CN1252100A - Recombinant haloaliphatic dehalogenases - Google Patents

Abstract

The present invention is to haloaliphatic dehalogenase enzymes capable of converting halogenated aliphatic substrate molecules to vicinal halohydrins, as well as to DNA sequences encoding the polypeptide of the enzymes, to expression constructs containing this DNA, and to methods for producing the enzymes by placing the expression constructs into host cells under conditions sufficient for the transformants to produce the dehalogenase. A process for immobilizing the enzyme on a solid support and use of the immobilized enzyme for converting a halogenated aliphatic hydrocarbon to an alcohol is also disclosed.

Description

Recombinant haloaliphatic dehalogenases

Preparing a large amount of short chain halogenated aliphatic hydrocarbon (HAHs) is used as organic solvent, grease-removing agent, sterilant, various other organic compound synthetic intermediate and is used as the composition of making in the plastics.These halogenated compounds being extensive use of in commercial run to improveing and/or utilizing the new technology of cheap byproduct to produce a large amount of opportunities again.

The too much HAHs that produces as byproduct in chemical process can burned heat production and can be reused into cheap initial substance in some cases, thereby obtains certain recovery from waste prods or too much byproduct.In the microbial environment of complexity (natural, water treatment plants etc.), the HAH degraded takes place by the microorganism biological degraded.When halogen was muriate, the biological degradation of HAHs caused the formation of carbonic acid gas, water and hydrochloric acid.

HAHs becomes carbonic acid gas, water and hydrochloric acid to be disclosed in United States Patent(USP) Nos. 4,853 by the selected microorganism biological degradation, in 334 and 4,877,736.Be used to decompose the chloro aliphatic hydrocrbon and do not point out to relate to method of microorganism and be disclosed in U.S. Patent No. 4,749, in 491.In addition, at " applied environment microbiology "., among the 52:383-384 (1986), Nelson etc. have reported the aerobic metabolism of acinetobacter calcoaceticus (Acinetobacter spp) to trieline.Vogel etc. have provided the general introduction that the halogenation aliphatic cpd are degraded at " environmental science and technology " in environment among the 21:722-736 (1987).U.S. Patent No. 5,372,944 disclose and have produced the kind of some Rhods (Rhodoccocus) that HAHs is converted into the dehalogenase of halohydrin.Yet these documents mainly depend on cell system and do not have to utilize the advantage that can use immobilized modification activities enzyme in continuing reinforced process and acquire benefit.The most relevant is, U.S. Patent No. 5,372, and 944 rely on the rhodococcus culture that comprises wild-type or mutant cell.Therefore yet the mutating technology of wherein telling about does not utilize the advantage of recombinant DNA method and fails to utilize these methods to improve and express and the benefit brought this dehalogenase is active.

Not to rely on by the biological degradation of cell culture to HAHs, but has improvement, the recombinase that can be adapted to lasting charging process easily will be superior, here, HAHs can be converted into the useful as intermediates that is used to prepare other useful products effectively, as the preparation polyethers to form intermediate in the polyurethane(s) or preparation ethylene glycol and polyoxyethylene glycol to form the intermediate of lubricant, tensio-active agent, emulsifying agent etc.

The present invention relates to comprise basically with Fig. 2 in residue 1-292 amino acid sequence homologous aminoacid sequence and HAHs can be converted into the recombinase of o-halohydrin.Another object of the present invention provides coding and comprises the dna sequence dna of such enzyme polypeptide, more specifically comprise with Fig. 2 in the base 37-912 nucleotide sequence dna sequence dna of homology polynucleotide basically.

Another object of the present invention provides the carrier that contains this dna sequence dna and is used to prepare the method for this polypeptide, comprises this carrier is placed host cell and cultivate this host cell under the condition that can make this transformant generation dehalogenase.

The enzyme that further purpose of the present invention provides the immobilization form comprises this HAH is contacted with immobilized enzyme on solid support and the method that is used for HAH is converted into alcohol or halohydrin.The accompanying drawing summary

Fig. 1 shows the plasmid map of carrier pEXPROK.Plasmid pEXPROK is derived from commercial available pPROK-1 plasmid, and (Clontech, Mountain View CA), contain Ptac promotor and 5S, T1T2 terminator sequence.In the figure, the T1T2 region representation is " Term ".This plasmid is by replacing the pPROK-1 multiple clone site to make up with a pair of importing restriction site Nco I, Hind III, Xho I, Nhe I and the Not I oligonucleotide in joint." ATG " sequence representative in Nco I site has the in-frame initiation site of function.Nhe I connects the EXFLAG joint sequence behind the site.The EXFLAG joint sequence is corresponding to the amino acid 295-315 in the RDhl protein sequence shown in Nucleotide 919-975 among Fig. 2 and the code pattern 2.

Fig. 2 (being Fig. 2 A and 2B) lists the nucleotide sequence and the aminoacid sequence that is derived from this nucleotide sequence of the prunosus red coccus TDTM003 halogenated alkane dehalogenase of coding derivation.Amino-acid residue 1-292 is corresponding to rhodococcus dehalogenase (RDhl) structure gene and coded by Nucleotide 37-912.Amino-acid residue-12 is represented the N-terminal afterbody that contains polyhistidine to-1 (Nucleotide 1-36), and residue wherein-12 and-11 participates in the formation of translation initiation site and Nco I cloning site simultaneously.Amino-acid residue 293-294 (Nucleotide 913-918) is coded and meet amino acid 295-305 thereafter by Nhe I cloning site, and it is called the EXFLAG peptide again at this.EXFLAG joint (Nucleotide 919-975) coding EXFLAG peptide and 2 translation termination sites (each is represented by asterisk).

Fig. 3 shows the plasmid map of carrier pEXPROK-RDhl.

Fig. 4 (being Fig. 4 A and 4B) has listed the comparison diagram of prunosus red coccus TDTM003 halogenated alkane dehalogenase, xanthobacter autotrophicus (Xanthobacter autotrophicus) GJ 10 dehalogenases, Renilla reniformis luciferin monooxygenase and pseudomonas class (Pseudomonas spp) LinB gene product (the tetrachloro hexamethylene diene lytic enzyme) aminoacid sequence of inferring.

Fig. 5 shows the plasmid map of the carrier pRDhl-KO2.3-EXPROK that is included in the prunosus red coccus TDTM003 halogenated alkane dehalogenase gene of inferring under the derivable Ptac transcripting promoter control of IPTG-.

Fig. 6 shows the plasmid map of the high level expression carrier pRSET-RDhl that is included in the prunosus red coccus TDTM003 halogenated alkane dehalogenase gene of inferring under the control of T7 transcripting promoter.

Fig. 7 shows the plasmid map of the high level expression carrier pTrcHis-RDhl that is included in the prunosus red coccus TDTM003 halogenated alkane dehalogenase gene of inferring under the control of trc transcripting promoter.

Fig. 8 shows the plasmid map of high level expression carrier pTrixFus-RDhl, this plasmid comprises the modification body of the prunosus red coccus TDTM003 halogenated alkane dehalogenase gene that is fused to the deduction on the coding intestinal bacteria sulphur oxygen cyclase protein gene, and the fusion gene of this connection is at P _LUnder the control of transcripting promoter.

Fig. 9 shows the SDS-PAGE gel figure with partially purified rRDhl enzyme expression pEXPROK-RDhl clone cell lysate sample relatively.

Figure 10 show with Fig. 9 in the resisting-FLAG antibody mediated immunity trace figure of identical SDS-PAGE gel.

Figure 11 shows the SDS-PAGE gel figure of the cell-free extract of expressing the pRSET-RDhl cell.

Figure 12 show with Figure 11 in the resisting-FLAG antibody mediated immunity trace figure of identical SDS-PAGE gel.

Figure 13 shows the SDS-PAGE gel figure from the cell-free extract of expressing the pTrcHis-RDhl cell.

Figure 14 shows the anti--FLAG antibody mediated immunity trace figure of the SDS-PAGE gel identical with Figure 13.

Figure 15 shows the SDS-PAGE gel figure of the cell-free extract of expressing the pTrxFus-RDhl cell.

Figure 16 shows the productive rate figure of the immobilized enzyme bio-reactor that acts on the substrate glyceryl trichloride.

Figure 17 shows the active histogram of prunosus red coccus halogenated alkane dehalogenase of EPPCR-sudden change.

Figure 18 shows the active histogram of prunosus red coccus halogenated alkane dehalogenase of EPPCR-sudden change.

Figure 19 shows RDhl enzyme that has C-terminal S-Tag polypeptide afterbody and the enzymic activity data plot that has the RDhl enzyme of C-terminal EXFLAG polypeptide afterbody.

The present invention comes from following further investigation, comprise the dna sequence dna that from the Rhod microorganism, obtaining coding and having the active polypeptide of haloaliphatic dehalogenases, prepare recombinant DNA sequence in the carrier and with this recombinant vectors conversion microorganism by this dna sequence dna itself or its modified forms are integrated into.Screening has the transformant of dehalogenase activity level and separates dehalogenase from having to increase the active transformant.Assess various solid support fixed systems then and can effectively halogenated aliphatic hydrocrbon be converted into enzyme-upholder combination of alcohol or halohydrin to identify wherein enzyme.

The halogenation aliphatic hydrocrbon (HAHs) that transforms with the immobilization dehalogenase comprises C ₂-C ₁₀Aliphatic hydrocrbon molecule and its have 2 or more a plurality of gene that adheres to halogen atom, and at least 2 halogen atoms wherein are positioned on the adjacent carbon atom.Preferred HAHs is saturated hydrocarbon, and wherein at least one halogen atom occupies the uncle position of this molecule or group; More preferably wherein more than 1 halogen occupies those HAHs of identical carbon atoms.Particularly preferred HAHs comprises 1, the stable hydrocarbon of 2-dihalo group, and the example has 1,2-dihalo ethane, 1,2-dihalopropane, 1,2-dihalo butane and 1,2,3-three halogenopropane molecule and groups.These kinds comprise, for example, 1,2-ethylene dichloride, 1,2-propylene dichloride, 1,2-dichlorobutane, glyceryl trichloride and 1,2-two bromo-3-chloropropane molecule and groups.

As used herein, term " halogen " means chlorine, bromine or iodine.Preferred halogen is bromine and chlorine.Highly preferred halogen is chlorine and volatile chloro aliphatic hydrocrbon (VCAH) molecule and group is arranged in highly preferred HAHs; Especially preferred VCAHs comprises 1,2-propylene dichloride and glyceryl trichloride molecule and group.

As used herein, term " halohydrin " means o-halohydrin, i.e. any aliphatic organic compound that has hydroxyl substituent and halogenic substituent on the adjacent carbons of molecule simultaneously except carboxylic acid.α, β-halohydrin are highly preferred o-halohydrin.

Term " immunoblotting (immunoblot) " and " immunoblotting (immunoblotting) " are meant following processes in this use: 1) from running gel, as be used in the polyacrylamide gel of PAGE albumen being transferred to protein-bonded film; And then 2) use and transfer to this film of the specific antibody test of those proteic protein ingredients on this film comprising; And then 3) any with in the various methods of adding lustre to well-known in the art is as detecting the position of this antibody with directly or indirectly being connected to the pigmentable mark colour developing on this antibody.The example of western blotting method is the Western trace.

Term " saturatingization (permeablize) ", " (permeablizing) of saturatingization " and " saturatingization (permeablization) " use expression to make the permeable method of some material at this, as make cell walls can be penetrating, term " supersound process " this use expression with ultrasonic wave the content in rapid tube shaken or other container with its thorough mixing.Term " vortex vibration " is pinned test tube simultaneously by hand in this use expression along its bottom mechanical rotation test tube top is motionless with the operation with its contents mixed.

Word used herein " can screen " and mean " can be selected ".For example, term " but selective marker " or " but dominance selective marker " expression hereditary feature, as the gene of coding antibiotics resistance enzyme, the host cell that its existence makes this gene corresponding select substratum as, contain in this antibiotic substratum and breed.With do not accept or to contain those cells of this plasmid opposite, when this hereditary feature is incorporated in the plasmid that contains coding RDhl enzyme gene, thereby and when handling these cells then and accepting this plasmid, cultivate these cells and make the cell selective growth of in fact accepting this plasmid in selecting substratum, this allows easily to identify the cell that contains the RDhl gene.

As used herein, term " expression construct " but refer to plasmid as known in the art, virus, virion, viroid, transposable element, Ke Si construct, in conjunction with the transfection vehicle of DNA chain (as, the natural or synthetic histone like-particles of " particle gun " granule (pellet) of DNA bag quilt or DNA bag quilt) or other DNA-as known in the art delivery system to-cell.

As used herein, in the context of describing aminoacid sequence, the monocase name below having used.

A, a L-Ala (Ala) M, m methionine(Met) (Met)

C, c halfcystine (Cys) N, n l-asparagine (Asn)

D, d aspartic acid (Asp) P, p proline(Pro) (Pro)

E, e L-glutamic acid (Glu) Q, q glutamine (Gln)

F, f phenylalanine (Phe) R, r arginine (Arg)

G, g glycine (Gly) S, s Serine (Ser)

H, h Histidine (His) T, t Threonine (Thr)

I, i Isoleucine (Ile) V, v Xie Ansuan (Val)

K, k Methionin (Lys) W, w tryptophane (Trp)

L, l leucine (Leu) Y, y tyrosine (Tyr)

As used herein, in the context of describing dna sequence dna, the monocase definition below having used: A VITAMIN B4 G guanine N A, C, G or TC cytosine(Cyt) T thymus pyrimidine R A or G

Y C or T

Here shortenings and definition below having used:

@ exists, as @37 ℃ be " at 37 ℃ " Bing Qie @60 minute for "

60 minutes "

(dust is 1 * 10 to the dust ^-10Rice)

The A absorbancy, as, A ₂₈₀Be " absorbancy that records at the 280nm place "

Aa amino acid

The Amp penbritin

2-AMP 2-aminopropanol

AMPSO 3-((1,1-dimethyl-2-hydroxyethyl) amino)-2

-hydroxyl-propanesulfonic acid

ATCC American type culture collection (Rockville, MD, the U.S.)

Base is the Nucleotide of a polynucleotide part

The bp base pair

CAPSO 3-(hexamethylene ammonia)-2-hydroxyl-1-propanesulfonic acid

The CD compact disk

CHES 2-(N-hexamethylene ammonia) ethyl sulfonic acid

The CM carboxymethyl

The CnBr cyanogen bromide

Δ changes or difference, is " absorbancy variation " as A

The dATP deoxyadenosine triphosphate

DCB 1, the 4-dichlorobutane

DCH 2,3-two trimethylewne chlorohydrin 3-s

The dCTP deoxycytidine triphosphate

The DEAE diethylaminoethyl-

The dGTP deoxyguanosine triphosphate

The dTTP deoxythymidine triphosphate

Hr hour Hz hertz (with the metering of per second circulating unit number to frequency) ID internal diameter Ig immunoglobulin (Ig) of EDTA ethylenediamine tetra-acetic acid or edetate EPPCR error-prone PCR GC gas-chromatography GIA glutaraldehyde gm gram (Grams), (dalton is heavily to the kD kilodalton for the international biochemical kbp of the alliance kilobase of " immunoglobulin G " IPTG isopropylthio galactosyl pyranoside IUB as IgG¹² The O atom 1/12) Ki suppresses the (molal quantity of chemism solute group in every liter of solution of (molal quantity of solute in every liter of solution) mM mM of MW molecular weight N equivalent of min minute mL milliliter mm millimeter of mg milligram of constant LB Luria culture medium μ g microgram μ L microlitre μ M micro-molar concentration μ mole micromole M (volume) mole

As, H ₂SO ₄Have 2 tart hydrogen and so 1M H ₂SO ₄For

The solution of 2N) nm nanometer ng nanogram

NP-40????????Nonoxynol；p-(n-C ₉H ₁₉)-C ₆H ₄-(OCH ₂CH ₂) _nOH；

Be also referred to as Nonylphenoxy polyoxyethylene glycol (a kind of non-ionic detergent

Tensio-active agent)

The OD optical density(OD) is as OD ₆₀₀" optical density(OD) that records at the 600nm place "

The oligo oligonucleotide

The P-plasmid, as pRSET, pTrcHis, pTrxFus, or pUC

The PAGE polyacrylamide gel electrophoresis

The PCR polymerase chain reaction

The PEI polymine

The pfu plaque forming unit

The phage phage

QAE Tetrylammonium (a kind of anionresin base)

RDhl rhodococcus halogenated alkane dehalogenase

Residue is the amino acid of a polypeptide part

The rpm rotations per minute

The rhodococcus halogenated alkane dehalogenase of rRDhl reorganization

The SDS sodium laurylsulfonate

Spp. kind

The TCP glyceryl trichloride

The TM trade mark

Tris three (methylol) aminomethane

The tRNA transfer RNA

U unit

The maximum enzymatic speed of Vmax

The percent by weight of the every volume of %w/v, the solute gram number of promptly every 100mL solution,

Also writing " % (w/v) "

The percent by weight of the every weight of %w/w, that is, per 100 grams contain the mixing of material

The gram number of this material in the thing; Also writing " % (w/w) "

～approximately

In order to obtain enzyme and immobilized enzyme, reach purpose of the present invention, carry out following step.Carry out these steps with the known technology of those skilled in the art: the aminoacid sequence of dehalogenase is separated and partly measured in (1); (2) sequencing according to this part makes up oligonucleotide probe; (3) with the dna fragmentation of this oligonucleotide probe separation coding dehalogenase, this DNA then increases; (4) this fragment is connected in the cloning vector with suitable replication orgin and coding dominant selectable marker gene; (5) transform and screen the microorganism that contains this recombinant plasmid; (6) this dna sequence dna is transferred in the suitable expression also with this recombinant vectors transformed host cell; (7) by this transformant preparation reorganization dehalogenase; (8) this dehalogenase of purifying; (9) are fixed to this dehalogenase on the various solid supports then; (10) in the process that HAHs is converted into alcohol or halohydrin, use immobilized dehalogenase;

(11) the effective dehalogenase supporting system of screening.

