACCCAACTTT û MGB (SEQ ID NO.4) wherein the reduction in homology down up to 85 percent is achieved by extension or shortening of the primers and/or the probe. There are also disclosed novel oligonucleotides intended for the use in invasive aspergillosis diagnostics.

Description

A method of diagnosing invasive aspergillosis and oligonucleotides for use in the method

Technical field

The present invention relates to a method of diagnosing invasive aspergillosis by quantitative PCR from biological samples taken from the body of immunocompromised patients, in particular from bronchoalveolar lavage samples. It further relates to novel oligonucleotides suitable for use in this method.

BACKGROUND OF THE INVENTION

Aspergillus sp. is a saprophytic fungus whose natural niche is soil where it grows on both organic and debris. Within its reproductive cycle, each organism produces thousands of conidia, which are released into the environment. Inhalation of conidia to individuals with a healthy immune system does not lead to any clinical manifestation; normal tissue defense mechanisms and innate cellular immunity mechanisms are sufficient to exclude them from the airways. More recently, filamentous fungal infections have been more likely to be associated with allergic manifestations in long-term exposed individuals with high fungal prevalence rates (eg working in agriculture). However, as the number of cancer patients increases and immunosuppressive treatment becomes more aggressive, the situation has changed dramatically and the initiation of invasive fungal infections (IFI) is increasing (Marr, KA, et al., Invasive aspergillosis in allogeneic stem). cell transplant recipients: changes in epidemiology and risk factors, Blood, 2002. 100 (13): p.

Ν. E., et al., A prospective study of real-time panfungal PCR for early diagnosis of invasive fungal infection in haematooncology patients. Bone Marrow Transplant, 2005. 35 (4): 389-95; Ráčil, Z., et al., Invasive fungal infections in cancer patients: changes in epidemiology and diagnostics. Postgrad Med, 2007. 9 (3): 240-252).

More than 90% of aspergill infections are responsible for A. fumigatus. Early initiation of antifungal therapy and hence early diagnosis are essential for patient prognosis. Since conventional diagnostic methods (cultivation, cytology, imaging) often fail in their sensitivity and timeliness, non-cultivative diagnostic methods have developed in recent years. These, in addition to serological methods (detecting fungal pathogen antigens), include PCR diagnostics. Currently for the detection of Aspergillus spp. there is still no standardized procedure in body fluids. Several primer and probe combinations have been disclosed (WO 02/079 512; Hinrikson et al. (2005) Med. Mycol. 43, Suppl. 1, S129 to S137), but none of them achieve sufficient sensitivity and precision for clinical practice.

Research on Detection of Aspergillus spp. In body fluids, especially peripheral blood and fluid obtained by bronchoalveolar lavage (lavage of the lower respiratory tract with saline, hereinafter abbreviated as BAL), much attention is currently paid. Sensitivity and negative predictive PCR value of Aspergillus sp. in BAL, the proportion of “healthy” patients among all patients with a negative test result is 90 to 100%, but a positive predictive value, ie the proportion of patients who are actually an aspergil infection of the total number of patients with a positive test result, it is only 32 to 52% (Raad, I., et al., Diagnosis of invasive pulmonary aspergillosis using polymerase chain reaction-based detection of aspergillus in BAL. Chest, 2002. 121 (4): p. 1171-1176). False positive results are therefore relatively common. Detection of Aspergillus sp. in BAL, it may reflect not only ongoing infection but also airway colonization. However, assuming that the amount of pathogen in colonization is lower than in active infection, progress in this direction could imply the introduction of quantitative PCR, which makes it possible to determine the amount of aspergillus DNA per 1 ml of BAL (Rantakokko-Jaiava, K. et al. Semiquantitative detection by real-time PCR of Aspergillus fumigatus in bronchoalveolar lavage fluids and tissue biopsy specimens from patients with invasive aspergillosis. J Clin Microbiol,

- 1 GB 302670 B6

2003. 41 (9): 4304-4311). Setting the appropriate positivity limit (x copies in ml BAL) would allow patients to be divided into groups with greater or lesser risk of developing 1F1.

