CN1332028C - Functional peptide of milk agglutinin and method for preparing same - Google Patents

Abstract

The present invention discloses a functional peptide of milk agglutinin and a preparation method of the functional peptide of milk agglutinin. The preparation method of the present invention comprises: total RNA is extracted from thirteen kinds of tissue mixtures of human beings to be worked as a first chain of cDNA; the first chain of cDNA is used as a template for extracting the total RNA from a hooked MGEF8 gene; a gene product of the functional peptide of human milk agglutinin is prepared by RT-PCR technology and cDNA PCR. A target protein is firstly obtained by a protein engineering method by the present invention. The target protein obtained by the method has the characteristics of repeatable extraction, sufficient amount, high purity, no toxicity and antigenic reservation. The present invention provides the guarantee of quality and quantity for the further study and the applications of the target protein.

Description

A kind of functional peptide of milk agglutinin and preparation method

Technical field

The invention belongs to biomedical sector, can be applicable to anti-rotavirus and infect, regulate infant's gi tract immunologic function and intestinal epithelial cells function maturation, and be applied to the infant care field.

Background technology

A large amount of epidemiology surveys shows that whole world rotavirus infection is the main cause of disease that causes children's diarrhae.There are every year 870,000 children below 5 years old to die from this disease approximately in developing country, account for 25% of the number of dying of dying of illness of children's diarrhae below 5 years old, account for 6% of all cause of disease death tolls.Wherein rotavirus GroupA is in the mankind's the widest popular type, estimates the annual death toll about 800,000 that is caused by GroupA.The annual sufferer of infantile diarrhea below 5 years old disease reaches 2.5 hundred million times through investigation China, and rough estimates show to have at least 100,000 children to die from rotavirus infection diarrhoea.But still there is not the specific anti-rotavirus medicaments at present.This shows that rotavirus diarrhea has caused important social and economic impact.

WHO in 1997 formally will develop Rotavirus Vaccine and classify primary vaccine developing goal as.Classified the candidate vaccine at present as and included attenuation human rotavirus vaccine (human rotavirus vaccinHRV): strains such as Wa strain, M37, MCN13; but their protective effect instability; as the protection ratio of Wa vaccine in Philadelphia is 76%; protection ratio in the Cincinnati is 100%, and is 49.6% at the protection ratio of Chinese Shanghai.The tetravalence reassortant vaccine of latest developments (rhesus rotavirus RRV-TV) is though have reliable security but protectiveness still has than great fluctuation process at country variant.Although with the plan inoculation on probation of this vaccine, expensive price has hindered its application in developing country in the U.S..

Recently the research of breast milk is having new progress aspect the anti-rotavirus infection, discover in developing country and developed country, the dysentery sickness rate is low than the artificial feeding infant in the breast-feeding infant, although also there are some sickness rate that studies show that dysentery similar in both, can affirm the breast-feeding infant rotavirus infection after symptom be lighter than the artificial feeding infant.By affinitive layer purification draw lactadherin (Lactadherin) be in the breast milk with the highest composition of the crosslinked the strongest and antiviral specificity of rotavirus, and do not contain Lactadherin in the formulated milk, therefore the further research to Lactadherin will be expected to provide new thinking for anti-rotavirus infects.

Lactadherin is that a kind of N holds glycosylated 46KD size to have immunogenic glycoprotein, form by 364 amino acid, Arg-Gly-Asp (RGD) the N end that contains Urogastron (EGF) spline structure can be crosslinked with α V β 3 integration plain (α V β 3-integrin).Hamosh has detected that the content of Lactadherin is about 93 ± 10mg/ml in the breast milk, and is more with first Ruzhong content, but understands still few at present to the physiological function of Lactadherin.In the research of system of the same race not, find that the structural domain of Lactadherin sequence in people, mouse and ox is quite conservative, so the Lactadherin of a large amount of animal milks and synthetic provides enough resources for our research.