Surprisingly, in the process of carrying out above-mentioned research, obtained new reorganization dehalogenase, its dehalogenase than wild-type has more graceful function feature, has obtained this recombinase therefrom.In addition, also identified effective immobilization dehalogenase supporting system.

Be used for dehalogenase of the present invention and preferably derive from rhodococcus kind ATCC 55388 and HAH can be changed into halohydrin or alcohol, be preferably halohydrin.Preferred recombinase comprises the polypeptide with enzymic activity with wild-type dehalogenase minimal features part,, keeps active its minimum possible fragment of halogenated alkane dehalogenase suitable after folding that is.Preferably, this polypeptide basically with Fig. 2 in the amino acid sequence homologous of residue 1-292.More preferably, this polypeptide has the homology at least about 90% with it, 95% homology of more preferably having an appointment at least and 99% the homology of further more preferably having an appointment at least again.Especially preferred is the polypeptide with enzymic activity with residue aminoacid sequence among residue 1-292 or Fig. 2.

This preferred recombinase can comprise that also one or more plant other unit, as mark, label, afterbody, joint, solid support, the sequestrant of all size, they prepare other enzyme etc. with the active polypeptide of this enzyme or are connected thereto after it forms.Such unit can excise from this enzyme after it suitably folds and/or is immobilized onto on the solid support.In preferred embodiments, preparation has or is connected to the enzyme of hydrophilic afterbody basically.This afterbody can for the hydrophilic oligopeptides that is expressed as this enzyme part or can for, for example, express the back at it and be attached to oligosaccharides part on the core enzyme by host cell.Thereby this afterbody must have enough length and wetting ability that core enzyme is maintained in the water-soluble substratum with suspensions.Preferred afterbody is the hydrophilic basically oligopeptides that is expressed as this enzyme part.More preferably, this enzyme is had highly hydrophilic oligopeptides afterbody by expression.The most preferably, this oligopeptides afterbody is expressed in the C-terminal of this enzyme.Most preferred oligopeptides afterbody is the hydrophilic C-terminal afterbody that is rich in Histidine and/or asparagicacid residue, especially about 5 to 25 amino acid lengths and containing at least about 25% Histidine or asparagicacid residue more preferably contain the afterbody at least about 50% this residue.This recombinase is preferably by containing the host cell preparation with base 37-912 nucleotide sequence at least a portion polynucleotide among Fig. 2.

The present invention also relates to express the recombinant DNA sequence of enzyme of the present invention.These dna sequence dnas comprise can be by not following or not exclusively follow the standard DNA password codon-express those sequences of new halogenated alkane dehalogenase to-the translation system of amino acid associative mode.Such system comprises that wherein some codon is subjected to those systems of " inhibition " with respect to the DNA password of standard.In a kind of " inhibition " expression system therein, have at least in the specific aminoacyl-tRNA of about 20 seed amino acids (" the aa-tRNA ") molecule a kind of contain at least a have this type of anticodon and be connected to " mistake " thus the tRNA molecule on the amino acid is predetermined this translation system to be produced to " trample " of standard DNA codon (violation) (promptly, causing inserting such amino acid by at least one position in extending polypeptide chain, promptly is not the amino acid that arrives with the mRNA codon normal findings of arranging this position).In the another kind variation of such system, aminoacyl-tRNA library of molecules contains the aa-tRNA that its anticodon is complementary to the initial or terminated mRNA codon of normal translation signals thereby suppresses this signal.These systems may, for example, owing to the sudden changes of planting in tRNA molecules or the aa-tRNA synthetic enzyme at one or more exist, perhaps because the mistake of not mutated aa-tRNA synthetic enzyme, or since the mankind's interference force amino acid and exist non-standard connection of tRNA.

In such translation system, dna sequence dna of the present invention will still produce new halogenated alkane dehalogenase, or because " mistake " amino acid whose insertion does not cause enzyme disappearance active or because this dna sequence dna contains such codon in the position that " incorrect " amino acid will be inserted into, promptly its " expection " thus the variation in this translation system makes therein or inserts the amino acid of " correctly " or makes mRNA codon " correctly " start signal.Preferred dna sequence dna comprise basically with Fig. 2 in the nucleotide sequence homologous polynucleotide of base 37-912.More preferably, these polynucleotide and its be at least about 90% homology, more preferably at least about 95% homology, and then, more preferably at least about 99% homology.Especially preferred for having the polynucleotide of base 37-912 aminoacid sequence among Fig. 2.

As used herein, term " homology basically " expression subject nucleotide sequence-be theme nucleotide sequence (oligonucleotide-or polynucleotide or DNA chain) or subject amino acid sequence (oligopeptides-or polypeptide or albumen) with relevant with reference to the similarity degree between Nucleotide or aminoacid sequence.This term definition between theme and canonical sequence when these sequences are carried out " comparison " at least about 75% " corresponding " (, the state that identical component-Nucleotide or amino acid are arranged in parallel).In this article, when having inserted minimized number " nonsense " in theme and/or the canonical sequence thus part claims (sequence) " comparison " existence when making the corresponding part number that exists between the two sequence maximum." nonsense " part is not the part of theme and canonical sequence; Equally, minimal number of " nonsense " part may be different with minimal number in the insertion canonical sequence in the insertion subject nucleotide sequence.Can be expressed as, equally also define with reference to the sequence identity degree between they and canonical sequence as, the homology degree of the increase of the given sequence of " 90% homology ".

In this definition, think that in following situation canonical sequence " is correlated with " with subject nucleotide sequence: 1) two kinds of albumen or proteic parts or 2 that nucleotide sequence is all encoded and can be accredited as identical IUB subclass) no matter identify it is that two seed amino acid sequences constitute the albumen or the proteic part that can be accredited as identical IUB subclass according to functional performance, sequence homology or maternal source." maternal source " refers to such fact, be that a kind of given enzyme may be at the initial IUB subclass that is divided into owing to its main or secondary function that has recognized that, but when the dna sequence dna of this enzyme of coding accumulates one or more and plants sudden change, the enzyme of this coding may demonstrate different I UB subclass functionally active-no matter whether it also keeps its original function simultaneously; These " different IUB subclass " may be positioned at identical or different IUB main classes.About " a proteic part " refer to according to the subclass that is accredited as an one functional domain also think difunctional and multifunctional enzyme-comprise that fusion rotein belongs to given IUB subclass.

In the preferred embodiment of the invention, the halogenated alkane dehalogenase belongs to IUB subclass 3.8.1 at least on female parent.Found that enzyme of the present invention has than the wild-type halogenated alkane dehalogenase of finding in the rhodococcus, as, U.S. Patent No. 5,372, the beat all advantageous characteristic of using in 944 of dehalogenase.Usually, except its stability under the reaction conditions, a kind of two kinds of features of given enzyme will determine its purposes in commerce: its to the avidity of product with and to the avidity of substrate.When enzyme is higher relatively to the avidity of product molecule, it will be extremely responsive to the feedback inhibition of this product.Use is less in the business process that this kind of enzyme often needs could work under the remarkable product concentration existence therein.Enzyme is the inhibition constant (" Ki (90) ") that records when 90% suppresses to the index that makes things convenient for of product relative affinity, the concentration of product when promptly enzyme is only kept its 10%Vmax, and Vmax is to record in 0 o'clock at production concentration.As for the present invention, wild-type halogenated alkane dehalogenase has the Ki (90) that 20mM records, and recombinase (see figure 2) of the present invention has the Ki (90) that 50mM records.In other words, this recombinase wants how insensitively and can therefore work to the feedback inhibition of product in the presence of the production concentration that will suppress wild-type enzyme basically fully.

But enzyme single expression of the present invention or along its amino and/or one or more peptide species afterbodys of C-terminal covalent attachment.This afterbody can by coded with the isolating exon of exon of this enzyme of coding or by for the dna sequence dna of a part of this enzyme exon of coding coded.As the DNA of this encoded tail during for this enzyme exon of coding a part of, the DNA of this encoded tail can by following arbitrary mode adhere to or " fusion " to 3 of this enzyme gene ' and/or 5 ' end, as or: 1) in the enzyme gene amplification process of in the nucleotide sequence by this afterbody of will encode comprises Oligonucleolide primers into, carrying out or 2) be connected to and carrying out in the plasmid that contains this enzyme gene in the plasmid construction process (no matter this enzyme gene be before or after the insertion of encoded tail DNA in this plasmid of insertion) by dna direct with encoded tail.

At suitable Genetic Control element-be enhanser, promotor, transcribe under the influence with translation initiation and terminator sequence etc.-expression of this kind DNA (or mRNA) fusion gene causes being created in the dehalogenase that one or two end has the polypeptide afterbody.The example that does not preferably have the afterbody enzyme is the enzyme with residue 1-292 aminoacid sequence among Fig. 2.The example of some preferred polypeptide afterbodys comprise polyhistidine sequence, polyacid (as, many-aspartic acid and/or many L-glutamic acid) sequence, cellulose binding domain and c-myc, S-Tag and FLAG peptide.Be available and can easily be used for purifying or fix the fusion rotein of this expression commercial in conjunction with the antibody of these typical afterbodys and affinity column.Yet, also can use many other afterbody and keep the dehalogenase of function simultaneously.No matter whether the sequence of encoded tail comprises in this expressing gene, and this gene must comprise translation initiation site in the position beyond this enzyme gene or this enzyme-afterbody fusion gene, is preferably ATG, and will also preferably includes the endonuclease restriction site.

In a preferred embodiment, the open reading frame of single exon is coded in amino and/or C-terminal has the dehalogenase that function is arranged that reaches about 30 amino-acid residue afterbodys.In this embodiment, when two ends all had afterbody, two afterbodys can be about identical length.In another preferred embodiment, this expression of enzymes is for having N-terminal and C-terminal afterbody simultaneously, but the C-terminal afterbody significantly is longer than aminoterminal afterbody.In this embodiment, preferably this N-terminal afterbody reaches about 25 amino acid whose length and the C-terminal afterbody is about 2 to 150 amino acid lengths.In arbitrary scheme in these embodiments, preferably, this amino and/or C-terminal afterbody will contain one section at least 5 adjacent histidine residues.In other embodiments, the about 10-150 of a N-terminal afterbody amino acid length and preferably contain or itself is for the polyhistidine sequence.In this embodiment, this enzyme can by with divalent-metal ion with chelating, as, Mg ²⁺Or Ni ²⁺The surface of bag quilt contacts and is reversibly fixed or the reversible inactivation.In this embodiment, thus the N-terminal afterbody that contains polyhistidine can be the avtive spot that so long partially or completely sealing enters this enzyme.In other version of this embodiment,, this afterbody increases the avtive spot that reaches this enzyme thereby can being designed to contain one or more amino-acid residue that the situation that the configuration of afterbody is seen becomes the configuration that bending, counter-rotating or elasticity connects from the polyhistidine sequence.

In embodiment preferred more, this open reading frame coding has the terminal afterbody of about 1 to 25 amino amino and has the polyhistidine sequence, the FLAG peptide sequence (can be available from the imaging system/VWR of Kodak, Rochester, NY) and/or the C-terminal of S-Tag peptide sequence extend the function dehalogenase arranged.In particularly preferred embodiments, this open reading frame coding has the dehalogenase of function: 1) reach about 10 amino acid whose N-terminal afterbodys and polyhistidine sequence and 2) comprise the C-terminal afterbody of (that is, containing) FLAG (see figure 2) or S-Tag peptide sequence.

The afterbody of this enzyme and/or above-mentioned dehalogenase improved its productive rate, stability and/or suppresses figure thereby can modify with the orthogenesis technology.A kind of direct evolution technology is used U.S. Patent No. 5,605, reorganize (gene Shuffling) method by disclosed genes such as Stemmer in 793, thereby numerous similar DNA sequences are wherein ressembled the highly multifarious library with purpose feature enzyme of screening of generation by fragmentation and in mode at random.The another kind of form of this technology comprises the fallibility gene amplification technology of using.The third form of orthogenesis is utilized the combination of these two kinds of methods.The 4th kind of mode of orthogenesis is (staggered extension) method of " waving extension " by disclosed what is called in the document of " Nature Biotechnol " (1988) (waiting at present to publish) such as Zhao.In preferred embodiments, fallibility gene amplification be used for speed with the about 1-6 of the every gene copy of an every gene amplification reaction point mutation import half random mutation to the dehalogenase gene (as, Fig. 2, residue 1-292) in, then this sudden change library is imported in the bacterium, but screening is active in abduction delivering albumen and the preferred web form of mark (as 96 holes or 384 orifice plates) spatially.

Effectively use orthogenesis to improve screening strategy and the screening conditions that a kind of enzyme or enzyme family need optimized mutagenesis strategy and expression system and effectively detect the required performance characteristic of this enzyme.For the primer dependency mutafacient system of (non--at random) (as, the reorganization based on primer of fallibility gene amplification and qualification), specific albumen subdomain can easily be chosen to be by design of primers and localized mutagenesis.In preferred embodiments, use such primer, promptly can mutagenesis is whole transcribe and translational domain inner occur the same of expression construct with it.Preferably, these primers only relate to the encoding histone zone target DNA (comprising afterbody) of expression construct.In embodiment preferred more, design primer by this way, keep this afterbody sequence simultaneously as directed mutagenesis dehalogenase gene.For example, for Fig. 2, when fallibility gene amplification technology was used the primer that is complementary to the Nucleotide of Nucleotide 36 fronts and then simultaneously and be complementary to the primer of Nucleotide 912 back Nucleotide and then, this dehalogenase gene can be unique mutagenesis target sequence.Equally, whole Fig. 2 coding region is the mutagenesis target sequence when the annealing of the outside in these primers and Nucleotide 1-951 zone; Amino afterbody of Fig. 2 or carboxyl afterbody are respectively target sequence when the annealing of the outside in these primers and Nucleotide 1-36 or 913-951 zone.

The dna sequence dna of code book invention enzyme or fusion rotein will preferably insert in the expression vector, then this carrier is transfected into host cell and cultivate this host cell under the condition of expressing this enzyme.Known have the host's vector expression system that is used for prokaryotic cell prokaryocyte of a variety of reorganization and can be used for the present invention.For example, commercial available carrier such as pKK233-2, pKK388-1, pSE380, pTrcHis (A, B and C), pRSET (A, B and C), pProEX-1 and phage (gt11), T3 and T7 all can express in intestinal bacteria and other Gram-negative prokaryotic cell prokaryocyte by guidance of heterologous protein.In these expression-forms, also can use the suitable inducible promoter of multiple bacterial strain.In addition, other prokaryotic organism are (as bacillus (Bacillus), Rhodopseudomonas, actinomyces (Actinomyces), bacillus (Bacillus) or Rhod biology), eukaryotic microorganisms is (as yeast and fungi, as Pichia (Pichia), saccharomyces (Saccharomyces), or the microorganism of Aspergillus (Aspergillus), as pichia pastoris phaff (Pichia pastoris) or Saccharomyces cerevisiae), other eukaryotic cell and clone (as Sf 21 cells that come source carrier to infect with baculovirus) reach even alga cells can produce the heterologous protein in the protokaryon source of activity form; Be used in the present invention's the incident at these other cells, will select suitable expression to be used for wherein.And numerous prokaryotic expression carriers can openly obtain and can be used among the present invention, illustrates the expression of this new enzyme with commercial available carrier pTrcHis, pRSET and pTrxFus series (can available from the Invitrogen in California, USA San Diego) and e. coli host cell at this.