SUMMARY OF THE INVENTION

The object of the present invention is a method of diagnosing invasive aspergillosis by isolating and detecting Aspergillus fumigatus DNA in biological samples taken from a patient, in particular in bronchoalveolar lavage or peripheral blood samples. The method also consists in isolating DNA from a biological sample and then detecting the amount of the internal transcribed spacer 2 (ITS2) gene for Aspergillus fumigatus ribosomal DNA using quantitative PCR, using oligonucleotides having at least 85 % nucleotide sequence identity to GGCTTTGTCACCTGCTCTGTAG (SEQ ID NO. 2) and CTGATCCGAGGTCAACCTTAGAAA (SEQ ID NO. 3) sequences, and a TaqMan MGB probe having at least 85% nucleotide sequence identity to sequence is used as probe.

CCGACACCCAACTTT - MGB (SEQ ID NO. 4), wherein identity reductions of up to 85% are achieved by extension or shortening of the primers and / or probe. Before detecting the amount of the ITS2 gene, it is also possible to pre-amplify the fungal DNA by the PCR method.

The starting material for carrying out the method of the invention is a biological sample taken from a patient, in particular a sample of bronchoalveolar lavage or peripheral blood, preferably a sample of bronchoalveolar lavage. If the sample is not processed immediately, it can be stored frozen.

The first step of the method of the invention is the isolation of DNA from a clinical specimen. This can be done, for example, by a mechanical disruption method using a commercially available kit.

Subsequently, optionally, the DNA pre-amplification is carried out using a pair of primers that flank the quantitative PCR ITS2 sequence and are specific for the genome of the fungus. Segment amplified by primers for an external round (pre-amplification) with forward and reverse primer designation (SEQ ID NO. 1):

ctgtccgagcgtcattgctgccctcaagcacggcttgtgtgttgggcccccgtccccctctc ccgggggacgggcccgaaaggcagcggcggcaccgcgtccggtcctcgagcgtatggggctt tgtcacctgctctgtaggcccggccggcgccagccgacacccaactttatttttctaaggtt gacctcggatcaggtagggatacccgctgaactfcaagcafcatcaataagcggagg *

In a further step of the method of the invention, the amount of the ITS2 gene is detected by amplifying a portion thereof by quantitative PCR, preferably real-time PCR using TaqMan MGB (minor groove binder modification ensuring stronger binding to a small DNA helical groove than conventional probes). oligonucleotides selected from the group comprising sequences having at least 85% identity of the nucleotide sequence to a sequence selected from the group consisting of:

Cust-fum-F (SEQ ID NO. 2) GGCTTTGTCACCTGCTCTGTAG Cust-fum-R (SEQ ID NO.3) CTGATCCGAGGTCAACCTTAGAAA Cust-fum-son (SEQ ID NO. 4) CCGACACCCAACTTT

Segment amplified by primers for the internal wheel with forward primer, reverse primer 45 and probe designation (SEQ ID NO. 5):

 ggctttgtcacctgctctgtaggcccggccggcgccagccgac * cccaactttattttteta aggttgacctcggatcag

About 40 copies of the rDNA genes are present in the A.fumigatus genome and consist of three subunits: 18S rRNA, 5.8S rRNA, and 28S rRNA. Between each subunit there are ITS1 (intemal transcribed spacer 1) and ITS2 (mtemal transcribed spacer 2). A portion of this gene is used because the gene is present in the Aspergillus fumigatus genome in several dozen copies, which increases the sensitivity of the reaction. At the same time, this gene segment is specific only to Aspergillus fumigatus, which ensures a high specificity of the reaction (no cross-reaction with other fungi was found) (Schabereiter-Gurtner, C., et al., Development of novel real-time PCT assays for detection and differentiation of elevated medically important Aspergillus and Candida species in clinical specimens, J. Clin Microbiol, 2007. 45 (3): p. 906-14.

The process of the invention is a combination of DNA isolation using a commercial kit, preferably with a slightly optimized protocol, as further shown in the examples, which are intended to illustrate but not limit the invention, and originally designed combinations of oligonucleotides for PCR amplification and reaction reactions. PCR conditions. Unlike commercial solutions available so far, the inventive solution does not require any investment in instrumentation beyond the equipment for conventional real-time PCR using TaqMan probes.

