CN1719973A - Compositions and methods for cancer diagnosis and therapy - Google Patents

Abstract

The miR15 and miR16 micro RNA genes are located at 13q14 within a 30 kb region of loss characteristic of cells from certain cancers, such as cells from chronic lymphocytic leukemia or prostate cancer. Chronic lymphocytic leukemia or prostate cancer can be diagnosed by detecting a reduction in miR15 or miR16 gene copy number, by determining miR15 or miR16 gene mutational status, or by detecting a reduction in the RNA transcribed from these genes. The miR15 or miR16 gene products can inhibit the neoplastic or tumorigenic growth of cancers such as chronic lymphocytic leukemia or prostate cancer cells when administered to subjects suffering from these diseases.

Description

The composition and the method that are used for cancer diagnosis and treatment

Governmental approval

The present invention partly is subjected to the support of National Cancer Institute, and license number is P01CA76259, P01CA81534, and P30CA56036.U.S. government has certain right for the present invention.

Invention field

The present invention relates to the diagnosis of cancer, particularly copy number by detecting miR15 and miR16, the sudden change situation, or gene expression comes diagnosing chronic lymphatic leukemia or prostate cancer.The invention still further relates to treatment for cancer, comprise the minimizing or the disappearance of miR15 or miR16 gene expression, particularly by using miR15 or miR16 gene outcome treatment chronic lymphatic leukemia or prostate cancer.

Background of invention

In the U.S. and whole world cancer all is a major reason dead and morbidity.Particularly chronic lymphatic leukemia (" CLL ") and prostate cancer are important adult's neoplastic disease clinically.CLL is that the Western countries is the most general a kind of one-tenth human leukemia form.And in the man of the U.S., the ageadjustment incidence of disease of prostate cancer has surpassed all other cancers at present, is only second to lung cancer, is the second largest reason of all male cancer death of this country.

The semizygote that 13q14 all can take place in the report CLL case more than half loses and/or homozygote is lost, and this has constituted chromosome abnormality the most frequent among the CLL.The caryotype of CLL patient's tissue sample has less chromosome abnormality relatively, and this specificity and frequency that shows viewed 13q14 disappearance has pathology importance.In addition, also have the 13q14 disappearance in 60% the prostate cancer, show that the pathogenesis of CLL and prostate cancer relates to one or more tumor suppressor genes that are positioned at 13q14.

Exist clone's property to isozygoty and the heterozygosity disappearance in CLL and the prostate cancer simultaneously, and very high 13q4 loses frequency, show that the disappearance in this zone is relevant with the cause of disease of particular cancers type.Several genes are carried out the position clone to differentiate the gene at disappearance position.So far eight genes have been differentiated altogether from the disappearance zone of the 13q14 of sudden CLL and inheritance CLL, and detected the change of its DNA and/or rna level: Leu1 (BCMS or EST70/Leu1), Leu2 (ALT1 or 1B4/Leu2), Leu5 (CAR), CLLD6, KPNA3, CLLD7, LOC51131 (the zinc finger protein NY-REN-34 antigen of supposition) and CLLD8.But detailed gene analysis comprises large-scale loss of heterozygosity (LOH), suddenlys change and expression study, but fails to prove the relation of any of these gene and carcinogenesis.

MicroRNA (miRNA) is present in and surpasses in 100 kinds of different organisms, comprises fruit bat, nematode and people.Think all to relate to miRNA in multiple growth adjustment process in these organisms, the miRNA processing of the feedback RNA front body structure by 60 to 70 nucleotide typically obtains, and this feedback RNA front body structure is by the miRNA genetic transcription.The miRNA product of RNA precursor or processing is easy to detect, and lacks these molecules and shows that the disappearance of corresponding miRNA gene or function lose.

The treatment of CLL at present typically comprises chemotherapy, uses separately or with carrying out from body homology bone-marrow transplantation.Employed chemotherapeutant has toxicity to the patient usually, all just reaches the effect that part is alleviated in most of patient.The therapy of prostate cancer and other treatment of cancer also comprises chemotherapy, normally after surgery operating removing tumor.But for CLL, the treatment of chemotherapeutant (carry out or therewith do not carry out with operation) is restricted.

Prostate cancer can also be to use separately or use with operation with outside radiation exposure or brachytherapy (for example using " seed " with radioactivity) treatment also.The danger of this treatment is that the normal structure with the patient is exposed among the radioactive ray, and may not be in full force and effect.

CLL or prostate cancer need fast, economic and accurate diagnostic assays.Also need economical and effectively and the patient is not had treatment, particularly CLL or a prostate cancer of significant negative effect for cancer.

The invention summary

Have now found that in the people miR15 or miR16 gene are positioned at 13q14, and the 13q14 zone lacks all in a big chunk CLL or patients with prostate cancer.Find that also the RNA product of miR15 or miR16 gene suppresses the excrescence or the tumor growth of CLL and prostate gland cancer cell.These RNA products can be used for treatment of cancer, and miR15 or miR16 gene are carried out negative regulation.

MiR15 and miR16 microRNA gene are positioned at 13q14, and in the 30kb zone that CLL and prostate cancer are lost, these two genes all lack or be subjected to negative regulation in most of CLL and prostate cancer.Therefore, the invention provides the diagnostic assays of a kind of CLL or prostate cancer, comprise the gene outcome that detects these genes, detect the copy number of miR15 or miR16 gene, or measure its sudden change situation.

In one embodiment, described diagnosis detects and comprises from suspection suffering from isolation of RNA the patient of CLL or prostate cancer, probe with miR15 or miR16 precursor or the miRNA that handled detects miR15 or miR16 gene outcome with Northern blot hybridization, and wherein miR15 or miR16 precursor or the miRNA that handled and normal specimens contrast and compare to some extent that minimizing then is diagnosed as CLL or prostate cancer.

In another embodiment, described diagnosis detects and comprises from suspection suffering from for example DNA isolation the patient of CLL or prostate cancer of miR15 or miR16 cancers mediated, probe with miR15 or miR16 gene order detects miR15 or miR16 gene copy number with Southern blot hybridization, and wherein gene copy number reduces to 1 or 0 and is diagnosed as CLL or prostate cancer.

In another embodiment, described diagnosis detects and comprises the minimizing that detects miR15 or miR16 gene copy number by the loss of heterozygosity of estimating D13S273 and D13S272 mark, wherein has the loss of heterozygosity of these marks to be diagnosed as CLL or prostate cancer.

In another embodiment, described diagnosis detects and comprises from suspection suffering from DNA isolation the patient of CLL or prostate cancer, detect the disappearance of miR15 or miR16 gene or sudden change and this amplified fragments is compared with the amplified fragments that normal specimens contrasts with pcr amplification miR15 or miR16 genetic fragment, wherein in one or more copies of miR15 or miR16 gene, detect sudden change and then be diagnosed as CLL or prostate cancer.Can compare amplified fragments with the single-strand conformation polymorphism method.On the one hand, the described excalation that sports miR15 or miR16 gene order.

In another embodiment, described diagnosis detects and comprises from suspection suffering from isolation of RNA the patient of CLL or prostate cancer, and the sudden change that detects miR15 or miR16 gene outcome then is diagnosed as CLL or prostate cancer.

In another embodiment, described diagnosis detects and comprises from suspection suffering from isolation of RNA the patient of CLL or prostate cancer, thereby detect the level of miR15 or miR16 gene outcome with revertase-polymerase chain reaction (PCR) amplification miR15 or miR16 precursor or the miRNA that handled, wherein miR15 or miR16 precursor or the miRNA that handled compare with the cloning RNA of internal reference to some extent that minimizing then is diagnosed as CLL or prostate cancer.

The present invention also provides a kind of method for the treatment of miR15 or miR16 cancers mediated in the patient of needs treatment, comprises that miR15 or the miR16 gene outcome with effective dose gives the patient, and the propagation of cancer cell is suppressed thus.

The present invention also provide a kind of in the patient of needs treatments the method for treatment miR15 or miR16 cancers mediated, wherein separate patient's cell and under isolated condition with the encode nucleic acid transfection of sequence of miR15 or miR16 gene outcome of containing of effective dose.Then these cells are implanted in patient's body again, the propagation of patient's cancer cell is suppressed thus.

The present invention further provides a kind of method that in the patient, suppresses the propagation of miR15 or miR16 cancers mediated, comprised the miR15 or the miR16 gene outcome of sending effective dose to cell.

The pharmaceutical composition that the present invention further also provides a kind of treatment to suffer from the patient of miR15 or miR16 cancers mediated comprises the miR15 or the miR16 gene outcome of separation, or the nucleic acid of encode miR15 or miR16 gene outcome, and the receivable carrier of pharmacy.

The accompanying drawing summary

Figure 1A and Figure 1B are respectively the miR15 of prediction and the schematic diagram of the secondary structure of miR16 precursor RNA.With " mfold " program, 3.1 editions, Matthews et al. (1999), J.Mol.Biol.288:911-940 carries out the RNA secondary structure prediction, and is manually modified so that to comprise the G/U wobble base in the helical segments right.The miR15 and the miR16miRNA that handle represent with underscore.According to Lagos-Quintana et al. (2001), Science294:853-858 revises.

Fig. 2 A is the genome in the sub-site of 13q14 tumor suppression among the CLL, demonstrates the location of miR15/16 gene cluster.Wherein shown genetic marker and the gene position on collection of illustrative plates.

Fig. 2 B is the 13q14 disappearance collection of illustrative plates of having reported, with horizontal bar collimation mark note.

Fig. 2 C is the site collection of illustrative plates between D13S1150 and the D13S272 mark.Direction at each gene on this site all marks with arrow below the gene title, and colored vertical bar is represented the position of the corresponding exon of each gene.

Fig. 2 D is the site collection of illustrative plates between Alu 18 and the D13S272 mark.Bar and frame table show the position of LEU2/ALT1 and LEU1 exon.Short vertical arrows is represented the position of miR15 or miR16 gene.Round dot represents to be used for screening derived from two kinds of positions of the somatic hybridization clone's of leukaemia's (CLL-A and CLL-B) fusion cell PCR primer independently.The filling frame table shows the part of the chromosome 13 in the crossbred.The 31.4kb of " ←～→ " be illustrated in from suffering from and have t (2; 13) (q12; Q13) Yi Wei CLL, both sides cancer eye, the disappearance zone of about 31.4kb among the patient's of ulcerative colitis the clone CLL-A.Long vertical arrows represents to have t (2; 13) (q32; Q14) breakpoint location of Yi Wei clone CLL-B, " ←～29kb → " represents among this clone the approximately disappearance zone of 29kb.

Fig. 3 A is normal person's kidney, prostate, and liver, skeletal muscle (" Sk flesh "), testis, the Northern blot of miR15 and miR16 gene expression analyzes in the CD5+B cell (CD5+), leukaemia (" Per Bl Leuk ") and marrow (" BM ").

Fig. 3 B is that the heterozygosis of microsatellite marker D13S272 and D13S273 is lost (" LOH ") and analyzed in 18 CLL patients.Use in contrast from the DNA of normal person CD5+ cell.The LOH state of sample is with "+/+heterozygosis ", "+/-LOH ", "/-homozygous deletion ", " NI " (meaningless), "? " (not having enough materials) and " ND " (not implementing).Northern gel with ethidium bromide staining contrasts as normalization.

Detailed Description Of The Invention

All nucleotide sequences that this paper provides all are 5 ' to 3 ' directions. In addition, nucleic acid order All deoxyribonucleotides in the row all represent (for example, deoxidation thymus gland with capitalization Pyrimidine is " T "), the ribonucleotide in the nucleotide sequence (for example represents with lowercase Uracil is " u ").

CLL or prostate cancer can be by detecting miR15 or miR16 gene copy number Minimizing, perhaps by detecting one or more copies of miR15 or miR16 gene Sudden change diagnose. MiR15 or miR16 gene copy number are reduced to single times from double, Perhaps reduce to not copy, then be diagnosed as CLL or prostate cancer. Similarly, miR15 Or the sudden change of one or more copies of miR16 gene represents losing of gene function, then Be diagnosed as CLL or prostate cancer.

Here used " CLL cell " is from suffering from or suspecting the trouble of suffering from CLL Person's lymphocyte, wherein lymphocytic " CLL mark " is at least 4, and this is root According to Matutes et al. (1994), Leukemia 8 (10): the described scoring of 1640-1645 System determines, is incorporated herein it in full as a reference. Here used " prostate cancer Cell " be prostatic neoplasm or the tumour cell that derives from, no matter whether it is positioned at In the prostate. Those skilled in the art can differentiate easily that CLL or prostate cancer are thin Born of the same parents.

The position of miR15/miR16 gene cluster is at 13q14. The nucleotide sequence of these genes Be included among the clone 317g11, the GenBank recording mechanism of its nucleotide sequence is AC069475. Be incorporated herein the full content of this record as a reference. Can be by surveying The fixed structure of suspecting these genes in the patient tissue of suffering from CLL or prostate cancer or Sequence, and in the unaffected tissue sample with itself and this patient, or Normal group Structure or the sequence of these genes in the sample of knitting compare, thereby detect miR15 Or the disappearance of miR16 gene or sudden change. Can carry out this ratio with any suitable method .

According to the present invention, diagnose the cancer of miR15 or miR16 mediation, be from the patient In obtain tissue sample. Prepare then sample and measure miR15 or miR16 gene product The disappearance of the expression of thing or miR15 or miR16 gene or sudden change. Tissue sample comprises Interested living tissue, and blood and humoral sample.