When using the orthogenesis technology, as fallibility gene amplification (as, fallibility PCR or " EPPCR ") time, the DNA of consequent mutator gene set is digested with suitable restriction enzyme (that is those endonucleases that, have restriction site outside the sudden change target sequence); Next, these mutator genes of purifying also are connected in the prokaryotic expression carrier to form plasmid library.Use this plasmid library transformed competence colibacillus host cell then, as, be preferably Bacillus coli cells and be incubated in the suitable substratum:, cell is plated on contains on the agar of selecting substratum in the intestinal bacteria situation.Then with these cell dilutions to form single bacterium colony, perhaps when prokaryotic organism such as intestinal bacteria situation, they can pass through initial vegetative period, individually choose the cell bacterium colony then and transfer in the isolating container, thereby contain the mono-clonal transformant as every hole in the 96 orifice plate apertures.According to this clone library, the single clone that can increase, abduction delivering target protein also screen the purpose activity.

Preferably finish the active screening of new enzyme haloaliphatic dehalogenases by detecting the proton or the halogenation ion that discharge during when carbon-halogen covalent linkage hydrolysis at substrate molecule.In preferred embodiments, the pH that follows proton to discharge changes measuring as enzymic activity; This pH change is preferably measured through the visible pH indicator that can detect color change with fluorescence or in target enzyme function pH scope.In other method, can utilize multiple parallel pH probe.

In screening active ingredients is measured, this mensurations mixture will contain: 1) cell of complete cell, saturatingization, cell pyrolysis liquid or available from the expression dehalogenase cell that suddenlys change, preferably available from the purifying enzyme of bacterial cell; 2) substrate; With 3) low-concentration buffer (general＜10mM).When needs used saturatingization cell, available chemical subtraction agent (as, Sodium desoxycholate) or physics freeze/melt method made bacterial cell penetrating.Substrate will preferably include one or more and plant above-mentioned halogenation aliphatic hydrocrbon.This damping fluid can be selected from any known effectively or this enzyme keep therein and find efficient buffer liquid in the active pH scope.In some situation, thereby provide the enough surge capability can be quantitatively active exactly with seeing cell residue itself.As long as use the damping fluid that increases, it will preferably have the pKa of about 6 to 10 scopes, though can use other damping fluid.The example of preferred buffer comprises glycine, 2-AMP, CAPSO, thanomin, CHES, borate, Serine and AMPSO; Especially preferred is CAPSO and even the concentration of more preferably about 5mM CAPSO.

Screening active ingredients is measured also will need to use measuring method.In preferred embodiments, detecting pH changes.Preferably, the pH indicator will comprise in this mensuration mixture.Can use this enzyme to have any pH indicator that has colour-change in the active pH scope therein.Preferably, in the scope of pH 10, more preferred arriving in the scope of pH 9 at about pH 7 will be experienced colour-change to this pH indicator at about pH 6.The example of preferred visible pH indicator comprises m-cresol purple, o-cresolsulfonphthalein, phenol red, dibromothymolsulfonphthalein and thymolsulfonphthalein; The example of preferred fluorescent pH indicator comprises naphthyl alcohol sulfonic acid, 1,4-sulfonaphthol, coumaric acid, 3,6-dioxy base phthalic acid dicyan and orcinaurine.In other embodiment, available pH detector detects pH to be changed.Especially preferred is with visible pH telltale, m-cresol purple, and even the concentration of more preferably about 50 μ M m-cresol purples.

In another embodiment preferred, detecting halogenation ionic in the substrate by following mode discharges and finishes detection: 1) comprise the halogenide fluorescent dye sensitive in the mixture of measuring, as nitric acid two-N-methylacridine (Iucigenin) (can be available from Molecular Probes ofEugene, OR, the U.S.) when contacting with the halogenation ion, nitric acid is two-and the N-methylacridine descended by quencher and the fluorescence that therefore records therein; Or 2) use halogenation ionic reaction proofing unit, as halogenide-reactive electrode.

In the 3rd embodiment preferred, finish the detection of enzymic activity with the link coupled enzyme system.For example, the conjugate enzyme system can be used for detecting the generation of product molecule: the dehalogenation effect of halogenated alkane causes alcohol to produce, and a lot of alcohol is planted the substrate of commercial available alcoholdehydrogenase (its activity is measured by the disappearance of NADH) for one or more.Is well-known by being coupled to NADH and needing desaturase in the art to the detection of alcohol.

Enzyme of the present invention can be fixed to one or more and plant on the solid support.Enzyme technique for fixing most convenient ground is divided into covalency and non-covalent method.Covalent approach is utilized the reactive group that exists on some amino acid side chains and directly or by being attached on polymkeric substance or the inorganic support with bifunctional linking agent.The soundness of the main advantage of this method for connecting.More and the scope of non--Covalent Immobilization method from directly and indirectly (as, chelating-or sequestrant-mediation) ion, absorption or biological affine upholder connection (as, biotin-avidin) carry or microencapsulation to gel-Bao.

The selecting of particular fixed technology that is used for the commercial enzyme method based on multiple factor.Wherein principal element is price and the biocompatibility connection or the coupling chemistry of supported matrix.Next is the fixing soundness of upholder under active recovery and the reaction conditions fixedly the time.Unfortunately, because every kind of enzyme all is unique, the method for seeking optimizer system is experimental.Yet relevant enzyme of the present invention, preferred fixing means comprise by reactive group such as epoxide, activatory nucleophile, different urea (isourea) etc. this enzyme is covalently bound to upholder.These reactive groups can be present in the natural surface of support material or this support material and can be modified into and have the linker that contains these groups.Preferred linker comprises and contains dialdehyde, diacid, diamino, vulcabond, cyanate and diimide group; If diamino is not united use with the carbon imide, also can use the linker that comprises at least one carbon diimide group, in preferred solid support, have based on the upholder of aluminum oxide with based on the upholder of silicon; More preferably based on the aluminum oxide or the silicon upholder of polymine infiltration.The fixed preferred method comprises with glutaraldehyde this solid support of pre-treatment and then this upholder is contacted with enzyme.

In case be fixed, this enzyme can be advantageously used in transforming its substrate/reactant becomes product.This reaction can not finished in not influencing the active any suitable media of dehalogenase basically.Preferably, this Enzymatic transformation is finished in the water-soluble medium that contains buffering system or one or more kind pH control device.

Though in some situation, also can use super-saturated substrate mixture, substrate emulsion or pure substrate goods, the halon substrate adds in the reaction medium usually to the substrate saturation point.If most of halon substrates reach saturation point, used halon concentration will be generally the scope of about 0.005% to 0.5% (w/v), preferably, the concentration of halon from about 0.005% to about 0.25%.More preferably the concentration of halon in medium is from about 0.005% to about 0.2%.Originally can substrate be joined in the reaction soln method in batches, perhaps join in the liquid flow that continues in the charging process.In this lasting charging process, this liquid flow can originally contain substrate or this substrate can at first add wherein because liquid flow is in the way that enters in the reactor.In arbitrary situation in the two, in whole reactor, be and pass enzyme thereby more substrate can directly join the substrate of guaranteeing high density in the liquid flow of reactor.In the method, can be thereby the substrate that this liquid flow can different levels is saturated again to be higher than the concentration accumulation product of this substrate solubility limit.The batch methods reaction is finished with vibration or stirring usually.Although reaction times or reactor residence time can change with reaction conditions such as concentration of substrate or enzyme amount, thereby preferably selecting such reaction conditions to make to be reflected in maximum 120 hours finishes.

By considering the following examples, the present invention will be able to further clarification, and these embodiment are intended to thorough illustration the present invention.If do not specialize, all percentage ratios are percent by weight.Normal experiment material and substratum:

All oligonucleotide by Genosys Biotechnologies company (Woodland, TX), Life Teehnologies company (Rookville, MD) or Integrated DNATechnologies company (Coralville, IA) synthetic and purifying.Restriction enzyme and dna modification enzyme are available from Gibco-Bethesda Research Laboratories (Gaithersburg, MD), the New England Biolab (Beverly of company, MA) or StratageneCloning System (La Jolla CA) and according to the method for manufacturers uses.Competence intestinal bacteria AG1 cell is available from Stratagene Cloning Systems, and competence e. coli jm109 and TOP 10F ' cell are available from Invitrogen company (San Diego, California).Plasmid DNA is separated the (RPM with Rapid Pure Miniprep on a small scale ^TM) system (BIO101, company., La Jolla CA) finishes.The DNA connection is finished with the test kit available from Stratagene Cloning System of test in advance.The purifying of dna fragmentation is with QIAquick gel extraction kit and QIA quick PCR purification kit, both all available from Qiagen company (Chatsworth, CA).SDS-polyacrylamide gel and relevant damping fluid and dyestuff and electroblotting transfering buffering liquid from Integrated SeparationSystem (ISS, Natick, MA).Antibody, anti-FLAG ^TMMonoclonal antibody M2 and goat-anti-mouse IgG1 respectively available from International Biotechnology company (IBI, New Haven, CT) and Southern Biotechnology Associate (Birmingham, AL).Microbial culture is in using available from Gibco-Bethesda ResearchLaboratories (G-BRL; Gaithersburg is MD) in the Luria-substratum of premixed reagent (" LB ").Reagent

1,4-dichlorobutane, 60% perchloric acid, iron nitrate and pharaoh's serpents are from Aldrich.Dehydrated alcohol is from Quantum/USI (Tuscola IL, the U.S.).Glyceryl trichloride is so kind as to give by Dow Chemical Company ' s Allylics Group (Freeport, TX, the U.S.).Potassium primary phosphate, dipotassium hydrogen phosphate, imidazoles, Guanidinium hydrochloride, EDTA disodium, ammonium sulfate, and no Tris alkali from Fisher Biotech Grade.Sulfuric acid is from Fisher (ACS level).Support material

Tresyl-Toyopearl chromatography upholder is from TosoHaas (Lot ^#65TRM72R).Sephadex G-25 packs post in advance from the Pharmacia.Celite R-648 is from Manville.Polymine, 50,000 MW and PEI-silicon-dioxide are from Sigma.1 grade of (Grade 1) 25% glutaraldehyde water solution from Sigma is stored in-20 ℃ before using equally.Other sample in being used for fixing comprises: Davison Low SA aluminum oxide, Norton SA 6176 aluminum oxide, Calcicat C type aluminum oxide, Calcicat s-88-473A type silicon-dioxide, Shell 5980-F silicon-dioxide, Davison 952-08-5X silicon-dioxide, Borecker subunit carbon and AmCy 5701-Sn carbon.Method: PCR reaction

(Nutley, the standard polymerization polymerase chain reaction damping fluid that NJ) provides carries out DNA cloning with Perkin-Elmer-Cetus.Usually, the reaction of 50 μ L comprises the damping fluid of manufacturers's supply of 1 * concentration, the MgCl of 1.5mM ₂, the forward of 125 μ M dATP, 125 μ M dCTP, 125 μ M dGTP, 125 μ M dTTP, 0.1-1.0 μ M and reverse primer, the 5 Ampli Taq of unit archaeal dna polymerases and＜target DNA of 1ng.Unless stated otherwise, otherwise the type of heating of DNA cloning is 94 ℃, 5 minutes; 55 ℃, 1 minute; 72 ℃, 1 minute 35 take turns the circulation type of heating.By polyacrylamide gel electrophoresis to proteic detection

Soluble proteins mixed with solubilising damping fluid (Tris/SDS/ beta-mercaptoethanol) at 1: 1 and be splined on the 10-20% gel (Daiichi, Natick, MA) in before boiled 5 minutes and carry out electrophoresis with Tris-glycine buffer (ISS).Gel Pro-Blue ^TM(ISS) dyeing.The muriate check and analysis of standard are to measure unit of enzyme activity

When with 1,4-dichlorobutane (Aldrich) is during as substrate, and the Sodium glycocollate of 100mM pH 9 is joined in the bottle that each 9mL adds a cover final volume to 6mL.When using glyceryl trichloride, use Tris vitriol/1mM EDTA (pH7.0) of 10mM as substrate.Add 6 μ L substrates and vortex vibration content then.Bottle is hatched stirring 1 hour in 30 ℃.Contain 5.25MHClO by taking out the 1mL mixture at 5 time points and being placed on ₄In 100 μ L 0.375M Fe ^3-(NO ₃) ₃The Eppendorf pipe in and take a sample.Vortex vibration Eppendorf pipe.When having collected all samples, 100 saturated in ethanol μ L pharaoh's serpentss (II) are joined in every arm.Again with the vibration of sample vortex, centrifugal then 3 minutes.In 460nm place read light density.On behalf of certain hour, mensuration absorb the slope (Δ A/ minute) of change and (is used Δ A/ μ mole Cl divided by 1.52 ^-For unit with NaCl as the optical extinction coefficient of standard at the 460nm place) to obtain μ mole Cl ^-/ minute.The enzymic activity of a unit is defined as needs dehalogenate 1.0 μ mole substrates/minute needed enzyme amount under specified condition.The method of fallibility PCR mutagenesis

In this directed evolution method, RDhl enzyme gene or RDhl antigen-4 fusion protein gene are provided as the target gene of EPPCR mutagenesis, as, by contain the plasmid of this target DNA sequence with suitable restriction enzyme digestion.In most situation, by gel electrophoresis purifying target DNA, this target DNA of gel extraction then.Thereby reach the reaction mixture of 7mM magnesium chloride and 0.15mM Manganous chloride tetrahydrate except the PCR damping fluid of standard replenishes with enough magnesium chlorides and Manganous chloride tetrahydrate, EPPCR comprises with suitable Oligonucleolide primers the pcr gene that target gene carries out standard is increased.This method can be planted the EPPCR product to one or more and be carried out repetition to import further sudden change therein.

With the EPPCR product that obtains be connected to expression vector (as, pTrcHis, pTrxFus) in and transform suitable competence host cell with these carriers then, be used for expression of enzymes and enzyme activity assay as intestinal bacteria AG1 or JM109 cell.Identify the clone who contains plasmid by the cultivation of selectivity on the LB/Amp agar plate.With toothpick with single colony lift in the aperture that contains the 96 hole flat boards of selecting substratum and in 37 ℃ hatch～8-12 hour cultivates.Behind initial incubation period, replica plate also increases, and presses described its single clone's of mensuration of lower part dehalogenase activity.Change the method for measuring the RDhl enzymic activity by detecting pH

Because acting on the pH that causes in to the substrate dehalogenate, this enzyme changes the activity of measuring the RDhl enzyme by measuring.The prokaryotic host cell that to express this enzyme before adding pH indicator, damping fluid and substrate is incubated in the substratum, quantitative and saturatingization.

Add the SOB substratum (available from Difco, Detroit, MI, the U.S.) that 200 μ L have replenished about 50-100 μ g/ml penbritin (" SOB/Amp ") in every hole of 96 hole microtest plates.Will be in a hole of this flat board from the cell inoculation of the single bacterium colony that produces the enzyme escherichia coli cloning.When detecting rRDhl enzyme or rRDHL fusion protein libraries, the inoculation of every hole is from the cell of different escherichia coli clonings.6 holes do not add cell and produce the escherichia coli cloning of wild RDhl enzyme as positive control as negative control and 6 other hole inoculations.Inoculum vibrates with 250rpm in 37 ℃ of overnight incubation in the Psycrotherm stove simultaneously.

After hatching,, and then in the Psycrotherm stove, hatched 5 hours and vibrated and the inducing culture thing with 150rpm simultaneously in 37 ℃ by the final concentration of adding IPTG to 1mM.After hatching 5 hours, measure the cell density of each culture with 1.573 Vmax/Kinetic microplate counters (Molecular Derices, Sunnyvale, CA, the U.S.).Then 20 μ L equal portions of every kind of inducing culture thing are joined in the aperture of fresh 96 orifice plates and and change damping fluid (10mM Sodium desoxycholate 10 * thoroughly of 2.2 μ L pH8.0,1%NP-40,50mMTris and 50mM EDTA) join in every equal portions and go, then with moderate hunting speed vibration 3-5 minute.Add 200 μ L then in each cell culture equal portions and contain the damping fluid (＞1 μ LDCB/mL buffering system) of the saturated pH 9.2-9.5 of the DCB-of 5mMCAPSO and 100 μ M cresol purples.Measure the activity that boosts the beginning enzyme beyond colour-change that indicator forms and the slope of the drawing colour-change with Spectro Max Plus microtest plate counter (MolecularDevices, Sunnyvale, CA, the U.S.).The separation of embodiment 1 dehalogenase from rhodococcus

By U.S. Patent No. 5,372, cultivate rhodococcus kind ATCC 55388 described in 944.From this culture, prepare enzyme extract by the following method by roughly described in the U.S. Patent No. 5,373,944, comprise and adopt 25%-75% ammonium sulfate to dam 2 ion exchange chromatography step (1.DEAE-sephadexs; 2.DEAE-sephacryl), (salt concn wherein changes in 0-400 mmole sodium sulfate scope with the form of gradient), with the gel permeation chromatography of sephadex G-75 and then by ultrafiltration and concentration to obtain containing enzyme preparation greater than 65% dehalogenase by SDS-polyacrylamide amine analysis.