The invention further provides oligonucleotides selected from the group comprising sequences having at least 85% identity of the nucleotide sequence to a sequence selected from the group consisting of GGCTTTGTCACCTGCTCTGTAG (SEQ ID NO. 2) and CTGATCCGAGGTCAACCTTAGAAA (SEQ ID NO. The invention further provides a TaqMan MGB probe having at least 85% nucleotide sequence identity to the CCGACACCCAACTTT-MGB sequence (SEQ ID NO. 4) for use in the diagnosis of invasive aspergillosis by a quantitative PCR method. A reduction in homology to 85% compared to the original nucleotide sequence is achieved, in particular, by extending or shortening the primers and / or probe by several nucleotides at the 5 'and / or 3' end. The present invention also provides such oligonucleotides for use in the diagnosis of invasive aspergillosis.

Sequence list

SEQ ID NO. 1: DNA segment amplified for external wheel.

SEQ ID NO. 2: Forward primer for internal round amplification.

SEQ ID NO. 3: Reverse primer for internal round amplification.

SEQ ID NO. 4: Probe for quantitative PCR.

SEQ ID NO. 5: DNA segment amplified for internal wheel.

DETAILED DESCRIPTION OF THE INVENTION

Example I

In a patient diagnosed with acute myeloid leukemia (AML), bronchoalveolar lavage was performed to suspect invasive aspergillosis. 2 ml of ABL-obtained fluid was collected in a sterile tube and centrifuged at 4000 to 600Xxg for 10 minutes at room temperature. After this centrifugation, all supernatant was collected by micropipette. Using a micropipette, the lysis solution, which is part of the ZR Fungal Bacterial Kit from Zymo, was added to the pellet.

Research, and the mixture was mixed. The lysate was then transferred to a glass bead tube. In the following steps, the glass bead sample was vortexed for 15 minutes at room temperature. This was followed by washing and isolating the DNA on the column according to the manufacturer's instructions. The DNA was then eluted into 50 microliters of elution buffer.

microliters of the isolated DNA was added to the reaction mixture with a pair of primers that flank the target sequence for real-time PCR and are specific for the genome of the fungus, and the reaction mixture was subjected to PCR amplification.

PCR amplification:

microliters of isolated DNA was amplified in the following reaction mixture:

ABsolute ^rM QPCR Mix (2x conc.) (Thermo Scientifica) 12.5 μΐ Asp-F primer (25 μΜ) * (Generi Biotech) 0,4 μΐ Primer ITS-R (25 μΜ) ** (Generi Biotech) 0,4 μ] MilliQ water 6,7 μΐ DNA 5μ1 Total volume 25 μΐ

In this reaction profile:

1:95 ° C / 15min

2:95 ° C / 15p

3: 60 ° C / min

4: go to step 2, 19x *, ** - according to Schabereiter-Gurtner, C., et al., Development of novel real-time PCR assays for detection and distribution of elevated medically important Aspergillus and Candida species in clinical specimens. J Clin Microbiol, 2007. 45 (3): 906-14.

Thus, in this reaction mixture, the fungal DNA present in the sample was pre-amplified after 20 PCR cycles. One microliter of PCR product from this reaction was used for further amplification in a real-time PCR reaction in which primers and a TaqMan MGB probe specific for Aspergillus fumigatus were used. In this real-time PCR reaction, part of the ribosomal DNA gene - internal transcribed spacer 2 (ITS2) was amplified.

PCR amplification:

microliter of PCR product from previous amplification was amplified in the following reaction mixture:

ABsolute ™ QPCR Mix (2χ conc.) Thermo Scientifíc 12.5 μΐ Primer Cust-fum-F (25 μΜ) 0,4 μΐ Primer Cust-fum-R (25 μΜ) 0,4 μΐ Cust-fum-son probe (25 μΜ) 0,2 μΐ MilliQ water 10,5 μΐ DNA Ιμΐ Total volume 25 μΐ

-4GB 302670 B6

In this reaction profile:

1:95 ° C / 15min

2: 95 ° C / 15s

3:60 ° C / min

4: go to step 2, 45x

At the same time, in addition to the clinical sample, samples of so-called standard DNA - plasmid DNA samples with a known number of copies of our target sequence - were also amplified in parallel. The calibration line, which was automatically constructed using Rotorgene 6 Software from the amplified standard series, was used to determine the copy number of aspergillus DNA in the PCR reaction and then converting the copy number of aspergillus DNA per ml of bronchoalveolar lavage fluid.