Here said " cancer of miR15 or miR16 mediation " refers at least one section Divide miR15 or miR16 base in the tumour cell relevant with this cancer or the neoplasm cell Because of any cancer that reduces or lack. The example bag of the cancer of miR15 or miR16 mediation Draw together CLL and prostate cancer.

The existence of miR15 or miR16 disappearance or sudden change can be passed through patient's genome The Southern blot of DNA hybridizes to detect, use miR15 or miR16 gene Probe, for example as described below. In addition, can suffer from CLL or prostate from suspection Obtain blood sample among the patient of cancer, separate leucocyte and carry out the DNA extraction. Preferred blood Liquid or tissue sample are not obtain from also begin radiotherapy or chemotherapeutic patient . Corresponding tissue in contrast or blood sample can be from this patient's the shadows that is not subjected to In the tissue that rings, perhaps from normal individual human, obtain.

Southern blot hybridization technique is well known to a person skilled in the art. For example will from Suspect the genome that separates in the patient's suffer from CLL or prostate cancer tissue or the blood The DNA digestion with restriction enzyme. Digestion produces the restriction fragment of genomic DNA, Can use electrophoresis, for example agarose electrophoresis is separated. Then the restriction fragment point sample is being mixed Hand on the film (for example celluloid or nylon), and with miR15 or miR16 gene Special label probe is hybridized. Carried out existing together mutually with this patient's DNA sample The contrast DNA sample of reason is compared, and the change of restricted clip types represents on the hybond membrane Disappearance or sudden change take place in these genes. Those of ordinary skills can easily determine Be suitable for detecting the probe mark of miR15 or miR16 gene copy number or sudden change and mixing The friendship condition. Terminology used here " disappearance " refers to the excalation of gene or all basic Because of disappearance.

The miR15 and the miR16 nucleic acid probe that are used for Southern blot hybridization can bases The sequence of disclosed miR15 and miR16 microRNA Lagos-Quintana et Al. (2001), the design of the described method of Science 294:853-858 is incorporated herein that it is complete Literary composition as a reference. The nucleotide sequence of miR15 microRNA is Uagcagcacauaaugguuugug (SEQ ID NO:3). The miR16 microRNA Nucleotide sequence is uagcagcacguaaauauuggcg (SEQ ID NO:4). Detect The proper probes of miR15 and miR16 DNA is respectively:

CACAAACCATTATGTGCTTGCTA(SEQ ID NO：5)

GCCAATATTTACGTGCTGCTA(SEQ ID NO：6)

The complementary series of SEQ ID NO:5 and SEQ ID NO:6 also can be used as The probe of miR15 and miR16 DNA.

The DNA of preparation mark and the method for rna probe, and with the condition such as the Molecular Cloning:A Laboratory Manual of target nucleotide sequences hybridization, J.Sambrook et al., eds., 2nd edition, Cold Spring Harbor LaboratoryPress, 1989, Chapters 10 and 11 are described, are hereby incorporated by.

For example, nucleic acid probe can with radionuclide for example as ³H, ³²P, ³³P, ¹⁴C or ³⁵S; Heavy metal; The perhaps part that can combine (for example vitamin h, avidin or antibody) with the ligand specificity of mark, fluorescence molecule, chemiluminescent molecule, materials such as enzyme carry out mark.

Can use Rigby et al. (1977), described nick-translation of J.Mol.Biol.113:237-251 or Fienberg et al. (1983), the described random priming of Anal.Biochem.132:6-13 obtains the label probe of high specific acitivity, is incorporated herein it in full as a reference.The latter then is from single stranded DNA or the synthetic high specific acitivity of RNA template ³²The method of the probe of P mark.For example, according to nick-translation, surpass 10 by replacing already present nucleotide with nucleotide, can be prepared into to have with high radioactivity ⁸The specific activity of cpm/mg ³²The nucleic acid probe of P mark.Then hybond membrane is exposed on film, carry out autoradiograph and detect.Film to the hybond membrane exposure carries out densitometric scan, obtains the accurate measurement result of miR15 or miR16 gene copy number.And miR15 or miR16 gene copy number can also use the calculator imaging system, AmershamBiosciences for example, and Piscataway, the Molecular Dynamics 400-B 2DPhosphorimager of NJ carries out quantitative analysis.

If can't carry out mark to DNA or rna probe, can use random priming that dTTP analog 5-(the amino pi-allyl of N-(N-biotinyl--aminocaproic acid base)-3-) Brdurd triphosphate is incorporated in the probe molecule with radionuclide.Biotinylated probe oligonucleotides can by with maybe can produce the coupled vitamin h of the enzyme of color reaction with fluorescent staining and combine albumen such as avidin, streptavidin, or anti-biotin antibodies is reacted and detected.

The disappearance of miR15 or miR16 gene or sudden change can also be by the fragments of these genes that increase with polymerase chain reaction (PCR) (PCR), the fragment that increases with order-checking or electrophoretic analysis with the sequence of the amplified fragments of definite patient DNA sample and/or length whether with contrast different detection of DNA sample.Those of ordinary skills can easily determine the suitable reactions and the cycling condition of the pcr amplification of dna fragmentation.The method of using among the embodiment as described below has provided typical PCR reaction and cycling condition.

The diagnosis of miR15 or miR16 cancers mediated can be by detecting the coloured differently body tag, Figure 1A for example, and 1B, and the disappearance of 13q14 is carried out between each mark shown in the 2A-2D.For example, the disappearance in the 13q14 zone between microsatellite marker D13S272 that contains miR15 or miR16 and D13S273 shows and has miR15 or miR16 cancers mediated.In addition, if the disappearance of 13q14 is between microsatellite marker D13S1150 and the D13S273 or between Alu18 site and microsatellite marker D13S273, wherein miR15 or miR16 disappearance then shows to have miR15 or miR16 cancers mediated.

Another determines that the miR15 of each diploid gene group in the tissue sample or the method for miR16 number gene are based on the fact that the miR15/miR16 gene cluster is positioned at 13q14 and links to each other with D13S273 with mark D13S272.MiR15 or losing of miR16 gene copy at the individuality of the site heterozygosis that links to each other with the D13S273 mark with D13S272 can be known by inference from losing of these mark heterozygosis.Determine that the method that the marker of chromosome heterozygosis is lost is well known to a person skilled in the art.Provide heterozygosis among the following embodiment 3 and lost the example of research.

The another kind of method of determining to suspect whether miR15 among the patient who suffers from CLL or prostate cancer or miR16 gene suddenly change is single stranded conformational polypeptide (SSCP), Orita et al. (1989) for example, Genomics 5:874-879 and Hayashi (1991), described in the PCRMethods and Applic.1:34-38, be incorporated herein it in full as a reference.The SSCP method comprises by the interested genetic fragment of pcr amplification, makes the fragment sex change and carry out electrophoresis with two sex change strands under non-sex change condition.Strand presents secondary structure in the complicated sequence-dependent chain, influences the electrophoretic mobility of chain.

One or whole disappearance or sudden change also can cause the minimizing of miR15 or miR16 gene expression in miR15 or the miR16 gene.Therefore, CLL or prostate cancer can also be diagnosed by the expression that detects the RNA that miR15 or miR16 gene produce, and the minimizing of miR15 or miR16 gene expression then is diagnosed as CLL or prostate cancer.

Each all transcribes the precursor RNA of generation～70kb miR15 and miR16 gene, forms loop-stem structure.Precursor RNA is not translated into protein, but further is treated as " microRNA " or " miRNA ", thinks that this is only the gene outcome of function.

Here said " miR15 or miR16 gene outcome " is meant by miR15 and miR16 gene and processing or the untreated rna transcription thing that comes will further specify below.Term " RNA ", " rna transcription thing " and " gene outcome " are used interchangeably when addressing miR15 or miR16 gene expression in this article.

MiR15 and miR16 precursor RNA such as Lagos-Quintana et al. (2001), Science 294, and 853-858 is described, is incorporated herein it in full as a reference.The sequence of miR15 and miR16 precursor RNA is shown in SEQ ID NO:1 and SEQ ID NO:2.The SEQ ID NO:1 of prediction and the loop-stem structure of SEQ ID NO:2 are respectively shown in Figure 1A and Figure 1B.

[SEQ?ID?NO：1]：

ccuuggaguaaaguagcagcacauaaugguuuguggauuuugaaaaggugcaggccauauugugcugccucaaaaauacaagg

[SEQ?ID?NO：2]：

gucagcagugccuuagcagcacguaaauauuggcguuaagauucuaaaauuaucuccaguauuaacugug?cugcugaagu?aagguugac

Be not subjected to the restriction of any theory, think that miR15 and miR16 precursor RNA by miR15/miR16 gene cluster coexpression, are treated as functional miRNA product by the Dicer/Argonaute complex.Referring to, Lee et al. (2001) for example, Science 294:862.Two functional miRNA products that these genes produce all are that length is the single stranded RNA molecule of 22 nucleotide, and 5 ' end has monophosphate, and 3 ' end has hydroxyl.The nucleotide sequence of the miR15 microRNA of handling is uagcagcacauaaugguuugug (SEQ ID NO:3).The nucleotide sequence of the miR16 microRNA of handling is uagcagcacguaaauauuggcg (SEQ ID NO:4).In the present invention, can detect the RNA precursor molecule of the 60-70nt that produces by miR15 or miR16 gene.Can also detect short miR15 and the miR16 microRNA gene outcome of precursor RNA being handled generation by Dicer and Argonaute albumen in addition.

The method of determining the rna expression level is well known to a person skilled in the art.For example, suffer from from suspection as mentioned above and obtain tissue or blood sample the patient of CLL or prostate cancer.As mentioned above from patient's unaffected tissue, or from normal person's individuality, obtain corresponding tissue or blood sample in contrast.Control tissue or blood sample and patient's sample is together handled.Then with the comparing of unaffected tissue among miR15 among the patient or miR16 expression of gene level and the patient, perhaps compare with the tissue of normal control or the miR15 in the blood or miR16 expression.For example, relative miR15 in CLL cell or the sample prostate gland cancer cell or miR16 expression can easily be determined with respect to one or more standards.These standards comprise that for example, a kind of is that expression is zero, and another kind is the gene expression dose of same patient's normal structure, or the expression in the normal control group tissue.Described standard can also comprise miR15 or the miR16 expression in the standard cell lines system.MiR15 or miR16 express the scale of comparing minimizing with the normal expression level and show the clinical effectiveness that will have after the treatment.

In addition, miR15 or the miR16 gene expression dose that suspection can also be suffered among the patient of CLL or prostate cancer compared with the previous normal control crowd's who obtains the miR15 or the average level of miR16 gene expression.

The proper method of determining the rna transcription thing level of specific gene in the cell is well known to a person skilled in the art.According to a kind of method wherein.Carry out homogenate with the nucleic acid extraction buffer solution and from cell, extract total cell RNA, centrifugal then.Make the nucleic acid precipitation, remove DNA with processing of DNA enzyme and precipitation.According to standard method agarose gel electrophoresis isolation of RNA molecule, transfer on the nitrocellulose filter then with for example so-called " Northern " blotting technology.By heating RNA is fixed on the film then.With DNA with suitable mark or rna probe specific RNA is detected with quantitative with described RNA complementation.Referring to, for example, Molecular Cloning:A LaboratoryManual, J.Sambrook et al., eds., 2nd edition, Cold Spring HarborLaboratory Press, 1989, Chapter 7, are incorporated herein it in full as a reference.The suitable probe that is used for the Northern blot hybridization of miR15 or miR16 RNA comprises SEQ ID NO:5 and SEQ ID NO:6.

The hybond membrane exposure on film, is carried out autoradiograph to the probe with miR15 or miR16 RNA hybridization and detected.Film to the hybond membrane exposure carries out accurately measure R NA transcriptional level of densitometric scan.In addition, can also carry out quantitative analysis to the rna transcription level, for example use AmershamBiosciences, Piscataway, the Molecular Dynamics 400-B 2DPhosphorimager of NJ by the computer generated image of results of hybridization.

Except Northern and other RNA blotting hybridization technique, can also detect the rna transcription level with hybridization in situ technique.This technology is lacked than the cell of Northern blotting Technology Need, comprises full cell deposition on microscopical cover plate, detects the nucleic acid content of cell with the solution of cDNA that contains radioactive label or other mark or cRNA probe.This technology is specially adapted to analyze the biological living tissue sample of suffering from the patient of prostate cancer from suspection.The method of operating such as the United States Patent (USP) sequence number 5,427,916 of more detailed in situ hybridization are described, are incorporated herein it in full as a reference.The probe that is applicable to the in situ hybridization of miR15 or miR16 RNA comprises SEQ ID NO:5 and SEQ IDNO:6.

The relative number of miR15 or miR16 transcript can also carry out polymerase chain reaction (PCR) amplification (RT-PCR) and measure then by the reverse transcription of miR15 or miR16 transcript.MiR15 or miR16 transcript level can be compared quantitatively with interior mark, for example, and the mRNA level of the gene of " running one's home " in the same sample.Suitable " running one's home " gene of target comprises myosin or glyceraldehyde-3-phosphate dehydrogenase (G3PDH) in can be used as.The method and other method that are applicable to quantitative RT-PCR are known to a person of ordinary skill in the art.

Measure other method that miR15 and miR16 express and also well known to a person skilled in the art, comprise that various measure R NA transcribe the method with degradation speed.

Can be with the miR15 or the miR16 gene outcome of separating, independent or combination gives miR15 or miR16 cancers mediated cell, thus treatment miR15 or miR16 cancers mediated.Do not wish to be subjected to the restriction of any theory, think that miR15 or miR16 gene outcome can suppress the excrescence or the tumor growth of these cancer cells.

