CN1807608B - Gama-tocopherol methyl transferase gene, its coding vector and uses - Google Patents
Gama-tocopherol methyl transferase gene, its coding vector and uses Download PDFInfo
- Publication number
- CN1807608B CN1807608B CN 200610001855 CN200610001855A CN1807608B CN 1807608 B CN1807608 B CN 1807608B CN 200610001855 CN200610001855 CN 200610001855 CN 200610001855 A CN200610001855 A CN 200610001855A CN 1807608 B CN1807608 B CN 1807608B
- Authority
- CN
- China
- Prior art keywords
- tocopherol
- plant
- ala
- ser
- tmt
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Enzymes And Modification Thereof (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
This invention discloses a gamma- tocopherol methyl transfer enzyme that from corn and soybean, their code gene and their use in the plant gene project field. This invention uses RACE and RT-PCR technique, it obtains the span cDNA code sequence of gamma- tocopherol methyl transfer enzyme showed by the SEQ ID NO: 1 and SEQ ID NO: 3 from the corn of high oil 115 and soybean (9525) which all belongsto the oil plants, and it obtains the gamma- tocopherol methyl transfer enzyme with biological activity through prokaryotes expression, and it also compares with the difference of gamma-TMT enzyme activity form different sources. This invention transforms the pattern plant from the related code sequence, through HPLC analysis, the content of the alpha- tocopherol of the transfer gene plant leafage is improved by 2-5 times comparing to that of the wild leafage. This invention is to cut a new way for culturing the new plant of oil plants with high vitamin E content.
Description
Technical field
The present invention relates to the to encode gene of gama-tocopherol methyl transferase relates in particular to that oil crops corn, soybean separate, clone's gama-tocopherol methyl transferase gene, its expression vector and their application, belongs to plant genetic engineering field.
Background technology
Vitamin-E is an anthropoid necessary liposoluble vitamin, has the important physical function.It can remove the free radical that lipid peroxidation produces and the biomembranous lipid bilayer of stable protection makes cell avoid the injury of superoxide (Brigeliusb-flohE R, Traber MG; Vitamin E:function andmetablism, The FASEB J, 1999; 13,1145-1155).Thereby be used as a kind of good antioxidant and be widely used in the industries such as medicine, food, feed.A large amount of experimentation on animalies prove, add the vitamin-E of 40～100IU (international unit) in the per kilogram feed, have the raising animal immunizing power, improve meat, improve the reproductive performance of animal, alleviate unusual effects such as its stress reaction.In addition, in feed, add the stability that vitamin-E can increase meat, prevent meat corruption, spoiled, variable color, and prolongation is put the time on the shelf.Clinical study over nearly 20 years shows that vitamin-E has more vital role for HUMAN HEALTH.The vitamin-E that absorbs 10～13.4IU every day just can be kept the unify normal physiological function of vascular system of muscle, central nervous system.But the vitamin-E that absorbs 100～1000IU every day is enhance immunity power then, and delaying human body caducity reduces or prevent and treat the generation of cardiovascular disorder and cancer.
The production of vitamin-E mainly obtains by chemosynthesis and natural extract.Chemical process synthetic product mainly exists with the form of acetic ester, and by product is many and biological activity is low.Natural VE mainly extracts from vegetables oil or its refining by product and obtains.All obviously be better than synthesising complex E in physiologically active and security, active effectiveness is about 1.3～1.4 times of synthesising complex E, thereby replaces sintetics to become main flow just gradually.Along with growth in the living standard, people more and more pay attention to health, the demand of natural VE are just constantly increased with 10%～15% annual growth in the world wide, make it to become one of vitamin products with the fastest developing speed in the world.
Natural VE is made up of 8 kinds of tocopherol isomer.Can be divided into tocopherol (tocopherol) and triolefin tocopherol (tocotrienol) two big classes according to the side chain saturation ratio.Every class is according to different α, β, γ, methyltocol and α, β, γ, the δ triolefin tocopherols of being divided into respectively again of methyl number on the aromatic nucleus and position.
The basic structure of tocopherol and triolefin tocopherol
Content and the relative reactivity of these 8 kinds of homologues in plant all is not quite similar, the highest (the α of the biological activity of alpha-tocopherol, β, γ, the δ relative reactivity is respectively 100%, 50%, 10% and 3%, α-triolefin tocopherol is about 30%, other triolefin tocopherols are 10% left and right sides .Kamal-Eldin A, Appelqvist LA, The chemistry and antioxidant properties of tocopherols and tocotrienols, Lipids, 1996,31,671-701), and can be by human body preferential absorption and utilization, this be since the transfer protein that transports alpha-tocopherol in liver preferentially in conjunction with (the Torbert R.Rocheford of the characteristic decision of alpha-tocopherol, Jeffrey C.Wong, Cem O.Egesel, Robert J.Lambert, Enhancement of Vitamin ELevels in Corn, Journal of the American college of nutrition, 2002, Vol.21, No.3,191-198).Also mainly judge for the quality standard of vitamin-E product in the world with the content and the activity of alpha-tocopherol.
But the content of alpha-tocopherol in plant seed is very low, even the content at each oil crop seeds by using that is used for extracting vitamin-E is also very low, only be 7%～20%, and the content of its biosynthesizing precursor Gamma-Tocopherol can account for 50～70% of total tocopherol content.Therefore increase substantially the particularly content of high reactivity alpha-tocopherol in the oil crops of plant, changing its proportion will be for the improvement crop quality, improve its agriculture added value brings enlightenment, has good society and economic benefit.
Research plant vitamin E route of synthesis finds, (γ-TMT) can improve the content and the ratio of alpha-tocopherol by transmethylation its precursor Gamma-Tocopherol to be converted into the gama-tocopherol methyl transferase of alpha-tocopherol.At present, the gene of this enzyme is from Arabidopis thaliana (Arabidopsis thaliana), blue-green algae (David Shintaniand Dean DellaPenna, Elevating the Vitamin E Contentof Plants ThroughMetabolic Engineering, Science, 1998, Vol.282,2098-2100), clone in the wild cabbage (Brassicaoleracea) etc. and obtain (Ou Yangqing, Fan Chuntao, Sun Hui, Zhang Yuman, Bai Shuanyi, Cai Wenqi, the clone of cabbage gama-tocopherol methyl transferase cDNA, the functional study of analysis and heterogenous expression zymoprotein thereof, the natural science progress, 2003, Vol.13, No.7,709-71).Functional verification shows in the Arabidopis thaliana, the overexpression of this gene can not increase the total content of tocopherol in the transgenic plant, but can change the composition of tocopherol, the content that makes the alpha-tocopherol in the plant is converted into more than 90% by original 10%, can make thus that the physiologically active of vitamin-E improves greatly in the plant.The clone of γ-TMT gene of deriving from wild cabbage and the result who expresses in plant have been obtained identical effect too.Though this imagination has obtained confirmation, do not see the new gene of separating clone γ-TMT from main oil crops so far, and it is transformed into the content that improves alpha-tocopherol in the oil crops and changes the report that alpha-tocopherol distributes.
Summary of the invention
The present invention's technical problem at first to be solved is to overcome the deficiencies in the prior art, separates from oil crops corn and soybean respectively, clones and obtain new gama-tocopherol methyl transferase cDNA.
The present invention's technical problem at first to be solved realizes by following two technological approaches:
1, a kind of from corn the cDNA sequence of separated coding gama-tocopherol methyl transferase, this cDNA sequence has following (a) and (b), (c) or nucleotide sequence (d):
(a) has the nucleotide sequence shown in the SEQ ID NO:1; Or
(b) under rigorous condition can with the nucleotide sequence of the complementary sequence hybridization of the nucleotide sequence shown in (a), and this nucleotide sequence codedly has the active albumen of gama-tocopherol methyl transferase; Or
(c) nucleotide sequence of aminoacid sequence shown in the coding SEQ ID NO:2; Or
(d) coding has the nucleotide sequence of the protein derivatives of gama-tocopherol methyl transferase function, and this protein derivatives obtains by one or more amino-acid residues of the aminoacid sequence shown in the SEQ ID NO:2 are replaced, lacked or insert.