After PCR detection, 46,576,259 copies of Aspergillus fumigatus were detected in a sample of said patient in response. This number corresponds to 8.72 log copies / ml (i.e. 10 (exp 8.72) copies / ml) of the BAL-derived fluid and is thus a very positive sample. Other markers for invasive aspergillosis - detection of galactomannan (GM) in BAL and peripheral blood - were also very positive. The result of GM testing is given as a dimensionless number - the so-called positivity index (IP). GM in BAL - IP ~ 6.32 and serum GM IP = 0.66 - with a positivity limit of IP = 0.5. The patient reported in this example is identical to patient # 1 in Table 1.

Example 2

Using the same procedure as in Example 1, 74 BAL samples from 74 patients at risk of invasive aspergillosis (ΪΑ) were processed. 12 samples (16.2%) were positive for A. fumigatus by the above PCR reaction. The basic characteristics of this set of positive patients are shown in Table 1. The table presents the basic patient diagnoses and results of GM testing in BAL and peripheral blood as a marker of invasive aspergillosis. It can be seen that the high number of A. fumigatus DNA copies detected correlates with the high GM positivity (IP »0.5). All findings - GM in BAL and serum are highly positive in patients # 1 and # 2. PCR in BAL - in peripheral blood, A. fumigatus DNA was detected only in patient # 1. Patient # 3, who has only a low level of A. fumigatus DNA and serum negative GM, developed clinical signs and increased GM positivity only within a week of BAL - the detected positivity corresponds to a very early stage of infection. Patients 4 to 12 have very low levels of A. fumigatus DNA in BAL and GM in BAL and serum are completely negative - these patients have also not been clinically evaluated as invasive aspergillosis.

Example 3

Determination of positivity value

Table 1 and our data show that 3 groups of patients can be observed in clinical specimens after detection of this marker - DNA specific for A. fumigatus. Patients in which no A. fumigatus lymphocytes are detected - these are completely negative. Patients in which the copy count is less than 5 log copies / ml BAL - in these patients, A.fumigatus appears not to be the primary cause of infection and the capture in the sample is more likely to be colonization or early in infection. And the last group are patients in which more than 7 log copies / ml BAL are detected and in whom the diagnosis of invasive apsergillosis is unequivocally confirmed.

-5 CZ 302670 B6

Number Clinical Patient Collection Date Diagnosis * _BAL_ Peripheral Cow IFI by EORTC Assessment

GM_log copies / ml_GM log copies / nl

19.3.2008 AML 6.32 8.72 0.66 64533 IFI 2 IFI 3

what what O O O O O O O O O H H H H M H H H H H H fa fe fe fe fe fe fe fe fe fe fe H H H H H W H H M H H

(0 W O CM rl O rl í-l rl i-l O H H H H H H H H H H H fe fe fe fe fe fe h fe fe fa fe H TO H H H H H H H M W

googooggggg

II p P 4 « 0 M > 4 4 υ X P * d X & IO what 41 r * w Ol what 10 IO Ol II AT G 4 lu 0 rl O i-l rl rl rl rl O rl fe Ol ti '4 ·. rl O O fe O fe O fe O O O O O fe O fe El • O rl El ti 3 8 G § 3 • O • d II O q> P 10 O O rl 1 X h X O 3 > 1 H rl • d w 0 fe 10 O Ol οι CM r- CM 4 · CM Γ * P H rl it CM WHAT (0 Ol Ol 4 rl r- 10 J * * N me fc fe fe fe fe fc fe fe fc fe fe • 3 rl ti fe 00 4 · IO 4 4 » 4 · 4 IO * WHAT what (3 O O • d WITH H rl 0 X 3 TO H X C O 4 0 O w ► Ή »» 'd 3 G C fe • rl • d II with ti * - * CQ WHAT WHAT CM Ό WHAT CM Ol Ol IO IO G (B) ti X 10 Ol i-l rl CM CM 4 Η rl what rl 5 .3 J3 0 whose fc fe fe fe fe fc fe *. fe fe fe O 3 rl .-4 what O O O O O O O O O O fc 2 O P 5

