CN1386752A - Gene-recombinant anticoaglant protein - Google Patents

Abstract

A gene-recombinant anticoaglant protein is a recombinant protein TANX 32 expressed in colibacillus after genetical modification of cysticercus cellulosae annexin 32. It has three structure domains composed of 251 amino acids and 27 KD of molecular weight. Its advantages are high anticoagulant effect, easy purifying, low cost and high physical and chemical stability.

Description

A kind of gene recombination anticoagulant protein

The present invention relates to the medical biotechnology field, is a kind of anticoagulant protein with anticoagulation and thrombus target function of being transformed the back expression by annexin 32 genes (annexin32).

Thrombosis is the cardiovascular disorder that a class seriously jeopardizes human health and life as Acute Myocardial Infarction (AMI), venous thromboembolism etc.Present antithrombotic reagent mainly is divided into thrombolysis medicine and anticoagulant.Anticoagulant can be divided three classes by the mechanism of action: (1) zymoplasm indirect inhibitor, as heparin; (2) the direct inhibitor of zymoplasm is as lepirudin 023 ludon; (3) vitamin K antagonist is as warfarin etc.The target site that preceding two class drug mains are wanted is a zymoplasm, though the anti-freezing effect is obvious, in the body transformation period short, and untoward reaction such as usually can cause bleeding.Warfarins etc. mainly by hindering the metabolism of vitamin K, play the anticoagulation purpose indirectly.The shortcoming of this medicine is that onset is slow, and usually can cause bleeding and cutaneous necrosis.Thereby these anticoagulation medicines are all not really desirable at present.

The annexin of finding from people's placenta tissue the end of the seventies (Annexins) is the protein family that a class has strong anticoagulant active.Its anti-freezing mechanism is: in " waterfall type " reaction of blood coagulation, thrombocyte at first activates, and the phosphatide membrane assymmetry changes, and originally the phosphatidylserine (PS) in the thrombocyte inboard exposes.Plasma thromboplastin component, X are being activated under the situation that calcium ion exists and after the combination of thrombocyte phosphatidylserine.And annexin is when calcium ion exists, equally can be rapidly and acidic phospholipid such as phosphatidylserine combination, thus competitive inhibition plasma thromboplastin component, X are with the combination of platelet membrane phosphatide, the activation of the anticoagulant factor.And then the formation of Trombin inhibiting, reach anticoagulant purpose.Compare with traditional anticoagulation medicine, annexin is the indirectly formation of Trombin inhibiting by competition platelet membrane phosphatide, does not destroy the activity of thrombin, thereby can not produce the side effect such as hemorrhage that is caused by the minimizing of thrombin.Simultaneously, but utilize the annexin specific recognition and, thereby can be used for guiding video picture based on the arterial thrombus of activated blood platelet in conjunction with the acid membrane phospholipid that activated blood platelet exposed; Can also annexin be carrier, combine, the thrombolytic drug of development thrombus target with thrombolytic agent such as t-PA etc.

The objective of the invention is to have the characteristic of anticoagulation and thrombus target function, provide side effect anticoagulant proteins little, with low cost such as a kind of anticoagulating active is strong, hemorrhage, to be further used for the preparation of anticoagulation medicine according to above-mentioned annexin.

Anticoagulant protein of the present invention is by annexin 32 genes (annexin32) of being cloned in the cysticercus cellulosae cDNA library are transformed the recombinant protein of back at e. coli expression.The annexin32cDNA sequence is in GeneBank login, accession number: AF147955.347 amino acid whose protein of this genes encoding, molecular weight 38kDa.Utilize the annexin 32 of escherichia coli prokaryotic expression system expression, show, have stronger anticoagulant active, and do not see the hemorrhage reaction that causes experiment mice through mouse animal experiment.The structural analysis of annexin 32 shows that except 27 amino acid short peptides of N end, all the other 320 amino acid form the structural domain I of 4 structural similitudies, and II, III, IV, each structural domain comprise a relatively independent calcium phospholipids incorporate site.Inventor imagination: if this albumen is removed some in 27 amino acid of N end and above-mentioned 4 structural domains, whether can both keep its anticoagulant active, again because the reducing of molecular weight, and the caused untoward reaction of the antigenicity that reduces heterologous protein? based on above-mentioned imagination, the inventor has carried out genetic modification to annexin32, has made up a series of sequence deletion mutant.Mutant has carried out the anticoagulating active detection behind escherichia coli expression, find wherein to have removed 27 amino acid of N end and C and hold the recombinant protein of the 4th structural domain to have anticoagulant active preferably.The present invention is and selects this gene mutation body expressed recombinant protein in intestinal bacteria for use.At this, mutant gene represents that with tanx32 this mutant gene is represented with TANX32 at the recombinant protein of expression in escherichia coli.TANX32 is made up of 251 amino acid, and molecular weight is 27kDa.