Preferably, the present invention's cDNA sequence of separated coding gama-tocopherol methyl transferase from corn has the nucleotide sequence shown in the SEQ ID NO:1.
2, a kind of from soybean the cDNA sequence of separated coding gama-tocopherol methyl transferase, this cDNA sequence has following (a) and (b), (c) or nucleotide sequence (d):
(a) has the nucleotide sequence shown in the SEQ ID NO:3; Or
(b) under rigorous condition can with the nucleotide sequence of the complementary sequence hybridization of the nucleotide sequence shown in (a), this is nucleotide sequence coded to have the active albumen of gama-tocopherol methyl transferase; Or
(c) nucleotide sequence of aminoacid sequence shown in the coding SEQ ID NO:4; Or
(d) coding has the nucleotide sequence of the protein derivatives of gama-tocopherol methyl transferase function, and this protein derivatives obtains by one or more amino-acid residues of the aminoacid sequence shown in the SEQ ID NO:4 are replaced, lacked or insert.
Preferably, the present invention's cDNA sequence of separated coding gama-tocopherol methyl transferase from corn has the nucleotide sequence shown in the SEQ ID NO:3.
Another technical problem to be solved by this invention provides a class gama-tocopherol methyl transferase.
Another technical problem to be solved by this invention realizes by following two technological approaches:
1, a kind of corn gama-tocopherol methyl transferase, it contains following (a) or aminoacid sequence (b):
(a) has the aminoacid sequence shown in the SEQ ID NO:2; Or
(b) protein derivatives that still has the gama-tocopherol methyl transferase function that replacement, disappearance or the insertion of the aminoacid sequence shown in the SEQ ID NO:2 by one or more amino-acid residues obtained.
Preferably, corn gama-tocopherol methyl transferase of the present invention has the aminoacid sequence shown in the SEQ ID NO:2.
2, a kind of soybean gama-tocopherol methyl transferase, contain following (a) or aminoacid sequence (b):
(a) has the aminoacid sequence shown in the SEQ ID NO:4; Or
(b) protein derivatives that still has the gama-tocopherol methyl transferase function that replacement, disappearance or the insertion of the aminoacid sequence shown in the SEQ ID NO:4 by one or more amino-acid residues obtained.
Preferably, soybean gama-tocopherol methyl transferase of the present invention has the aminoacid sequence shown in the SEQ ID NO:4.
Another technical problem to be solved by this invention is that the gama-tocopherol methyl transferase cDNA that the present invention is separated to from corn, soybean is applied to cultivate transgenic plant.
Another technical problem to be solved by this invention realizes by following technological approaches:
A kind of method of using gama-tocopherol methyl transferase cDNA of the present invention comprises:
Structure contains the plant expression vector of gama-tocopherol methyl transferase cDNA of the present invention, and this plant expression vector is transformed in the recipient plant, screens, cultivates positive transgenic plant.
Described recipient plant is preferably oil crops, for example can be peanut, corn, rape, soybean, Sunflower Receptacle, sesame etc.
Another technical problem to be solved by this invention provides a kind of method for preparing gama-tocopherol methyl transferase.
Another technical problem to be solved by this invention realizes by following technological approaches:
A kind of method for preparing gama-tocopherol methyl transferase may further comprise the steps:
Structure contains the recombinant prokaryotic expression vector of claim 3,4,7 or 8 any described cDNA sequences, with described prokaryotic expression carrier transformed host cell, cultivate institute's transformed host cells, induce the reorganization gama-tocopherol methyl transferase to express collection, the expressed reorganization gama-tocopherol methyl transferase of purifying.
In the aforesaid method, described recombinant prokaryotic expression vector is preferably pET-sigMTMT or pET-sigSTMT; Described host cell is preferably e. coli bl21.
Herein, described " a plurality of " mean 2～60 usually, are preferably 2～15, and these depend on the position or the amino acid whose kind of amino-acid residue in the three-dimensional structure of gama-tocopherol methyl transferase; Described " replacement " is meant respectively and replaces one or more amino-acid residues with different amino-acid residues; Described " disappearance " is meant the change of aminoacid sequence, wherein lacks one or more amino-acid residues respectively; Described " insertion " is meant the change of aminoacid sequence, relative natural molecule, and described change causes adding one or more amino-acid residues; Described " rigorous condition " is meant that hybridization solution is 5～6 * SSC, and 42～75 ℃ of hybridization are spent the night, and room temperature to 37 ℃ is with one to twice of 2 * SSC washing, preferably, described " rigorous condition " is 6 * SSC for hybridization solution, and 68 ℃ of hybridization are spent the night, and 37 ℃ with 2 * SSC washed twice.
Detailed description of the present invention:
The present invention adopts 3 ' RACE (Rapid Amplification of cDNA End) and 5 ' RACE and RT-PCR technology, obtains the full-length cDNA encoding sequence of the γ-TMT shown in SEQ IDNO:1 and SEQ ID NO:3 respectively from oil crops high oil corn 115, soybean (Zheng 9525).Carried out homology relatively (Fig. 2,3) with the cDNA encoding sequence and the deduced amino acid of the γ-TMT gene of delivering that derives from Arabidopis thaliana, cabbage, Chinese sorghum (Sorghum bicolor).Find that relatively the present invention clones that the homology of the corn γ-TMT of acquisition and jowar γ-TMT is higher, nucleotide homology is 78.8%, and amino acid identity is 76.9%.Soybean γ-TMT and cabbage γ-TMT homology that the present invention obtains are higher, nucleotide homology is 58.5%, amino acid identity is 63.2%, and the two nucleotide homology of corn, soybean γ-TMT is 55.4%, and amino acid identity is 62.9% (utilizing the clustal V methods analyst in the DNASTAR software).For comparing the proteic enzymic activity of γ-TMT of different sources, the cDNA encoding sequence (removing self signal peptide) that will derive from γ-TMT gene of corn, soybean, Arabidopis thaliana and cabbage respectively is building up on the prokaryotic expression carrier pET-30a (+), under identical condition, carry out abduction delivering, and utilize the affinitive layer purification target protein.With Gamma-Tocopherol and S-adenosylmethionine (SAM) is substrate, carry out catalyzed reaction at the external enzyme in four kinds of sources that makes, determine that by the content of measuring the product alpha-tocopherol that generates enzyme is alive, measure the concentration of purifying protein simultaneously, compare the expressed albumen of the different γ-TMT gene in four kinds of sources than existing between living thereby calculate than big-difference, the ratio of the γ-TMT in corn source is lived the highest, and the ratio of wild cabbage is lived minimum.
In addition, the present invention has made up the constitutive plant expression vector that contains corn, soybean γ-TMT gene respectively, by agrobacterium mediation method difference transformation mode plant Arabidopis thaliana and tobacco.Obtain PCR, ELISA and be the male transfer-gen plant.The content of analyzing the alpha-tocopherol in transgenic arabidopsis and the tobacco leaf through HPLC improves 2～5 times.
The present invention clones the cDNA complete sequence of γ-TMT gene of oil crops corn, soybean first.And obtained bioactive zymoprotein by prokaryotic expression.γ-TMT the enzyme that has compared different sources is than the difference of living.And further verified gene function and create new variety new approaches are provided for improve oil crops by molecular breeding by the transformation mode plant.
Description of drawings
Fig. 1 is the γ-TMT gene cDNA homology of the different sources figure that relatively evolves.
Fig. 2 is the γ-TMT gene deduced amino acid homology of the different sources figure that relatively evolves.
Fig. 3 is construction of prokaryotic expression vector figure.
Fig. 4 is γ-TMT induction expression of protein SDS-PAGE electrophorogram.