Will (～25mg) purifying enzyme be carried out cyanogen bromide digestion.With the water gradient of 0-80% acetonitrile/contain 0.1% trifluoroacetic acid with the sun of RP-8 Macrosphere (Altech) hybrid mode from post isolated peptides fragment.

Check order with cyanogen bromide (CnBr) fragment of automatic Edman degraded three kinds of purifying proteins and purifying.Measure terminal and three the CnBr fragments sequence of N-.One of them CnBr fragment is identical with this N-end sequence.Other two inside dehalogenase sequences corresponding to uniqueness.The sequence of all peptides is shown in the table 1.

Table 1: the N-end of purifying rhodococcus desaturase and the sequence of proteolytic fragments

N-terminal sequence: SEIGT GFPFD PHYVE VLGER cyanogen bromide fragment sequence: 1.HYVDV GPRDG 2.DHYRE PFLKP VDRE

The dna primer design

Thereby design primer RDhl 5.4 and RDhl 3.12 make the open reading frame of amplification and clones coding rhodococcus dehalogenase (RDhl) gene in expression system pEXPROK.The sequence of RDhl5.4 is from this proteic N-end sequence and RDhl 3.12 is based on actual dna sequence dna and designs.Thereby design primer RDhl 5.7 and RDhl 3.13 produce the RDhl gene in expression system pRSET and TrcHis.Design primer Trx2++ and Trx-are to produce the RDhl gene in expression system pTrxFus.The sequence of these Oligonucleolide primers is as follows: table 2: the sequence and the direction that are used for cloning the Oligonucleolide primers of rhodococcus dehalogenase

Few (Nucleotide) title	Direction	Design consideration	Sequence *
				??RDhl?5.4	Forward	N-end/homology	????5’GGTTCCATGGGNTT(CT)CCNTT(CT)GA(CT)CCNCA(TC)TA
??RDhl?3.12	Oppositely	3 '-sequence data	????5′Bio-CAGAGCTAGC?GAGTCCGGGGAGCCAGCG
				??RDhl?5.7	Forward		????5′CGTACATATGGCCATGGGG?GCT?TCT?CAT?CAT?CAT ?????????????Nde?1?Nco?1?G??G???S???H???H???H ????CAT?CAT?CAT?GGT?ATG?TCT?GAA?ATA?GGT?ACC ?????H???H???H ????GGT?TTT?CCC?TTC?GAC?CCT?CAT?TA-3′
??RDhl?3.13	Oppositely		????5′-GAT?GAC?AAA?TAA?TGA?GCG?GCC?GCA?AGC?TTG?TAC-3?′′ ????????????????????????????Not?1????Hind?III
				??Trx2++			????5′-CC?GGG?GAT?CCC?ATG?GCT?TCT?GAA?ATA?GGT?ACC?GGT ???????????????BamH?I??Nco?I ????????TTT?CCC?TTC?GAC?CCT?CAT?TA-3′
??Trx-			????5′-TCG?ACT?GCA?GGC?GGC?CGC?TCA?TTA?TTT?GTC?ATC-3′ ????????????????Pst?I??Noc?I

^*The Bio=vitamin H; N=A, C, G or T; ()=surplus in the certain base half of given position, the underscore sequence is corresponding to 5 ' sequence of desiring to import the restriction site compatible with desiring cloning vector (pEXPROK) in the DNA product of amplification.The clone of the rhodococcus dehalogenase gene of part

By the following clone who finishes rhodococcus dehalogenase gene by the amplification from genome dna library.Method (bacteriology magazine 175:4631-4640 (1993)) isolation of genomic DNA from rhodococcus ATCC bacterial strain 5538 with P.J.Asturias and K.Timmis.Genomic dna (the 100 μ g) machinery of purifying is broken into＜mean size of 10kbp.These fragments are connected on the BamHI joint, yet with BamHI digestion and connect into the phage-ZAP Express of BamHI digestion ^TMIn the goods of DNA (available from Stratagene company, LaJolla, CA, the U.S.).Commercial production contains the library of genome rhodococcus dna fragmentation, and (Stratagene company, LaJolla is CA) and with 1 * 10 ⁴Pfu/ μ L (plaque forming unit/microlitre) supply.With the solid phase phosphoramidite chemosynthesis corresponding to half surplus dna primer (RDhl 5.4) of N-end sequence amino acid 6-13 codon and by HPLC purifying (table 2).

RDhl 5.4 primers and identification T3 bacteriophage promoter sequences (and are positioned at λ ZAPExprexx ^TMCarrier inside) thereby the commercial primer that obtains is united use amplification dehalogenase gene from the genomic dna phage library of single amplification.With containing 1 μ M RDhl, 5.4 primers, the biotinylated T3 Pro of 100nm primer (New England Biolabs), 10 * Amplitaq reaction buffer (Perkin-Elmer-Cetus), 1.5mM MgCl ₂, 5U rAmpliTaq archaeal dna polymerase (Perkin-Elmer-Cetus) and 4 μ L phage libraries (complete phage) polymerase chain reaction (50 μ L) finish amplification.Carry out 35 with following type of heating and take turns amplification: 94 ℃ 1 minute; 55 ℃ 2 minutes; 72 ℃ 2 minutes.Separate the PCR product and identify the decoupled band of 1.3kb by 1.0% agarose gel electrophoresis, from gel, downcut (band) and separate with QiaQnick gel-purified test kit (Qiagen company).Determine that this DNA also can be by after other rhodococcus dehalogenase primer amplified, with restriction enzyme NcoI and PstI digest this fragment and connect into NcoI/PstI digestion pGEM52f (+) (ProMega, Madison, WI).To 3 of this cloned sequence '-order-checking of non-translational region makes it possible to identify the terminator codon of deduction and uses primer RDhl 5.4 subsequently and the amplification of 3.12 pairs of these coding regions of RDhl.

Sequence and restriction enzyme analysis: the biotinylation primer (table 3) of every wheel continuously design is carried out two strands by two method of deoxidations of many wheels continuously to the dehalogenase gene check order according to the sequencing result of front.Band separates in 5.5-6.0% polyacrylamide urea sequencing gel, and shifts DNA transferred on the nitrocellulose filter and unite chemical luminous substrate again with well-known streptavidin-alkaline phosphatase coloration method by capillary and observe.Table 3: the sequence and the direction of the rhodococcus dehalogenase gene Oligonucleolide primers that is used for checking order

Few (Nucleotide) title	Direction	Concrete bp	Sequence *
				Dh1?Seq7	Forward	??697-714	??5′Bio-CCTGTCCCGAAGTTGTTG
Dh1?Seq8	Oppositely	??807-791	??5′Bio-CGGGCCGATGTCCACTG
				Dh1?Seq11	Forward	??186-202	??5′Bio-TGCTCCAGACCTGATCG
Dh1?Seq12	Oppositely	??496-480	??5′Bio-TCTGATCGATGATCAAC
				Dh1?Seq13	Forward	??404-422	??5′Bio-TCCCGACGTGGACGAATG
Dh1?Seq14	Oppositely	??663-646	??5′Bio-GAGCGCGACGATGTTCGC
				Dh1?Seq15	Forward	??725-742	??5′Bio-CACCCGGCGTACTGATCC
Dh1?Seq18	Oppositely	??951-934	??5′Bio-GAGACCGGTCAGCATTCC
				PROK-SEQ1	Forward	Promotor	??5′Bio-GAGCGGATAACAATTTCA
PROK-SEQ2	Oppositely	Terminator	??5′Bio-TCTCATCCGCCAAAACAG

^*The Bio=vitamin H; N=A, C, G or T; The alkali that ()=given position is certain

Base half is surplus.Do not comprise the life that was used to measure this gene order when in table 2, describing

Thing elementization primer.Also used specific commercial the getting of T3, T7 and SP6 promotor

To (New England Biolads) biotinylation primer but do not list at this.

Carrier pEXPROK (Fig. 1) is commercial available pPROK-1 carrier (Clontech company, Mountain View, derivative CA).And pEXPROK has the functional element (paired (paired) transcription termination signal that comprises amicillin resistance mark, Ptac transcripting promoter and polylinker rear portion) of pPROK carrier, and the pEXPROK carrier replaces the EcoRI-of pPROK-1 to arrive-the HindIII polylinker with the synthetic polylinker that is called EXFLAG that extends.Thereby design EXFLAG joint inserts open reading frame between NcoI site and NheI site.Having in the frame in six-Nucleotide NheI site is 11 amino acid peptides, and last octapeptide wherein is corresponding to well-known FLAG peptide (Kodak's imaging system, Rochester, New York), at its antibody and affinity reagent commercial be available.The sequence and the feature of EXFLAG joint are as follows: EcoR I Nco I Hind III Xba I Xho I Nhe I I-----EXFLAG-

GAATTCAG CCATGGCATAAGCTT TCTAGA CTCGAGGGA GCTAGC GGC CTA GGT Gly Leu Gly peptide------------→ Not I GAC TAC AAG GAC GAT GAT GAC AAA TAA TGA GCGGCCGC TAGCTT Asp Tyr Lys Asp Asp Asp Asp Lys***?***

The pcr amplification RDhl5.4/T3 Pro gene from the pGEM5 construct with primer RDhl 5.4 and RDhl 3.12, thus by NcoI and NheI digestion rhodococcus dehalogenase gene is connected in the expression vector of suitable digestion then.This method is used for the RDhl gene is inserted pEXPROK.The plasmid map of pEXPROK and pEXPROK-RDhl is shown in respectively in Fig. 1 and 3.Confirm the dna sequence dna of pEXPROK-RDhl construct then by the automated DNA order-checking.

Sequential analysis: the global DNA of dehalogenase gene and the protein sequence that obtains are shown among Fig. 2.Dna sequence data demonstrates the open reading frame of 876bp, obtains the protein sequence of 292 amino acid whose derivations and the expection molecular weight of 33kD.This is similar to the molecular weight of numerous other hydrolysis dehalogenases of report.

In order whether to measure this isolating gene dehalogenase of might encoding, the sequence of other known protein that relatively contains in this protein sequence that obtains and the Entrez sequence library (this database is kept by American National biotechnology information center) with MacVectorv.4.5.2 (Kodak) sequence analysis software bag.The RDhl polypeptide demonstrates with the so-called α/β that comprises several halogenated alkanes and halogenated acid hydrolase family dehalogenase, epoxide hydrolase has similarity maximum between multiple different catalysis enzyme member.The sequence of Dow rhodococcus dehalogenase and two kinds of other dehalogenases and non--dehalogenase (luciferin monooxygenase) relatively is shown among Fig. 4.Comprise that in the drawings enzyme and open source literature thereof are as follows: xanthobacter autotrophicus halogenated alkane dehalogenase D.B.Janssen, etc., bacteriology magazine 171:6791-6799 (1989); Tetrachloro cyclohexadiene lytic enzyme (TCCH or LinB)-Y.Nagata, etc., bacteriology magazine 175 (20): 6403-6410 (1993); Renilla reniformis luciferin monooxygenase-W.W.Lorenz, etc., institute of U.S. natural science institute newspaper 88 (10): 4438-4442 (1992).The entry of the up-to-date issue of Entrez database also demonstrates the mycobacterium tuberculosis of the supposition of Dow RDhl albumen and 2 kinds of unknown function, (Mycobacterium tuberculosis) albumen, isolating halogenated alkane dehalogenase in (by the Entrez database license number 1449324 and 1478233 respectively at 7-22-96 and 7-23-96 submission such as K.Badcock and C.M.Churcher) and the prunosus red coccus, significant similarity between (equaling the Entrez database license number 1196824 that 2-15-96 submits to) by A.N.Kulakova.

In the sequence that compares in Fig. 4, only the bacillus flavus dehalogenase has carried out sufficient signature analysis on structure and mechanism level.Obviously, 2 (2 of paramount importance residues, Asp-124 and His-289) in known three residues participating in the bacillus flavus catalytic cycle directly guard in the rhodococcus sequence.Similarity shown in these similaritys and the figure shows the structure and the mechanism conservative property of height between this family protein member.The dehalogenase protein expression

For the characteristic of the dehalogenase that confirms above-mentioned clone, we make every effort in this full-length proteins of expression in escherichia coli.In order to finish this operation, from pRDhIKO 2.1-pGEM5 construct, downcut the NcoI/SpeI restricted fragment of the 1300bp contain the RDhl gene and be connected with the pEXPROK carrier of NcoI/NheI-digestion.Because SpeI produces and the restriction fragment that is connected consistency with NheI, cause like this producing and contain under the derivable Ptac promoter transcription of IPTG is controlled and the complete deduction RDhl expression of gene construct (Fig. 5) under endogenous RDhl 3 ' non-translational region termination control.

To obtain bacterium colony overnight incubation in the little culturing bottle of 2mL (miniculture) that plasmid (pRDhIKO 2.3-EXPROK) transforms with this, precipitation is cleaned also every kind of culture of supersound process 1mL then.Measure extract then and adding the RDhl substrate, the ability that the catalytic chlorination thing discharges behind the 1-chlorobutane.The disappearance muriate discharges active in the culture that does not contain this clone gene; Culture with this clone gene demonstrates muriate and discharges activity, should activity increase when this gene transcription activity increases by adding IPTG.Therefore, in containing the recombination bacillus coli overnight culture of pRDhIKO2.3-pEXPROK construct, can induce the dehalogenase activity.Embodiment 2

The gene of this dehalogenase of encoding is separated and be cloned in the bacteria Escherichia coli.Dna sequence analysis shows that this isolating genes encoding and other known dehalogenase have the albumen of height sequence similarity.In order to increase the biosynthesizing level to commercial significance level (i.e. " expressions "), detected numerous reports can be in intestinal bacteria the high-level system for preparing heterologous protein.

For construction of expression vector pEXPROK-RDhl, with restriction enzyme NcoI/NheI digested plasmid pEXPROK and use QIAqmick gel extraction kit (Qiagen company, Chatsworth, CA) purifying in addition then.With primer RDHL 5.4 as forward primer (containing the NcoI site) to instruct translation initiation and with primer RDHL as reverse primer (and containing the NheI site) amplification RDhl open reading frame.Behind the DNA with NcoI and NheI digest amplification, this gene is connected in the pEXPROK carrier.Then new construct is transformed into the bacterium colony of intestinal bacteria AG1 competent cell and picking amicillin resistance.Contain the plasmid of RDhl gene and be called the pEXPROK-RDhl construct by analytical restriction enzyme digestion evaluation.The pEXPROK-RDhl plasmid map is shown among Fig. 3.The structure of pRSET-RDhl and pTrcHis-RDhl expression vector

In order to make up pRSET-RDhl and pTrcHis-RDhl expression vector, with Oligonucleolide primers RDhl 5.4 and RDhl 3.13 with the PCR condition of the standard RDhl gene that from pEXPROK-Rdhl, increases.Amplified production separates on sepharose and with the method for standard purifying in addition.

PRSET and pTrcHis carrier are the derivable expression vector of IPTG from cloning vector pUC18 and 19 series.They are all available from Invitrogen company (San Diego, California) and contain following feature:

(a) both all are designed for high-level protein expression and all have ampicillin resistance gene.

(b) both all contain the sequence of the terminal fusogenic peptide of six histidine residues N-of coding.These residues work as the melts combine district and can allow after by affinity chromatography and purification of recombinant proteins.

(c) these vector encoded are positioned at the enteropeptidase cutting recognition sequence (FLAG and/or EXFLAG peptide) in dehalogenase coding region downstream, and they make it be detected and fix by anti--FLAG antibody.

The high level expression characteristic of pRSET carrier is owing to have the T7 promotor in the upstream of this heterologous gene.Because intestinal bacteria do not contain the T7 polysaccharase, yet the M13 phage that need contain the T7 rna polymerase gene is used for protein expression.In fact, prepare this heterologous protein by introduce the bacterium that contains heterologous gene under the control of T7 promotor with the T7 phage-infect recombination bacillus coli that contains the T7 RNA polymerase.As selection, (that is, intestinal bacteria BL21) can be transformed with the pRSET construct commercial available stably express T7 RNA polymerase.

By with Restriction Enzyme NcoI/HindIII digested plasmid pRSET and be incorporated in 5 then ' end contains the NcoI site and makes up the pRSET-RDhl expression vector in the RDhl gene fragment that 3 ' end contains the HindIII site.Then this novel constructs is transfected into the bacterium colony of escherichia coli jm109 competent cell and picking amicillin resistance.Contain the plasmid of RDhl gene and be called the pRSET-RDhl construct by analytical restriction enzyme digestion evaluation.The pRSET-RDhl expression construct is shown among Fig. 6.Such clone (clone 16-4) is used for the protein expression with this pRSET system is carried out signature analysis.