Description of drawings:

Fig. 1 is annexin32 whole gene cDNA sequence and corresponding amino acid coding

Previous column is the cDNA sequence, length: 1044bp;

Next classifies corresponding amino acid sequence as, length: 347 amino acid.

Fig. 2 is recombination tanx32 cDNA sequence and corresponding amino acid coding

Previous column is the cDNA sequence, length: 756bp;

Next classifies corresponding amino acid sequence as, length: 251 amino acid

Fig. 3 is the molecular structure that utilizes the TANX32 of homology modeling method foundation

Fig. 4 is the structure schema of thermal induction type prokaryotic expression plasmid pJM-tanx32

Fig. 5 detects the anticoagulant active experimental result of TANX32 for KPTT

Fig. 6 detects the anticoagulant active test-results of TANX32 for the rabbit thrombus model

Below in conjunction with accompanying drawing, preparation method of the present invention is described in detail.

One, genetic modification-structure recombination tanx32

See Fig. 1, the cDNA of annexin32 comprises 5 ' non-translational region, 3 ' non-translational region and intermediary encoding sequence.According to the protein structure of this genes encoding, except 27 amino acid of N end regions, all the other 320 amino acid form the repeating structure territory of four structural similitudies, respectively with I, and II, III, IV represents.

CDNA sequence with above-mentioned annexin32 is a template, utilizes the method for PCR, amplification coding structural domain I, II, the nucleotide sequence of III.Forward primer is: 5 ' G GAATTCATGGCCTACTGTCGCTCC3 ' wherein comprises EcoRI restriction endonuclease sites " GAATTC " and initiator codon " ATG ".Reverse primer is: 5 ' G GTCGACTTAACCTGACTGCGAGTGGAG3 ', wherein comprise terminator codon TAA and SalI restriction enzyme site " GTCGAC "Adopt the TaKaLa pfu of company high-fidelity DNA polymerase, 50ul reaction system, 25 circulations.The temperature of sex change, annealing, extension is respectively: 94 ℃, 55 ℃, 72 ℃.(referring to " molecular cloning " related Sections, Science Press, 1992 publish).The tanx32DNA sheet cracked ends genecore company order-checking that obtains after the amplification confirms that sequence is entirely true.Nucleotide and the corresponding amino acid sequence of tanx32 are seen Fig. 2.

For analyzing the biologic activity whether improved albumen has the calcium phospholipids incorporate, the homology modeling program SWISS-Model that utilizes European information biology center to provide carries out the TANX32 molecular model and makes up.The homology modeling is a kind of very effective method of analyzing proteins structure and predicted protein function in recent years, as shown in Figure 3, the basic structure of TANX32 molecule is a flat tubbiness, be arranged in parallel by three similar structural domains and form, each structural domain all has a calcium ion binding site, be respectively CA1, CA2, CA3.Pro200 represents this albumen and acid phosphorus adipose membrane (as phosphatidylserine PS) bonded critical sites among the figure.The molecular structure that this recombinant protein is described still has typical calcium phospholipids incorporate site, that is still has anticoagulant molecular structure basis after the genetic modification.