1: albumen marker; 2: the Arabidopis thaliana γ-TMT albumen of purifying; 3: the wild cabbage γ-TMT albumen of purifying; 4: the corn γ-TMT albumen of purifying; 5: the soybean γ-TMT albumen of purifying.
Fig. 5 is the proteic SDS-PAGE electrophorogram of affinity chromatography γ-TMT.
Fig. 6 is γ-TMT enzyme activity assay thin-layer chromatogram.
1: the Gamma-Tocopherol standard substance; 2, the pET-TMT reaction product in wild cabbage source; 3, the pET-TMT reaction product in soybean source; 4, the pET-TMT reaction product in corn source; 5, the pET-TMT reaction product in Arabidopis thaliana source; 6, alpha-tocopherol standard substance.
Fig. 7: plant expression vector construction figure.
Further describe beneficial effect of the present invention by the following examples, it should be understood that these embodiment only are used for the purpose of illustration, never limit protection scope of the present invention.
Embodiment
The clone of embodiment 1 corn gama-tocopherol methyl transferase gene
1.1 the extraction of total RNA
The extraction of total RNA is by the RNAgents Total RNA Isolation System kit of Promega company and carry out.Get No. 115 blade 1g of high oil corn grind into powder in liquid nitrogen of 20 days of growth, join 600L sex change liquid (the 26mmol/L sodium-acetate of ice precooling, 0.5% lauryl creatine acid pH 4.0,0.125mol/L beta-mercaptoethanol, the 4mol/L guanidine thiocyanate) in, add 60L 2mol/L sodium-acetate (pH4.0) then successively, mixing adds 600L phenol: chloroform: primary isoamyl alcohol (25: 24: 1, pH4.7), thermal agitation is placed 15min on ice, 4 ℃ of centrifugal 20min of following 10000g, with the supernatant sucking-off, add isopyknic Virahol, place 30min, 4 ℃ of centrifugal 10min of following 10000g for-20 ℃, supernatant discarded, after precipitation added 75% washing with alcohol of 1mL ice precooling, the precipitated rna seasoning was with standby after the Nuclease-free water dissolution.The content of the total RNA of ultraviolet determination and purity, the total RNA that gets 5g makees the chain that reverse transcription obtains cDNA.42 ℃ of water-bath 1min add 1 μ L (200U) SuperScript
TMII RT mixes gently, 42 ℃ of insulation 50min.70 ℃ of water-bath 15min stop this reaction, and centrifugal 10～20s places it under 37 ℃, add 1 μ L RNAase mix, mixing gently, and 37 ℃ of reaction 30min, after reaction finishes that sample is of short duration centrifugal, be placed on ice.
Oligo(dT)(10μmol/L) 1.5μL
The total RNA 10 μ L of sample (5 μ g)
DEPC?ddH
2O 4μL
70 ℃ of insulation 10min place 1min on ice, and are of short duration centrifugal
10×PCR?buffer 2.5μL
MgCl
2(25mmol/L) 2.5μL
dNTP?mix(2.5mmol/L) 2μL
DTT(0.1mol/L) 2.5μL
1.2cDNA3 ' terminal rapid amplifying
Behind first chain that obtains cDNA, according to the design of the conserved sequence in the γ that derives from Chinese sorghum (Sorghum bicolor)-TMT gene 5 ' end primer Vep 1:5 ' TGTGGCATTGGAGGCAGCTCAAGGTA, Oligo (dT) is 3 ' end primer, carries out the terminal amplification of cDNA3 '.The pcr amplification condition is: 94 ℃ of 4min, 94 ℃ of 1min, 52 ℃ of 45s, 72 ℃ of 45s (30 circulations), 72 ℃ of 10min.Amplify the fragment of about 600bp, link on pGM-T Easy (sky the is Time Inc.) carrier construction recombination plasmid pT-3 ' MTMT, and Transformed E .coli DH5 α after the recovery, enzyme is cut evaluation, order-checking (Shanghai Bo Ya Bioisystech Co., Ltd) behind the acquisition positive colony.
1.3cDNA5 ' terminal rapid amplifying
Press the 5 ' RACE System for Rapid Amplification of cDNA Ends of GibcoBRL company, the Version2.0kit operation.Get the total RNA of 5ug and carry out reverse transcription (as described in 1.1), obtain cDNA first chain.Handle through RNaseH, add poly (dC) at the synthetic first chain cDNA3 ' end with terminal enzyme (DNA).With anchor primer AnchorP:5 ' GGCCACGCGTCGACTAGTACGGGGGGGGGG is 5 ' terminal specific primer, according to γ-TMT gene 3 ' end parts sequences Design 3 ' the terminal specific primer VeP2:5 ' TGGCAGCATGTCACGATGATTAT that obtains, carry out the terminal amplification of cDNA5 '.The pcr amplification condition is: 94 ℃ of 4min, 94 ℃ of 45s, 55 ℃ of 45s, 72 ℃ of 45s (30 circulations), 72 ℃ of 10min.Amplify the dna fragmentation of about 600bp, and this fragment is cloned as stated above on pGM-T Easy carrier, construction recombination plasmid pT-5 ' MTMT identifies positive colony and order-checking.
The part sequencing fragment result who obtains by 3 ' RACE and 5 ' RACE can obtain the full length cDNA sequence of the corn γ-TMT gene shown in sequence table SEQ ID NO:1, and its deduced amino acid is shown in SEQ ID NO:2.
1.4RT-PCR the coding region sequence of amplification cDNA
The full length cDNA sequence design primer of the γ-TMT gene that obtains according to above-mentioned steps carries out RT-PCR, the cDNA coding region sequence of this gene that increases.
Upstream primer MaiP 1:5 ' tctagaATGGCTCACGCGGCGCTGCTC (5 ' end contains an XbaI enzyme cutting site); Downstream primer MaiP2:5 ' gagctcCTACGCGGCTCCAGGCTTGCGAC (5 ' end contains a SacI restriction enzyme site).Reaction conditions is: 94 ℃ of 4min, 94 ℃ of 1min, 58 ℃ of 45s, 72 ℃ of 1min20s (30 circulations), 72 ℃ of 10min.Amplify the dna fragmentation of about 1000bp, and this fragment is cloned as stated above on pGM-T Easy carrier, construction recombination plasmid pT-MTMTcDNA, and transformed into escherichia coli DH5 α identify positive colony and order-checking.
The clone of embodiment 2 soybean gama-tocopherol methyl transferase genes
2.1 the extraction of total RNA
Choose 20 days soybean varieties (Zheng 9525) of growth and extract total RNA, adopt above-mentioned 1.1 method to obtain cDNA first chain of reverse transcription.
2.2cDNA3 ' terminal rapid amplifying
Behind first chain that obtains cDNA, according to the design of the conserved sequence in the γ that derives from Arabidopis thaliana-TMT gene 5 ' end primer S-TMT1:5 ' TAGTGGATGTTGGGTGTGG, Oligo (dT) is 3 ' end primer, carries out the terminal amplification of cDNA3 '.The pcr amplification condition is: 94 ℃ of 4min, 94 ℃ of 1min, 55 ℃ of 45s, 72 ℃ of 45s (30 circulations), 72 ℃ of 10min.Amplify the fragment of about 600bp, link after the recovery on the pGM-T Easy carrier, construction recombination plasmid pT-3 ' SoyTMT, and Transformed E .coli DH5 α, enzyme is cut evaluation, order-checking (Shanghai Bo Ya Bioisystech Co., Ltd) behind the acquisition positive colony.