VP4 in the rotavirus (by the gene4 proteins encoded) is the attachment proteins of virus, be virus replication and produce immunogenic basis, thereby in the presence of sialic acid Lactadherin can with the crosslinked inhibition of virus virus replication, alleviation symptom of diarrhea.Still can not detect anti-rotavirus antibody even studies show that breast feeding babies when the rotavirus infection symptom occurring, prompting is crosslinked with rotavirus, and stoping virus replication is not unique mechanism of Lactadherin anti-rotavirus.After known food and microbial antigen stimulate, intestinal intraepithelial lymphocytes in the gut-associated lymphoid tissue (intraepithelial lymphocytes, IEL) propagation and form active T lymphocyte colony at the enteric epithelium layer, the IEL that is activated has (1) dissolved cell activity; (2) produce auxiliary activity by secrete cytokines; (3) stimulate cell renewal between epithelium; (4) to the effect of food allergen tolerance etc., thus protection enteron aisle and excite other Lymphoid tissues to produce further reaction.There are some researches show α V β 3-integrin is arranged on mammary gland and vascular endothelial cell and the lymphocyte; Lactadherin can be crosslinked with it and be promoted the propagation of these cells, but Lactadherin to the effect that is produced of lymphocyte and endotheliocyte and the enteron aisle protective immunity effect that causes subsequently really cutter system it be not immediately clear.We known Lactadherin all has activity and structure not by destructions such as proteolytic enzyme under any pH value of stomach, guaranteed that Lactadherin arrives enteron aisle with complete 26S Proteasome Structure and Function.We suppose that courageously (1) Lactadherin or Lactaherin and rotavirus can stimulate enteric epithelium T lymphopoiesis after crosslinked and produce cytokine and then cause a series of liquid immune responses; (2) enteron aisle chorion epithelioma cell comes off along with the massive duplication of virus during rotavirus infection, quickened the secretory sheet cell on move, these immature epithelial cells that still are in secretor state have increased the weight of water, electrolytical disorder.Have report point out breast milk particularly colostrum promote the growth of intestinal epithelial cells by the genetic expression of regulating gut epithelium, therefore we will inquire into Lactadherin quickening intestinal epithelial cell maturation from another point of view, substitute the effect that impaired epithelial cell is brought into play in anti-rotavirus.

By Lactadherin being regulated the research of GALT function and intestinal epithelial cells maturing, that inquires into that its anti-rotavirus infects may mechanism, for clinical development with utilize Lactadherin treatment rotavirus infection diarrhoea that the important theory foundation is provided.

Prior art is to utilize column chromatography and affinity chromatography directly to extract target protein matter lactadherin from cow's milk.This law specifically by collecting a large amount of fresh (extruding in 4 hours) cow's milk without any processing, according to the difference of the protein molecular weight in the fat globule membrane in the cow's milk, is carried out chromatographic separation, utilizes method such as affinitive layer purification to extract again and obtains target protein matter.

Prior art has following deficiency or shortcoming:

Raw material sources: gathered the fresh undressed cow's milk difficulty within back 4 hours in a large number.

Sample Quality Control: its quality control difficulty of the cow's milk of different sources.

The sample yield: it is many to utilize the affinity chromatography method to separate loaded down with trivial details, the consuming time length of target protein matter process (about 1 week), yield poorly (0.35ug/ml), uncontrollable factor.

Summary of the invention

The objective of the invention is to overcome the deficiencies in the prior art, a kind of functional peptide of milk agglutinin and preparation method thereof is proposed, its (1) does not need to guarantee fresh cow's milk without any processing, the DNA that only need preserve reorganization can obtain fresh activated protein repeatedly, has solved starting material source difficult problem; (2) obtain a kind of have can repeat extraction, capacity, purity height, nontoxicity, the antigenic target protein matter of reservation.

The objective of the invention is to realize by following technological method: the inventive method comprises the preparation of goal gene functional peptide of milk agglutinin, the structure of expression plasmid, wherein plasmid is selected from pET-28a, pET-28b, the purification assays of target protein functional peptide of milk agglutinin etc.

The preparation of goal gene functional peptide of milk agglutinin at first is to organize extracted total RNA the mixture from human 13 kinds, uses the RT-PCR technology its reverse transcription become cDNA, and with cDNA the gene product that template is prepared people's lactadherin functional peptides.

After obtaining functional peptide of milk agglutinin gene PCR product, this gene can be used for prokaryotic system expresses to obtain needed target protein, prokaryotic expression system use the most extensively and to become hot the most be escherichia expression system, the structure that is used for the expression plasmid of this system at first is that the goal gene that PCR prepares is separated through agarose gel electrophoresis, after the glue of QIAGEN company reclaims the fragment column purification, get 100ng and be connected, spend the night in 16 ℃ of connections with 50ng pET-28a (+).Get 5uL and connect liquid and transform 50uL DH5 α tm library efficiency chemically competent cells, transformant was through 42 ℃ of heat-shockeds 50 seconds, and 37 ℃ (concussion is applied to the kantlex flat board, 37 ℃ of overnight incubation after cultivating 1h.Picking list bacterium colony extracts plasmid, carries out the determined dna sequence that enzyme is cut evaluation and gene, positive plasmid is transformed into the BL-21 competent cell after measurement result is entirely true again, detects and expresses.