Particularly, can treat CLL or prostate cancer with the miR15 that separates or miR16 gene outcome separately or combination gives CLL or prostate gland cancer cell.

Here said " miR15 or miR16 cancers mediated cell " is meant separation obtains from the patient who suffers from miR15 or miR16 cancers mediated tumour or excrescence cell.MiR15 or miR16 cancers mediated cell can perhaps be discerned by the cancer or the excrescence phenotype that detect in the cell by the minimizing or the disappearance of miR15 or miR16 gene outcome in the detection cell.Those skilled in the art can easily discern the cell with cancer or excrescence phenotype.For example, the growth inhibition that cells in culture is induced for contact is insensitive, flocks together when continuing to cultivate.Cancer or excrescence cell also show distinctive morphological change, cell colony inorganization growth and adherent growth not.Cancer or excrescence cell also have in susceptible animal the ability that forms the invasive tumour, and this can be with the technology of this area by estimating injection cell in athymic mouse.

Here said " separation " gene outcome is by the feasible gene outcome different with its nature or that separate from its nature of artificial intervention.For example, the natural RNA that is present in the animal alive is not " separation ".Synthetic RNA, perhaps the RNA that partly or entirely separates from the concurrent of its nature is " separation ".The RNA that separates can be pure basically form exist, also may reside in RNA and be delivered in wherein the cell.Therefore, be delivered in the cell, perhaps at cell, for example miR15 that expresses in CLL or the prostate gland cancer cell or miR16 gene outcome are thought " separation " gene outcome.

Can obtain miR15 or miR16 gene outcome with the multiple standards method.For example, gene outcome can chemosynthesis or is produced with method reorganization well known in the art.Preferably, the described RNA product ribonucleotide phosphoramidite and the chemosynthesis of traditional DNA/RNA synthesizer of due care.The supplier of synthetic RNA molecule or synthetic agent comprise Proligo (Hamburg, Germany), Dharmacon Research (Lafayette, CO, USA), Pierce Chemical (part of Perbio Science, Rockford, IL, USA), Glen Research (Sterling, VA, USA), ChemGenes (Ashland, MA, USA) and Cruachem (Glasgow, UK).

In addition, miR15 and miR16 gene outcome can be with any suitable promotor with reorganization annular or linear DNA plasmid expressions.Be used for comprising U6 or H1 RNA pol III promoter sequence in the suitable promotor of plasmid expressed rna, or cytomegalovirus promoter.Those skilled in the art know how to select other suitable promotor.Recombinant plasmid of the present invention can also comprise induction type or adjustment type promotor, in order at CLL, and prostate cancer, or express miR15 and miR16 gene outcome in other cell.

The miR15 of expression of recombinant plasmid and miR16 gene outcome can be separated from the cultured cells expression system with standard method.The miR15 of expression of recombinant plasmid and miR16 gene outcome can also be delivered in CLL or the prostate gland cancer cell or directly express therein.With recombinant plasmid miR15 and miR16 gene outcome are delivered in CLL or the prostate gland cancer cell and will go through below.

MiR15 and miR16 gene outcome can be expressed in independent recombinant plasmid respectively, perhaps also can express in same recombinant plasmid.Preferably, miR15 and miR16 gene outcome are expressed as the RNA precursor molecule in single plasmid, with suitable treatment system precursor molecule are treated as functional miRNA molecule then.Suitable treatment system comprises external drosophila cell dissolution fluid system, openly applies for described in 2002/0086356 as U.S. of Tuschl etc., is incorporated herein it in full as a reference.

Be suitable for expressing the selection of the plasmid of miR15 and miR16 gene outcome, in plasmid, insert the method for nucleotide sequence and expressing gene product, and the method that recombinant plasmid is delivered in the cells of interest well known to a person skilled in the art all.Referring to, Zenget al. (2002) for example, Molecular Cell 9:1327-1333; Tuschl (2002), Nat.Biotechnol, 20:446-448; Brummelkamp et al. (2002), Science 296:550-553; Miyagishi et al. (2002), Nat.Biotechnol.20:497-500; Paddison et al. (2002), Genes Dev.16:948-958; Lee et al. (2002), Nat.Biotechnol.20:500-505; With Paul et al. (2002), Nat.Biotechnol.20:505-508, be incorporated herein it in full as a reference.

In preferred embodiments, the plasmid that is used for expressing miR15 or miR16 gene outcome comprises the coding miR15 that is under the control of CMV early promoter or the sequence of miR16 precursor RNA.Described here " being under the promotor control " presentation code miRNA product nucleotide sequence be positioned at 3 ' end of this promotor, make transcribing that this promotor can initial miRNA product coded sequence.

MiR15 or miR16 gene outcome can also be expressed with recombinant viral vector.MiR15 and miR16 gene outcome can be expressed with two independent recombinant viral vectors, perhaps can express with same viral vectors.The RNA that recombinant viral vector is expressed can separate from the cultured cells expression system with standard method.Perhaps can directly in CLL or prostate gland cancer cell, express.Use recombinant viral vector that miR15 or miR16 gene outcome are delivered in CLL or the prostate gland cancer cell and will go through below.

Recombinant viral vector of the present invention comprises the sequence of coding miR15 and miR16 gene outcome and is used for any suitable promotor of expressed rna sequence.Suitable promotor comprises, for example U6 or H1 RNA pol III promoter sequence, or cytomegalovirus promoter.Those skilled in the art know how to select other suitable promotor.Recombinant plasmid of the present invention can also comprise induction type or adjustment type promotor, in order to express miR15 and miR16 gene outcome in CLL or prostate gland cancer cell.

Can use any viral vectors of the coded sequence that can accept miR15 and miR16 gene outcome; For example, from adenovirus (AV); Adeno-associated virus (AAV); Retrovirus (for example slow virus (LV), rhabdovirus, murine leukemia poison); The carrier of herpes virus etc.Thereby can also modify the taxis that carrier changes viral vectors with other surface protein of coating protein or other virus.For example, can use vesicular stomatitis virus (VSV), rabies virus, Ebola virus, mokola viruses etc. are modified AAV carrier of the present invention.Be applicable to the selection of recombinant viral vector of the present invention, in carrier, insert the method for nucleotide sequence and expressing gene product, and the method that viral vectors is delivered in the cells of interest well known to a person skilled in the art all.Referring to, for example, Dornburg (1995), Gene Therap.2:301-310; Eglitis (1988), Biotechniques 6:608-614; Miller (1990), Hum.Gene Therap.1:5-14; And Anderson (1998), Nature 392:25-30 is incorporated herein it in full as a reference.

Preferred viral vectors is the carrier that comes from AV and AAV.Be applicable to the AV carrier of expressing miRNA of the present invention, make up the method for reorganization AV carrier and carrier is delivered to method in the target cell, at Xia et al. (2002), description is arranged among the Nat.Biotech.20:1006-1010, be incorporated herein it in full as a reference.Be suitable for expressing the AAV carrier of miRNA of the present invention, make up the method for reorganization AAV carrier and carrier is delivered to method in the target cell, at Samulski et al. (1987), J.Virol.61:3096-3101; Fisher et al. (1996), J.Viral., 70:520-532; Samulski etal. (1989), J.Virol.63:3822-3826; United States Patent (USP) sequence number 5,252,479; United States Patent (USP) sequence number 5,139,941; International Patent Application WO 94/13788; With International Patent Application WO 93/24641, be incorporated herein it in full as a reference.Preferably, miR15 and the miR16 gene outcome single reorganization AAV vector expression that contains early promoter among the CMV.

In one embodiment, reorganization AAV viral vectors of the present invention comprises the nucleotide sequence of coding miR15 or miR16 precursor RNA, operationally links to each other with the polyT terminator sequence, and is under the control of people U6 RNA promotor.The nucleotide sequence that is meant coding sense strand or antisense strand " operationally linking to each other with the polyT terminator sequence " described here is in 5 ' direction next-door neighbour polyT termination signal.In the process that miR15 or miR16 sequence are transcribed in carrier, the polyT termination signal is used for stopping transcribing.

In the present invention, miR15 or miR16 gene outcome are used to suppress miR15 or the cancer cell, particularly CLL of miR16 mediation or the excrescence or the tumor growth of prostate gland cancer cell.Do not wish to be subjected to the restriction of any theory, think that the miR15 and the miR16 miRNA that handled combine with complementary series initial and/or that keep in excrescence or the necessary one or more said target mrnas of growth of tumour cell in these cells.Therefore, the invention provides a kind of miR15 or miR16 cancers mediated, for example method of CLL or prostate cancer of in the patient of this treatment of needs, treating.Described method comprises miR15 or the miR16 gene outcome that gives patient's effective dose, makes the propagation of the cancer cell that miR15 or miR16 mediate be suppressed.

As mentioned above, miR15 or miR16 cancers mediated be meant wherein with at least a portion of the tumour of this disease association or excrescence cell in miR15 or the miR16 gene any one or the both reduces or the cancer of disappearance.MiR15 or miR16 expression of gene reduce or disappearance in the tumour of CLL or prostate cancer or excrescence cell; Therefore, CLL and prostate cancer are considered to miR15 or miR16 cancers mediated.In other cancer, also find the minimizing or the disappearance of miR15 or miR16 gene expression; These cancers also are considered to be miR15 or miR16 cancers mediated.

For example, miR15 or miR16 gene expression reduces or disappearance: sarcoma (connective tissue of mesexine and other tissue cancers) in the elementary or metastatic tumo(u)r of the cancer of following tissue typing or excrescence cell at least; Melanoma (coming from the cancer of melanocyte); Cancer (epithelium cancer); Gland cancer (galandular epithelium cancer); Nervous system cancer (glioma/spongioblastoma and astrocytoma); And blood tumor, for example leukemia and lymphoma (for example, acute lymphoblastic leukemia and chronic myelogenous leukemia).

MiR15 or miR16 gene expression also reduce or lack in the cancer that derives from following at least organ or tissue, no matter its tissue typing how: mammary gland; Masculinity and femininity urogenital tissue (for example ureter, bladder, prostate, testis, ovary, uterine cervix, uterus, vagina); Lung; Gastronintestinal system tissue (for example, stomach, large intestine and small intestine, colon, rectum); Exocrine gland is pancreas and suprarenal gland for example; Oral cavity and esophageal tissue; Brain and spinal cord; Kidney (kidney); Pancreas; Liver and gall (for example, liver, gall-bladder); Lymphatic system; Smooth muscle and striated muscle; Bone and marrow; Skin and part tissue of eye.

Also reduce or lack in the pre-after-stage miR15 of cancer or tumour or miR16 gene expression, for example available " Overall Stage Groupings " (being also referred to as " RomanNumeral ") or " Tumor; Nodes, and Metastases " be systematic survey by stages (TNM).For the prognosis that is fit to of given cancer by stages system and by stages description be well known in the art, for example at National Cancer Institute " CancerNet " Internet station the above.

Need the patient of treatment miR15 or miR16 cancers mediated to differentiate: to obtain tumour or excrescence cell (perhaps suspection is tumour or excrescent cell) sample from this patient, measure at least a portion cell wherein and compare the expression of miR15 or miR16 with the cell that derives from this patient's normal structure and whether reduce or lack by following method.The method of miR15 or miR16 gene expression dose is to well known to a person skilled in the art (as mentioned above) in the detection cell.In addition, miR15 or the miR16 that derives from patient's the cell expresses and can also compare with the average expression of these genes in the cell of normal population.The doctor can easily differentiate the patient who needs treatment CLL with the standard diagnostics technology.Referring to, for example " Chronic lymphocytic leukemia:recommendationsfor diagnosis; staging; and response criteria.International Workshopon Chronic Lymphocytic Leukemia; " (1989) Annals of InternalMedicine110 (3): 236-238 is incorporated herein it in full as a reference.For example, the patient who suffers from CLL has the CLL cell of circulation, shows lymphocytosis (be in the blood lymphocyte number be equal to or greater than every cubic millimeter of 10,000 cells), and the accumulation gradually in marrow and lymphatic tissue of CLL cell.

The evaluation of CLL cell can be by direct visual observations blood sample in blood samples of patients or other tissue, and/or measures lymphocytic " CLL mark " and verify.Whether the CLL fraction representation exists five lymphocytic cell surface mark: CD5+ of CLL cell, CD23+, and FMC7-, and the faint expression of surface immumoglobulin (SmIg) (+/-) and CD22.This points-scoring system all provides 1 or 0 value in these five marks each, is typically or atypical according to being it to CLL.The CLL mark of CLL cell is 4 or 5, and other leukemic lymphocytic CLL mark is＜1 to 3.Referring to Matutes et al. (1994), Leukemia 810:1640-1645 and Moreauet al. (1997), American Journal of Clinical Pathology, 108:378-82 is incorporated herein it in full as a reference.The CLL cell is lower with the immunoglobulin level that normal peripheral blood B cell is compared the film surface.The immunoglobulin level on lymphocyte film surface can easily detect with standard method; Referring to, Rozman et al. (1995) for example, New England Journal of Medicine 333:1052-1057 is incorporated herein it in full as a reference.

The doctor also can easily identify the patient of needs treatment prostate cancer according to the standard diagnostics technology, used standard is patient age for example, check out that with the anus palpation prostate increases, the antigen of prostate-specific (" PSA ") level, the Gleason mark of tissue, and exist on the immunohistochemistry level can detected genetic marker, for example p53 on the prostata tissue cell, p21, and cyclin.Serum PSA level is that 20ng/ml or higher and prostata tissue differentiation not good (for example the Gleason mark is 8 or higher) expression suffer from prostate cancer.The imaging technique checking that the existence of tumor of prostate also can be by Noninvasive among the patient, CT scan for example, to prostatic per-rectum ultrasonic examination (" TRUSP "), and magnetic resonance imaging (" MRI "), these technology all are well known in the art.