The pTrcHis carrier contains another kind of high-level transcripting promoter-trc promotor, the fusion of crossing trp promotor and lac promotor for detailed analysis.The pTrcHis carrier also contains the little cistron (mini-cistron) that is positioned at this heterologous gene upstream, and this makes effectively and the repeatedly initial translation of clone's albumen height in the multiple clone site.

Use similar method, thereby we go into pTrcHis carrier structure pTrcHis-RDhl expression vector with the RDhl gene fragment clone.For expression study, intestinal bacteria TOP 10 ' competent cell is transformed with the pTrcHis novel constructs.PRSET-RDhl and pTrcHis-RDhl expression vector all contain the 11 amino acid EXFLAG peptides that are positioned at downstream, NheI site.

It is consistent and be useful for analyzing and testing and affinity purification that the EXFLAG peptide sequence is cloned proteic open reading frame therewith.Fig. 7 shows the collection of illustrative plates of complete pTrcHis-RDhl expression construct.One of them such clone (clone 18-3) is accredited as high-expression clone and is used for further signature analysis to the TrcHis expression system.The structure of pTrxFus-RDhl expression vector

Thio Fusion ^TMExpression system (Invitrogen company, San Diego, California) by the proteic like this gene fusion of will encoding to the coding e. coli protein, on the gene of sulphur oxygen cyclase protein and be provided in the pTrxFus expression vector method of expressing a large amount of heterologous proteins.This sulphur oxygen cyclase protein part can be given solvability and the thermostability that it merges part, thereby has opened and be used for by infiltration in shock or heat treated and the method for purifying.This expression vector, pTrxFus allow foreign gene to insert in its multiple clone site.It utilizes the P of phage _LThe level that promoters driven is expressed and transcribed from the cl repressor control of phage equally.Cl repressor expression of gene is under trp promotor and the proteic control of repressor.To substratum, cut off the synthetic and permission of cl repressor by adding tryptophane from P _LTranscribing of promotor and the expression of induction exogenous gene.

Design primer Trx2++ and Trx-(seeing the dna primer design) have the RDhl gene fragment of the exclusive enzyme restriction site of TrxFus multiple clone site with modification.Plasmid pEXPROK-RDhl is carried out PCR generation gene fragment as template and by primer Trx2++ and the Trx-that is used in 5 ' end adding BamHI site and 3 ' end adding PstI site.With this fragment of QIAquick PCR purification kit purifying.PTrxFus carrier and gene fragment are carried out enzymic digestion, sepharose purifying and be connected.With novel constructs, pTrxFus-RDhl (Fig. 8) mixes the GL174 electroreception attitude cell (Invitrogen company) according to manufacturers's explanation preparation.Expression analysis

The cultivation of cell culture with induce-for expression study, be incubated at 3mL Luria substratum (LB) or the SOB substratum (Difco that contains 50 μ g/mL penbritins in the 15mL round bottom polypropylene culture tube with being accredited as the clone who contains suitable DNA construct, Detroit, MI, the U.S.) in.With these culture tubes in 37 ℃ of vibrations (in the rotation bottle swingging machine 200 rev/mins) overnight incubation or be cultured to OD ₆₀₀Be 0.6.Afterwards, adding 2mL has in the fresh culture of IPTG (to the IPTG final concentration of 1mM) and culture tube was hatched in 37 ℃ of constant once more vibrations in 4-5 hour.For recombinant clone pRSET, after IPTG induces 1 hour, cell culture is induced with titrating M13/T7 phage-infect in advance and by aforementioned the continuation.

As for the clone of pTrxFus, the clone that will contain the RDhl gene is incubated in the 1mL RM substratum with 100 μ g/mL penbritins and in 37 ℃ of vibrations (in the rotation bottle swingging machine 200 rev/mins) overnight incubation.Second day, add the fresh inducing culture of 9mL and continue to be cultured to OD in 30 ℃ ₅₅₀Be 0.5.Then, with tryptophane inducing cell culture (to the final concentration of 100 μ g/mL) and change in 37 ℃ the incubator and again with 200rpm vibration 2 to 4 hours.

The preparation of cell-free extract is for analysis of protein, by precipitate the inductive cell culture that spends the night in 4 ℃ centrifugal (in SorvallSS-34 rotary heads 5000rpm10 minute).In containing the cold 10mM Tris vitriol damping fluid (pH 7.5) of 1mM EDTA disodium, clean cell precipitation and and then centrifugal.For pEXPROK, pRSET and pTrcHis clone, (Soniprep 150 with apiculus supersound process detector (small-tip sonicatingprobe) for final suspension, MSE company., Crawley, Sussex) with 14Hz on ice through 20 seconds " opening ", repeat supersound process 30 seconds " pass " 3 times.By with 10,000rpm removed insoluble sludge in centrifugal 10 minutes.Be transferred to acellular supernatant liquor in the clean polypropylene tube then and carry out suitable analysis.3 10-of final cell suspension supersound process of pTrxFus clone are sprayed (brust) and freezing fast in exsiccant ice/ethanol bath then second.Soon, melt cell lysate fast and carry out 2 supersound process-freeze-thaw circulations fast again after freezing in 37 ℃.Behind last the thawing, continue the step of above-mentioned removal cell and insoluble sludge.The left side of expression and purification Fig. 9 of pEXPROK-RDhl (2-5 road) shows the Pro-Blue of pEXPROK-RDhl clone 12-4 lysis sample ^TMPainted SDS-PAGE gel and in the right side Pro-Blue of the rRDhl enzyme of (8-11 road) display part purifying ^TMPainted SDS-PAGE gel.1 road contains the FLAG-peptide protein band that molecular weight standard and 6 roads and 7 roads contain single 60ng and 180ng 55kD molecular weight.The 2-5 road shows all soluble proteinss from cell-free extract.Because the rRDhl enzyme is not the major protein in the extract, and identical gel is carried out immunoblotting to prove conclusively existing of this recombinase.Figure 10 is presented in each sample road by anti--FLAG antibody at this recombinase band that estimated molecular weight～35kD discerned.6 roads among Figure 10 and 7 roads are respectively the FLAG-peptide protein of 20ng and 60ng.At Pro-Blue ^TMAnalyze the recombinase of affinity purification on painted SDS-PAGE gel and the immunoblotting film.With the continuous fraction of four kinds of affine-purifying rRDhl enzymes at the Pro-Blue shown in Figure 10 ^TMGlue is walked in the 8-11 road in the painted SDS-PAGE gel.Except be positioned at～the obvious band of 35kD molecular weight, other protein band also is a visible on this gel.Yet, the immunoblotting of partially purified enzyme (Figure 10,8-11 road) confirm the recombinase at～35kD be unique usefulness anti--albumen of FLAG antibody staining and therefore appear as the rRDhl albumen of correct translation.These data show that the rRDhl enzyme all can dye in the environment and in the whole purge process in Escherichia coli cell.The expression of pRSET-RDhl and pTrcHis-RDhl

Analysis is available from the proteic existence of reorganization RDhl in pRSET recombinase expression system and pTrcHis recombinase expression system clone's the cell-free extract.Sign 5 clones that contain correct big or small NcoI/HindIII dna fragmentation, the expression (Figure 11) of SDS-PAGE gel analysis rRDhl is also passed through in overnight incubation, cracking.1 road shows that molecular weight standard and 7 and 8 roads contain the FLAG-peptide protein band of single 60ng and 180ng 55kD molecular weight.The 2-6 road shows these 5 clones' 1 μ L cell-free extract sample and the cell-free extract sample that the 9-12 road shows 0.1 μ L.When anti--when FLAG antibody was used to dye this immunoblotting (Figure 12), the immunoblotting of these extracts demonstrated 2 bands (35kD and 38kD).This may show 2 initiator codons in the pRSET-RDhl system.First initiator codon initial design is arranged in about 41 amino acid (123bp) before the actual cloning site of pRSET carrier system, this feasible Met ATG codon translation behind 6 Histidines.Second initiator codon may be positioned at the NcoI cloning site originally on one's body, it is designed to be arranged in the initial 5 ' end primer of RDhl gene fragment.Yet the anti--existence of FLAG antibody response band has confirmed the existence of rRDhl enzyme.

Figure 13 shows the Pro-Blue from pTrcHis system cell-free extract ^TMPainted SDS-PAGE gel and Figure 14 show the immunoblotting of identical SDS-PAGE gel.All of pTrcHis system are cloned in～and 35kD molecular weight place demonstrates the band of anti--FLAG reaction of overload, and it confirms the existence of rRDhl enzyme in this extract.Because the volume of initial culture is identical with nothing-cell extraction Tetramune in all three systems, so the band of these overloads is presented at higher production of enzyme is arranged in the pTrcHis system.The expression of pTrxFus-RDhl

Detect the cell extract soluble proteins of pTrxFus system with reductibility SDS-PAGE.Figure 15 shows with Pro-Blue ^TMStained gel.12 roads show that molecular weight standard and 11 roads show 55kD molecular weight and the FLAG-peptide protein of single 150ng.In road, 1 road to 9, merge the major protein of band in 47kD molecular weight place high-visible sulphur oxygen cyclase protein.This size is corresponding to the sulphur oxygen cyclase protein of 12kD and the rRDhl enzyme of 35kD.On the contrary, 10 roads have the sample from the lysis insoluble substance, and this shows the sulphur oxygen ring fusion rotein that does not have high level expression.This confirms that all fusion roteins are soluble status.This fusion rotein band of data presentation identical molecular weight place in the immunoblotting film from other experiment can be discerned (data not shown) by anti--FLAG antibody.The active analysis of hydrolysis dehalogenate

For the hydrolysis dechlorination reactive behavior of quantitative this recombinase, used the muriate release to birth ratio chromatographic analysis at 460nm place.

Measure the activity of recombinant protein in the reaction buffer of cell-free extract (by above-mentioned preparation) by adding appropriate amount 6.0mL to the vial.100mM Sodium glycocollate damping fluid (pH9.0) is used for measuring to 1, the activity and the 100mM Tris-SO of 4-dichlorobutane (DCB) (Aldrich chemical company) ₄Damping fluid (pH 7.0) is used for measuring the activity to glyceryl trichloride (TCP).Add halogenated substrate (6 μ L) and little stirring rod and closed vial.The bottle that seals is hatched in 30 ℃ of stirred in water bath.

Every interval certain hour takes out the 1.0mL sample and is used for free muriatic mensuration.Add reagent 1,0.375M iron nitrate (10%v/v) is to stop hydrolysis reaction and adding reagent 2 in the 5-25N perchloric acid, and the saturated pharaoh's serpents (10%v/v) in the ethanol is with colour developing.Be in Perkin-Elmer 552A UV/VIS spectrophotometer counting final sample in 460nm.After proofreading and correct, measure the dehalogenate activity of ratio (rates) reorganization rhodococcus dehalogenase to the hydrolysis of barren non-enzymatic

Compare although the data of front show with the wild-type rhodococcus, the level that this reorganization dehalogenase can be much higher is synthetic in intestinal bacteria, and they do not illustrate the activity of this expressing protein.Really, the output of enhancing dehalogenase is the crucial purpose of this work.Sign in this reason, we have measured the active level relatively of dehalogenase among the representative clone of above-mentioned every kind of construct.Active by free muriate discharge analyze is measured and with Figure 13-15 in the protein expression that writes down make comparisons.Protein expression by high resolution scanning optical density(OD) instrument on the SDS-PAGE gel in addition quantitatively and the amount of the rRDhl that records represent with total soluble protein %.Following table is presented at the relation between the active and rRDhl enzyme percentage ratio of dehalogenate in the total soluble protein in all four kinds of expression systems.

Expression system	Total soluble protein %	The DCB of every mL culture *Active	Clone's title
				pEXPROK	?～3	????0.3×10 -2	?EXPROK-RDhl
pREST	?～10	????0.8×10 -2	RSET RDhl clones 16-4
				pTrcHis	?～15	????2.4×10 -2	TrcHis RDhl clones 18-3
pTrxFus	?～30	????4.8×10 -2	TrxFus RDhl clone 4

^*DCB unit is determined as this enzyme dehalogenate 1, indicator color change during the 4-dichlorobutane

Degree (Δ OD/min).

Intensive mutual relationship between this data presentation rRDhl protein expression and observed dehalogenase activity.

In this embodiment, rhodococcus halogenated alkane dehalogenase can high level be expressed in the 4 kinds of systems of intestinal bacteria that detect 3 kinds.The rhodococcus dehalogenase of reorganization stably express and discerned by anti--FLAG antibody in all 4 kinds of systems at the molecular weight place of expection.This recombinase demonstrates with wild-type dehalogenase similar activity level and with heterologous protein and expresses proportional activity level.The preparation of embodiment 3 porous alumina upholders

To represent the albumen (385mg) of 22TCP activity unit under mild stirring, to be fixed on the free evaporable aluminum oxide of 2.0g (U.S., IL, the lot#1587k-4 aluminum oxide of DesPlaines UOP) in 4 ℃.Method comprises polymine bag quilt according to GIA-activatory UOP standard practices, the adding of water cleaning and enzyme.Outwell soak solution gently and use 2mM Tris/1mMEDTA, (pH 7.5) clean upholder 5 times.Enzyme purification that is used for fixing and goods prepare reorganization rhodococcus dehalogenase with the pTrcHis expression system in intestinal bacteria.The enzyme preparation that is used for all fixing researchs is at first used 4 ℃ of 45% ammonium sulfate precipitation partial purification to 70% saturation ratio, then in 10mM Tris vitriol, and dialysis and clarification among the 1mM EDTA (pH 7.5). this ealkaline buffer is used for whole purification step.Record these goods routine from lysate by 280nm place absorbancy and be purified 4-5 doubly, and be estimated as the dehalogenase albumen of 30-35% purity by SDS-PAGE.Obtain more highly purified enzyme preparation by the agarose of DEAE-again chromatography step with 0-400mM ammonium sulphate gradient wash-out.Obtained having approximately 10 times purifying from lysate of 85-90% enzymic activity like this.Carry out QAE-agarose (Sepharose) FF chromatography with narrower 0-120mM ammonium sulphate gradient after this step, obtain purifying doubly, and carry out the homogeneity of SDS-PAGE with the proof enzyme from the about 12-of lysate.The RDhl of purifying generally is called the preparation of " rRDhl ", upholder at this from TrcHis RDhl expression system

All anionresin upholders are illustrated thorough hydration (if necessary) according to manufacturers, and cleaning down is to remove ethanol and to change sulphate form into by washing continuously with 10mM Tris vitriol 1mM EDTA then.Whole process is used the above sample enzyme preparation of this identical initial damping fluid.