37 ℃ of overnight incubation of BL21/pET-28a (+) functional peptide of milk agglutinin clone; the next day with 10 times of LBbroth substratum dilutions; continue to cultivate 3 hours; with ITPG abduction delivering 4～12 hours; collect bacterium and extract protein; utilize Triton X-100 and ultrasonic method broken cell film and inclusion body film, add proteinase inhibitor, the protection target protein.After after ultracentrifugation obtains supernatant, utilize the affinity column (Ni-chelatingcolum) of specificity nickel chelating, by binding buffer liquid, lavation buffer solution, the elution buffer of different concns, wash-out obtains the target protein of purifying.The functional peptide of milk agglutinin that purifying obtains detects through SDS-PAGE detected through gel electrophoresis, monoclonal antibody specific, obtained proteic correct with conclusive evidence, because whole protein Preparation process has kept proteic activity without the process of chemical modification and renaturation, has saved a large amount of time.

A kind of functional peptide of milk agglutinin of the present invention disclosed (1); (2) functional peptide of milk agglutinin preparation method.

Its advantage applies exists: (1) utilizes the means of protein engineering to obtain target protein matter (functional peptide of milk agglutinin) first;

(2) the target protein matter of utilizing institute's employing method to obtain has and can repeat extraction, capacity, purity height, nontoxicity, the antigenic characteristics of reservation;

(3) all difficulties that original method is brought have been solved;

(4) assurance that provides quality and quantity for the further research and the application of target protein matter;

(5) provide the method for target protein matter industrialization.

Description of drawings

Fig. 1 shows the PCR product of functional peptide of milk agglutinin gene.M, DNA marker (100bpladdermarker, 2000,1500,1200,1000,900,800,700,600,500,400,300,200,100) PCR products (MFGE8), MFGE8 are the functional peptide of milk agglutinin gene.

Fig. 2 shows functional peptide of milk agglutinin recombinant plasmid structure.

Fig. 3 shows the success of enzyme blanking method evaluation plasmid construction.

Fig. 4 shows that enzyme is cut and identifies that correct recombinant plasmid carries out the dna sequencing result.

Fig. 5 shows the result of functional peptide of milk agglutinin expression.Behind M, standard molecular weight albumen 1, abduction delivering whole bacterial protein 2, broken bacterium supernatant 3, solubilization of inclusion bodies postprecipitation 4, the solubilization of inclusion bodies when supernatant 5, purifying stream wear the MFGE8 albumen of component 6, purifying.

Fig. 6 shows functional peptide of milk agglutinin expression back SDS PAGE electrophoresis result.

Fig. 7 shows monoclonal antibody specific Western blot detected result.

Fig. 8 shows that extracting target protein matter Sepharys-200 in the cow's milk crosses post result (before the purifying).

Fig. 9 shows extraction target protein matter affinity chromatography result (behind the purifying) in the cow's milk.

Figure 10 shows two kinds of method gained target protein quantitative analysis results, AN-5: make up the expressed purifying protein of plasmid, A4: the albumen that extracts in the cow's milk

Figure 11 shows the MFGE8 gene order.

Embodiment

Below in conjunction with embodiment the present invention is further described.

Embodiment 1

One, material:

13 kinds of tissues are supplied by Shanghai Genomics; PCR-Kit purchases the company in TAKARA; Taq enzyme, dna molecular amount standard are purchased in Shanghai bio-engineering corporation; Restriction enzyme, T4 ligase are purchased the company in NEB;

Bacterial classification and plasmid: transformant (DHa-MAX, BL-21) is purchased the company in Novagen; PET-28a purchases the company in Promega;

The PCR primer is synthetic by Shanghai Genomics.

Reagent: ITPG purchases the company in Sigma; Affinity column is purchased the company in Roche; His-tag antibody is purchased the company in Pharmingen.