" effective dose " of miR15 described here or miR16 gene outcome is meant the amount of the cancer cell of miR15 among the patient who is enough to suppress to suffer from miR15 or miR16 cancers mediated or miR16 mediation.For example, the effective dose of miR15 or miR16 gene outcome can be the amount that is enough to suppress to suffer from CLL cell proliferation among the patient of CLL, or suffers from the amount of prostate gland cancer cell propagation among the patient of prostate cancer.Should be appreciated that " prostate tumor cells " not necessarily is present in the prostate, but comprise the cell that derives from prostatic metastatic tumour.

Here said " propagation that suppresses the cancer cell of miR15 or miR16 mediation " is meant cell killing, or permanent or cell is stopped growing.If these cells after having used miR15 or miR16 product among the patient remain unchanged or reduce, can infer that so then the propagation of the cancer cell of miR15 or miR16 mediation has been subjected to inhibition.If the absolute quantity of these cells increases, but the speed of tumor growth has reduced, think that so also the propagation of the cancer cell that miR15 or miR16 mediate has been subjected to inhibition.

The quantity of the cancer cell of miR15 or miR16 mediation can be determined by directly measuring in patient's body, perhaps determines from the size estimation of original or metastatic tumour piece.

For example, the number of patient CLL cell can easily be determined, for example by whole blood or white blood cell count(WBC).The number of CLL cell can also pass through immunohistochemical method, flow cytometry, or other characteristic surface mark that is used to detect the CLL cell is easily measured.

The tumor of prostate piece can perhaps pass through for example X ray of diagnostic formation method by direct visual observations, magnetic resonance imaging, and ultrasonic and scintigraphy are measured.Be used for determining that the diagnostic formation method of tumor mass size can use or therewith not use with contrast agents, as known in the art.The size of tumor mass can also be measured with physical method, for example the palpation of piece of tissue or with measuring instrument for example caliper piece of tissue is measured.For tumor of prostate, determine that preferably the physical method of tumor mass size is the anus palpation.

Those skilled in the art can easily determine the miR15 that uses to particular patient or the effective dose of miR16 gene outcome, and it is according to following parameters, as patient's stature and body weight; The degree of disease; Patient's age, health status and sex; Administering mode; And administration is local or general.

For example, the effective dose of compound of the present invention can be based on the approximate weight of the tumor mass that will treat.The approximate weight of tumor mass can be measured by the approximate volumes of calculating tumor mass, wherein the heavily about gram of one cubic centimetre volume.Based on the effective dose of the miR15 of tumor mass weight or miR16 gene outcome can be 10mg/g tumor mass, preferably 10-500mg/g tumor mass at least.More preferably, effective dose is a 60mg/g tumor mass at least.Particularly preferably be, effective dose is a 100mg/g tumor mass at least.Preferably will be injected directly in the tumour based on the effective dose of tumor mass weight.

The effective dose of miR15 or miR16 gene outcome can be based on the patient's that will treat approximate or estimation body weight.Preferably, this effective dose is parenteral or enteral administration, and is as described below.For example, giving patient's the miR15 or the effective dose of miR16 gene outcome is the 5-3000mg/kg body weight, and preferably the 700-1000mg/kg body weight is more preferably the body weight greater than 1000mg/kg.

Those skilled in the art can easily determine given patient is given the suitable dosage regimen of miR15 or miR16 gene outcome.For example miR15 or miR16 gene outcome can disposablely give the patient (for example single injection or deposition).In addition, this gene outcome can also give patient one to twice every day, and administration time continues about three to about 28 days, is more preferably about seven to about ten days.In preferred dosage regimen, miR15 or miR16 gene outcome are administered once every day, continue seven days.If dosage regimen is a multiple dosing, the effective dose that is to be understood that the miR15 that gives the patient or miR16 gene outcome is the total amount of the gene outcome that gives in whole dosage regimen.

MiR15 or miR16 gene outcome can be delivered to patient's cell with this gene outcome by any being suitable for, candidate stem cell (HSC) for example, and the mode in CLL cell or the prostate gland cancer cell gives the patient.For example miR15 or miR16 gene outcome can perhaps be used the mode administration of the nucleic acid transfection patient cell of the sequence that contains coding miR15 or miR16 gene outcome with being suitable for miR15 or miR16 gene outcome.Cell can be directly with miR15 or miR16 gene outcome (when it is nucleic acid) transfection, perhaps can be with the nucleic acid transfection of the sequence that contains coding miR15 or miR16 gene outcome.Preferably, the cell plasmid or the viral vectors transfection of the sequence that contains coding miR15 or miR16 gene outcome, as mentioned above.

Eukaryotic transfection method is well known in the art, comprises nucleic acid is injected directly in cell nucleus or the cell protokaryon; Electroporation; Liposome conversion or the conversion that mediates by lipophilic substance; Receptor-mediated delivery of nucleic acids, biological bullet or particle quicken; Calcium phosphate precipitation, the transfection of viral vectors mediation.

For example, cell can transform compound with liposome, for example DOTAP (N-[1-(2,3-two oleoyl oxygen) propyl group]-N, N, N-trimethyl-ammonium methyl sulfate, Boehringer-Mannheim) or for example LIPOFECTIN transfection of its equivalent.The amount of employed nucleic acid is unimportant for enforcement of the present invention; With 0.1-100mg nucleic acid/10 ⁵Individual cell can both obtain satisfied result.For example, the amount of use can be per 10 ⁵Individual cell 3mg DOTAP wherein contains the 0.5mg plasmid vector.

In one embodiment, isolate the cancer cell of miR15 or miR16 mediation from the patient, for example CLL or prostate cancer are with the nucleic acid transfection of coding miR15 or miR16 gene outcome, among the neo-implanted patient that lays equal stress on.In preferred embodiments, cell transfection and that implant again is the CLL cell.In a more preferred embodiment, cell transfection and that implant again is the HSC that is diagnosed as the patient of CLL.

The technology of extracting the CLL cell from the patient is well known in the art, described in for example following embodiment 7.The technology of extracting, differentiate, separating and cultivating HSC from the patient also is well known in the art, and for example the United States Patent (USP) sequence number 5,635,387 and 5,643,741, and described in Campana et al. (1995) the Blood 85:1416-1434, be incorporated herein it in full as a reference.Preferably, before transfection HSC, from the marrow of collecting, extract tumour or excrescence cell.Suitable extractive technique comprises, the leucocyte removal of for example immobilization peripheral blood cells based on immunity affine selection or kill tumor cell, perhaps uses optionally kill tumor cell of cytotoxicity or photosensitive reagents, all is well known in the art.Referring to, for example, Bone Marrow Processing andPurging, Part 5 (A.Gee, ed.), CRC Press, Boca Raton, Fla., 1991; Lydaki et al. (1996) J.Photochem.and Photobiol.32:27-32; With Gazitt et al. (1995), Blood, 86:381-389, be incorporated herein it in full as a reference.

CLL cell that separates or HSC can be with any suitable technology transfections, as mentioned above.Check that a part of CLL cell or HSC are to verify whether described gene outcome has suitable expression after the transfection.Have suitable expression in case verified miR15 or miR16 gene outcome, just remaining transfectional cell is reintroduced among the patient.The CLL cell of transfection or HSC can be reintroduced among the patient by the parenteral method, comprise venoclysis or directly injection in marrow.Transfectional cell is preferably introduced the patient again with salting liquid or the receivable carrier of other pharmacy.Again the suitable quantity of the transfectional cell of Yin Ruing is every kg weight in patients about 10 ⁵To about 10 ⁸Individual cell.Thereby increase the quantity of the transfectional cell can be used for introducing again can in medium, expanding cell before the transfection.

Preferably, CLL cell or HSC be with the nucleic acid of the sequence that contains coding miR15 or miR16 gene outcome, for example can stable integration in CLL cell or the HSC genome with the plasmid expression vector transfection of this compound of long-term expression.Stable integration and expression can be used technical identification well known in the art, for example as probe genomic DNA are carried out Southern blot with miR15 or miR16 cDNA (or its fragment).The expression of miR15 or miR16 gene outcome can also detect with standard Northern blot technology.CLL cell or HSC with the sequence stable transfection of coding miR15 or miR16 gene outcome can continue to express this compound after implanting among the patient again.From the patient, separate HSC,, and the HSC of transfection is implanted to illustrative methods among the patient again shown in following embodiment 8 with the plasmid transfection of expressing miR15 or miR16 gene outcome.

MiR15 or miR16 gene outcome can also give the patient by any suitable intestines or parenteral mode.It is oral to be applicable to that suitable enteral administration mode of the present invention comprises, rectum, or intranasal delivery.Suitable parenteral mode comprise intravascular administration (for example vein high dose injection, venoclysis, the injection of intra-arterial high dose, endoarterial infusion and be infused in the vascular system through conduit); Organize outer inject with tissue is interior (for example tumour is outer and the interior injection of tumour, and retina is interior to be injected, or subretinal injection); Hypodermic injection or deposition comprise h inf (for example osmotic pump); Be applied directly to interested tissue, for example by conduit or other apparatus for placing (for example retina particle or suppository or contain porous, atresia, or the implant of colloid substance); And suck.Preferably, miR15 or miR16 gene outcome are by injection or infusion administration.For the cancer that contains tumor mass of miR15 or miR16 mediation, preferred miR15 or miR16 gene outcome are by being injected directly into administration in the tumour.

In the method for this paper, miR15 or miR16 gene outcome can be used as exposed RNA, perhaps with delivery of agents together, perhaps as containing nucleic acid (for example recombinant plasmid or the viral vectors) administration of the sequence that can express this gene outcome.The suitable delivery of agents that is applicable to miR15 or the administration of miR16 gene outcome comprises Mirus TransitTKO lipophilicity reagent; Lipofectin; Lipofectamine; Cellfectin; Or polycation (for example polylysine), or liposome.

The recombinant plasmid that contains the sequence that can express miR15 or miR16 gene outcome as mentioned above.The recombinant viral vector that contains the sequence that can express miR15 or miR16 gene outcome also as mentioned above, the CLL or the method in the prostate gland cancer cell that these carriers are delivered to the patient are well known to a person skilled in the art.

In preferred embodiments, liposome can be used for miR15 or miR16 gene outcome, or the delivery of nucleic acids of sequence that contains this gene outcome of encoding is in the patient.Liposome can also increase this gene outcome or the half life period of nucleic acid in blood.In the practice of this embodiment of the present invention, described miR15 or miR16 gene outcome, or the nucleic acid that contains the sequence of this gene outcome of encoding can be encased in the liposome before using to the patient.

Be applicable to that liposome of the present invention can generally include for example cholesterol of phosphatide neutral or that have negative electrical charge and sterol with the lipid preparation of the formed carrier of standard.The selection of lipid usually can be according to for example desirable liposome size of various factors and the half life period of liposome in blood vessel.The known multiple method for preparing liposome, Szokaet al. (1980) for example, Ann.Rev.Biophys.Bioeng.9:467; With United States Patent (USP) sequence number 4,235,871,4,501,728,4,837,028 and 5,019, described in 369, be incorporated herein it in full as a reference.

Include miR15 or miR16 gene outcome, or the liposome of nucleic acid that contains the sequence of this gene outcome of encoding can comprise the cancer cell that described liposome target can be arrived surely miR15 or miR16 mediation, for example ligand molecular on CLL or the prostate gland cancer cell.In these cancer cells generally can with the part of receptors bind, can be preferred for example with the monoclone antibody of tumor-cell antigen or CLL cell surface marker.

Can also be to including miR15 or miR16 gene outcome, or the liposome of nucleic acid that contains the sequence of this gene outcome of encoding is modified avoiding and is removed by monokaryon macrophage system (" MMS ") and reticuloendothellium system (" RES ").Have opsonic action on the surface of the liposome of this modification or in its liposome structure and suppress molecule.In specific embodiment preferred, liposome of the present invention can comprise opsonic action simultaneously and suppress molecule and part.

The opsonic action that is used to prepare liposome of the present invention suppress molecule typically can with the membrane-bound macromolecular hydrophilic polymer of liposome.Opsonic action described here suppresses molecule and liposome membrane and " combines " and be meant itself and film generation chemistry or physical connection, and for example fat-soluble deadman is inserted in the film, perhaps directly combines with the active group of film fat.These opsonic actions suppress hydrophilic polymer and form the superficial layer with protective effect, can significantly reduce liposome and be absorbed by MMS and RES, and for example the United States Patent (USP) sequence number 4,920, described in 016, be incorporated herein it in full as a reference.