Two, the structure of thermal induction prokaryotic expression plasmid pJM-tanx32

See Fig. 4, the tanx32 dna segment that utilizes above-mentioned PCR method amplification to obtain, purifying according to a conventional method, and use EcoRI and SalI double digestion respectively, directed cloning is gone into equally with the plasmid vector pJM (Promega company) behind EcoRI and the SalI double digestion then, and the recombinant plasmid that obtains is called pJM-tanx32.Thermal induction type expression vector pJM total length 4.9Kb (kilobase to) contains plasmid replication starting point (ori), ammonia benzyl resistant gene (AP ^r) and P ^RP ^LPromotor.The present invention adopts thermal induction type expression vector, and when mainly considering large scale culturing, thermal induction mode cost is lower, and expression amount also can be satisfied the demand substantially.Certainly also can adopt other prokaryotic expression system, as utilize IPTG inductive expression system, perhaps adopt yeast expression system.

Three, preparation engineering bacterium K802 (pJM-tanx32)

Behind the plasmid pJM-tanx32 transformed into escherichia coli bacterial strain K802 of above-mentioned structure engineering bacteria.Adopting calcium chloride transformation commonly used to carry out plasmid transforms.

1, the preparation of competence bacterium places the 50mlLB substratum with host's bacteria strain K802 earlier, and this substratum contains 1% Tryptones, 0.5% yeast extract and 1% sodium-chlor, and pH7.0,37 ℃ of shaking culture are to OD ₆₀₀Be 0.4 o'clock, 4 ℃ with 4000rpm centrifugal 10 minutes, remove supernatant.The host bacterium suspends with the calcium chloride solution of the 100mmol/L of 5ml ice precooling, centrifugal 2 minutes of 10000rpm, and the calcium chloride solution of icing the 100mmol/L of precooling with 1～2ml suspends.Ice bath 2 hours is the competence bacterium.

2, plasmid transforms pJM-tanx32 plasmid 100ng and the above-mentioned competence bacterium mixing that will make up and is placed on ice bath 30min.42 ℃ of heat-shockeds are 90 seconds then, ice bath 10 minutes.The LB substratum that adds 0.8ml, cultivated 1 hour for 37 ℃, get the 0.2ml converted product and coat and contain on the antibiotic LB agar plate of ammonia benzyl, cultivated 12-15 hour for 37 ℃, can obtain to contain the mono-clonal bacterium of recombinant expression plasmid pJM-tanx32, be engineering bacteria K802 (pJM-tanx32).

3, the abduction delivering of recombinant protein TANX32

Single bacterium colony of the above-mentioned engineering bacteria of picking contains to 100ml in the LB substratum of ammonia benzyl 50mg/L respectively, 28 ℃ of jolting overnight incubation.Next day, get 100ml bacterium liquid and be seeded in the 1L LB substratum that contains ammonia benzyl 50mg/L, continue 28 ℃ of shaking culture, (spectrophotometer detects, and wavelength is that 600nm place light absorption value is A to bacterial growth to logarithmic phase ₆₀₀=0.5) time, place 70 ℃ of hot water baths to be rapidly heated nutrient solution, again in 42 ℃ of shaking culture 5～7 hours to 42 ℃.A ₆₀₀Increase to about 1.2, can express a large amount of recombinant protein TANX32 in the thalline.

4, the purifying of recombinant protein TANX32

With centrifugal 10 minutes of the bacterium liquid 10000rpm after cultivating, abandon supernatant.With 1 * PBS damping fluid suspension thalline, conventional carrying out ultrasonic bacteria breaking.When ultrasonic, adjust ultrasound parameter, can stop when translucent when bacterium liquid is faded to by muddiness, and note not having foam to produce according to bacterial concentration and volume.10000rpm is centrifugal 5 minutes then, gets supernatant, progressively adds saturated ammonium sulphate solution to saturation ratio 60% in supernatant liquor, with the precipitation foreign protein.Centrifugal 5 minutes of 10000rpm gets supernatant, behind the constant volume, progressively adds saturated ammonium sulphate solution to saturation ratio 80% again, and slowly stirs with magnetic stirring apparatus, with precipitation recombinant protein TANX32.10,000rpm is after centrifugal 5 minutes, collecting precipitation, and with 2 times of 20mM to precipitation volume, the dissolving of the TrisHCl damping fluid of pH8.0.Be transferred to the desalination of dialysing in the dialysis tubing then, dialyzate is 20mM TrisHCl, 100mM urea, pH8.0.Dialysed 14 hours, and changed dialyzate therebetween 2～3 times for 4 ℃.