According to the method for fine foundation (U.S. Patent No. 4,268,410 and Mosbach, immobilized enzyme is in 44 Enzymology methods (1976) (academic press, New York)) with polymine and pentanedial decoration inorganic support.Weighing exsiccant upholder sample also is scattered in the adding a cover in the bottle of 12mL.Add 2.5% polyethyleneimine: amine aqueous solution to total every gram upholder 10mL.Bottle is sealed and stirred gently on the bottle swingging machine that room temperature is being shaken 1 hour then.Sample transfer is removed in the little B of liquid to vacuum gently.Be transferred to upholder in the glass dish and allow it in air at room temperature dried overnight (about 18 hours).With sample transfer to wherein adding in the new bottle of 25% glutaraldehyde water solution of fresh thawing with the ratio of every gram (gm) upholder 20mL.With mixture sealing and then in pocket (hood) not failure of oscillation swung 1 hour.Go glutaraldehyde and water cleaning down gently till fuchsine test does not detect aldehyde.Before enzyme is fixing, decants upholder but do not allow its drying.Fixing of enzyme

All enzymes are fixed in 4 ℃ of cold room temperatures to carry out stirring to provide slowly with the bottle swingging machine that shakes.Be used for enzyme preparation and be attached to time on the upholder for from being used for 1 hour of ion-exchange upholder to being used for being 4 days scope to the maximum with what PEI-GIA modified that inorganic support tests.Buffer exchange only is used for the research of Celite R648 binding ability, and Tris damping fluid is wherein changed on sephadex (Sephadex) the G-25 post of prepackage with the 10mM potassiumphosphate, 1mM EDTA (pH 7.0) damping fluid.Enzyme coming off from the ion-exchange upholder

Resin suspension (slurry) and enzyme 11.1 DCB U (Toyopearl with 2 covers, 250 μ L equal portions ^) or 6.63 DCB U (PEI Cellulose) in conjunction with spending the night.The careful removal in conjunction with supernatant liquor also analyzed.With resin in 6, centrifugal 8 minutes of 000rpm.Remove other supernatant liquor and clean resin 2 times with 100mM Sodium glycocollate damping fluid (pH 9).With the effective 0.5M (NH in every cover ₄) ₂SO ₄Enzyme was come off in 1 hour from upholder thereby handle.Wash these resins with damping fluid once more.Analyze the activity of resin and supernatant liquor as substrate with DCB.The ion-exchange upholder

Anion-exchange chromatography has been widely used in the purifying and the signature analysis of wild-type and reorganization dehalogenase.This enzyme when neutral pH (carrying out dehalogenation therein) be anionic property and the anionresin upholder fix in this proteinoid through being everlasting and bring into play good function.Because this method can allow enzyme is carried out the while purifying with fixing, so it also is attractive, in order to confirm this potential purposes, we have detected rRDhl albumen combining and wash-out on negatively charged ion and Zeo-karb in pH scope widely.Fig. 2 is presented at dehalogenase almost quantitative delay on DEAE agarose ion exchange resin in 5 pH unit's scopes.On the contrary, the CM-agarose is lost its binding ability rapidly when being higher than pH 5.Fixing

Detect the fixedly efficient of rRDhl of numerous support material.In these researchs; the part of using dehalogenase 40-70% ammonium sulfate to dam.Two cover enzymes on every kind of upholder are fixed in 13 kinds of ion-exchange upholders in preparation. Discharge the dehalogenate activity of the wherein a kind of enzyme in the every cover enzyme of assay determination immediately with muriate.Second kind of enzyme handled 1 hour in 45 ℃ with the saturated 10mM Tris damping fluid (pH7.5) of TCP-.After this handles; remove supernatant liquor and also measure this cover enzyme by the chloride process of standard.Table 4 has been summed up the result of these mensuration. table 4: the presence of the substrate 45 ℃ for 1 hour at 13 after two ion exchange support on TrcHis RDhl screening supports suppliers Lot / batch # TCP processing activity % silicone PE1-Silica Sigma 24H0810 0DEAE Sephadex a-50 Sigma 24H0485 19PE1 cellulose (med.mesh) Sigma 94H7200 54Glass , aminopropyl Sigma 34H8260 43Toyopearl^Super Q-650M TosoHaas 65QAM02RM 79DEAETrisacryl Plus-M Sigma 92H0861 21Spectra/ gel ion-exchange 1 * 8 Spectrum 16865 14Dowex ^1 * 8-200 ion exchange resin Aldrich 12627-85-9 54 ^*DE52 Whatman 1,152,032 50 quaternary ammonium Mierocrystalline cellulose Whatman 9852032 2DEAE agarose Sigma 53H0177 30AG3 * 4 100-200 Bio-Rad 52594A 18AG4 * 4 100-200 Bio-Rad 47426A 9 ^*Hatch in 37C

These results show that these matrix have significant otherness as the efficient of dehalogenase upholder.Similarly otherness also will see the similar dehalogenase of the similar reaction of catalysis.

Filter out four kinds of optimal candidate upholders and behind certain hour in the presence of the TCP, still have stability.They are: PEI Mierocrystalline cellulose, Toyopearl ^Super Q-650M, GlassAminopropyl and DEAE Sepharose.Preparation 2 covers, wherein a cover is used for initial muriate check and analysis, the another set of mensuration that is used for after being exposed to TCP.In the middle of table 5 shows 43 in 24 hours, lose significant activity but after initial (activity) loses, keep stable activity and reach at least 7 days.Toyopearl ^Experienced similar but postpone lose (in 48-120 hour) and as if stable then.Table 5: TCP is present in the stability study upholder of TrcHis RDHL on 4 kinds of ion-exchange upholders through the active % behind the certain hour in room temperature

24hr????48hr????120hr????192hrPE1?Cellulose(med.mesh)Sigma??????83??????79??????78???????78Glass，Aminopropyl?Sigma??????????78??????87??????75???????66Toyopearl ^Super?Q-650M?TosoHaas?100?????100?????78???????82DEAE?Sepharose?Sigma??????????????76??????79??????73???????62

As if as if all four kinds of resins be the good candidate material of fixing dehalogenase and be provided for prolonging the suitable surface of enzymic activity.Be covalently coupled on the Tresyl-activatory polyacrylic polymer

In order to measure, Tresyl-Toyopearl is assessed through the outstanding amino feasibility that rRDh1 is covalently coupled on any upholder.This activatory resin provide and this enzyme between stable primary amino key:

The rRDhl goods that are used for these researchs obtain affinity purification and estimate that by SDS-PAGE 20% purity is arranged approximately from the intestinal bacteria lysate with anti--FLAG antibody column.Enzyme (1.96mg total protein) with 0.35 unit under the condition that manufacturers is described is coupled on the 40mgTresyl-Toyopearl.After 3 hours, pass through A ₂₈₀The decline that the place observes (absorption) records 93% albumen by coupling.Add the 10mg resin again and continue 1 hour albumen of coupling with combination＞98%.Redeterminate the active activity (31%) that reclaims 0.11 unit that shows of the dehalogenase that cleans gel.Test once more with 2.6 unit same enzyme goods and 1.0gm activated resin confirms to have 37% active recovery.Explanation according to manufacturers; reclaim usually scope from the activity that is coupled to this upholder enzyme, so 31-37% represents reasonable recovery and is enough to by its amino this enzyme is coupled to fixedly that support material is used for small-scale or industrial reactor becomes business practice at 40-60%.

This covalent attachment of hydrophilic resin also is the fixing effective ways of dehalogenase.Inorganic support with the infiltration of the polymine of glutaraldehyde cross-linking

Because obtain easily, easy the to be capable property of cheap, high last sample ability, regeneration and utilization again and pore size widely, so inorganic support is also found to have been widely used in the industrial enzyme field.Porous aluminum oxide, silicon-dioxide and Celite (diatomite) have found to use widely as the upholder of immobilized enzyme, wherein use comparatively limited based on the upholder of titanium and carbon.

Can enzyme be fixed on the inorganic support by three kinds of mechanism.This enzyme can combine with inorganic support or can be attached on the ionic polymer that is impregnated in the inorganic support through ion-exchanging mechanism through ionic interaction, and perhaps available difunctional chemical joint is cross-linked on the ionic polymer.First method do not see be widely used because faint ionic interaction frequently cause rinsing out of enzyme.Polymine (PEI) becomes the best polymer of infiltration owing to its cheap price.These amino will be used cross-linking chemistry widely.Glutaraldehyde is to study at most and is used cheap linking agent.Research to rRDhl concentrates entirely on this coupling chemistry.

Use porous upholder that being used to of having established prepare the PEI-infiltration method of glutaraldehyde cross-linking (U.S. Patent No. 4,268,410 and Mosbach, the immobilized enzyme in 44 Enzymology methods, (1976) (academic press, New York)) then.2 kinds of active recovery of upholder rRDhl of initial screening.With the porous silica of PEI infiltration available from Sigma (standard 250 pore sizes).Celite R-648 is available from Manville (about 150 in standard aperture) and according to U.S. Patent No. 4,268,410 method with the PEI of Sigma (average 50,000MW) infiltration.Two kinds of upholders are all handled with glutaraldehyde (GIA) and then water thoroughly clean.(1.0mL, the highly purified rRDhl enzyme preparation (by SDS-PAGE (being determined as)＞98% purity) of 0.55mg albumen/mL) are used to be coupled to every kind of 500mg to be handled with glutaraldehyde, on 2 kinds of upholders of PEI infiltration with 5.5 units.Sample level (0.11%w/w) is thought known low at least 2 orders of magnitude of sample ability of going up than this upholder on this.Thoroughly cleaning with before removing the albumen that does not connect, with this enzyme and upholder 4 ℃ of overnight incubation (18 hours) of vibrating gently, redeterminate these two kinds of upholders with DCB and prove that PEI-Celite R-648 have 40% recovery and PEI-silicon-dioxide that 31% recovery is arranged.Under reaction conditions (saturated DCB), these samples are stored in 1 week of room temperature and measure once more.Celite fixed enzyme preparation is lost 49% activity in 1 week and the enzyme preparation of silica stationary is lost its activity of 28%.

For the inorganic support of any type of rapid determination will obtain the active optimum recovery of rRDhl, available porous upholder on the screening several commercial, with the same in front the experiment, with the last sample level set of highly purified rRDhl enzyme than low three the most magnitudes (0.0055%w/w) of last sample ability of this upholder expection thus only depend on sample ability, pore size etc. than upholder according to the specific activity of recovery.

Filter out three kinds of porous aluminum oxide, three kinds of porous silicon-dioxide and two kinds of porous carbon.In addition, reappraise under the same conditions Sigma PEI-Silica and Celite R-648 (estimating in the former screening).The same as beforely soak into all upholders and handle with glutaraldehyde with PEI.Stir gently to hatch in 4 ℃ with 25 μ L enzyme preparations (13.8 μ g) thereby with every kind of upholder and guaranteed maximum last sample in 72 hours.In bathliquid enzyme on sample by measuring 24 and 72 hours A ₂₈₀And monitored.Hatch after 72 hours at bathliquid (unconjugated) and the gel (bonded) washed and go up the activity of measuring DCB.Table 6 and 7 shows the result of these researchs.

Table 6: by A ₂₈₀immersion holder in the porous holder that the rRDhl enzyme that monitors is processed to PFI-infiltration GIA, percentage in 24 hours loadings, percentage aluminium oxide-Davison in 72 hours loadings, Low, SA, 83%, 62% aluminium oxide-Norton, SA, 6176, 86%, 84% aluminium oxide-Calcicat, Type, C, 84%, 67% silica-Calcicat, S-88-473, TypeA, 69%, 72% silica-Shell, 5980-F, 81%, 93% silica-Davison, 952-08-5 *, 91%, 92% carbon-Borecker, Subunit, 77%, 91% carbon-AmCy, 5701-Sn, 90%, 95% diatomite-Manville, R648, 82%, 95%PEI-silica-Sigma, 85%, 93% table 7: the recovery holder of processing enzymatic activity on holder at PEI-infiltration GIA, the % combination, % is combination not, % loses * aluminium oxide-Davison, Low, SA, 7%, 38%, 55% aluminium oxide-Norton, SA, 6176, 3%, 17%, 80% aluminium oxide-Calcicat, Type, C, 7%, 34%, 59% silica-Calcicat, S-88-473, TypeA, 12%, 28%, 60% silica-Shell, 5980-F, 12%, 8%, 80% silica-Davison, 952-08-5 *, 17%, 11%, 72% carbon-Borecker, Subunit, 5%, 9%, 86% carbon-AmCy, 5701-Sn, 7%, 5%, 88% diatomite-Manville, R648, 21%, 5%, 74%PEI-silica-Sigma, 6%, 7%, 87%

^*% loses=100%-(% combination+% is combination not)

Every kind of upholder demonstrates 62% to 95% difference that immerses scope and immerses pattern after 72 hours.For most systems, can finish for finishing that sample is enough on the proteic maximum in 72 hours at 4 ℃.Yet in fact three kinds of alumina systems reveal than bigger immersion in 72 hours at 24 hour meters.Compare with the lyoenzyme contrast of being untreated, 72 hours active scopes of 3% to 21% that are recovered as of desmoenzyme.In the system of all detections, there is quite a lot of activity of 55% to 87% not calculated or " losing ".The combination that the upholder of using equally, in the past (Sigma PEI-Silica and Manville Celite R 648) demonstrates is still less reclaimed.This may be owing to be used for sample ratio or longer incubation time on the lower enzyme of this experiment.If this joint efficiency and the active recovery of this desmoenzyme have been arranged, diatomite,, silicon-dioxide, carbon and aluminum oxide all can be used as among the present invention effectively fixedly support material, though the performance of diatomite and silicon-dioxide is better than aluminum oxide and carbon.Yet as if with regard to stability, alumina supports is performance more superior (face as follows).

This also carries out Journal of Sex Research steady in a long-term in conjunction with sample.After analyzing as substrate with DCB, the flushing upholder also is dipped in the saturated damping fluid of TCP-.At given time point, remove the TCP damping fluid, wash upholder once more and analyze with DCB.Table 8: the active % that the Journal of Sex Research upholder steady in a long-term of the crosslinked upholder of PEI is kept in the room temperature

At 41 hr at 136 hr aluminium oxide 1 38 57 aluminium oxide 2 66 67 aluminium oxide 3 58 75 silica 1 76 81 silica 2 79 46 silica 3 60 30 carbon 1 75 0 carbon 2 37 48 diatomite 57 12PEI-silica 43 60

Therefore, 2 kinds of upholders of recovery levels in the middle of in fixation reaction, showing, silicon-dioxide and aluminum oxide proof have best stability through behind the certain hour.Screening all these upholders does not have PEI or GIA to modify and direct ability in conjunction with this enzyme yet.Yet, remove enzyme with flushing from upholder in conjunction with very weak and not reproducible and easy.Inorganic support with polymine infiltration of the desmoenzyme by ion-exchange

The molecular weight of same known PEI has influence to the overall yield and the stability of immobilized enzyme.In addition, PEI can work as the ion exchange ligands on the various upholders or as the glutaraldehyde cross-linking acceptor.Owing to these reasons, the PEI with two kinds of different molecular weights is impregnated in the various porous inorganic support according to the described method of the part of front.Yet, these the experiment in, enzyme (the half purifying goods that contain 1-2U/mL) by ion-exchange in conjunction with but omitted the GIA cross-linking step.Thereby sample is carried out the stability screening detect whether the PEI size is important factor.Table 9: do not have the stability of the porous upholder of crosslinked PEI infiltration to screen the active % that upholder supplier MW PEI keeps

At 24 hr at 120 hr1 aluminum oxide Norton SA 6,176 50,000 70 622 aluminum oxide Calcicat Type C 50,000 61 423 silicon-dioxide Calcicat S-88-473 Type A 50,000 101 644 silicon-dioxide Shell 5980-F 50,000 80 555 carbon Borecker Subunit 50,000 41 326 carbon AmCy 5701-Sn 50,000 39 177 diatomite Manville R, 648 50,000 83 508 aluminum oxide Norton SA, 6,176 2,000 82 559 aluminum oxide Calcicat Type C, 2,000 91 6110 silicon-dioxide Calcicat S-88-473 Type A, 2,000 94 5711 silicon-dioxide Shell 5980-F, 2,000 76 5512 carbon Borecker Subunit, 2,000 44 5013 carbon AmCy 5701-Sn, 2,000 42 2114 diatomite Manville R 648 2,000 58 2

As if except diatomite, the PEI of different molecular weight does not have material impact to the fixed efficiency or the stability of enzyme.The structure of embodiment 4pRSET-RDhl.Nde

Mix and make up the pRSET-RDhl.Nde expression vector in this construct by then 5 ' end is contained RDhl gene fragment that NdeI site and 3 ' end contains Hind III site with restriction enzyme NdeI and Hind III digested plasmid pRSET RDhl clone 16-4.Then will this new construct be transformed in the escherichia coli jm109 competent cell (available from the Invitrogen of California, USA Carlsbad) and the bacterium colony of picking amicillin resistance.Contain the plasmid of RDhl gene and be called the pRSET-RDhl.Nde construct by analytical restriction enzyme digestion evaluation.The proteic preparation of reorganization Rdhl is transformed into intestinal bacteria B834 (DE3) competent cell (from Novagen company, Madison, WI, the U.S.) with two kinds of new construct-pRSET-RDhl.Nde and pTrcHis-RDhl.Confirm the generation of active dehalogenase and the level that produces with PAGE research enzyme by the dehalogenate activation analysis.Thereby measure the active analysis of dehalogenate to 1 with the muriate release to birth ratio chromatographic analysis of 460nm place, the enzymatic dechlorination activity of 4-dichlorobutane (DCB).

We observe the generation of the reorganization RDhl enzyme that increases in this host-intestinal bacteria B834 (DE3) competent cell.Following table is presented at the relation between the rRDhl enzyme percentage ratio in the active and total soluble protein of dehalogenate in different expression systems and the host cell.

Expression system	The competence host cell	RRDhl% in the soluble proteins	Every mL culture DCB *Active (* 10 2)
				pEXRPOK	Intestinal bacteria AG 1 +	??～3	????～0.3
pRSET	Intestinal bacteria JM 109	??～10	????～0.8
				pTrcHis	Intestinal bacteria top 10F ' +	??～15	????～2.4
pTrxFus	Intestinal bacteria G1 174 +	??～30	????～4.8
				pTrcHis	Intestinal bacteria B834 (DE3)	??～42	????～4.5-12.5
pRSET	Intestinal bacteria B834 (DE3)	??～48	????～14.8

^*DCB unit is to 1, active the measuring of 4-dichlorobutane (DCB) dechlorination. ⁺Intestinal bacteria AG1 chemoreception attitude cell is available from Stratagene (La Jolla, CA, the U.S.); Intestinal bacteria TOP 10F ' chemoreception attitude cell is available from Invitrogen (Carlsbad, CA, the U.S.); (Carlsbad CA) and according to supplier's explanation makes the electroreception attitude to intestinal bacteria G1 174 cells available from Invitrogen.The rhodococcus desaturase that embodiment 5 modifies

Because the rhodococcus desaturase by TrcHis RDhl construct preparation is modified with extra amino acid at amino and carboxyl terminal, so thereby set up the plasmid construction body and test the influence that every kind of modification in these modifications may have this enzymic activity.By with NcoI and AgeI enzymatic digestion pTrcHis Rdhl 18-3 plasmid and with the oligonucleotide of 17bp be connected to remove in the breach that obtains aminoterminal many-the Histidine afterbody.