The opsonic action that is applicable to modified liposome suppresses preferably water-soluble polymer of molecule, and its mean molecule quantity is about 500 to about 40, and 000Da is more preferably about 2,000 to about 20,000Da.This polymer comprises polyethylene glycol (PEG) or polypropylene glycol (PPG) derivative; For example methoxy PET or PPG, and PET or PPG stearate; Synthetic polymer is polyacrylamide or poly-N-polyvinylpyrrolidone for example; Straight chain, branch chain and branched polyamide base amine; Polyacrylic acid; Polyalcohol, for example polyvinyl alcohol and xylan alcohol, wherein carboxyl chemically is connected with amino, and gangliosides, for example Ganglioside GM1.Also can use PEG, methoxy PEG, or methoxy PPG, the copolymer of or derivatives thereof.In addition, it can be PEG and polyaminoacid that opsonic action suppresses polymer, polysaccharide, polyamide, polyvinylamine, or any the block copolymer in the polynucleotide.It can also be natural amino acid or the carboxylic acid of containing that described opsonic action suppresses polymer, galacturonic acid for example, glucuronic acid, mannuronic acid, hyaluronic acid, pectic acid, neuraminic acid, alginic acid, the polysaccharide of carrageenan; Amination polysaccharide or oligosaccharides (straight chain or branch chain); Or carboxylated polysaccharides or oligosaccharides, for example can finally be connected carboxylic group with the carbonic acid derivative reaction.Preferably, it is PEG that described opsonic action suppresses molecule, PPG, or derivatives thereof.The liposome of modifying with PEG or PEG derivative is called as " liposome of PEGization " sometimes.

Opsonic action suppresses molecule and can combine with liposome membrane by multiple known method.For example, the N-hydroxy-succinamide ester of PEG can combine with the fat-soluble deadman of phosphatidyl-ethanolamine, is attached on the film then.Similarly, the dextran polymer can with the fat-soluble deadman of octadecylamine by oxolane with Na (CN) BH and solvent mixture such as 30:12: water comes derivatization at 60 ℃ of reductive aminations that carry out.

The liposome that suppresses the time ratio unmodified that the liposome of molecular modification keeps with opsonic action in the circulatory system is long.Given this reason, these liposomes are sometimes referred to as " stealth " liposome.Hidden liposome is known can be accumulated in by tissue porous or " seepage is arranged " microvasculature feedback.Therefore, have the tissue of microvasculature defect, for example tumor mass can effectively accumulate these liposomes; Referring to Gabizon, et al. (1988), Proc.Natl.Acad.Sci., USA, 18:6949-53.In addition, thus the minimizing that RES absorbs is owing to stoped the accumulation of this liposome in liver and spleen to reduce the toxicity of hidden liposome.Therefore, the liposome that suppresses molecular modification with opsonic action is applicable to miR15 or miR16 gene outcome, or the delivery of nucleic acids of sequence that contains this gene outcome of encoding is in tumour cell.

MiR15 or miR16 gene outcome were preferably made pharmaceutical composition according to technology well known in the art before using to the patient.Pharmaceutical composition of the present invention is aseptic at least and does not contain thermal source.Here said " pharmaceutical preparation " comprises the preparation that uses with the animal doctor that is used for the people.The method for preparing pharmaceutical composition of the present invention is well known to a person skilled in the art, Remington ' s Pharmaceutical Science for example, 17th ed., MackPublishing Company, Easton, described in the Pa. (1985), be incorporated herein it in full as a reference.

Pharmaceutical preparation of the present invention contains miR15 or miR16 gene outcome, or contains the nucleic acid (for example by weight 0.1 to 90%) of the sequence of this gene outcome of encoding, or the receivable salt of its physiology, and mixed mutually with the receivable carrier of pharmacy.Pharmaceutical preparation of the present invention can also comprise miR15 or the miR16 gene outcome that is included in the liposome, or contains the nucleic acid of the sequence of this gene outcome of encoding, and the receivable carrier of pharmacy.

The preferred receivable carrier of pharmacy is a water, buffer solution, physiological saline, 0.4% salt solution, 0.3% glycine, hyaluronic acid etc.

In preferred embodiments, pharmaceutical composition of the present invention comprises miR15 or the miR16 gene outcome that can resist nuclease degradation.Those skilled in the art can easily synthesize miR15 and the miR16 gene outcome with nuclease resistance, for example add one or more ribonucleotides in 2 ' position of miR15 and miR16 gene outcome.2 ' the suitable ribonucleotide of modifying is included in 2 ' position and has fluorine, amino, alkyl, the ribonucleotide that alkoxyl and O-pi-allyl are modified.

For example, pharmaceutical composition of the present invention contains the miR15 or the miR16 gene outcome of the 2 ' ribonucleotide of modifying that has added one or more general formulas with 2 ' AR-nucleotide, wherein:

A is oxygen or halogen (preferred fluorine, chlorine or bromine); And

R is hydrogen or straight chain or branch chain C _1-6Alkyl;

Wherein when A is halogen, there are not X and R.The preferred 2-ribonucleotide of modifying is 2 '-O methyl ribonucleotides.Preferably, pharmaceutical composition of the present invention comprises that wherein each ribonucleotide all is the miR15 or the miR16 gene outcome of the ribonucleotide of 2 '-modification.

Pharmaceutical composition of the present invention can also comprise traditional drug excipient and/or additive.Suitable drug excipient comprises stabilizing agent, and antioxidant is regulated reagent, buffer solution and the pH regulator reagent of Morie osmolarity.Suitable additive comprises physiological biocompatible buffer solution (for example hydrochloric acid trometamol), add chelating agent (for example DTPA or DTPA-bisamide) or calcium chelated complexes (DTPA calcium for example, the CaNaDTPA-bisamide), perhaps, selectively, add calcium salt or sodium salt (for example, calcium chloride, Calcium Ascorbate, calcium gluconae or calcium lactate).Pharmaceutical composition of the present invention can use with liquid form, also can use with lyophilized form.

For solid composite medicament of the present invention, can use the receivable carrier of pharmacy of traditional nontoxic solid; The mannitol of pharmaceutical grade for example, lactose, starch, dolomol, saccharin sodium, cellulose, glucose, sucrose, magnesium carbonate etc.

For example, the solid composite medicament that is used for oral administration can contain above-mentioned any carrier and 10-95%, miR15 or the miR16 gene outcome of preferred 25%-75%.The pharmaceutical composition of (suction) administration of being used for spraying can contain 0.01-20% by weight, and preferred 1%-10% by weight is contained in miR15 or miR16 gene outcome in the above-mentioned liposome and propellant.Can also comprise other carrier; The lecithin that for example is used for intranasal delivery.

Following non-limiting example will be made an explanation to the present invention.

Embodiment

Use following method in an embodiment:

Patient's sample and cell-line-patient's sample is to obtain after the patient's who has obtained being diagnosed as by CLL ResearchConsortium institutions CLL informed consent.Brief, peripheral blood obtains from CLL patient, monocyte is by Ficoll-Hypaque gradient centrifugation (Amersham Pharmacia Biotech, Piscataway, NJ) separate, handle then so that extract RNA and DNA by standard method, as Sambrook J et al. (1989), Molecular cloning:ALaboratory Manual (Cold Spring Harbor Laboratory Press, ColdSpring Harbor, NY), be incorporated herein it in full as a reference.The oral mucosa DNA of respective patient is placed on small pieces (1-2mm ²) on the paper, as the normal control in the LOH research.

30 people's cell-line is to derive from American type culture collection (ATCC; Manassas VA) and according to the explanation of ATCC cultivates.These cell-lines are AS283, BL2, Bla, BJAB, CA46, Namalva, P3HRI, PAPB 682, PABm, Raji (Burkitt ' s lymphoma), Dell, SKDHL, ST486 (T-cell lymphoma), JM (immunoblast B cell lymphoma), MC116 (undifferentiated lymphoma), Molt3, Supt 11 (T-ALL), U266 (Huppert's disease), A549, H1299 (lung cancer), TE2, TE10 (cancer of the esophagus), HeLa (cervix cancer), RC48 (kidney) and 2220,2221,11609,11611, LNCAP, TSUR (prostate cancer).

The separation one of CD5+B-cell obtains tonsil from paediatrics group (3-9 year) by conventional tonsillectomy.The sheep erythrocyte of handling with neuraminidase scatters monocyte, obtains the B cell of purifying.(Sweden) further classification as Dono M etal. (2000), described in the J.Immunol.164:5596-5604, is incorporated herein it in full as a reference for Pharmacia Biotech, Uppsala with discontinuous Percoll gradient with the B cell.From 50% Percoll fraction, collect the B cell, and cultivate, cultivate with sheep anti mouse Ig then with little magnetic bead combination with anti-CD5 mAb.Collecting cell also places on the magnetic posts MS, with MiniMACS system (Miltenyi Biotec) by just selecting to obtain the CD5+B cell.

Somatic hybridization-carry out somatic hybridization with conventional method is selected on hypoxanthine-aminopterin-thymidine (HAT) medium, as Negrini M et al. (1994), described in the CancerRes.54:1818-1824, be incorporated herein it in full as a reference.The DNA that obtains from individual cells clone and subclone organizes kit (Qiagen) to separate with DNeasy and whether has chromosome 13 and chromosome 2 marks (primer sequence is stated table 1 as follows) with the PCR detection.From a kind of t (2 that has; 13) (q32; Q14) separation obtains 15 clones in Yi Wei the CLL cell (CLL-B), has t (2 from another kind; 13) (q12; Q13) separation obtains a clone in Yi Wei the CLL cell (CLL-A).12 clones from CLL-B have the fully-complementary sequence of chromosome 13 and 2, other three fully-complementary sequences that have del (13q) and chromosome 2.Contain from the clone of CLL-A and to have the little disappearance of chromosome 13 in the 13q14 position and not contain chromosome dyad 2.

(Molecular ResearchCenter Inc) separates total RNA to Northern blotting-with Tri Reagent method.(Bio-Rad Laboratories, Hercules separate on CA) and transfer on the Hybond-N+ film (AmershamPharmacia Biotech) at 15% acrylamide distortion (urea) Criterion precast gel with RNA sample (each 30g).42 ℃ at 7%SDS, 0.2M Na ₂PO ₄Under the condition of pH7.0 with- ³²P ATP hybridization is spent the night.42 ℃ with film 2x SSPE, the 0.1%SDS washed twice is used 0.5x SSPE, the 0.1%SDS washed twice.The probe that is used to detect miR15 and miR16 RNA is respectively:

CACAAACCATTATGTGCTTGCTA(SEQ?ID?NO：5)

GCCAATATTTACGTGCTGCTA(SEQ?ID?NO：6)

In the 0.1%SDS aqueous solution/0.1x SSC, boil peeled off in 10 minutes hybond membrane and again hybridization several times.With the 5S rRNA of ethidium bromide staining in contrast.

Reverse transcriptase polymerase chain reaction (PCR) (RT-PCR)-analyze gene expression dose in normal CD5+ cell and 23 the B-CLL samples by RT-PCR.With a microlitre cDNA, every kind of gene-specific primer 10pmol carries out 35 circulations with the each amplified reaction of Advantage2 PCR kit (Clontech), 94 ℃ 20 seconds, 65 ℃ 30 seconds, 68 ℃ 1 minute (primer is tabulated and is stated table 1 as follows).For the RNA that guarantees to use among the RT-PCR has enough purity, (CA) special primer carries out the PCR detection for Clontech, PaloAlto with G3PDH cDNA.Separate the RT-PCR product with the standard method among the above-mentioned Sambrook J et al. (1989) with agarose gel electrophoresis.

Western blotting-is to the SDS/PAGE jel product of 9 B-CLL patients' cytolysis thing GST-SLUG Middle antibody (Dr.Thomas Look-Harvard, MA gifts) and SNX2 (N17) antibody (Santa Cruz Biotechnology, CA) detection.(AmershamPharmacia UK) detects, according to the description operation of manufacturer with ECL Western Blotting detection kit.

BLAST arrangement instrument search " nr " and " dbEST " database that the National Center forBiotechnology Information website that database analysis-use is safeguarded by National Institutes of Health and theNational Library of Medicine provides, the sequence of almost completely mating that search is short.Also can be referring to Altschul et al. (1990), J.Mol.Biol.215:403-10 and Altschul et al. (1997), Nucleic Acids Res.25:33 89-3402 is incorporated herein it in full as a reference.Also can search for the homologous sequence of short sequence with the FASTA arrangement instrument that Biology workBench website provides.