Two, method:

Organize the total RNA of mixture to extract for (1) 13 kind

1) gets 13 kinds and organize mixture (seeing Table 1), with TES washing, the centrifugal supernatant of abandoning;

2) adding 2ml Trizol damping fluid concuss is transferred in the centrifuge tube of 2ml;

3) add 400uL chloroform concuss, room temperature left standstill 5 minutes, and centrifugal 10 minutes of 4 ℃ of 14000rpm get supernatant, add isopyknic Virahol, shook up gently that to leave standstill 5 minutes centrifugal 15 minutes speed the same;

4) abandon supernatant, precipitation is washed 3 times drying at room temperature with 70% ethanol;

5) precipitation is got 5uL and is extracted RNA with 50uLDEPC dissolving, adds 495uL distilled water water and is diluted to 500uL, surveys A260/A280 ratio, and to extract RNA purer when ratio proof greater than 1.8 time;

6) RNA concentration is transferred to 1～1.2ug/uL, stand-by.

(2) design feasibility primer

MFGE5 gcgccatgggcCTGGATATCTGTTCCAAAAACCCCTGC

MFGE3 gcgctcgagACAGCCCAGCAGCTCCAGGC。

(3)RT-PCR(V＝50uL)

2times Bca lst butter 25uL

25mM MgSO4 10uL

10mM dNTP 5uL

Rnase inhibitor 2.5uL

Oligo dTPrimer 1uL

RNA 2uL

Rnase free H2O 3.5uL

BcaBEST polymerase 1uL

Reaction conditions: 65 ℃ after 1 minute 30 ℃ 5 minutes, slowly be warming up to 65 ℃ (heating up 1.2 ℃ in per 30 seconds) in 15 minutes, continue 65 ℃ 15 minutes, subsequently in 98 ℃ of 5 minutes deactivation ThermoScript II, 4 ℃ of preservations.

(4)cDNA PCR(V＝50uL)

25mM MgSO ₄ 3uL

5times Bca 2nd butter 10uL

10mM dNTP 5uL

primer forward 1uL

primer reverse 1uL

Bca-optimized Taq 1uL

RT-PCR product 20uL

Reaction conditions: 94 ℃ 1 minute, again by 35 circulations of following program amplification: 94 ℃ 30 seconds, 56 ℃ 1 minute, 72 ℃ 2 minutes.Extended 10 minutes for 72 ℃ the back.Reaction is got the 5uL reaction product through 1.5% agarose electrophoresis after finishing, and verifies the successful (see figure 1) that whether increases.

(5) the purpose segment reclaims

Add NaAC (pH5.2) 3uL in the PCR reaction product, the dehydrated alcohol 1ml that adds precooling put into-20 ℃ of refrigerators 20 minutes, and centrifugal 15 minutes of 14000rpm abandons supernatant, and 70% ethanol is washed 2 times, vacuum-drying.Precipitation is dissolved in the 50uL water.

(6) enzyme is cut PCR product and carrier (V=50uL)

10times buffer 2 5uL

Enzyme Nde I 2.5uL

Xho I 2.5uL

BAS 1uL

PCR product or carrier 40uL

37 ℃ overnight.

(7) pET-28a-functional peptide of milk agglutinin construction of recombinant plasmid

The glue purification enzyme is cut product, and enzyme is cut the connection of product;

Enzyme is cut carrier 3uL

Enzyme is cut PCR product 1uL

T4 ligase enzyme 1uL

10times buffer 2uL

H ₂O 13uL

Connecting 16 ℃ spends the night.

To connect product and change DH5 α ^TmIn the library efficiency chemicallycompetent cell (being the top efficiency transformant), 37 ℃ of cultivations are overnight, choose clonal expansion, extracting DNA.

(8) evaluation of positive colony:

1) cultivates back picking colony extraction plasmid and carry out digestion with restriction enzyme evaluation (see figure 3)

2) enzyme is cut the correct recombinant plasmid of evaluation and carried out the dna sequencing analysis.

Sequencing primer: forward 14A; 5 ' tgagcggataacaattcccctc 3 '

Reverse PR2:5 ' CTAGTTATTGCTCAGCGG 3 '.

Order-checking the results are shown in Figure 4 consistent Figure 11 of opinion with gene library, consult gene library LOCUS NM_005928.

(9) pET-28a/ functional peptide of milk agglutinin protein expression

1) plasmid that successfully constructs is transformed as in the BL-21 competence bacteria, be coated with flat board and spend the night;

2) get the clone and be incubated in the 50ml LB substratum, add the 50ug/ml kantlex, 37oC concussion incubator spends the night;

3) inferior daily LB substratum dilution is 10 times, 37 ℃ continue to hatch 3 hours after, (rotating speed 7000rpm 20 minutes, abandons supernatant for isopropyl β-σ-thiogalactopyranoside) continued to hatch 4 hours, centrifugal collection bacterium to add ITPG;

4) add the ultrasonic broken cell film of 10ml 1 * PBST (0.5%Triton X-100), ultracentrifugation, rotating speed 18000rpm, 15 minutes, extract supernatant, to be purified.