Behind the dialysis desalination, carry out ion exchange chromatography with weak anionic exchange column (chromatography media is a diethylin ethyl agarose, DEAE Sepharose FastFlow, Pharmacia company).At 20mM TrisHCl, under the pH8.0 condition, carry out the isoconcentration gradient elution from 0～1mol/LNaCl, utilize polyacrylamide gel electrophoresis (SDS-PAGE) to determine the peak value at recombinant protein place.Collect the peak value elutriant, use 20mM TrisHCl, 100mM urea after the dialysis of pH8.0 dialyzate concentrates, is further removed impurity through SephacrylS-200 (Pharmacia company) gel filtration chromatography again.The recombinant protein sample liquid is examined the dyeing of Ma Shi light blue and is shown as single protein band through the 10%SDS-PAGE electrophoretic separation, illustrates to obtain pure TANX32.Adopt Coomassie brilliant blue staining (Bradford method) to measure purifying protein concentration, calculate recovery rate.With packing after the gained protein frozen drying, put 4 ℃ of preservations.(above-mentioned method for purifying proteins is main with reference to " protein purification and identification experiment guide ", Science Press, 2000).

The purifying of recombinant protein TANX32 of the present invention is conventional protein purification technology, utilizes this cover purifying process, and every gram bacterium can be obtained about 30mg TANX32.Can be part with phosphatidylserine (PS) also according to proteic Ca-dependent phospholipids incorporate activity, affinitive layer purification albumen.Purification step is simple, and purifying yield height, but cost is too big.

Be the anticoagulation function of the checking albumen TANX32 that obtains, mainly done following experiment:

(1) adopt white bole activated prothrombin time (KPTT) to carry out external anti-freezing experiment, for carrying out at present the standard method of patients serum's thrombin check clinically.Method is: get the part activated thromboplastin reagent of 100 μ L, add the testing sample of the different protein concentrations of 100 μ L, 37 ℃ of incubation 10min.The reference blood plasma that adds 100 μ L then, 37 ℃ of incubation 3min.Add 100ul 25mMCaCl again ₂Solution, measured reaction thing setting time.Experiment is detected by RockPotor Thrombolyzer automatic tester.The results are shown in Figure 5: the clotting time of blank is 41 seconds, and the TANX32 protein concentration is to be respectively 62 seconds in clotting time of 30 μ g/mL, 50 μ g/mL, 70 μ g/mL, 120 seconds, 140 seconds, illustrates that the present invention has tangible anticoagulant effect.

(2) be the interior anticoagulating active of body that further detects recombinant protein TANX32, adopt extracorporeal thrombosis forming device (Puli gives birth to instrument company) to set up rabbit animal thrombus model.Every rabbit weight 2.5-3.0Kg, auricular vein injection TANX32 solution, dosage is 0.5mg albumen/Kg body weight.The formation situation of inject back half an hour, 1 hour, observing thrombus in 1 and a half hours respectively.Experimental result is seen Fig. 6: injected back 1 hour, the thrombus length of recombinant protein experimental group is 1.8cm, and physiological saline (1 * PBS) control group is 4.2cm.Illustrate that recombinant protein TANX32 has tangible blood coagulation resisting function.

Advantage of the present invention and positively effect:

Gene recombinant protein TANX32 anticoagulant effect of the present invention is obvious, and it does not destroy existing thrombin, and therefore untoward reaction such as can not cause bleeding can be used for the anticoagulation therapy behind the thrombolysis, prevents embolism once more.TANX32 is little because of molecular weight, so cause that the possibility of untoward reaction is also little.In addition, according to recombinant protein TANX32 thrombus target function, can be used for the thrombus video picture clinically, be carrier with this proteinoid perhaps, amalgamation and expression thrombolytic drug, the newtype drug that development has thrombolysis and anticoagulation function.Gene recombinant protein TANX32 of the present invention, physico-chemical property is stable, can preserve at normal temperatures for a long time after packing, lyophilize.During use with after 25% the glucose for injection salt water dissolution, intravenous injection.