Table 1-is used for the primer of detection bodies cell hydridization strain

Title primer sequence SEQ

ID

NO：

D2S396L ATA?CAC?CTC?TAA?ATA?TCT?GTT?CCA?G 7

D2S396R AAG?TAG?GAC?CAT?TCT?AAT?AGC?C 8

D2S112L GAG?TGG?CGG?TGA?GAA?GGT?AT 9

D2S112R AGC?CAT?TGCTAT?CTT?TGA?GG 10

D2S2243L TGG?GAT?ATG?CTT?CAG?GGA?C 11

D2S2243R AGC?TGA?CCT?TGG?AAT?CTG?GTT 12

D13S260L AGA?TAT?TGT?CTC?CGT?TCC?ATG?A 13

D13S260R CCC?AGA?TAT?AAGl?GAC?CTG?GCT?A 14

D13S263L CCT?GGC?CTG?TTA?GTT?TTT?ATT?GTT?A 15

D13S263R CCC?AGT?CTT?GGG?TAT?GTT?TTT?A 16

D13S165L GTT?TCG?CCAAGC?CTG?TT 17

D13S165R GTT?GAC?AAT?AAA?ATA?CGC?CAC?A 18

D13S273L CTG?NGG?CAA?AAA?CAA?CTC?TT 19

D13S273R ATC?TGT?ATG?TCC?TCC?TTT?CAA?TG 20

D13S1168L AAC?CTC?ATT?TAA?ATG?TAA?AGC?ATC?A 21

D13S1168R GTAATG?TCA?TTG?CTT?TTG?ATT?TGC 22

D13S1150L CTC?TTG?AGG?GAA?AAA?AAA?AAT?CA 23

D13S1150R CCA?GGC?AAC?CAA?CCA?GTC 24

D13S272L ATA?CAG?ACT?TCC?CAG?TGG?CT 25

D13S272R AGC?TAT?TAA?AGT?TCC?CTG?GAT?AAA?T 26

GCT16C05L AAG?GAA?TCA?GAG?AAA?TGG?GG 27

GCT16CO5R GCT?GAG?TCA?GAG?GGA?TTT?GA 28

D13S25FOR AGA?GGT?AAA?CAA?ACC?AAA?CCC 29

D13S25REV GCT?GAC?AAT?CAA?GAG?AAG?ATG 30

D13S284L AAA?ATC?AGG?TGG?AAA?CAG?AAT 31

D13S284R AAA?GGC?TAA?CAT?CGA?AGG?GA 32

01ALU18 CAG?AAC?CAG?AGA?AAC?AGC 33

02ALU18 ATG?GCA?CAA?CAG?CTT?AAC 34

AFMA301WB5 GAA?TGC?AGG?TGT?ACC?TAT?CAA?C 35

AFMA301WB5 ACT?GAG?TGA?CTG?CTA?CCC?AG 36

D13S272L1 AGC?TAG?CCC?TAT?CAG?GGT 37

D13S272R1 GTA?AGT?GGA?GGT?TAC?CTG 38

5279F GAA?TCA?TTC?GTG?CTA?AGT?GGA?T 39

5451R TGC?CAA?CTG?CTT?GAA?GAA?TCT?C 40

7130F ACA?CCT?AAC?TCC?TGG?GTT?GTT?C 41

7371R ACT?AAA?TGC?CAG?CGT?TTG?CAT?G 42

9530F GGT?CTT?ACT?CTG?GTT?AAA?TCT 43

9757R CAT?TGG?TAG?CTA?AGG?AAA?CAC 44

11521F CCA?TTC?AAG?CCT?GGA?CAA?TCT?T 45

11802R GAA?ACT?TGA?GAC?AAT?AAG?GAG?C 46

12440F CAT?GTA?ACC?AAG?ATA?AAT?CCG?T 47

12558R CTG?GAA?AAT?GTA?TGT?GAT?GAG?G 48

17261F CTG?TTG?CTA?TCT?GTA?ATA?ACA?C 49

17494R CTT?GGA?ATT?TTC?CAC?TGA?ATC 50

18701R TCA?TCA?GAA?GAA?ATC?AAG?GCA?G 51

18560F CAG?TGT?TAG?GAA?TAC?GCA?TTC?A 52

GSP2F4 CCT?TGC?CAG?TAC?GCC?CAC?AAG?CTG 53

GSP1R1 CCC?CAC?CTA?TGG?TTG?TAG?TGA?GCA 54

TCC

The disappearance zone of one section 30kb in the embodiment 1-CLL patient's somatic cell hybrid strain

So far also do not determine the Minimum Area that lose at CLL patient 13q14 place.Multiple and relatively large (130 to 550kb) zone (referring to Fig. 2 B) of 13q14 place disappearance among the CLL has been described.Analyze the border, centromere of differentiating that Alu18 site homozygote is lost with LOH and Southern blot, exon 5 places of LEU2 gene are arrived in this site less than the 65kb centromere between D13S1150 and D13S272.But, find the little or overlapping homozygous deletion that target tumor suppression is located.

In order better to define the lost regions among the CLL, the somatic hybridization strain of preparation mouse LM-TK-and the CLL cell that has the 13q14 displacement and/or lack.The PCR that the hybridization that obtains is cloned detects two copies that can separate the chromosome 13 that exists in the tumour.Can discern the disappearance of the 31.4kb in a kind of cell in this way, and the accurate location (Fig. 2 D) of chromosome breakpoint in the another kind of cell.These results show in the zone of the 29kb of 13q14 tumor suppressor gene between the exon 2 and 5 of LEU2 gene.The primer that is used for detection bodies cell hydridization strain is as shown in table 1.

As shown in Figure 2, the zone that lacks in the somatic hybridization strain is identical with all lost regions of having reported, comprises several years ago the zone by the 10kb of Liu et al. (1997) Oncogene 15:2463-2473 report.The exons 1 of LEU2 and 2 is also in this zone, and also in zone defined herein.But LEU2 is not that possible candidate's tumor suppression subbase of B-CLL is because of (referring to Bullrich et al. (2001), CancerRes.61:6640-6648; Migliazza et al. (2001), Blood 97:2098-2104; Wolf et al. (2001), Hum.Mol.Genet.10:1275-1285; With Mertens etal. (2002) Blood 99:4116-4121)

Embodiment 2-miR15 and miR16 gene are positioned at the minimum disappearance zone of chromosome 13, and in the CD5+ cell high expressed

New controlling gene in disclosing available sequence information and database in the smallest loss zone at screening 13q14 place.Two miRNA gene clusters of being cloned recently, miR15 and miR16 are positioned at this disappearance zone (Fig. 2 A) just.In order to estimate miR15 and the miR16 expression in normal structure,, comprise that separation analyzes (Fig. 3 A) from the Northern blot that the tonsilar CD5+B cell of normal individual carries out miR15 and miR16 RNA to one group of normal structure.Do contrast with the CD5+B cell, this is because B-CLL has and accumulates the lymphocytic characteristic of CD5+B gradually.Find ubiquity miR15 and miR16 expression of gene, and expression is the highest in normal CD5+ lymphocyte.In addition, in normal structure miR16 all the time than miR15 expression height.These data show that miR15 and miR16 gene have important function in the dynamic equilibrium of normal CD5+B cell.

Embodiment 3-miR15 and miR16 gene in the CLL sample of 13q14 disappearance usually lack or are subjected to negative regulation

Whether relevant in order to study miR15 with the morbidity of CLL with the miR16 gene, analyzed 60 CLL samples and 30 human carcinoma cell lines' miR15 and miR16 gene expression (Fig. 3 A) with Northern blotting.Among the CLL patient 68% (41/60), and in 6 prostate cancer cell lines analyzing 5 compare to demonstrate to express significantly with its normal structure homologue and reduce.These inventions proof miR15 and miR16 gene are subjected to negative regulation in most of B-CLL that is detected and prostate gland cancer cell.

In addition, 23 (38%) in 60 CLL samples demonstrate the band of about 70nt of the obvious discernible miR15 of representative precursor RNA.And all do not find the miR15 band (Fig. 3 A) of 70nt in any normal structure of analyzing except marrow, this shows that the CLL cell is lower to the treatment effeciency of miR15 precursor RNA.

Whether relevant for the negative regulation of determining viewed expression with the allelomorph disappearance of CLL, with microsatellite marker D13S272 and D13S273 46 CLL patients have been carried out LOH research, can obtain normal DNA (Fig. 3 B) from these patients.We find to have 68% of adopted sample to show LOH (in 35 24) at least one mark.The expression of miR15/16 gene outcome all reduces to some extent in all samples (75%) except 4 samples.The problem of initial substance 12 samples arranged owing to can not obtain repeatably result.In addition, expression also reduces to some extent in 6 (55%) in not having 11 samples of obvious LOH.In these experiments, may can not be detected by used mark because deletion fragment is too little.

Northern blot the analysis showed that at the cell that has known big homozygous deletion at the 13q14 place and is less than in 5% the normal cell and express miR15 and miR16 gene outcome, shows to have other highly similarly microRNA gene in genome.In fact, existing report have one with the miR15/miR16 gene cluster very similarly gene cluster be positioned at chromosome 3q25-26.1 place (referring to Lagos-Quintana et al. (2002), Curr.Biol.12:735-739).For the variation that shows miR15/16 gene expression relevant with the disappearance of chromosome 13q really, designed to the miR16 precursor RNA on the chromosome 13 special and to the special probe of miRNA precursor RNA that the gene on the chromosome 3 produces, be used to carry out Northern blot.

The miR16 precursor RNA of chromosome 13 only detects very low level, with chromosome 3 probes specific hybridization does not take place but in same sample.In addition, the microsatellite marker that is positioned at the centric 2Mb of this gene cluster zone with two leaps carries out LOH research.17 have 4 in the adopted sample to demonstrate LOH at least one mark, and do not find the relation between the expression of itself and miR15/16.These data prove that obviously the negative regulation of miR15 and miR16 gene expression is relevant with the allelic loss at 13q14 place among the CLL, show that miR15 and miR16 gene outcome have important function in the morbidity of CLL.

Embodiment 4-miR15 in mouse is also relevant with the CLL morbidity with miR16

For further whether research miR15 is relevant with the CLL morbidity with the miR16 gene, continue to study (Bichi et al., (2002), Proc.Natl.Acad.Sci.USA 99:10:6955-6960) with the E-TCL1 transgenic mice of suffering from CLL.The variation of cell and gene in the detection E-TCL1 transgenic mice.Carry out Northern blot as mentioned above and analyze (referring to embodiment-" Northern blotting " and embodiment 3).

In about 80% transgenic mice, to compare with the normal mice splenic lymphocyte, the mouse homologue of miR15 and miR16 all decreases in the CLL cell.These results are consistent with the result that the people CLL described in the embodiment 3 compares with normal cell.

Also mouse chromosome 15 and human chromosome 12 are compared.The leukemic icp gene hybridization (CGH) of transgenic mice demonstrates about 35% zone that has amplified mouse chromosome 15, corresponding to the zone of human chromosome 12.The cell analysis of these mouse leukemias shows that also mouse chromosome 15 has triploid property or tetraploid property.The chromosome 12 of known nearly 25% people CLL has triploid property.

Icp gene hybridization has shown that also mouse chromosome 14 (51.6-78.5Mb) has the zone of losing, corresponding to people's 13q14 zone.

These results of study show that the CLL mouse model has reappeared event in the people CLL morbidity.Comprehensive, the data of embodiment 1-4 show that miR15 and miR16 have important function in the CLL morbidity in mammal.

Embodiment 5-mutation analysis does not demonstrate that miR15 and miR16 gene have point mutation in CLL and human primary gastrointestinal cancers

In order further to estimate miR15 and the effect of miR16 gene in CLL, use to pcr amplification product directly the method for order-checking detected in 120 B-CLL and 80 colorectal cancers and the cancer of the stomach whether have sudden change.The chromosomal region of 720 bp that contain full gene bunch has increased.Under these three kinds of situations, find that the miR16 precursor RNA has same variation; 2 have the displacement of T to C in the site.This variation can not change the hairpin structure of miRNA.Also found the polypeptide of several nongenetics.Because miR16 gene less (70bp), it is not astonishing that the miR16 gene only has few sudden change.

In order to be identified in the possibility mechanism of remaining allelic inactivation among the CLL that demonstrates LOH, differentiate the possible promoter region that is positioned at the miR16 gene about 215bp in downstream with " in silico " clone.Reported that several cancer associated genes have the negative regulation of promotor high methylation reaction, comprise p16 ^INK4a, p73, hMLH1, or VHL (referring to Esteller (2002), Oncogene 21:5427-5440).Therefore use the pcr analysis of methylation specific to be positioned at a methylation state that is rich in the CpG zone of 5 ' of possible miR16 promotor.In ten CLL samples, irrelevant with the level (eight expression decreased, two have high expressed) of miR15 or miR16 gene expression, all do not detect the difference of methylation patterns in any CpG site of analyzing.But the PCR that can not get rid of methylation specific does not detect the zones of different in CpG site or methylating than the zonule.

Embodiment 6-miR15 and the expression of miR16 gene outcome in people's cell

The miR15 of 70 nucleotide of coding total length and the cDNA sequence of miR16 RNA precursor are cloned into respectively among the irrelevant mRNA, this mRNA is under the giant cell control of (CMV-IE) promotor in early days immediately, according to Zeng et al. (2002), method operation described in the Mol.Cell 9:1327-1333 is incorporated herein it in full as a reference.

Brief, Xho I connexon is placed the end of the double-stranded cDNA sequence of coding miR15 and miR16 RNA precursor, and these constructs are cloned into the Xho I site of pBC12/CMV plasmid respectively.PBC12/CMV plasmid such as Cullen, (1986), Cell 46:973-982 is described, is incorporated herein it in full as a reference.The described plasmid that contains miR15 precursor RNA sequence is called pCMV-miR15, and the described plasmid that contains miR16 precursor RNA sequence is called pCMV-miR16.

With standard method pCMV-miR15 and pCMV-miR16 are distinguished the people 293T cell that transfection is cultivated with FuGene 6 reagent (Roche).Extract total RNA as mentioned above, whether have miR15 or the miR16 RNA that handled with Northern blot analyzing and testing with miR15 and the special probe of miR16.

Make pCMV-miR15 and the pCMV-miR16 PC-3 2220,2221,11609,11611 of transfection cultivation respectively again, LNCAP, TSUR.Extract total RNA as mentioned above, with the special probe of miR15 and miR16 with whether having miR15 or the miR16RNA that handled in the Northern blot analyzing and testing prostate gland cancer cell.The prostate gland cancer cell of assessing transfection simultaneously overcomes the ability of contact inhibition in modal variation, and can indicate other mark that transforms phenotype.

Embodiment 7-miR15 and miR16 gene outcome transfection CLL cell

Suffers from separation of C LL cell the patient of CLL from diagnosis, the plasmid transfection with coding miR15 and miR16 microRNA as described below.

Separation of C D5+B cell as mentioned above, with visual observations or by with Matuteset al. (1994), Leukemia 8 (10): the points-scoring system of 1640-1645 is measured the CLL mark and is differentiated the CLL cell, is incorporated herein it in full as a reference.It is the CLL cell that the CLL mark is at least that 4 CD5+B cell is considered as.Confirmed in the CLL cell that separates, to have the disappearance in 13q14 zone, thereby removed the miR15/miR16 gene cluster.