1.3cDNA5 ' terminal rapid amplifying
Press the 5 ' RACE System for Rapid Amplification of cDNA Ends of GibcoBRL company, the Version2.0kit operation.Get the total RNA of 5ug and carry out reverse transcription (as mentioned above), obtain cDNA first chain.Handle through RNaseH, add poly (dC) at synthetic first chain 3 ' end with terminal enzyme (DNA).With anchor primer AnchorP:5 ' GGCCACGCGTCGACTAGTACGGGGGGGGGG is 5 ' terminal specific primer, according to γ-TMT gene 3 ' end parts sequences Design 3 ' the terminal specific primer S-TMT2:5 ' AGGCATATGCTCACCACTCT that obtains, carry out the terminal amplification of cDNA5 '.The pcr amplification condition is: 94 ℃ of 4min, 94 ℃ of 45s, 52 ℃ of 45s, 72 ℃ of 45s (30 circulations), 72 ℃ of 10min.Amplify the dna fragmentation of about 600bp, and this fragment is cloned as stated above on pGM-T Easy carrier, construction recombination plasmid pT-5 ' soyTMT identifies positive colony and order-checking.
The part sequencing fragment result who obtains by 3 ' RACE and 5 ' RACE can obtain the full length cDNA sequence of the soybean γ-TMT gene shown in sequence table SEQ ID NO:.3, and institute's deduced amino acid is shown in SEQ ID NO:4.
1.5RT-PCR the coding region sequence of amplification cDNA
The full length cDNA sequence design primer of the γ-TMT gene that obtains according to above-mentioned steps carries out RT-PCR, the cDNA coding region sequence of this gene that increases.Upstream primer S-rTMTF0:5 ' CCCGGGACCACCATGGCCACCGTGGTGAGGAT (5 ' end contains a SmaI restriction enzyme site); Downstream primer S-rTMTR0:5 ' GATATCCTTTTTTTTTCGAACAACCCCTTTC (5 ' end contains an EcoRV restriction enzyme site), reaction conditions is: 94 ℃ of 4min, 94 ℃ of 1min, 56 ℃ of 45s, 72 ℃ of 1min20s (30 circulations), 72 ℃ of 10min.Amplify the dna fragmentation of about 1000bp, and this fragment is cloned as stated above on pGM-T Easy carrier, construction recombination plasmid pT-STMTcDNA, and transformed into escherichia coli DH5 α identify positive colony and order-checking.
3.1 the removal of endogenous signal peptide
Find by the software analysis deduced amino acid, corn γ-TMT exists one albumen navigated to the peptide sequence of leading on the chloroplast membranes in that N-is terminal, in protokaryon, correctly express and obtain activated albumen for making γ-TMT gene, we design primer MTMTsig:5 ' CCCGGGGCCTCGTCGACGGCTCAGG (5 ' end has a SmaI restriction enzyme site) according to its gene order at 5 ' end, and and MaiP2:5 ' gagctcCTACGCGGCTCCAGGCTTGCGAC (5 ' end contain a SacI restriction enzyme site) carry out PCR reaction (is template with plasmid pT-MTMTcDNA) and lead peptide sequence to remove chloroplast(id), reaction conditions is: 94 ℃ of 4min, 94 ℃ of 1min, 58 ℃ of 45s, 72 ℃ of 1min (30 circulations), 72 ℃ of 10min.Amplified production is 916bp, reclaims rear clone construction recombination plasmid pT-sigMTMT on pGM-T Easy carrier, and transformed into escherichia coli DH5 α checks order after screening positive transformant.
The γ of soybean-TMT gene exists chloroplast(id) to lead peptide sequence equally, with above-mentioned principle and operation, design primer S-rTMTF2:5 ' CCCGGGGTAGCGAGCTCGGAGAGAGGG (5 ' end has a SmaI restriction enzyme site), and and S-rTMTR0:5 ' gatatcCTTTTTTTTTCGAACAACCCCTTTC (5 ' end contain an EcoRV restriction enzyme site) carry out PCR (is template with plasmid pT-STMTcDNA), remove chloroplast(id) and lead peptide sequence, construction recombination plasmid pT-sigSTMT, transformed into escherichia coli checks order after screening positive transformant.
3.2 contain the structure of γ-TMT Prokaryotic Expression carrier
3.2.1 contain the structure of the γ-TMT Prokaryotic Expression carrier in corn source
Utilize SmaI, SacI enzyme to cut and handle recombinant plasmid pT-sigMTMT, downcut the fragment of 916bp, cut with EcoRV, SacI enzyme simultaneously and handle expression vector pET-30a (+) (Novagen company), this 916bp fragment is connected in construction recombination plasmid pET-sigMTMT (Fig. 3) on pET-30a (+) carrier.Transformed into escherichia coli BL21 cuts evaluation through enzyme and obtains positive colony.
3.2.2 contain the structure of the γ-TMT Prokaryotic Expression carrier in soybean source
Utilize SmaI, NotI enzyme to cut and handle recombinant plasmid pT-sigSTMT, downcut the fragment of 916bp, cut with EcoRV, NotI enzyme simultaneously and handle carrier pET-30a (+), this 916bp fragment is connected in construction recombination plasmid pET-sigSTMT (Fig. 3) on pET-30a (+) carrier.Transformed into escherichia coli BL21 cuts evaluation through enzyme and obtains positive colony.
3.3 γ-TMT induction expression of protein
Picking contains the single bacterium colony of BL21 of recombinant plasmid pET-sigMTMT in 10mL LB liquid nutrient medium (Kan that contains 50mg/L), 37 ℃ of jolting overnight incubation.Transfer in 50mL LB substratum (contain 50mg/L Kan) in 1: 20 ratio next day, and 37 ℃ of shaking culture add IPTG to final concentration 0.4mmol/L, in 28 ℃ of abduction delivering 3h to OD=0.6～0.8.Centrifugal collection thalline is abandoned supernatant liquor.Simultaneously with the bacterial strain that contains pET-30a (+) empty carrier with contain recombinant plasmid pET-sigMTMT but do contrast without IPTG inductive bacterial strain.The SDS-PAGE analysis revealed, the e. coli bl21 that contains recombinant plasmid pET-sigMTMT through the IPTG inductive has a tangible protein band (Fig. 5 in the position of about 38kD, and two bacterial strains in contrast do not have protein band (Fig. 4, Lane I, II) herein LaneIII).Illustrate that the γ-TMT gene that derives from corn has obtained expression.γ-TMT the gene in soybean source is also induced with aforesaid method and operation, the SDS-PAGE analysis revealed also obtained expression (Fig. 4, LaneIV).
Activity for the expressed zymoprotein of the γ-TMT gene that compares different sources, we have obtained the cDNA encoding sequence of γ-TMT gene of Arabidopis thaliana and cabbage according to the sequences Design primer clone of Arabidopis thaliana that searches among the GenBank and cabbage, and according to aforesaid method and operation, remove its signal peptide sequence and be cloned on the prokaryotic expression carrier pET-30a (+), induce and obtain and express.Four different γ-TMT genes in source are carried out abduction delivering under the same conditions.Inductive condition is: IPTG final concentration 0.4mmol/L, and in 28 ℃ of abduction delivering 3h.The thalline of centrifugal collection 600mL nutrient solution, sterilized water washing 1 time is resuspended in 6mL 20mM pH7.5Na
2HPO
4-NaH
2PO
4(contain 0.5MNaCl, the 10mM imidazoles) in the phosphoric acid buffer, the bacterium liquid of ultrasonic disruption to the fragmentation and not broken bacterium liquid phase are than till the obvious clarification.4 ℃, 10000rpm, 20min is centrifugal.Get 10-20 μ L supernatant and make SDS-PAGE, all the other supernatants are used for protein purification.
Because the expressed protein of pET30a (+) expression system that is adopted is fusion rotein, its N-terminal has 6 successive Histidines, can pass through metal ion chromatography column (Ni
2N TA Agarose) carry out affinity purification..Adopt AKTA FPLC protein purification system (Amersham pharmacia biotech company); HiTrap Chelating HP (column volume 1mL) carries out purifying to four albumen of inducing acquisition.Purification condition is:
Level pad: 20mM pH7.5Na
2HPO
4-NaH
2PO
4Phosphoric acid buffer (containing 0.5M NaCl, the 10mM imidazoles), elution buffer: 20mM pH7.5Na
2HPO
4-NaH
2PO
4Phosphoric acid buffer (containing 0.5M NaCl, the 500mM imidazoles).Adopt linear gradient elution, flow velocity is: 1mL/min.SDS-PAGE analysis revealed, purifying obtain the albumen (Fig. 5) of single band.