The right dna sequence dna of this oligonucleotide is as follows:

RDhl?ΔHis-6-F

5′-CATGGGTGAAATAGGTA-3′

RDhl?ΔHis-6-R

5′-CCGGTACCTATTTCACC-3′

With the molecular biology method of standard, with the annealing of His-6-F and His-6-R oligonucleotide, connect in the 18-3 construct of digestion and be transformed in competence intestinal bacteria TOP 10F ' cell.By being incubated at the clone that screening transforms on the LB/Amp agar plate.The N-terminal sequence that obtains is:

-12??-11??3

ATG??GGT??GAA??ATA??GGT

Met??Gly??Ile

(the amino acid numbering with initial unmodified sequence shows).

Digestion and reconnect the construct that the Ala-293 Ser-294 sequence (Fig. 2) that obtains wherein becomes Ala-293 Arg-294 sequence.The back of coding Arg codon is the trimerical terminator codon of TGA Nucleotide corresponding to base 927-979 place in the original series.

Remove C-terminal EXFLAG by digesting pTrcHis RDhl 18-3 and be connected this plasmid again with AvrII and NheI.

Screen single clone by enzymatic digestion and gel electrophoresis.Candidate clone is incubated in the 5mL culture in 37 ℃, induces and by the supersound process cracking with IPTG.Come the analytical pyrolysis thing by PAGE, Western trace and muriate check and analysis.Those clones that lack N-terminal polyhistidine or C-terminal EXFLAG demonstrate and the equal catalytic activity of construct originally.The structure materials and methods of embodiment 6pTrcHis RDhl-S-Tag and pRSET RDhl-S-Tag:

CTERM S-Tag F (forward) and CTERM S-Tag R (oppositely) are for being designed FLAG polypeptide-a kind of 11 amino acid peptides-change into two primers of S-Tag polypeptide-a kind of fifteen amino acid sequence.The sequence of these oligonucleotide following (segmental every the chain of S-Tag is by underscore):

---Avr?II---CTERM?S-Tag?F???????????5’-CTA?GGT?GAC?AAA?GAA?ACC?GCT?GCT?GCT?AAA

---Nsp?V---

TTC?GAA?CGC?CAG?CAC?ATG?GAC?AGC?AAA?TAA

GTT?TAA?ACA?TCA?TTCCAATTGC

---Not?I---CTERM?S-Tag?R???????????5’-GGCCGCAATTGGAATGATGTTTA?AAC?TTA?TTT?GCT

--Nsp?V---

GTC?CAT?GTG?CTG?GCG?TTC?GAA?TTT?AGC?AGC?AGC

The structure of GGT TTC TTT GTCACpTrcHis RDhl-S-Tag

In order to make up plasmid pTrcHis RDhl-S-Tag, be connected (by room temperature primer CTERM S-Tag F and primer CTERM S-Tag R are annealed and prepare the S-Tag fragment) with restriction enzyme AvrII and NotI digested plasmid pTrcHis RDhl clone 18-3 and with the S-Tag fragment.The construct that this is new, pTrcHis RDhl-S-Tag are incorporated into the bacterium colony of intestinal bacteria AG1 competent cell (from Stratagene, La Jolla, CA, the U.S.) and picking amicillin resistance.Contain the segmental plasmid of S-Tag by analytical restriction enzyme digestion evaluation.The structure of pRSET RDhl-S-Tag

Also use and be used to make up the identical method of pTrcHis RDhl-S-Tag to make up pRSETRDhl-S-Tag, but it is initial and this construct is connected on the above-mentioned S-Tag fragment to clone 16-4 with the plasmid pRSET RDhl of restriction enzyme AvrII and NotI digestion.

The half purifying RDhl-S-Tag albumen for preparing among semipurified rRDhl (cloning the albumen of the EXFLAG mark of 18-3 from TrcHis RDhl) and this embodiment is carried out kinetics relatively.Active at 0mM to the TCP concentration range detection muriate release of 5mM.As shown in Figure 19, the albumen of S-Tag-modification demonstrates the consistence increase than EXFLAG modified protein Vmax about 15%.Compare with EXFLAG albumen, S-Tag albumen also demonstrates the Km lower to TCP～25%.These results confirm that the change of TDhl enzyme C-end can be used for regulating and improving the activity of this enzyme.Embodiment 7 reactor design and the setting of behavior performance reactor:

Stainless steel assembling hull shape and tubular small-scale reactor with 316 1/4 inch ID altogether.The import and export pipe of reactor also is a stainless steel.Keep reactor in 30 ℃ with Lauda circulator bath (having thermostatted).Reactor is filled with the immobilization rRDhl enzyme stream of upper reaches (up-flow) direction.Immobilization rRDhl enzyme at first by partially purified enzyme preparation (SDS-PAGE identify be about 70% purity) is gone up sample to the PEI infiltration with in 2 hours the aluminum oxide of 25% (w/v) glutaraldehyde pre-treatment (from 4000 grades of the ISP of UOP) and prepared; Fully wash with distilled water then, enough albumen is imported in the aluminum oxide to obtain every gm upholder 300mg albumen (by the Lowry method).At room temperature in conjunction with spending the night.By measuring unconjugated enzymic activity in the soak solution or estimating the activity of desmoenzyme by the final photoabsorption at 280nm place.

At import and export immobilized rRDhl enzyme is transferred in the reactor as interval body with the 2mm granulated glass sphere.The reinforced beginning of liquid perfusion with the 10mM sodium phosphate/10 μ M edta buffer liquid (pH 7.0) of pre-temperature.Clean after a few hours remove any unconjugated enzyme, feed in raw material and carry as the solution of continuously stirring with the flow velocity of 0.15mL/min with glyceryl trichloride (TCP) saturated liquid.Reactant TCP and product 2 import and export liquid stream by the GC analytical sampling allow reactor balance～2 residence time before 3-two trimethylewne chlorohydrin 3-s (DCH) concentration.In order to prepare the sample that is used for GC, that every kind of sample is at first saturated and extract with the chloroform (2 volume) that contains each (unsym.-tetraehloroethane and trimethylene chlorohydrin) in 2 kinds of internal standards of 10mM then with sodium sulfate.From the GC data, estimate TCP and DCH level and calculate its productive rate (the percentage output of per every volume of time) with the internal standard method then.This initial productive rate is measured as initial enzymic activity.The productive rate of small-scale rRDhl biological respinse

Trimestral time of operation, while are imported and exported liquid stream according to the aforesaid method periodic sample continuously with bio-reactor.At the capacity productive rate (the product weight of the every liquid flow volume of per minute) of each this enzyme of time point determining and change percentage ratio in the period at this section and drop to about 40% from about 60%.Measurement result is listed among Figure 16.According to these data, estimate that the half life of this immobilized enzyme is about 3500 hours.This makes this immobilization dehalogenase be a member in the catalyzer of reporting so far of stabilize proteins the most.Embodiment 8EPPCR is to the orthogenesis of dehalogenase

AgeI and Nhe-digestion carried out fallibility PCR mutagenesis by agarose gel electrophoresis purifying and the plasmid pTrc/His RDhl 18-3 that extracts from gel.The EPPCR product is connected in the expression vector with AgeI and NheI cleavage site.The plasmid that obtains is transformed into competence AGI cell, it is cultivated into bacterium colony on the agar that replenishes penbritin.Test this cell clone that obtains " pTrc/HisRDhl " EPPCR library with changing the method for measuring the RDhl enzymic activity by mensuration pH, method is as follows: use B1 from single colony inoculation 96-hole microtest plate in pTrc/His RDhl EPPCR library to the H12 hole, 200 μ L SOB/Amp substratum are contained in every hole, the negative control substratum is only contained in the A1-A6 hole, and with wild-type pTrc/His RDhl18-3 colony inoculation A7-A12 hole as positive control.Representative the results are shown in Figure 17 and 18.

The result shows that the great majority clone who is produced by EPPCR mutagenesis demonstrates the wild-type RDhl that is produced by TrcHisRDhl clone 18-3 and equates or littler field of activity.Yet, clone at random in the active every kind of situation of dehalogenase from the EPPCR library analyzing 84, there is minority to demonstrate in every 96-orifice plate than the remarkable higher activity of wild-type enzyme.

On February 3rd, 1998, with three kinds of plasmids, pTrcHis RDhl clone 18-3, pRSET RDhl clone 16-4, and pTrxFus RDhl clone is preserved in American type culture collection (ATCC) and obtains following name: ATCC 209609, ATCC 209610 and ATCC 209611 respectively according to budapest treaty.On February 3rd, 1998, cell culture intestinal bacteria TrxFusRDhl clone 4 is preserved in American type culture collection (ATCC) and obtains following name: ATCC 202087 according to budapest treaty.

On January 30th, 1998, with cell culture, intestinal bacteria TrxHis RDhl clone 18-3 and intestinal bacteria RSET RDhl clone 16-4 are preserved in American type culture collection (ATCC) and obtain following name: ATCC202086 and ATCC 202085 respectively according to budapest treaty.

Based on this specification sheets disclosed herein or practice of the present invention, other embodiment of the present invention is conspicuous to those skilled in the art.It is exemplary to it should be noted that this specification sheets and embodiment only should see as, and scope that the present invention is real and spirit are illustrated by following claim.

The sequence table general information:

The applicant:

Title: Dow chemical company

Street: 1790 Bldg.Washington Street

City: Maryland

State: MI

Country: the U.S.

Postcode: 48674

Phone: 517-636-1687

Fax: 517-638-9786

Invention exercise question: recombinant haloaliphatic dehalogenases

Sequence number: 26

Computer-reader form:

Media type: 3-1/2 " floppy disk

Computer: IBM PC compatible

Operating system: MS-DOS

Software: PatentInSEQ ID NO:1 information:

Sequence signature:

Length: 305

Type: amino acid

Chain: strand

Topology: linearity

Initial source:

Biological: prunosus red coccus

Single strain isolated: TDTM003

Feature:

Title/key: RDhl enzyme

Position: 1..292

Feature:

Title/key: carboxyl-terminal EXFLAG afterbody

Position: 295..305 feature:

Title/key: amino-end is many-the His afterbody

position :-10..-1 sequence description: SEQ, ID, NO:1:Met, Gly, Gly, Ser, His, His, His, His, His, His, Gly, Met, Ser, Glu, Ile, Gly-12,-10,-5,-1, 1Thr, Gly, Phe, Pro, Phe, Asp, Pro, His, Tyr, Val, Glu, Val, Leu, Gly, Glu, Arg, 5, 10Met, His, Tyr, Val, Asp, Val, Gly, Pro, Arg, Asp, Gly, Thr, Pro, Val, Leu, PheLeu, His, Gly, Asn, Pro, Thr, Ser, Ser, Tyr, Leu, Trp, Arg, Asn, Ile, Ile, ProHis, Val, Ala, Pro, Ser, His, Arg, Trp, Ile, Ala, Pro, Asp, Leu, Ile, Gly, MetGly, Lys, Ser, Asp, Lys, Pro, Asp, Leu, Asp, Tyr, Phe, Phe, Asp, Asp, His, ValArg, Tyr, Leu, Asp, Ala, Phe, Ile, Glu, Ala, Leu, Gly, Leu, Glu, Glu, Val, ValLeu, Val, Ile, His, Asp, Trp, Gly, Ser, Ala, Leu, Gly, Phe, His, Trp, Ala, LysArg, Asn, Pro, Glu, Arg, Val, Lys, Gly, Ile, Ala, Cys, Met, Glu, Phe, Ile, ArgPro, Ile, Pro, Thr, Trp, Asp, Glu, Trp, Pro, Glu, Phe, Ala, Arg, Glu, Thr, PheGln, Ala, Phe, Arg, Thr, Ala, Asp, Val, Gly, Arg, Glu, Leu, Ile, Ile, Asp, GlnAsn, Ala, Phe, Ile, Glu, Gly, Val, Leu, Pro, Lys, Cys, Val, Val, Arg, Arg, LeuThr, Glu, Val, Glu, Met, Asp, His, Tyr, Arg, Glu, Pro, Phe, Leu, Lys, Pro, ValAsp, Arg, Glu, Pro, Leu, Trp, Arg, Phe, Pro, Asn, Glu, Ile, Pro, Ile, Ala, GlyGlu, Pro, Ala, Asn, Ile, Val, Ala, Leu, Val, Glu, Ala, Tyr, Met, Asn, Trp, LeuHis, Gln, Ser, Pro, Val, Pro, Lys, Leu, Leu, Phe, Trp, Gly, Thr, Pro, Gly, ValLeu, Ile, Pro, Pro, Ala, Glu, Ala, Ala, Arg, Leu, Ala, Glu, Ser, Leu, Pro, AsnCys, Lys, Thr, Val, Asp, Ile, Gly, Pro, Gly, Leu, His, Tyr, Leu, Gln, Glu, AspAsn, Pro, Asp, Leu, Ile, Gly, Ser, Glu, Ile, Ala, Arg, Trp, Leu, Pro, Gly, Leu