Oi

El mm

4 r- O O WHAT 00 r * Γ- r- IO / • fe 4 « O O CM O O O P * jrfe O O ^ fe O O O fej O O O O w λ O in CM CM rl O CM and IO CM • Ol * O rl oí CM • 4 CM WHAT CM O rl CM IO O CM 10 CM CM CM IO O IO rl ft rl • WHAT Ifefc 00 tn H 4 rl CM rl CM rl CM CM

cMco4kioior * cooi o

rl i-1 CM

-6GB 302670 B6

UntitIed.ST25

SEQUENCE LISTING <110> Masaryk University <120> Method for the diagnosis of invasive aspergillosis and oligonucleotides for use in this method <130> pl121C00 <160> 5 <170> Patentln version 3.3 <210> 1 <211> 242 <212> DNA <213> Aspergillus fumigatus <400 1

ctgtccgagc gtcattgctg ccctcaagca tcccggggga cgggcccgaa aggcagcggc gctttgtcac ctgctctgta ggcccggccg aaggttgacc tcggatcagg tagggatacc ga <2IO> 2 <211> 22nd <212> DNA <213> artficíal <220> <223> forward primer <400 2 ggctttgtca cctgctctgt ag <210> 3 <211> 24 <212> DNA <213> artificial <220 <223> reverse primer <400> 3

cggcttgtgt gttgggcccc cgtccccctc 60 ggcaccgcgt ccggtcctcg agcgtatggg 120 gcgccagccg acacccaact ttatttttct 180 cgctgaactt aagcatatca ataagcggag 240

242 ctgatccgag gtcaacctta gaaa

-7EN 302670 B6

Untitled.ST25 <2IO> 4 <211> 15 <212> DNA <213> artificial <220>

<223> probe <400> 4 ccgacaccca acttt <210> 5 <211> 80 <212> DNA <213> Aspergillus fumigatus <400> 5 ggctttgtca cctgctctgt aggcccggcc ggcgccagcc gacacccaac tttatttttc 60 taaggttgac

Claims (7)

PATENT CLAIMS A method for diagnosing invasive aspergillosis by isolating and detecting Aspergillus fumigatus DNA in biological samples taken from a patient, characterized in that DNA is isolated from the biological sample taken from the patient, and then the amount of Aspergillus fumigatus ribosomal DNA ITS2 is detected quantitative PCR, using oligonucleotides having at least 85% identity of the nucleotide sequence to GGCTTTGTCACCTGCTCTGTAG (SEQ ID NO. 2) and CTGATCCGAGGTCAACCTTAGAAA (SEQ ID NO. 3) as primers for quantitative PCR, and using a TaqMan MGB probe as probe. at least 85% identity of the nucleotide sequence to the sequence CCGACACCCA ACTTT MGB (SEQ ID NO. 4), wherein a reduction of identity up to 85% is achieved by extension or shortening of the primers and / or probe. Method according to claim 1, characterized in that before the step of detecting the amount of the ITS2 gene, the pre-amplification of the fungal DNA is carried out by PCR. Method according to claim 1, characterized in that a bronchoalveolam lavage sample or a peripheral blood sample is used as the biological sample taken from the patient. 4. The method of claim 1 wherein the step of isolating DNA from a biological sample taken from the patient is performed by a mechanical disruption method. 5. The method of claim 2, wherein the step of pre-amplifying the fungal DNA is performed using a pair of primers that flank the target sequence for quantitative PCR and are specific for the genome of the fungus. -8EN 302670 B6 6. Oligonucleotides selected from the group consisting of sequences having at least 85% identity of the nucleotide sequence to a sequence selected from the group consisting of ict GGCTTTGTCACCTGCTCTGTAG (SEQ ID NO. 2) and CTGATCCGAGGTCAACCTTAGAAA (SEQ ID NO. 3). or truncation of oligonucleotides, pro 5 use in the diagnosis of invasive aspergillosis by quantitative PCR. A TaqMan MGB probe having at least 85% nucleotide sequence identity to the sequence CCGACACCCAACTTT-MGB (SEQ ID NO. 4), wherein a identity reduction of up to 85% is achieved by lengthening or shortening the probe, for use in diagnosing invasive aspergillosis by quantitative PCR.