After obtaining the γ-TMT albumen of purifying, Qualitative and Quantitative research is carried out in its enzyme work, the ratio between the comparison is lived.Enzyme reaction system: get 300 μ L purifying enzyme liquid, add 5 μ L S-adenosylmethionine SAM (0.35mg), the dithiothreitol (DTT) (DTT) of 2.5 μ L 1M, 0.3mg Gamma-Tocopherol, mending damping fluid (pH7.5) to total reaction system is 500 μ L, behind 30 ℃ of reaction 3h, adds 500 μ L chloroforms: methyl alcohol (2: 1) termination reaction, behind the violent vortex 1min of each sample, 10000rpm, 10min, centrifugal phase-splitting, lower floor's chloroform is changed in the new centrifuge tube mutually, dry up with high pressure nitrogen.Be dissolved in the 20 μ L dehydrated alcohols.Get 3 μ L sample point samples on TLC plate (gel GF 254 plate), room temperature exhibition layer in methylene dichloride.And with standard substance γ-be born in phenol and α-be born in phenol (Sigma company) in contrast.Drying at room temperature TLC plate is observed chromatogram spot (Fig. 6) down in UV-light (253nm).Sample thief carries out the HPLC quantitative assay simultaneously.
Analysis condition:
High performance liquid chromatograph (day island proper Tianjin),
Chromatographiccondition:
Moving phase: normal hexane: isopropyl ether (90: 10 V/V)
Chromatographic column: silicagel column: granularity 5 μ L, 4.6 * 25cm;
Detect wavelength: excitation wavelength: 298nm; Emission wavelength: 325nm
Column temperature: 40 ℃ of flow velocitys: 1..5ml/min analysis time: 20min.
Obtain content, thereby obtain the activity of four enzymes through the alpha-tocopherol of enzyme reaction generation alive.The enzyme work of γ-TMT is defined as: the needed enzyme amount of 1 μ g alpha-tocopherol that per hour generates under pH7.5,30 ℃ of conditions is 1 enzyme unit (U) that lives.Measure the protein concentration of purifying with BioRad analysis of protein method, and the specific activity that calculates four zymoproteins thus (is defined as: every milligram of enzyme activity unit that albumen is contained).See Table 1
The γ of table 1 different sources-TMT zymoprotein specific activity relatively
Above numerical value is three mean value results
Table 1 result shows that the expressed albumen ratio of the different γ-TMT gene of originating exists than big-difference between living, and the ratio of the γ-TMT in corn source is lived the highest, and the ratio of wild cabbage is alive minimum.
With XbaI, SacI carrier pBI121 and recombinant plasmid pT-MTMTcDNA are carried out double digestion respectively, reclaim the corn γ-TMT fragment of about 1kb and the big segment of carrier of 13kb, enzyme connects, and transforms, construction recombination plasmid pBI121-MTMT, and cut through enzyme and to identify positive colony.With SmaI, SacI carrier pBI121 and recombinant plasmid pT-STMTcDNA are carried out double digestion respectively, reclaim the soybean γ-TMT fragment of about 1kb and the big fragment of carrier of 13kb, enzyme connects, and transforms, construction recombination plasmid pBI121-STMT, and cut through enzyme and to identify positive colony (Fig. 7).
With recombinant plasmid pBI121-MTMT, the pBI121-STMT transformed competence colibacillus Agrobacterium LBA4404 that shocks by electricity respectively, add 1mL YEB liquid nutrient medium and cultivated 3 hours for 28 ℃, get 200 μ L and be coated with YEB resistant panel (Kan 50mg/L, Rf 50mg/L), 28 ℃ of cultivations.Picking list bacterium colony extracts the Agrobacterium plasmid, and cuts by PCR, enzyme and to identify the Agrobacterium that obtains to contain plasmid pBI121-MTMT and pBI121-STMT respectively.
The plant genetic that embodiment 6 contains γ-TMT gene transforms
6.1 conversion of tobacco and regeneration
Picking is identified single bacterium colony of correct Agrobacterium respectively, and (Kan 50mg/L, Rif50mg/L) in the liquid nutrient medium, 28 ℃, 250rpm cultivated 36 hours to be inoculated in 5mLYEB.Transfer in 50mLYEB (Kan 50mg/L, Rif 50mg/L) liquid nutrient medium according to 1: 200,28 ℃, be cultured to OD
600=0.8～1.0.5, the centrifugal collection thalline of 000rpm, with isopyknic aseptic MS resuspended dip-dyeing solution.Utilize the leaf disc transformation method transformation of tobacco.Choose the blade of the tobacco that grows 8 to 10 leaves, blade is cut into 1cm along vein
2The leaf dish, be soaked in the bacterium liquid 10 minutes, take out, on aseptic filter paper, blot bacterium liquid, put in the MS flat board (6BA 2mg/mL, IAA 0.2mg/mL) the dark leaf dish of cultivating after 2 days conversion processing and be dipped in the MS liquid 10 minutes, on aseptic filter paper, blot, change the MS flat board (6BA 2mg/mL, IAA 0.2mg/mL, the kan 100mg/mL that contain resistance over to, CB 500mg/mL) on, illumination cultivation (24 ℃, illumination 16 hours) was changed dull and stereotyped in 20 days, sprout until differentiation, downcut resistant buds and forward (MS+kan 100mg/mL, CB 500mg/mL) on the root media to, take root to growing up to plant.
6.2 arabidopsis thaliana transformation
Picking is identified single bacterium colony of correct Agrobacterium, and (Kan 50mg/L, Rif50mg/L) in the liquid nutrient medium, 28 ℃, 250rpm cultivated 36 hours to be inoculated in 5mL YEB.Be forwarded in 200mLYEB (Kan 50mg/L, the Rif 50mg/L) liquid nutrient medium according to 1: 300,28 ℃, be cultured to OD
600≈ 2.0.5, the centrifugal collection thalline of 000rpm is resuspended in 10% sucrose solution (matching while using) of about 2 times of volumes, to OD
600About ≈ 1.0, add the Silwet 70 (Sigma company) of 0.02% (v/v).Select for use the Arabidopis thaliana of a large amount of unopened buds of tool to transform.Arabidopis thaliana is inverted, bud is immersed in the penetrating fluid down, stopped 20～40 seconds, take out bud, shake off the unnecessary penetrating fluid on the plant gently, plant is just put.Plant after the conversion is built preservative film after protecting with rigid plastic sheet.In 22 ℃ of cultivations (illumination 16 hours), the collection seed bears pods up to blooming.Be sprinkling upon on the 1/2MS substratum after the seed disinfection in T0 generation of collecting handled and (contain Kan 50mg/L, 1% sucrose).Seal plate with sealing film, 4 ℃ of vernalization 48～72 hours.22 ℃ of cultivations (illumination in 16 hours).Seedling with that resistance of card can be green by normal growth on resistant panel, non-resistance seedling then yellow is die.Treat it to be moved in the soil when green seedling on the flat board grows four true leaves, cover the preservative film water conservation and throw off two days later, but cultivate that seedling grows 8～10 true leaves and clip blade when more sturdy, carry genomic dna, carry out PCR and detect.