290Ala?Ser?Lys?Leu?Gly?Asp?Tyr?Lys?Asp?Asp?Asp?Asp?Lys

295 300 305 SEQ ID NO: 2 RDhl Figure 2 DNA CC ATG GGG GGT TCT CAT CAT CAT CAT CAT CAT GGT ATG TCT GAA ATA 47 GGT ACC GGT TTT CCC TTC GAC CCT CAT TAT GTG GAA GTC CTG GGC GAG CGT ATG CAC TAC GTC GAT GTT GGA CCG CGG GAT GGC ACG CCT GTG CTG TTC CTG CAC GGT AAC CCG ACC TCG TCC TAC CTG TGG CGC AAC ATC ATC CCG CAT GTA GCA CCG AGT CAT CGG TGC ATT GCT CCA GAC CTG ATC GGG ATG GGA AAA TCG GAC AAA CCA GAC CTC GAT TAT TTC TTC GAC GAC CAC GTC CGC TAC CTC GAT GCC TTC ATC GAA GCC TTG GGT TTG GAA GAG GTC GTC CTG GTC ATC CAC GAC TGG GGC TCA GCT CTC GGA TTC CAC TGG GCC AAG CGC AAT CCG GAA CGG GTC AAA GGT ATT GCA TGT ATG GAA TTC ATC CGG CCT ATC CCG ACG TGG GAC GAA TGG CCG GAA TTC GCC CGT GAG ACC TTC CAG GCC TTC CGG ACC GCC GAC GTC GGC CGA GAG TTG ATC ATC GAT CAG AAC GCT TTC ATC GAG GGT GTG CTC CCG AAA TGC GTC GTC CGT CCG CTT ACG GAG GTC GAG ATG GAC CAC TAT CGC GAG CCC TTC CTC AAG CCT GTT GAC CGA GAG CCA CTG TGG CGA TTC CCC AAC GAG ATC CCC ATC GCC GGT GAG CCC GCG AAC ATC GTC GCG CTC GTC GAG GCA TAC ATG AAC TGG CTG CAC CAG TCA CCT GTC CCG AAG TTG TTG TTC TGG GGC ACA CCC GGC GTA CTG ATC CCC CCG GCC GAA GCC GCG AGA CTT GCC GAA AGC CTC CCC AAC TGC AAG ACA GTG GAC ATC GGC CCG GGA TTG CAC TAC CTC CAG GAA GAC AAC CCG GAC CTT ATC GGC AGT GAG ATC GCG CGC TGG CTC CCC GGA CTC GCT AGC GGC CTA GGT GAC TAC AAG GAC GAT GAT GAC AAA TAA TGA GCGGCCGC AAGCTT SEQ ID NO: 3 TCCH amino acids Met Ser Leu Gly Ala Lys Pro Phe Gly Glu Lys Lys Phe Ile Glu Ile Lys Gly Arg Arg Met Ala Tyr Ile Asp Glu Gly Thr Gly Asp Pro Ile Leu Phe Gln His Gly Asn Pro Thr Ser Ser Tyr Leu Trp Arg Asn Ile Met Pro His Cys Ala Gly Leu Gly Arg Leu Ile Ala Cys Asp Leu Ile Gly Met Gly Asp Ser Asp Lys Leu Asp Pro Ser Gly Pro Glu Arg Tyr Ala Tyr Ala Glu His Arg Asp Tyr Leu Asp Ala Leu Trp Glu Ala Leu Asp Leu Gly Asp Arg Val Val Leu Val Val His Asp Trp Gly Ser Ala Leu Gly Phe Asp Trp Ala Arg Arg His Arg Glu Arg Val Gln Gly Ile Ala Tyr Met Glu Ala Ile Ala Met Pro Ile Glu Trp Ala Asp Phe Pro Glu Gln Asp Arg Asp Leu Phe Gln Ala Phe Arg Ser Gln Ala Gly Glu Glu Leu Val Leu Gln Asp Asn Val Phe Val Glu Gln Val Leu Pro Gly Leu Ile Leu Arg Pro Leu Ser Glu Ala Glu Met Ala Ala Tyr Arg Glu Pro Phe Leu Ala Ala Glu Ala Arg Arg Pro Thr Leu Ser Trp Pro Arg Gln Ile Pro Ile Ala Gly Thr Pro Ala Asp Val Val Ala Ile Ala Arg Asp Tyr Ala Gly Trp Leu Ser Glu Ser Pro Ile Pro Lys Leu Phe Ile Asn Ala Glu Pro Gly Ala Leu Thr Thr Gly Arg Met Arg Asp Phe Cys Arg Thr Trp Pro Asn Gln Thr Glu Ile Thr Val Ala Gly Ala His Phe Ile Gln Glu Asp Ser Pro Asp Glu Ile Gly Ala Ala Ile Ala Ala Phe Val Arg Arg Leu Arg Pro Ala SEQ ID NO: 4 Rlucif amino acids Met Thr Ser Lys Val Tyr Asp Pro Glu Gln Arg Lys Arg Met Ile Thr Gly Pro Gln Trp Trp Ala Arg Cys Lys Gln Met Asn Val Leu Asp Ser Phe Ile Asn Tyr Tyr Asp Set Glu Lys His Ala Glu Asn Ala Val Ile Phe Leu His Gly Asn Ala Ala Ser Ser Tyr Leu Trp Arg His Val Val Pro His Ile Glu Pro Val Ala Arg Cys Ile Ile Pro Asp Leu Ile Gly Met Gly Lys Ser Gly Lys Ser Gly Asn Gly Ser Tyr Arg Leu Leu Asp His Tyr Lys Tyr Leu Thr Ala Trp Phe Glu Leu Leu Asn Leu Pro Lys Lys Ile Ile Phe Val Gly His Asp Trp Gly Ala Cys Leu Ala Phe His Tyr Ser Tyr Glu His Gln Asp Lys Ile Lys Ala Ile Val His Ala Glu Ser Val Val Asp Val Ile Glu Ser Trp Asp Glu Trp Pro Asp Ile Glu Glu Asp Ile Ala Leu Ile Lys Ser Glu Glu Gly Glu Lys Met Val Leu Glu Asn Asn Phe Phe Val Glu Thr Met Leu Pro Ser Lys Ile Met Arg Lys Leu Glu Pro Glu Glu Phe Ala Ala Tyr Leu Glu Pro Phe Lys Glu Lys Gly Glu Val Arg Arg Pro Thr Leu Ser Trp Pro Arg Glu Ile Pro Leu Val Lys Gly Gly Lys Pro Asp Val Val Gln Ile Val Arg Asn Tyr Asn Ala Tyr Leu Arg Ala Ser Asp Asp Leu Pro Lys Met Phe Ile Glu Ser Asp Pro Gly Phe Phe Ser Asn Ala Ile Val Glu Gly Ala Lys Lys Phe Pro Asn Thr Glu Phe Val Lys Val Lys Gly Leu His Phe Ser Gln Glu Asp Ala Pro Asp Glu Met Gly Lys Tyr Ile Lys Ser Phe Val Glu Arg Val Leu Lys Asn Glu Gln SEQ ID NO: 5 XDhl amino acids Met Ile Asn Ala Ile Arg Thr Pro Asp Gln Arg Phe Ser Asn Leu Asp Gln Tyr Pro Phe Ser Pro Asn Tyr Leu Asp Asp Leu Pro Gly Tyr Pro Gly Leu Arg Ala His Tyr Leu Asp Glu Gly Asn Ser Asp Ala Glu Asp Val Phe Leu Cys Leu His Gly Glu Pro Thr Trp Ser Tyr Leu Tyr Arg Lys Met Ile Pro Val Phe Ala Glu Ser Gly Ala Arg Val Ile Ala Pro Asp Phe Phe Gly Phe Gly Lys Ser Asp Lys Pro Val Asp Glu Glu Asp Tyr Thr Phe Glu Phe His Arg Asn Phe Leu Leu Ala Leu Ile Glu Arg Leu Asp Leu Arg Asn Ile Thr Leu Val Val Gln Asp Trp Gly Gly Phe Leu Gly Leu Thr Leu Pro Met Ala Asp Pro Ser Arg Phe Lys Arg Leu Ile Ile Met Asn Ala Cys Leu Met Thr Asp Pro Val Thr Gln Pro Ala Phe Ser Ala Phe Val Thr Gln Pro Ala Asp Gly Phe Thr Ala Trp Lys Tyr Asp Leu Val Thr Pro Ser Asp Leu Arg Leu Asp Gln Phe Met Lys Arg Trp Ala Pro Thr Leu Thr Glu Ala Glu Ala Ser Ala Tyr Ala Ala Pro Phe Pro Asp Thr Ser Tyr Gln Ala Gly Val Arg Lys Phe Pro Lys Met Val Ala Gln Arg Asp Gln Ala Cys Ile Asp Ile Ser Thr Glu Ala Ile Ser Phe Trp Gln Asn Asp Trp Asn Gly Gln Thr Phe Met Ala Ile Gly Met Lys Asp Lys Leu Leu Gly Pro Asp Val Met Tyr Pro Met Lys Ala Leu Ile Asn Gly Cys Pro Glu Pro Leu Glu Ile Ala Asp Ala Gly His Phe Val Gln Glu Phe Gly Glu Gln Val Ala Arg Glu Ala Leu Lys His Phe Ala Glu Thr Glu SEQ ID NO: 6 RDhl 5.4 GGTTCCATGG GNTTYCCNTT YGAYCCNCAY TA SEQ ID NO: 7 RDhl 3.12 CAGAGCTAGC GAGTCCGGGG AGCCAGCG SEQ ID NO: 8 RDhl 5.7 CGTACATATG GCCATGGGGG GTTCTCATCA TCATCATCAT CATGGTATGT CTGAAATAGG TACCGGTTTT CCCTTCGACC CTCATTA SEQ ID NO: 9 RDhl 3.13 GATGACAAAT AATGAGCGGC CGCAAGCTTG TAC SEQ ID NO: 10 Trx2 + + CCGGGGATCC CATGGCTTCT GAAATACGTA CCGGTTTTCC CTTCGACCCT CATTA SEQ ID NO: 11 Trx- TCGACTGCAG GCGGCCGCTC ATTATTTGTC ATC SEQ ID NO: 12 Dh1 Seq 7 CCTGTCCCGA AGTTGTTG SEQ ID NO: 13 Dh1 Seq 8 CGGGCCGATC TCCACTG SEQ ID NO: 14 Dh1 Seq 11 TGCTCCAGAC CTGATCG SEQ ID NO: 15 Dh1 Seq 12 TCTGATCGAT GATCAAC SEQ ID NO: 16 Dh1 Seq 13 TCCCGACGTG GACGAATG SEQ ID NO: 17 Dh1 Seq 14 GAGCGCGACG ATGTTCGC SEQ ID NO: 18 Dh1 Seq 15 CACCCGGCGT ACTGATCC SEQ ID NO: 19 Dh1 Seq 18 GAGACCGGTC AGCATTCC SEQ ID NO: 20 PROK-Seq 1 GAGCGGATAA CAATTTCA SEQ ID NO: 21 PROK-Seq 2 TCTCATCCGC CAAAACAG SEQ ID NO: 22 EXFLAG connector GAATTCAGCC ATGGCATAAG CTTTCTAGAC TCGAGGGAGC TAGCGGCCTA GGTGACTACAA GGACGATGAT GACAAATAAT GAGCGGCCGC TAGCTT SEQ ID NO: 23 RDhl ΔHis-6-F CATGGGTGAA ATAGGTA SEQ ID NO: 24 RDhl ΔHis-6-R CCGGTACCTA TTTCACC SEQ ID NO: 25 CTERM S-Tag F CTAGGTGACAAAGAAACCGCTGCTGCTAAATTCGAACGCCAGCACATGGACAGCAAATAAGTTTAAACATCA TTCCAATTGC SEQ ID NO: 26 CTERM S-Tag R GGCCGCAATTGGAATGATGTTTAAACTTATTTGCTGTCCATGTGCTGGCGTTCGAATTTAGCAGCAGCGGTT TCTTTGTCAC ...

Claims (45)

1. the halogenation aliphatic hydrocrbon can be converted to the enzyme of halohydrin, described enzyme contain basically with Fig. 2 in the polypeptide of amino acid sequence homologous of residue 1-292.

2. the enzyme of claim 1, wherein said enzyme contain with Fig. 2 in residue 1-292 aminoacid sequence at least about 90% to 100% homologous aminoacid sequence.

3. the enzyme of claim 2, wherein said enzyme contain with Fig. 2 in residue 1-292 aminoacid sequence at least about 95% homologous aminoacid sequence.

4.DNA sequence can express with Fig. 2 in the aminoacid sequence homeopeptide basically of residue 1-292, described polypeptide can be converted to halohydrin with the halogenation aliphatic hydrocrbon.

5. the dna sequence dna of claim 4, the aminoacid sequence of residue 1-292 is at least about 90% to 100% homology among wherein said polypeptide and Fig. 2.

6. the dna sequence dna of claim 5, the aminoacid sequence of residue 1-292 is at least about 95% homology among wherein said polypeptide and Fig. 2.

7. contain with Fig. 2 in the nucleotide sequence dna sequence dna of homology polynucleotide basically of base 37-912, described polynucleotide can be expressed the polypeptide that the halogenation aliphatic hydrocrbon can be converted to halohydrin.

8. the dna sequence dna of claim 7, the Nucleotide at least 90% of base 37-912 is to 100% homology among wherein said polynucleotide and Fig. 2.

9. the dna sequence dna of claim 8, nucleotide sequence at least 95% homology of the base 37-912 among wherein said polynucleotide and Fig. 2.

10. the microorganism that contains recombinant plasmid, plasmid wherein can instruct contain with Fig. 2 in aminoacid sequence enzyme synthetic of homeopeptide basically among the residue 1-292.

11. the microorganism of claim 10, microorganism wherein are Escherichia, Pichia, bacillus, saccharomyces, Rhodopseudomonas, Rhod, actinomyces or Aspergillus.

12. the microorganism of claim 11, microorganism wherein are Escherichia.

13. contain the residue 1-292 aminoacid sequence expression construct of the dna sequence dna of homeopeptide basically among coding and Fig. 2.

14. have the immobilized enzyme of halogenated alkane dehalogenase, this dehalogenase has the haloaliphatic dehalogenases activity and is attached on the solid support.

15. at least one halogenic substituent is removed in the hydrolysis from the molecule of halogenation aliphatic hydrocrbon, halogenation fatty alcohol and halogenation aliphatic polyol molecule and group or group of the enzyme of claim 14, endonuclease capable wherein.

16. the enzyme of claim 15, wherein said molecule or group have at least one halogen atom and 2 to 10 carbon atoms, in the described carbon atom each independently replaces with one or several described halogen atom, precondition is that the carbon atom with hydroxyl substituent no longer includes halogenic substituent when described molecule or group are alcohol or polyvalent alcohol.

17. the enzyme of claim 16, wherein said molecule or group contain at least 2 halogen atoms.

18. the enzyme of claim 17, wherein said molecule or group are 1,2-dihalo molecule or group.

19. the enzyme of claim 17, wherein said molecule or group are selected from 1,2-dihalo ethane, 1,2-dihalopropane, 1,2-dihalo butane and 1,2,3-three halogenopropanes.

20. the enzyme of claim 19, wherein said molecule or group are selected from 1 respectively, 2-ethylene dichloride, 1,2-propylene dichloride, 1,2-dichlorobutane, 1,2-two bromo-3-chloropropane and glyceryl trichloride.

21. the enzyme of claim 20, wherein said molecule or group convert at least a following product molecule or product group to, comprise ethylene chlorhydrin, 1-chloro-2-propanol, 2-chloro-1-propanol, 1-chloro-2-butanols, 2-chloro-1-butanols, 1-bromo-3-chloro-2-propyl alcohol, 2-bromo-trimethylene chlorohydrin, 2,3-two bromo-1-propyl alcohol, 1,2-two chloro-3-propyl alcohol and 1,3-two chloro-2-propyl alcohol.

22. the enzyme of claim 14, wherein said halogenated alkane dehalogenase is available from rhodococcus.

23. preparation contain with Fig. 2 in the aminoacid sequence method of the enzyme of homeopeptide basically of residue 1-292, may further comprise the steps:

1) provide and comprise the dna fragmentation that can express described polypeptide polynucleotide,

2) described dna fragmentation is inserted in the expression construct,

3) with described expression construct transfection host cell and

4) provide the environment of the described polypeptide of host cell expression.

24. the method for claim 23 after the step 4 of described method, further comprises the step of the described enzyme of purifying.

25. prepare covalently bound contain to the solid support with Fig. 2 in the aminoacid sequence method of the immobilized enzyme of homeopeptide basically of residue 1-292, may further comprise the steps:

1) provide contain with Fig. 2 in the aminoacid sequence enzyme of homeopeptide basically of residue 1-292,

2) provide be attached to the solid support that has at least a reactive group connexon and

3) but described enzyme is contacted under the biology acceptable conditions with described connexon, wherein said reactive group be covalently attached to amino on the described polypeptide, carboxyl, hydroxyl or sulfydryl reaction to form covalent attachment.

26. the method for claim 25, wherein said connexon has at least a following group that is selected from, comprise twain-aldehyde compound, two acids, two amines, diisocyanates, cyanate, diimine class and Carbodiimides, precondition is that diamines does not share with carbodiimide.

27. immobilized enzyme according to the preparation of claim 25 method.

28. the halogenation aliphatic hydrocrbon is converted to the method for alcohol or halohydrin, may further comprise the steps:

1) provide contain with Fig. 2 in the aminoacid sequence enzyme of homeopeptide basically of residue 1-292,

2) provide and be attached to the solid support that has at least a reactive group connexon,

3) described enzyme is contacted with described connexon under biological acceptable terms, wherein said reactive group be covalently attached to amino on the described polypeptide, carboxyl, hydroxyl or sulfydryl reaction with produce covalent attachment and form immobilized enzyme and

4) described therein enzyme can be converted to the halogenation aliphatic hydrocrbon under the condition of alcohol or halohydrin described immobilized enzyme is contacted with the halogenation aliphatic hydrocrbon.

29. the method for claim 28, wherein said enzyme are the enzyme of claim 2 or 3.

30. according to each enzyme among the claim 1-3, wherein said enzyme is the fusion rotein with one or two terminal polypeptide afterbody.

Reach 30 amino acid whose single N-terminal afterbodys 31. the enzyme of claim 30, wherein said fusion rotein have, wherein contain the sequence of at least six continuous histidine residues.

32. having, the enzyme of claim 30, wherein said fusion rotein reach 150 amino acid whose single C-terminal afterbodys.

33. the enzyme of claim 32, wherein said C-terminal afterbody is hydrophilic.

Reach 30 amino acid whose N-terminal afterbodys and reach 150 amino acid whose C-terminal afterbodys 34. the enzyme of claim 30, wherein said fusion rotein have simultaneously.

35. the enzyme of claim 34, wherein said N-terminal afterbody contains the sequence with at least 6 continuous histidine residues.

36. containing, the enzyme of claim 34, wherein said C-terminal afterbody be selected from following polypeptide: EXFLAG polypeptide, S-Tag polypeptide, contain six Histidine polypeptide of sequence and cellulose binding domains.

37. have the active enzyme of halogenation aliphatic series dehalogenase, its DNA obtains from associated dna sequence by directed evolution method, wherein said enzyme has the dehalogenate activity bigger than associated dna sequence.

38. according to the enzyme of claim 37, the dehalogenase of wherein said associated dna sequence encoding wild type or reorganization.

39. according to the enzyme of claim 38, the halogenated alkane dehalogenase of wherein said associated dna sequence encoding wild type or reorganization.

40. according to the enzyme of claim 39, the rhodococcus halogenated alkane dehalogenase of wherein said associated dna sequence encoding wild type or reorganization.

41. according to the enzyme of claim 37, wherein said directed evolution method comprises and carries out fallibility PCR.

42. according to the enzyme of claim 37, enzyme wherein is the fusion rotein with one or two terminal polypeptide afterbody.

43. according to the enzyme of claim 42, one of them afterbody or two afterbodys are modified by directed evolution method.

44. be selected from the expression vector of ATCC 209609, ATCC 209610 and ATCC 209611.

45. be selected from the cell culture of ATCC 202085, ATCC 202086 and ATCC 202087.

Images