By the standard method pCMV-miR15 CLL cell that transfection separates with pCMV-miR16.Extract total RNA as mentioned above, whether have miR15 or the miR16RNA that handled with Northern blot analyzing and testing with miR15 and the special probe of miR16.Carry out the stable integration that Southern blot hybridization has also confirmed miR15 and miR16 gene with miR15 and the special probe of miR16 gene order.

Embodiment 8-miR15 and miR16 gene outcome transfection candidate stem cell

As described belowly from the patient's that is diagnosed as CLL marrow, obtain candidate stem cell (HSC).

From patient's ilium collecting marrow with standard method under the conventional narcosis at operating room.Repeatedly aspirate with the heparinize syringe, obtain total amount and be about 750 to 1000ml marrow.The marrow of extracting out transferred at once transport in the medium (TC-199, Gibco, Grand Island, New York), this medium of every 100ml contains the heparin that does not contain preservative of 10,000 units.The marrow of extracting out is not contained cell aggregation thing, the cell suspension of cell fragment and bone particle by three meticulous gradually sub-sieves filtrations.The marrow that filtration is obtained further uses automated cell separator (for example Cobe2991 Cell Processor) to obtain " buffy coat " (promptly not containing red blood cell and hematoblastic leucocyte) then.

It is as described below that (Norway) the just selection of carrying out the CD34+ cell makes buffy coat prepared product part enrichment candidate stem cell (HSC) for Dynal A.S., Oslo with immunomagnetic beads.The buffy coat prepared product is resuspended in the medium that adds additive, and cultivates altogether with 1: 20 dilution ratio, put upside down test tube gently 45 minutes at 4 ℃ with mouse anti HPCA-I antibody.With the medium washed cell that adds additive three times, then be coated with sheep anti-mouse igg ₁(75 1 immunobeads/10 ⁷The microballon of the Fc fragment CD34+ cell) is cultivated altogether., the cell that sticks on the microballon is just selected after 45 minutes 4 ℃ of cultivations, according to the specification operation of manufacturer with the magnetic particle concentrator.

With 2 * 10 in the prepared product of enrichment HSC ⁴Individual cell is at 5ml polypropylene tube (Fisher Scientific, Pittsburgh, PA) cumulative volume that contains 2% people AB serum and 10mM Hepes buffer solution in is to cultivate in the Dulbecco ' s medium (IMDM) revised of the Iscove ' s of 0.4ml, and with standard method with pCMV-miR15 and pCMV-miR16 transfection.Analyze by Northern blot with the HSC of a part of transfection and to confirm wherein to express miR15 or miR16 RNA, with a part of HSC by Southern blot analysis confirmed wherein stable integration miR15 or miR16 gene order.With remaining transfectional cell with about 4 * 10 ⁸/ kg body weight is to about 8 * 10 ⁸The ratio of/kg body weight is implanted in patient's body again with the standard marrow transplant techniques may.

Repeat this experiment, except be used in transfection and remigrate before remove excrescence cell in the marrow with the ionization radiation, as described below.Adjust in the buffy coat prepared product cell to cell concentration in containing the TC-199 of about 20% autologous plasma, being 2 * 10 ⁷/ ml.In cell suspension, add recombined human hemopoieticgrowth factor rH IL-3 or rHGM-CSF with the excrescent growth of hematopoietic stimulation, thereby increase its susceptibility ionizing radiation.Then with these cellular exposure in the ionizing radiation of 5-10Gy, 4 ℃ with the TC-199 washing that contains about 20% autologous plasma once, use pCMV-miR15 and pCMV-miR16 transfection then as mentioned above.

Embodiment 9-contains the preparation of the liposome of miR15 or miR16

The preparation 1-of liposome is by the lactoyl cerebroside ester, phosphatidyl glycerol, lecithin and cholesterol were with molar ratio 1: 1: 4: 5 liposomes of forming are by United States Patent (USP) sequence number 4,235, anti-phase method of evaporating preparation described in 871 is incorporated herein it in full as a reference.In the pCMV-miR15 of the miR15 of the processing of 100g/ml or miR16 RNA or 500g/ml or the pCMV-miR16 aqueous solution, prepare liposome, therefore the liposome for preparing contains the miR15 or the miR16 RNA of processing, or pCMV-miR15 or pCMV-miR16 plasmid.

Then liposome is passed through 0.4 polycarbonate membrane, be resuspended in the salt solution, use 135mM sodium chloride, 10mM sodium phosphate pH7.4 comes by column chromatography and the separating substances that does not coat.Described liposome need not to modify and can further use perhaps as described below the modification.

Some liposomes that prepare are as mentioned above joined in the suitable reaction vessel, and adding contains 20mM sodium metaperiodate, the solution of 135mM sodium chloride and 10mM sodium phosphate (pH7.4) while stirring.The mixture that obtains under being about 20 ℃ condition, temperature was placed 90 minutes in the dark.(pH7.4) excessive periodate was removed in dialysis in 2 hours for 135mM sodium chloride, 10mM sodium phosphate with the 250ml brine buffer solution with reactant mixture.The product that obtains is the liposome that the hydroxyl of surface carbohydrate is oxidized to aldehyde-base.Target group or opsonic action suppress molecule and can combine with surface of liposome by these aldehyde group.

The preparation 2-preparation as described below of liposome is by maleimide benzoyl-phosphatidyl-ethanolamine (MBPE), second kind of liposome that lecithin and cholesterol are formed.MBPE can make the compound that contains sulfydryl, comprises the active phospholipid of protein and liposome coupling.

Myristoyl phosphatidyl-ethanolamine (DMPE) (100mmol) is dissolved in the 5ml absolute methanol of the triethylamine that contains 2 equivalents and 50mg m-maleimide benzoyl N-hydroxy-succinamide ester, as Kitagawa et al. (1976), described in the J.Biochem.79:233-236, be incorporated herein it in full as a reference.Continue reaction in room temperature and spend the night under nitrogen atmosphere, use chloroform/methanol/water (65/25/4) to carry out thin-layer chromatography then on silica gel H, this can quantitatively demonstrate DMPE to the transformation of moving product faster.Methyl alcohol is removed in decompression, and product is dissolved in the chloroform again.Extract chloroform phase twice with 1% sodium chloride, use chloroform/methanol (4/1) as solvent silicic acid chromatographic purifying maleimide benzoyl-phosphatidyl-ethanolamine (MBPE).After the purifying, thin-layer chromatography indicates the pure phosphoric acid salt that contains the negative spot of ninhydrine.

In miR15 or the miR16 RNA aqueous solution or 500g/ml pCMV-miR15 or pCMV-miR16 solution that 100g/ml handles, with above-mentioned United States Patent (USP) sequence number 4, anti-phase method of evaporating preparation in 235,871 is by MBPE, and lecithin and cholesterol are the liposome of forming at 1: 9: 8 with mol ratio.By column chromatography liposome and the separating substances that does not coat are come with 100mM sodium chloride-2mM sodium phosphate (pH6.0).

Embodiment 10-makes anti-CD5+ or anti-prostate tumor antibody combine with the liposome that contains miR15 or miR16

With the liposome preparation thing 1 that has the 2-group of 1.1ml (containing about 10mmol), or above-mentioned liposome preparation thing 2 is packed in the proper container.In this prepared product, add while stirring the 200mM cyanogen boron hydrogen sodium solution of 0.2ml and 1.0ml 3mg/ml directly at the monoclonal anti liquid solution of CD5+ cell surface marker or prostate tumor cells antigen.Continuing reaction in room temperature spends the night.With the mixture that obtains at BiogelA5M agarose column (Biorad, Richmond, Ca.; 1.5 * 37cm) upward separate.

Embodiment 11-suppresses the human prostate tumour with miR15 or miR16 gene outcome in vivo

Give nude inoculation hormone resistance human prostate gland cell system (PC-3), mouse is divided into processed group and control group.When the tumour in the mouse reaches time 100 to 250 cubic millimeters, will be wrapped in the miR15 of the processing in the liposome and the tumour that miR16 is injected directly into processed group.Only inject the liposome that is enclosed with carrier solution in the tumour of control group.Measure gross tumor volume in the research process always.Also estimated miR15 and miR16 gene outcome suppress the tumor of prostate growth in Dunning R-3327 mouse adenocarcinoma of the prostate model effect, as described below.Metastatic and malignant clone (RT-3.1) is inoculated in the Copenhagen mouse with the height of Dunning R-3327 adenocarcinoma of the prostate cell, then it is divided into processed group and control group.Two groups all form the entity tumor piece after the about week.MiR15 and the miR16 that injection is wrapped in the processing in the liposome in the tumour of processed group biweekly, injected for 5 weeks altogether then.The tumour of control group is only injected the liposome that contains carrier solution.Measure gross tumor volume in the research process always.

The related list of references of all this paper all is incorporated herein by reference at this.Those skilled in the art should understand easily, the present invention be very suitable for implementing and reach this paper mentioned with and intrinsic goal of the invention and advantage.The present invention can also and not deviate from its spirit and base attribute with other ad hoc fashion enforcement, correspondingly can be used as the reference of following claim rather than above-mentioned specification, characterizes protection scope of the present invention.

Sequence table

＜110〉Thomas Jefferson Univ.

West, M Crow, Carlow

George A card woods

＜120〉be used for the composition and the method for cancer diagnosis and treatment

<130>08321-0126PC

<150>60/425.864

<151>2002-11-13

<150>60/469,464

<151>2003-05-09

<160>54

<170>FastSEQ?for?Windows?Version?4.0

<210>1

<211>83

<212>RNA

＜213〉people

<400>1

ccuuggagua?aaguagcagc?acauaauggu?uuguggauuu?ugaaaaggug?caggccauau 60

ugugcugccu?caaaaauaca?agg 83

<210>2

<211>89

<212>RNA

＜213〉people

<400>2

gucagcagug?ccuuagcagc?acguaaauau?uggcguuaag?auucuaaaau?uaucuccagu 60

auuaacugug?cugcugaagu?aagguugac 89

<210>3

<211>22

<212>RNA

＜213〉people

<400>3

uagcagcaca?uaaugguuug?ug 22

<210>4

<211>22

<212>RNA

＜213〉people

<400>4

uagcagcacg?uaaauauugg?cg 22

<210>5

<211>23

<212>DNA

＜213〉artificial sequence

<220>

＜223〉probe

<400>5

cacaaaccat?tatgtgcttg?cta 23

<210>6

<211>21

<212>DNA

＜213〉artificial sequence

<220>

＜223〉probe

<400>6

gccaatattt?acgtgctgct?a 21

<210>7

<211>25

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>7

atacacctct?aaatatctgt?tccag 25

<210>8

<211>22

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>8

aagtaggacc?attctaatag?cc 22

<210>9

<211>20

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>9

gagtggcggt?gagaaggtat 20

<210>10

<211>20

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>10

agccattgct?atctttgagg 20

<210>11

<211>19

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>11

tgggatatgc?ttcagggac 19

<210>12

<211>21

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>12

agctgacctt?ggaatctggt?t 21

<210>13

<211>22

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>13

agatattgtc?tccgttccat?ga 22

<210>14

<211>22

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>14

cccagatata?aggacctggc?ta 22

<210>15

<211>25

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>15

cctggcctgt?tagtttttat?tgtta 25

<210>16

<211>22

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>16

cccagtcttg?ggtatgtttt?ta 22

<210>17

<211>17

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>17

gtttcgccaa?gcctgtt 17

<210>18

<211>22

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>18

gttgacaata?aaatacgcca?ca 22

<210>19

<211>20

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<221>misc_feature

<222>(1)…(20)

<223>n＝A，T，C?or?G

<400>19

ctgnggcaaa?aacaactctt 20

<210>20

<211>23

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>20

atctgtatgt?cctcctttca?atg 23

<210>21

<211>25

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>21

aacctcattt?aaatgtaaag?catca 25

<210>22

<211>24

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>22

gtaatgtcat?tgcttttgat?ttgc 24

<210>23

<211>23

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>23

ctcttgaggg?aaaaaaaaaa?tca 23

<210>24

<211>18

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>24

ccaggcaacc?aaccagtc 18

<210>25

<211>20

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>25

atacagactt?cccagtggct 20

<210>26

<211>25

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>26

agctattaaa?gttccctgga?taaat 25

<210>27

<211>20

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>27

aaggaatcag?agaaatgggg 20

<210>28

<211>20

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>28

gctgagtcag?agggatttga 20

<210>29

<211>21

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>29

agaggtaaac?aaaccaaacc?c 21

<210>30

<211>21

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>30

gctgacaatc?aagagaagat?g 21

<210>31

<211>21

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>31

aaaatcaggt?ggaaacagaa?t 21

<210>32

<211>20

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>32

aaaggctaac?atcgaaggga 20

<210>33

<211>18

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>33

cagaaccaga?gaaacagc 18

<210>34

<211>18

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>34

atggcacaac?agcttaac 18

<210>35

<211>22

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>35

gaatgcaggt?gtacctatca?ac 22

<210>36

<211>20

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>36

actgagtgac?tgctacccag 20

<210>37

<211>18

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>37

agctagccct?atcagggt 18

<210>38

<211>18

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>38

gtaagtggag?gttacctg 18

<210>39

<211>22

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>39

gaatcattcg?tgctaagtgg?at 22

<210>40

<211>22

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>40

tgccaactgc?ttgaagaatc?tc 22

<210>41

<211>22

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>41

acacctaact?cctgggttgt?tc 22

<210>42

<211>22

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>42

actaaatgcc?agcgtttgca?tg 22

<210>43

<211>21

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>43

ggtcttactc?tggttaaatc?t 21

<210>44

<211>21

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>44

cattggtagc?taaggaaaca?c 21

<210>45

<211>22

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>45

ccattcaagc?ctggacaatc?tt 22

<210>46

<211>22

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>46

gaaacttgag?acaataagga?gc 22

<210>47

<211>22

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>47

catgtaacca?agataaatcc?gt 22

<210>48

<211>22

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>48

ctggaaaatg?tatgtgatga?gg 22

<210>49

<211>22

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>49

ctgttgctat?ctgtaataac?ac 22

<210>50

<211>21

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>50

cttggaattt?tccactgaat?c 21

<210>51

<211>22

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>51

tcatcagaag?aaatcaaggc?ag 22

<210>52

<211>22

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>52

cagtgttagg?aatacgcatt?ca 22

<210>53

<211>24

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>53

ccttgccagt?acgcccacaa?gctg 24

<210>54

<211>27

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>54

ccccacctat?ggttgtagtg?agcatcc 27

Claims (74)

1. a method for the treatment of miR15 or miR16 cancers mediated in the patient of needs treatment comprises miR15 or the miR16 gene outcome of using the separation of effective dose to the patient, and the propagation of miR15 or miR16 cancers mediated cell is suppressed thus.