Screening of embodiment 7 positive transgenic plant and tocopherol Determination on content thereof
7.1 the evaluation of transgenic positive plant
Get respectively T0 for transgene tobacco and through the T1 of resistance screening for the about 30～50mg of Arabidopis thaliana plant leaf, extract plant genome DNA, carry out pcr amplification as template, the screening positive plant.Corn γ-used primer of TMT gene masculine plant is changeed in screening: inner primer VeP1:5 ' TGTGGCATTGGAGGCAGCTCAAGGTA of gene and carrier terminator primer 35terP:5 ' TATGATAATCATCGCAAGACC.Amplification condition is: 94 ℃ of 4min, 94 ℃ of 1min, 60 ℃ of 45s, 72 ℃ of 1min (30 circulations), 72 ℃ of 10min.Amplify about 800bp fragment and illustrate that promptly this plant is the PCR positive plant.It is carrier promoter primer 35Pro:5 ' AAAGGAAAGGCCATCGTTG and the inner primer S-rTMTR05 ' of gene GATATCTTTTTTTTTCGAACAACCCCTTTC that soybean γ-used primer of TMT gene masculine plant is changeed in screening.Amplification condition is: 94 ℃ of 4min, 94 ℃ of 1min, 58 ℃ of 45s, 72 ℃ of 1min 30s (30 circulations), 72 ℃ of 10min.Amplify about 1.2kb fragment and illustrate that promptly this plant is the PCR positive plant.
7.2 the evaluation of high expression level positive plant
Getting above-mentioned PCR male transfer-gen plant and not genetically modified each 150mg of wild-type plant leaf changes over to after with liquid nitrogen grinding and contains 700 μ L and take out body fluid (150mM Tris-HCL pH8.0,25% glycerine, 2% (w/v) polyethylene pyrrole Lip river alkane ketone, 1mmol/L PMSF) in the 1.5mL centrifuge tube.Mixing left standstill 3～4 hours on ice, 4 ℃ of centrifugal 20min of 12000rpm, and it is standby to draw supernatant liquor.Identify the high expression level positive plant by the ELISA method.At first, be antigen with corn, the soybean γ-TMT albumen of embodiment 4 described purifying, be diluted to 2 μ g/mL with coating buffer, get 100 μ L points on enzyme plate, 4 ℃ of bags are spent the night.The bag that will spend the night is taken out in 37 ℃ by plate to be placed 1 hour.Wash plate 3～5 times with phosphoric acid buffer PBST.Every hole adds 200 μ L 3%BSA (bovine serum albumin component V) solution, 37 ℃ of incubations 1 hour.PBST washes plate, adds an anti-solution (with the anti-γ of the rabbit-TMT serum of the protein immunization of affinitive layer purification, 1: 10000 times of Dilution ratio) of 100 μ L dilution, places 1 hour, and carries out contrast simultaneously for 37 ℃.PBST washes plate, adds 37 ℃ of two anti-diluents (goat anti-rabbit igg of wax root peroxidase labelling, 1: 5000 times of dilution) and places 1 hour, and PBST washes plate, add substrate OPD develop the color to color obviously after, add 50 μ L 2M sulfuric acid termination reactions.Under wavelength 492nm, measure.The sample explanation corn of ELISA significant reaction, the γ-TMT gene in soybean source have higher expression in tobacco and Arabidopis thaliana.
7.3 positive transfer-gen plant tocopherol Determination on content
Selecting the positive plant of ELISA significant reaction and not genetically modified each 100mg of wild-type plant leaf changes over to after with liquid nitrogen grinding and contains 600 μ L methyl alcohol-chloroforms (2: 1) and take out in the 1.5mL centrifuge tube of body fluid, fully shake mixing, add 200 μ L chloroforms and 200 μ L sterilized waters then, fully mixing.The centrifugal 15min of 12000rpm takes off layer organic phase and changes in the new centrifuge tube, and nitrogen dries up, and is dissolved in the 400 μ L dehydrated alcohols.Analyze discovery by HPLC, the content of alpha-tocopherol generally increases in the positive transgene tobacco of commentaries on classics corn and soybean γ-TMT gene and the Arabidopsis leaf, and wherein the content of alpha-tocopherol improves 2～5 times (table 2) in 1/3rd the positive rotaring gene plant blade.
The contrast of wild plant of table 2 and positive transfer-gen plant alpha-tocopherol content
Sequence table .txt
SEQUENCE?LISTING
＜110〉Biological Technology institute, Chinese Academy of Agricultural Sciences
＜120〉gama-tocopherol methyl transferase gene, its expression vector and application
<130>p00345
<160>4
<170>PatentIn?version?3.3
<210>1
<211>1059
<212>DNA
＜213〉corn (Zea mays)
<400>1
atggctcacg?cggcgctgct?ccattgctcc?cagtcctcca?ggagcctcgc?agcctgccgc 60
cgcggcagcc?actaccgcgc?cccttcgcac?gtcccgcgcc?actcccgccg?tctccgacgc 120
gccgtcgtca?gcctgcgtcc?gatggcctcg?tcgacggctc?aggcccccgc?gacggcgccg 180
ccgggtctga?aggagggcat?cgcggggctg?tacgacgagt?cgtcggggct?gtgggagaac 240
atctggggcg?accacatgca?ccacggcttc?tacgactcga?gcgaggccgc?ctccatggcc 300
gatcaccgcc?gcgcccagat?ccgcatgatc?gaggaggcgc?tcgccttcgc?cggtgtccca 360
gcctcagatg?atccagagaa?gacaccaaaa?acaatagtcg?atgtcggatg?tggcattggt 420
ggtagctcaa?ggtacttggc?gaagaaatac?ggagcgcagt?gcactgggat?cacgttgagc 480
cctgttcaag?ccgagagagg?aaatgctctc?gctgcagcgc?aggggttgtc?ggatcaggtt 540
actctgcaag?ttgctgatgc?tctggagcaa?ccgtttcctg?acgggcagtt?cgatctggtg 600
tggtccatgg?agagtggcga?gcacatgccg?gacaagagaa?agtttgttag?tgagctagca 660
cgcgtggcgg?ctcctggagg?gacaataatc?atcgtgacat?ggtgccatag?gaacctggat 720
ccatccgaaa?cctcgctaaa?gcccgatgaa?ctgagcctcc?tgaggaggat?atgcgacgcg 780