(10) protein purification

Supernatant liquor (containing target protein) is utilized the affinity column (Ni-chelatingcolum) of specificity nickel chelating, with binding buffer liquid 5mM imidazole, 0.5M NaCl, 20mM Tris HCl PH7.9, lavation buffer solution 60mM imidazole, 0.5M NaCL, 20mM Tris HCL PH7.9, elution buffer 1M imidazole, 0.5M NaCL, 20mM Tris HCL PH7.9, the target protein that will contain 6 Histidines elutes, and obtains protein purification.

(11) Identification of Fusion Protein

The target protein of gained purifying is carried out the SDS-PAGE electrophoresis, and part glue dyes and observes the band (see figure 6), and part glue is used to be Western Blot, utilizes the specific antibody of the Histidine tag albumen (see figure 7) that has a definite purpose.

Comparative example

From cow's milk, extract the experimental technique of lactadherin

(1) cow's milk fat extraction

Fresh in adding 1Mm phenylmethylsulforyl fluoride (phMeSO2F) in any treatment of cow's milk (extrude in 4 hours to use or freeze in-80 degree refrigerators stand-by immediately), centrifugal 1 hour, extract external fat.

(2) the preparation damping fluid of Buffer milk is washed cow's milk fat 2 (buffer:0.14MNaCl, 3Mm KCL, 8Mm Na ₂HPO ₄, 2Mm KH ₂PO ₄PH7.4), be 35% with the dilution of cow's milk fat, the aperture screen filtration obtains Buffer milk.

(3) cow's milk Oil globule membranin extracts

Adjust PH to 4.8 with adding 1M HCl in the filtered liquid, 37oC stirring at room 1 hour, centrifugal 90 minutes, abandon supernatant, will precipitate mixed choosing and be suspended from 50Mm NH ₄HCO ₃PH7.9 comprises 1Mm phMeSO ₂F (2ml/Lmilk), add chloroforms by 2: 1 times of volumes, get supernatant after centrifugal and add 0.2M NaCl damping fluid, 40ml/100g albumen, stirring at room 30 minutes, centrifugal 80 minutes, precipitation is suspended in 100Mm Tris-HCl PH8.2,6M urea, 1M KCL, 0.2 MNaCl, phMeSO2F (10ml/100 restrains albumen) stirs 16 hours (4 ℃), centrifugal 70 minutes.Promptly contain MFGM in the supernatant.

(4) slightly carry lactadherin

With the supernatant liquor that extracts with the elutriant liquid of dialysing, preparation sepharys-200 chromatography column (3cm*115cm), elution buffer is washed post and is spent the night, and gently spissated MFCG is overlying on the micelle surface, and gravity makes sample all enter in the post, gently cover elutriant in the post surface, connect gathering system, every pipe is collected 7ml, and gathering speed is 0.3ml/min (collecting approximately 48 hours), every collection tube is drawn 20ul and is carried out the SDS-PAGE electrophoresis, glue dyeing.The next day observe the electrophoretic band (see figure 8), it is more to collect lactadherin content, the about 50ml of purer sample is ready to use in affinity chromatography.

(5) purifying of lactadherin in the cow's milk

Preparation agrose affinity chromatography system, all by chromatography column, binding buffer liquid is washed post 1 time with the sample of dialysed overnight, and dcq buffer liquid is washed post 1 time, and the elutriant wash-out obtains the end product lactadherin.

(6) the qualitative (see figure 9) of protein electrophorese band.

1 week of whole process of preparation.

Two kinds of method gained target protein quantitative analysis (see figure 10)s

Table 1

Organization name	Concentration
		The heart	1ug/ul
Lung	1ug/ul
		Liver	1ug/ul
Spleen	1ug/ul
		Pancreas	1ug/ul
Skeletal muscle	1ug/ul
		Stomach	1ug/ul
Duodenum	1ug/ul
		Small intestine	1ug/ul
Colon	1ug/ul
		Testis	1ug/ul
Bladder	1ug/ul
		The uterus	1ug/ul

Lactadherin .SEQ

SEQUENCE LISTING

＜110〉Xinhua Hospital Attached to Shanghai No.2 Medical Univ

＜120〉a kind of functional peptide of milk agglutinin and preparation method

<130>/

<140>2005100241047

<141>2005-07-19

<160>3

<170>PatentIn version 3.1

<210>1

<211>38

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

<222>(1)..(38)

＜223〉primer

<400>1

gcgccatggg cctggatatc tgttccaaaa acccctgc 38

<210>2

<211>29

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

<222>(1)..(29)

＜223〉primer

<400>2

Lactadherin .SEQ

gcgctcgaga cagcccagca gctccaggc 29

<210>3

<211>1164

<212>DNA

＜213〉homo sapiens (Homo sapiens)

<400>3

atgccgcgcc cccgcctgct ggccgcgctg tgcggcgcgc tgctctgcgc ccccagcctc 60

ctcgtcgccc tggatatctg ttccaaaaac ccctgccaca acggtggttt atgcgaggag 120

atttcccaag aagtgcgagg agatgtcttc ccctcgtaca cctgcacgtg ccttaagggc 180

tacgcgggca accactgtga gacgaaatgt gtcgagccac tgggcatgga gaatgggaac 240

attgccaact cacagatcgc cgcctcatct gtgcgtgtga ccttcttggg tttgcagcat 300

tgggtcccgg agctggcccg cctgaaccgc gcaggcatgg tcaatgcctg gacacccagc 360

agcaatgacg ataacccctg gatccaggtg aacttgctgc ggaggatgtg ggtaacaggt 420

gtggtgacgc agggtgccag ccgcttggcc agtcatgagt acctgaaggc cttcaaggtg 480

gcctacagcc ttaatggaca cgaattcgat ttcatccatg atgttaataa aaaacacaag 540

gagtttgtgg gtaactggaa caaaaacgcg gtgcatgtca acctgtttga gacccctgtg 600

gaggctcagt acgtgagatt gtaccccacg agctgccaca cggcctgcac tctgcgcttt 660

gagctactgg gctgtgagct gaacggatgc gccaatcccc tgggcctgaa gaataacagc 720

atccctgaca agcagatcac ggcctccagc agctacaaga cctggggctt gcatctcttc 780

agctggaacc cctcctatgc acggctggac aagcagggca acttcaacgc ctgggttgcg 840

gggagctacg gtaacgatca gtggctgcag gtggacctgg gctcctcgaa ggaggtgaca 900

ggcatcatca cccagggggc ccgtaacttt ggctctgtcc agtttgtggc atcctacaag 960

gttgcctaca gtaatgacag tgcgaactgg actgagtacc aggaccccag gactggcagc 1020

agtaagatct tccctggcaa ctgggacaac cactcccaca agaagaactt gtttgagacg 1080

cccatcctgg ctcgctatgt gcgcatcctg cctgtagcct ggcacaaccg catcgccctg 1140

cgcctggagc tgctgggctg ttag 1164

Claims (3)

1, a kind of preparation method of functional peptide of milk agglutinin of the dna encoding as SEQ ID:NO.3 is characterized in that the preparation method comprises the steps:

(1) from tissue, extracts total RNA;

(2) design functional peptide of milk agglutinin PCR primer nucleotide sequence is made the functional peptide of milk agglutinin gene;

(3) make up the functional peptide of milk agglutinin recombinant plasmid;

(4) recombinant plasmid transformed;

(5) functional peptide of milk agglutinin is expressed;

(6) functional peptide of milk agglutinin purifying.

2, the proteic preparation method of lactadherin according to claim 1, it is characterized in that: tissue is selected from the heart, lung, liver, spleen, pancreas, skeletal muscle, stomach, duodenum, small intestine, colon, testis, bladder, uterus mixed structure, and functional peptide of milk agglutinin PCR primer nucleotides sequence is classified as

MFGE5 gcgccatgggcCTGGATATCTGTTCCAAAAACCCCTGC

MFGE3 gcgctcgagACAGCCCAGCAGCTCCAGGC。

3, the preparation method of functional peptide of milk agglutinin according to claim 1 is characterized in that: plasmid is selected from pET-28a, pET-28b in the functional peptide of milk agglutinin recombinant plasmid, and the functional peptide of milk agglutinin recombinant plasmid changes DH5 α over to ^TmIn the cell, functional peptide of milk agglutinin is expressed at the BL-21 competent cell.

Images