2. the process of claim 1 wherein that described miR15 or miR16 cancers mediated are chronic lymphocytic leukemia or prostate cancer.

3. the process of claim 1 wherein the mode administration of the miR15 of described separation or miR16 gene outcome by transfection patient cell.

4. the method for claim 3, wherein said cell is a candidate stem cell, chronic lymphocytic leukemia cell or prostate gland cancer cell.

5. the process of claim 1 wherein that the miR15 or the miR16 gene outcome of described separation use to the patient with the form in parenteral or the intestines.

6. administering mode is oral in the method for claim 5, wherein said intestines, rectum, or in the nose.

7. the method for claim 5, wherein said parenteral mode is selected from intravascular administration, organizes injection in periphery or the tissue, and hypodermic injection or deposition comprise h inf, directly application, and suck.

8. the method for claim 7, wherein said intravascular administration is selected from the quick high dose infusion of intravenous, intravenous infusion, the quick high dose infusion of intra-arterial, endoarterial infusion and instil to the conduit of vascular system.

9. the method for claim 7 is injected to be selected from outside the tumour and in the tumour outside the wherein said tissue and in organizing and is injected, and inject in the retina, or the retina rising pouring is penetrated.

10. the method for claim 7, wherein said hypodermic injection or deposition comprise uses the osmotic pump infusion.

11. the method for claim 7, wherein said direct application comprises by conduit, the retina ball, and suppository contains the implant of porous mass, contains non-porous material, perhaps contains the implant of the material of spawn.

12. the process of claim 1 wherein the miR15 of described separation or miR16 gene outcome with naked rna, or and delivery of agents together, perhaps to contain the nucleic acid administration of the sequence of expressing miR15 or miR16 gene outcome.

13. the method for claim 12, the wherein said nucleic acid that contains the sequence of expressing miR15 or miR16 gene outcome is recombinant plasmid or recombinant viral vector.

14. the method for claim 13, wherein said recombinant plasmid or recombinant viral vector comprise the U6 promotor, H1 promotor, or cytomegalovirus promoter.

15. the method for claim 13, wherein said recombinant viral vector is an adenovirus vector, gland relevant viral vector, retroviral vector, or herpesvirus vector.

16. the method for claim 15, wherein said retrovirus is selected from slow virus carrier, rhabdovirus carrier and murine leukemia poisonous carrier.

17. the process of claim 1 wherein miR15 or the miR16 gene outcome and the lipophilicity reagent of described separation, lipofectin, lipofectamine, cellfectin, polycation, or liposome administration together.

18. the method for claim 17, wherein said liposome contain opsonic action and suppress molecule.

19. the method for claim 18, wherein said liposome contain can be with the fixed part on chronic lymphocytic leukemia cell or prostate gland cancer cell of this liposome target.

20. the process of claim 1 wherein that described patient suffers from tumour, the miR15 of the separation of described effective dose or miR16 gene outcome are about at least 10mg/g tumor mass.

21. the method for claim 20, the miR15 of the separation of wherein said effective dose or miR16 gene outcome are about at least 60mg/g tumor mass.

22. the method for claim 20, the miR15 of the separation of wherein said effective dose or miR16 gene outcome are about at least 100mg/g tumor mass.

23. the method for claim 20, the miR15 of the separation of wherein said effective dose or miR16 gene outcome are about 10-500mg/g tumor mass.

24. the process of claim 1 wherein that the miR15 of separation of described effective dose or miR16 gene outcome are about 5 to the 3000mg/kg weight in patients.

25. the preferably about 700-1000mg/kg weight in patients of the method for claim 24, the miR15 of the separation of wherein said effective dose or miR16 gene outcome.

26. the process of claim 1 wherein that the miR15 of separation of described effective dose or miR16 gene outcome are greater than about 1000mg/kg weight in patients.

27. a method for the treatment of miR15 or miR16 cancers mediated in the patient of needs treatment comprises the steps:

1) isolated cell from the patient;

2) with the described cell of nucleic acid transfection of the sequence that contains the miR15 of the effective dose of encoding or miR16 gene outcome; And

3) cells transfected is implanted in patient's body again, miR15 among the patient or miR16 cancers mediated cell are suppressed thus.

28. the method for claim 27, wherein said miR15 or miR16 cancers mediated are chronic lymphocytic leukemia or prostate cancer.

29. the method for claim 28, wherein conclusive evidence is expressed described miR15 or miR16 gene outcome in transfectional cell before implanting cells transfected in patient's body again.

30. the method for claim 27, wherein the nucleic acid stability that conclusive evidence contains the sequence of the miR15 of the effective dose of encoding or miR16 gene outcome before implanting cells transfected in patient's body again is incorporated in the genome of transfectional cell.

31. the method for claim 27, the nucleic acid of the sequence of wherein said miR15 that contains the effective dose of encoding or miR16 gene outcome comprises recombinant plasmid or recombinant viral vector.

32. the method for claim 31, wherein said recombinant plasmid or recombinant viral vector comprise the U6 promotor, H1 promotor, or cytomegalovirus promoter.

33. the method for claim 32, wherein said recombinant viral vector is an adenovirus vector, gland relevant viral vector, retroviral vector, or herpesvirus vector.

34. the method for claim 33, wherein said retrovirus is selected from slow virus carrier, rhabdovirus carrier and murine leukemia poisonous carrier.

35. the method for claim 27, wherein said cells transfected are chronic lymphocytic leukemia cell or prostate gland cancer cell.

36. the method for claim 27, wherein said cells transfected is a candidate stem cell.

37. a method that suppresses miR15 or the cell proliferation of miR16 cancers mediated in the patient comprises to miR15 or miR16 cancers mediated cell and uses the miR15 or the miR16 gene outcome of the separation of effective dose.

38. the method for claim 37, wherein said miR15 or miR16 cancers mediated cell comprise chronic lymphocytic leukemia cell or prostate gland cancer cell.

39. the method for claim 37, the miR15 of wherein said separation or miR16 gene outcome are with the mode administration of transfection miR15 or miR16 cancers mediated cell.

40. the method for claim 37, the miR15 of wherein said separation or miR16 gene outcome be with naked rna, or and delivery of agents together, perhaps to contain the nucleic acid administration of the sequence of expressing miR15 or miR16 gene outcome.

41. the method for claim 40, the wherein said nucleic acid that contains the sequence of expressing miR15 or miR16 gene outcome is recombinant plasmid or recombinant viral vector.

42. the method for claim 41, wherein said recombinant plasmid or recombinant viral vector comprise the U6 promotor, H1 promotor, or cytomegalovirus promoter.

43. the method for claim 41, wherein said recombinant viral vector is an adenovirus vector, gland relevant viral vector, retroviral vector, or herpesvirus vector.

44. the method for claim 43, wherein said retrovirus is selected from slow virus carrier, rhabdovirus carrier and murine leukemia poisonous carrier.

45. the method for claim 37, the miR15 of wherein said separation or miR16 gene outcome and lipophilicity reagent, lipofectin, lipofectamine, cellfectin, polycation, or liposome administration together.

46. the method for claim 45, wherein said liposome contain opsonic action and suppress molecule.

47. the method for claim 45, wherein said liposome contain can be with the fixed part on chronic lymphocytic leukemia cell or prostate gland cancer cell of this liposome target.

48. a pharmaceutical composition contains miR15 or the miR16 gene outcome and the pharmaceutically acceptable carrier of separation.

49. the pharmaceutical composition of claim 48, the miR15 of wherein said separation or miR16 gene outcome are wrapped in the liposome.

50. the pharmaceutical composition of claim 49, wherein said liposome contain opsonic action and suppress molecule.

51. the pharmaceutical composition of claim 49, wherein said liposome contain can be with the fixed part on chronic lymphocytic leukemia cell or prostate gland cancer cell of this liposome target.

52. the pharmaceutical composition of claim 48, the degraded that the miR15 of wherein said separation or miR16 gene outcome can be resisted nuclease.

53. the pharmaceutical composition of claim 52, the miR15 of wherein said separation or miR16 gene outcome contain one or more ribonucleotides that has modification in 2 ' position.

54. the pharmaceutical composition of claim 53, containing wherein, each ribonucleotide all is the miR15 or the miR16 gene outcome of the 2 ' ribonucleotide of modifying.

55. the pharmaceutical composition of claim 53, the one or more ribonucleotides that wherein have modification in 2 ' position have fluorine in 2 ' position, amino, alkyl, alkoxyl, or the modification of O-allyl group.

56. the pharmaceutical composition of claim 53, the one or more ribonucleotides that wherein have modification in 2 ' position have the general formula of 2 ' AR-nucleotide, wherein:

A is oxygen or halogen (preferred fluorine, chlorine or bromine); And

R is hydrogen or straight chain or branch chain C _1-6Alkyl;

Wherein when A is halogen, then there are not X and R.

57. the pharmaceutical composition of claim 53, the one or more ribonucleotides that wherein have modification in 2 ' position are 2 '-O methyl ribonucleotides.

58. a pharmaceutical composition contains the miR15 of coding separation or the nucleic acid of miR16 gene outcome, and pharmaceutically acceptable carrier.

59. the pharmaceutical composition of claim 58, wherein said nucleic acid is wrapped in the liposome.

60. the pharmaceutical composition of claim 59, wherein said liposome contain opsonic action and suppress molecule.

61. the pharmaceutical composition of claim 59, wherein said liposome contain the part that this liposome target can be arrived surely CLL or prostate gland cancer cell.

62. method of diagnosing miR15 among the patient or miR16 cancers mediated, comprise the level of mensuration from miR15 in patient's the sample or miR16 gene outcome, wherein the level of miR15 or miR16 gene outcome is lower with respect to miR15 in the control sample or miR16 gene outcome in the sample, shows to have miR15 or miR16 cancers mediated.

63. the method for claim 62, wherein the detection method to miR15 or miR16 gene outcome level is the detection method that is selected from down group: northern blot analyzes, in situ hybridization and quantitative reverse transcriptase polymerase chain reaction (PCR).

64. being selected from, the method for claim 62, wherein said miR15 or miR16 gene outcome have sequence SEQ ID NO:1, SEQ ID NO:2, the gene outcome of SEQ ID NO:3 and SEQ ID NO:4.

65. the method for claim 62, wherein said miR15 or miR16 cancers mediated are chronic lymphocytic leukemia or prostate cancer.

66. method of diagnosing miR15 among the patient or miR16 cancers mediated, comprise that analysis is from miR15 in patient's the sample or miR16 gene, the miR15 or the miR16 gene that wherein detect in the sample that comes from the patient have one or more disappearances or sudden change with respect to miR15 in the control sample or miR16 gene, show to have miR15 or miR16 cancers mediated.

67. the method for claim 66, the detection method of wherein analyzing described one or more disappearance or sudden change are the detection methods that is selected from down group: Southern blot hybridization, sequence analysis and single stranded conformational polypeptide.

68. the method for claim 66, wherein said miR15 or miR16 cancers mediated are chronic lymphocytic leukemia or prostate cancer.

69. method of diagnosing miR15 among the patient or miR16 cancers mediated, comprise miR15 or the miR16 gene copy number measured in the sample that derives from the patient, wherein miR15 or miR16 gene copy number reduce to 1 or 0, then show to have miR15 or miR16 cancers mediated.

70. the method for claim 69, the minimizing of wherein said gene copy number is to lose mensuration by the D13S273 that analyzes the 13q14 place or the heterozygosis of D13S272 microsatellite marker, and wherein the heterozygosis of D13S273 or D13S272 microsatellite marker is lost and shown and have miR15 or miR16 cancers mediated.

71. the method for claim 70, wherein heterozygosis is lost and is to lose mensuration by the heterozygosis of analyzing D13S1150 or D13S273 microsatellite marker.

72. the method for claim 71, wherein heterozygosis is lost and is to lose mensuration by the heterozygosis of site of analysis Alu18 or D13S273 microsatellite marker.

73. the method for claim 69, wherein miR15 or miR16 gene copy number are by Southern blot hybridization assays.

74. the method for claim 68, wherein said miR15 or miR16 cancers mediated are chronic lymphocytic leukemia or prostate cancer.

Images