tactacctcc?cggactggtg?ctcaccttca?gactatgtgg?acattgccaa?gtcactgtct 840
ctcgaggata?tcaagacagc?tgactggtcg?gagaacgtgg?ccccgttttg?gcccgccgtg 900
ataaaatcag?cgctaacatg?gaagggcttc?acctctctgc?tgacgaccgg?atggaagacg 960
atcagaggcg?cgatggtgat?gccgctaatg?atccagggct?acaagaaggg?cctcatcaaa 1020
ttcaccatca?tcacctgtcg?caagcctgga?gccgcgtag 1059
<210>2
<211>352
<212>PRT
＜213〉corn (Zea mays)
<400>2
Met?Ala?His?Ala?Ala?Leu?Leu?His?Cys?Ser?Gln?Ser?Ser?Arg?Ser?Leu
1 5 10 15
Ala?Ala?Cys?Arg?Arg?Gly?Ser?His?Tyr?Arg?Ala?Pro?Ser?His?Val?Pro
20 25 30
Arg?His?Ser?Arg?Arg?Leu?Arg?Arg?Ala?Val?Val?Ser?Leu?Arg?Pro?Met
35 40 45
Ala?Ser?Ser?Thr?Ala?Gln?Ala?Pro?Ala?Thr?Ala?Pro?Pro?Gly?Leu?Lys
50 55 60
Glu?Gly?Ile?Ala?Gly?Leu?Tyr?Asp?Glu?Ser?Ser?Gly?Leu?Trp?Glu?Asn
65 70 75 80
Ile?Trp?Gly?Asp?His?Met?His?His?Gly?Phe?Tyr?Asp?Ser?Ser?Glu?Ala
85 90 95
Ala?Ser?Met?Ala?Asp?His?Arg?Arg?Ala?Gln?Ile?Arg?Met?Ile?Glu?Glu
100 105 110
Ala?Leu?Ala?Phe?Ala?Gly?Val?Pro?Ala?Ser?Asp?Asp?Pro?Glu?Lys?Thr
115 120 125
Pro?Lys?Thr?Ile?Val?Asp?Val?Gly?Cys?Gly?Ile?Gly?Gly?Ser?Ser?Arg
130 135 140
Tyr?Leu?Ala?Lys?Lys?Tyr?Gly?Ala?Gln?Cys?Thr?Gly?Ile?Thr?Leu?Ser
145 150 155 160
Pro?Val?Gln?Ala?Glu?Arg?Gly?Asn?Ala?Leu?Ala?Ala?Ala?Gln?Gly?Leu
165 170 175
Ser?Asp?Gln?Val?Thr?Leu?Gln?Val?Ala?Asp?Ala?Leu?Glu?Gln?Pro?Phe
180 185 190
Pro?Asp?Gly?Gln?Phe?Asp?Leu?Val?Trp?Ser?Met?Glu?Ser?Gly?Glu?His
195 200 205
Met?Pro?Asp?Lys?Arg?Lys?Phe?Val?Ser?Glu?Leu?Ala?Arg?Val?Ala?Ala
210 215 220
Pro?Gly?Gly?Thr?Ile?Ile?Ile?Val?Thr?Trp?Cys?His?Arg?Asn?Leu?Asp
225 230 235 240
Pro?Ser?Glu?Thr?Ser?Leu?Lys?Pro?Asp?Glu?Leu?Ser?Leu?Leu?Arg?Arg
245 250 255
Ile?Cys?Asp?Ala?Tyr?Tyr?Leu?Pro?Asp?Trp?Cys?Ser?Pro?Ser?Asp?Tyr
260 265 270
Val?Asp?Ile?Ala?Lys?Ser?Leu?Ser?Leu?Glu?Asp?Ile?Lys?Thr?Ala?Asp
275 280 285
Trp?Ser?Glu?Asn?Val?Ala?Pro?Phe?Trp?Pro?Ala?Val?Ile?Lys?Ser?Ala
290 295 300
Leu?Thr?Trp?Lys?Gly?Phe?Thr?Ser?Leu?Leu?Thr?Thr?Gly?Trp?Lys?Thr
305 310 315 320
Ile?Arg?Gly?Ala?Met?Val?Met?Pro?Leu?Met?Ile?Gln?Gly?Tyr?Lys?Lys
325 330 335
Gly?Leu?Ile?Lys?Phe?Thr?Ile?Ile?Thr?Cys?Arg?Lys?Pro?Gly?Ala?Ala
340 345 350
<210>3
<211>1053
<212>DNA
＜213〉Glycine soybean (Glycine max (L.) Merill)
<400>3
atggccaccg?tggtgaggat?cccaacaatc?tcatgcatcc?acatccacac?gttccgttcc 60
caatcccctc?gcactttcgc?cagaatccgg?gtcggaccca?ggtcgtgggc?tcctattcgg 120
gcatcggcag?cgagctcgga?gagaggggag?atagtattgg?agcagaagcc?gaagaaggat 180
gacaagaaga?agctgcagaa?gggaatcgca?gagttttacg?acgagtcttc?tggcttatgg 240
gagaacattt?ggggcgacca?catgcaccat?ggcttttatg?actcggattc?cactgtttcg 300
ctttcggatc?atcgtgctgc?tcagatccga?atgatccaag?agtctcttcg?ctttgcctct 360
gtttctgagg?agcgtagtaa?atggcccaag?agtatagttg?atgttgggtg?tggcataggt 420
ggcagctcta?gatacctggc?caagaaattt?ggagcaacca?gtgtaggcat?cactctgagt 480
cctgttcaag?ctcaaagagc?aaatgctctt?gctgctgctc?aaggattggc?tgataaggtt 540
tcctttcagg?ttgctgacgc?tctacagcaa?ccattctctg?acggccagtt?tgatctggtg 600
tggtccatgg?agagtggaga?gcatatgcct?gacaaagcta?agtttgttgg?agagttagct 660
cgggtagcag?caccaggtgc?cactataata?atagtaacat?ggtgccacag?ggatcttggc 720
cctgacgaac?aatccttaca?tccatgggag?caagatctct?taaagaagat?ttgcgatgca 780
tattacctcc?ctgcctggtg?ctcaacttct?gattatgtta?agttgctcca?atccctgtca 840
cttcaggaca?tcaagtcaga?agattggtct?cgctttgttg?ctccattttg?gccagcagtg 900
atacgctcag?ccttcacatg?gaagggtcta?acttcactct?tgagcagtgg?acaaaaaacg 960
ataaaaggag?ctttggctat?gccattgatg?atagagggat?acaagaaaga?tctaattaag 1020
tttgccatca?ttacatgtcg?aaaacctgaa?taa 1053
<210>4
<211>350
<212>PRT
＜213〉Glycine soybean (Glycine max (L.) Merill)
<400>4
Met?Ala?Thr?Val?Val?Arg?Ile?Pro?Thr?Ile?Ser?Cys?Ile?His?Ile?His
1 5 10 15
Thr?Phe?Arg?Ser?Gln?Ser?Pro?Arg?Thr?Phe?Ala?Arg?Ile?Arg?Val?Gly
20 25 30
Pro?Arg?Ser?Trp?Ala?Pro?Ile?Arg?Ala?Ser?Ala?Ala?Ser?Ser?Glu?Arg
35 40 45
Gly?Glu?Ile?Val?Leu?Glu?Gln?Lys?Pro?Lys?Lys?Asp?Asp?Lys?Lys?Lys
50 55 60
Leu?Gln?Lys?Gly?Ile?Ala?Glu?Phe?Tyr?Asp?Glu?Ser?Ser?Gly?Leu?Trp
65 70 75 80
Glu?Asn?Ile?Trp?Gly?Asp?His?Met?His?His?Gly?Phe?Tyr?Asp?Ser?Asp
85 90 95
Ser?Thr?Val?Ser?Leu?Ser?Asp?His?Arg?Ala?Ala?Gln?Ile?Arg?Met?Ile
100 105 110
Gln?Glu?Ser?Leu?Arg?Phe?Ala?Ser?Val?Ser?Glu?Glu?Arg?Ser?Lys?Trp
115 120 125
Pro?Lys?Ser?lle?Val?Asp?Val?Gly?Cys?Gly?Ile?Gly?Gly?Ser?Ser?Arg
130 135 140
Tyr?Leu?Ala?Lys?Lys?Phe?Gly?Ala?Thr?Ser?Val?Gly?Ile?Thr?Leu?Ser
145 150 155 160
Pro?Val?Gln?Ala?Gln?Arg?Ala?Asn?Ala?Leu?Ala?Ala?Ala?Gln?Gly?Leu
165 170 175
Ala?Asp?Lys?Val?Ser?Phe?Gln?Val?Ala?Asp?Ala?Leu?Gln?Gln?Pro?Phe
180 185 190
Ser?Asp?Gly?Gln?Phe?Asp?Leu?Val?Trp?Ser?Met?Glu?Ser?Gly?Glu?His
195 200 205
Met?Pro?Asp?Lys?Ala?Lys?Phe?Val?Gly?Glu?Leu?Ala?Arg?Val?Ala?Ala
210 215 220
Pro?Gly?Ala?Thr?Ile?Ile?Ile?Val?Thr?Trp?Cys?His?Arg?Asp?Leu?Gly
225 230 235 240
Pro?Asp?Glu?Gln?Ser?Leu?His?Pro?Trp?Glu?Gln?Asp?Leu?Leu?Lys?Lys
245 250 255
Ile?Cys?Asp?Ala?Tyr?Tyr?Leu?Pro?Ala?Trp?Cys?Ser?Thr?Ser?Asp?Tyr
260 265 270
Val?Lys?Leu?Leu?Gln?Ser?Leu?Ser?Leu?Gln?Asp?Ile?Lys?Ser?Glu?Asp
275 280 285
Trp?Ser?Arg?Phe?Val?Ala?Pro?Phe?Trp?Pro?Ala?Val?Ile?Arg?Ser?Ala
290 295 300
Phe?Thr?Trp?Lys?Gly?Leu?Thr?Ser?Leu?Leu?Ser?Ser?Gly?Gln?Lys?Thr
305 310 315 320
Ile?Lys?Gly?Ala?Leu?Ala?Met?Pro?Leu?Met?Ile?Glu?Gly?Tyr?Lys?Lys
325 330 335
Asp?Leu?Ile?Lys?Phe?Ala?Ile?Ile?Thr?Cys?Arg?Lys?Pro?Glu
340 345 350
Claims (3)
1.SEQ the nucleotides sequence shown in the ID NO:3 is listed in the purposes that improves in the plant alpha-tocopherol content.