Use engineering bacteria of the present invention to prepare the embodiment of recombinant protein TANX32:

Take out frozen engineering bacteria K802 (pJM-tanx32) after room temperature is melted from-80 ℃ of refrigerators, dip in the bacterium liquid streak inoculation that takes a morsel in 1.5% the LB agar plate that contains 50 μ g/mL ammonia benzyls with transfering loop.After 37 ℃ of overnight incubation, get mono-clonal and be inoculated in the LB nutrient solution that 50ml contains 50 μ g/mL ammonia benzyls, it contains 1% Tryptones, 0.5% yeast extract and 1% sodium-chlor, pH7.0.Cultivated 40 hours for 37 ℃, as seed liquor.In 1: 20 ratio seed liquor is inoculated in 1 liter and contains 50 μ g/mL LB nutrient solutions.After 5 hours triangle is shaken bottle in 37 ℃ of cultivations and place 70 ℃ of hot water baths to be rapidly heated, place 42 ℃ of shaking culture to carry out thermal induction in 8 hours again to 42 ℃.

Bacterium liquid after thermal induction is cultivated centrifugal 5 minutes in 10000rpm is collected thalline.Thalline is suspended in 50ml 1 * PBS damping fluid, is distributed into 5 pipes, every pipe 10ml, conventional carrying out ultrasonic bacteria breaking.10000 rpm centrifugal 5 minutes then, get supernatant.According to the temperature of supernatant liquor, (Yan Ziying translates for fine works molecular biology experiment guide, Science Press according to solid-state ammonium sulfate fractional separation table.The nineteen ninety-five publication) data that provide progressively add saturated ammonium sulphate solution to saturation ratio 60% at this supernatant liquor, remove foreign protein.Centrifugal 5 minutes of 10000rpm gets supernatant, behind the constant volume, progressively adds saturated ammonium sulphate solution to saturation ratio 80% again, and slowly stirs with magnetic stirring apparatus.10,000rpm is collecting precipitation after centrifugal 5 minutes, with 2 times to the 20mM of precipitation volume TrisHCl, pH 8.0 damping fluids dissolvings.Carefully be transferred in the dialysis tubing, with dialyzate 20mM TrisHCl, 100mM urea, pH8.0 dialysed 14 hours for 4 ℃, and it is asked and changes 2～3 dialyzates.

The protein sample of above-mentioned dialysis desalination carries out ion exchange chromatography through DEAE Sepharose FF.With 20mM TrisHCl, pH8.0+1mol/L NaCl pH8.0 constant gradient wash-out utilizes polyacrylamide gel electrophoresis (SDS-PAGE) to determine the peak value at recombinant protein place.Collect the elutriant of peak value section, dialysis concentrates, and is further purified through Sephacryl S-200 gel column, and final protein sample is examined the dyeing of Ma Shi light blue and is shown as single protein band after the 10%SDS-PAGE electrophoretic separation.Adopt Coomassie brilliant blue staining (Bradford method) to measure purifying protein concentration, calculate recovery rate.After lyophilize, finished product is made in packing.

Claims (2)

1, a kind of gene recombination anticoagulant protein is characterized in that being made up of 251 amino acid, and aminoacid sequence is:

FSPTADAEHL?KRAMRGLGTN?ERAIIDILGN?RTSMRGLGTN?ERAIIDILGN?RTSAERMAIR

DAYPSISSKT?LHDALTSELS?GKFRRFALLL?IQSPWQVMAE?ALYDAMKGAG?TKERVLNEII

AGCSKDDIPQ?LKKAFEEVSG?GETLDDAIKG?DTSGDYREAL?LLALAGQADE?PQAMQLKNLT

PSTLSQVVNP?GLAETDAKEL?YACGEGRPGT?AESRFMRPIV?NRSFLQLNAT?NEAYNRAYGH

EDFLITRVRY?A

2, the described gene recombination anticoagulation of claim 1 egg is from the purposes that is used to prepare anticoagulant or thrombus target thrombolytic drug.

Images