2. according to the described purposes of claim 1, it is characterized in that, comprising: make up the plant recombination expression vector that contains nucleotide sequence shown in the SEQ ID NO:3; Described plant recombination expression vector is transformed in the plant.
3.SEQ the purposes of the aminoacid sequence shown in the ID NO:4 in improving plant alpha-tocopherol content.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200610001855 CN1807608B (en) | 2006-01-24 | 2006-01-24 | Gama-tocopherol methyl transferase gene, its coding vector and uses |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200610001855 CN1807608B (en) | 2006-01-24 | 2006-01-24 | Gama-tocopherol methyl transferase gene, its coding vector and uses |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1807608A CN1807608A (en) | 2006-07-26 |
| CN1807608B true CN1807608B (en) | 2010-07-07 |
Family
ID=36839703
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 200610001855 Expired - Fee Related CN1807608B (en) | 2006-01-24 | 2006-01-24 | Gama-tocopherol methyl transferase gene, its coding vector and uses |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1807608B (en) |
Families Citing this family (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101514345B (en) * | 2009-02-19 | 2012-07-04 | 上海交通大学 | Lettuce phytol kinase protein coded sequence |
| CN102010874A (en) * | 2010-09-10 | 2011-04-13 | 兰州大学 | Artemisia sphaerocephala gamma-tocopheryl methyl transferase (As-gamma-TMT) gene and application |
| CN103087999B (en) * | 2011-11-03 | 2014-09-03 | 中国农业科学院北京畜牧兽医研究所 | Medicago sativa gamma-tocopherol methyltransferase (MSTMT) gene and its coded protein and use |
| US9747755B2 (en) | 2013-03-04 | 2017-08-29 | Aristocrat Technologies Australia Pty Limited | Method of gaming, a gaming system and a game controller |
| CN106939308B (en) * | 2016-01-04 | 2020-06-30 | 深圳市农科集团有限公司 | Flanking sequence of exogenous insert of transgenic maize event GT1 and application thereof |
| CN107022554B (en) * | 2017-06-09 | 2020-03-13 | 华中农业大学 | Nucleotide sequence for regulating and controlling synthesis of corn tocopherol and application thereof |
| CN108239654A (en) * | 2017-12-31 | 2018-07-03 | 青岛袁策生物科技有限公司 | A kind of method for improving rice grain vitamin content |
| CN113817705B (en) * | 2021-10-27 | 2023-03-24 | 陕西海斯夫生物工程有限公司 | Gamma-tocopherol methyltransferase mutant and application thereof in improving yields of alpha-tocopherol and alpha-tocotrienol |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1472324A (en) * | 2002-08-01 | 2004-02-04 | 中国农业科学院生物技术研究所 | Encoding DNA sequence and amino sequence of sunflower gama tocopherol methyl transferases and use thereof |
| CN1510132A (en) * | 2002-12-24 | 2004-07-07 | 中国科学院微生物研究所 | Gamma-tocopherol tranferase, gene and use thereof |
| WO2004081215A1 (en) * | 2003-03-12 | 2004-09-23 | Universidad de Córdoba | Dna molecule coding for a gamma-tocopherol methyltransferase in maize and applications thereof |
| CN1578835A (en) * | 2001-10-25 | 2005-02-09 | 孟山都技术有限公司 | Aromatic methyltransferases and uses thereof |
-
2006
- 2006-01-24 CN CN 200610001855 patent/CN1807608B/en not_active Expired - Fee Related
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1578835A (en) * | 2001-10-25 | 2005-02-09 | 孟山都技术有限公司 | Aromatic methyltransferases and uses thereof |
| CN1472324A (en) * | 2002-08-01 | 2004-02-04 | 中国农业科学院生物技术研究所 | Encoding DNA sequence and amino sequence of sunflower gama tocopherol methyl transferases and use thereof |
| CN1510132A (en) * | 2002-12-24 | 2004-07-07 | 中国科学院微生物研究所 | Gamma-tocopherol tranferase, gene and use thereof |
| WO2004081215A1 (en) * | 2003-03-12 | 2004-09-23 | Universidad de Córdoba | Dna molecule coding for a gamma-tocopherol methyltransferase in maize and applications thereof |
Non-Patent Citations (1)
| Title |
|---|
| NCBI: ID AY960126.NCBI.2005, * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN1807608A (en) | 2006-07-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN1807608B (en) | Gama-tocopherol methyl transferase gene, its coding vector and uses | |
| US11981905B2 (en) | Polynucleotide sequences and proteins encoded thereby useful for modifying plant characteristics | |
| Falcone Ferreyra et al. | Cloning and characterization of a UV‐B‐inducible maize flavonol synthase | |
| Deng et al. | Molecular cloning, functional analysis of three cinnamyl alcohol dehydrogenase (CAD) genes in the leaves of tea plant, Camellia sinensis | |
| JPH05508774A (en) | Increased starch content in plants | |
| JPH04504800A (en) | Genetic engineering of novel plant phenotypes | |
| CN102234653A (en) | Salt-tolerant and drought-resistant gene TaMYB33 of wheat and coding protein as well as application thereof | |
| JP3444191B2 (en) | Transcription factors that regulate the phenylpropanoid biosynthetic pathway | |
| EP2235051B1 (en) | Glycosyltransferases, polynucleotides encoding these and methods of use | |
| Lee et al. | Cloning and expression of squalene synthase cDNA from hot pepper (Capsicum annuum L.) | |
| CN108047320A (en) | The application of Protein G mMYB12 and encoding gene in isoflavones accumulation and salt tolerance is improved | |
| Germain et al. | Differential expression of two tomato lactate dehydrogenase genes in response to oxygen deficit | |
| CN101265295B (en) | Tocopherol synthesis correlated albumen, coding gene and application thereof | |
| CN115197951B (en) | Tea tree flavonol synthesis candidate gene CsNAC086 and application thereof | |
| WO1997048793A9 (en) | Plant sterol reductases and uses thereof | |
| Jeleńska et al. | Mitotic B-type cyclins are differentially regulated by phytohormones and during yellow lupine nodule development | |
| JP4189636B2 (en) | Plants with increased amino acid content, plants with increased nitrogen content, plants with deregulated growth under nitrogen limitation, and methods for producing them | |
| KR100411702B1 (en) | Transgenic Plants and Plant Cells with Improved Growth Rate and Related Methods | |
| CZ289646B6 (en) | Antimicrobial proteins, recombinant DNAs encoding thereof, antimicrobial preparation containing thereof and method of fighting fungi or bacteria | |
| CN106480077A (en) | Millet alpha amylase and its encoding gene and application | |
| CN102286491A (en) | Rice root growth control gene OsZRL | |
| CN101892212B (en) | Tomato phosphoenolpyruvate carboxykinase as well as coding gene and application thereof | |
| JP2008220304A (en) | Membrane-bound prenyltransferase | |
| JP5164093B2 (en) | Method for increasing resistance of rice to pathogens and pathogen-resistant rice transformants | |
| CN101323854B (en) | Rice RDB1 drought resistant gene |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20100707 Termination date: 20220124 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |