CN117721204A - ceRNA regulatory mechanism of circ0104727 and application thereof in glioma - Google Patents

Abstract

The invention belongs to the field of biological medicine, and particularly relates to a cerRNA regulation mechanism of circ0104727 and application thereof in glioma. The circ0104727 is taken as the ceRNA to regulate the occurrence of glioma through competitive binding of miRNA-21-5p, and eliminates the inhibition effect of miRNA-21-5p on TIMP3/SMAD 7. More specifically, the invention also provides application of circ0104727 in glioma diagnosis, classification, prognosis and treatment.

Description

ceRNA regulatory mechanism of circ0104727 and application thereof in glioma

Technical Field

The invention belongs to the field of biological medicine, and particularly relates to a cerRNA regulation mechanism of circ0104727 and application thereof in glioma.

Background

Circular RNA (circRNA) as a star molecule studied in recent years can adsorb miRNAs via a sponge to regulate the expression of a downstream target gene, and this mechanism is called competitive endogenous RNA (competitive endogenous RNA, ceRNA) theory. The competitive endogenous ribonucleic acid (ceRNA) hypothesis is a novel posttranscriptional regulation pattern of genes, i.e., messenger RNAs (mrnas) encoding proteins, long-chain non-coding RNAs (lncrnas), pseudogene transcripts, circular ribonucleic acids (circrnas), etc., can be regulated by binding microribonucleic acids (mirnas) to the expression of their target genes. The ceRNA is a supplement to the regulatory action of traditional micrornas (mirnas) and messenger RNAs (mrnas), and it has been found that a variety of RNA molecules can interact to form a ceRNA regulatory network to perform a biological function of post-transcriptional regulation, and play an important role in maintaining a normal physiological state and regulating the occurrence and development of diseases. The ceRNA network provides important scientific research value for comprehensively understanding the heterogeneity and molecular generation mechanism of glioma.

Gliomas are the most common primary tumor in the brain and spinal cord and remain incurable until now. Different genetic and non-genetic effects determine tumor biology and clinical processes. In 2007, the world health organization (World Health Organization, WHO) classified central nervous system tumors into 4 classes WHO i through iv. Among them, one type of brain glioma that is highly heterogeneous and most malignant is glioblastoma multiforme, glioblastoma (glioblastoma multiforme, GBM), whose median survival in patients is currently only about 15 months, even if actively co-administered.

Disclosure of Invention

Aiming at the technical problems faced at present, the invention screens differentially expressed circRNAs through glioblastoma (glioblastoma multiforme, GBM) gene chips, determines that the circSH3GL3 (hsa_circ_ 0104727) with remarkably low expression in glioma is taken as an entry point, and finally provides a novel mechanism that the circSH3GL3 competitively combines miR-21-5p to play a cerRNA role by combining RNA pull down, protein mass spectrometry and miRNA and mRNA sequencing on the basis of preliminary determination of the cancer suppressor gene role, wherein the circSH3GL3 eliminates the inhibition effect of miR-21-5p on downstream target genes TIMP3 and SMAD7, and plays an important role in glioma by respectively inhibiting PI3K/AKT and wnt/beta-catenin signal paths through TIMP3 and SMAD7 functional activation.

According to the results, a new strategy for combined treatment of glioma based on the circRNA and the signal path molecular inhibitor can be established, and a theoretical basis and an experimental basis are provided for developing and excavating tumor drug action targets.

Specifically, the invention provides the following technical scheme:

in a first aspect, the invention provides the use of hsa_circ_0104727 for modulating glioma development.

More specifically, the hsa_circ_0104727 as ceRNA modulates glioma occurrence by competitive binding to miRNA-21-5 p.

The term "ceRNA", i.e., competitive endogenous ribonucleic acid (competing endogenous RNA), as used herein, refers to protein-encoding messenger RNAs (mRNA), long-chain non-coding RNAs (lncRNA), pseudogene transcripts, circular ribonucleic acids (circRNA), and the like, which are regulated by binding microribonucleic acids (miRNA) to their target gene expression.

Preferably, the glioma comprises a WHO grade 1-4, wherein a WHO grade 1-2 may be referred to as a low grade glioma, e.g., an oligodendroglioma, an astrocytoma; WHO 3-4 may be referred to as high grade glioma, e.g., degenerative astrocytoma, glioblastoma.

In another aspect, the invention provides the use of a miRNA-circRNA-TIMP3 or miRNA-circRNA-SMAD7 regulatory module in modulating glioma development, or,

the invention provides an application of miRNA-circRNA-TIMP3 or miRNA-circRNA-SMAD7 regulating module in preparing a product for regulating glioma,

the circRNA is hsa_circ_0104727 and the miRNA is miR-21-5p.

Preferably, the glioma comprises a WHO grade 1-4, wherein a WHO grade 1-2 may be referred to as a low grade glioma, e.g., an oligodendroglioma, an astrocytoma; WHO 3-4 may be referred to as high grade glioma, e.g., degenerative astrocytoma, glioblastoma.

Preferably, the circRNA abrogates TIMP3/SMAD7 inhibition by miRNA.

More preferably, the TIMP3 inhibits the PI3K/AKT signaling pathway.

More preferably, the SMAD7 inhibits the Wnt/β -catenin signaling pathway.

Preferably, the PI3K/AKT signaling pathway and Wnt/β -catenin signaling pathway are important targets for glioma development.

In another aspect, the invention provides the use of a reagent for detecting hsa_circ_0104727 expression level in the preparation of a product having any one of the following functions:

1) Diagnosing glioblastoma, and diagnosing the glioblastoma,

2) The glioma is classified into a grade and a grade,

3) Prognosis of glioma patients is predicted.

Preferably, the glioblastoma is one of gliomas.

Preferably, the grading is to identify the glioma patient as a low grade glioma or a high grade glioma.

Preferably, the glioma comprises a WHO grade 1-4, wherein a WHO grade 1-2 may be referred to as a low grade glioma, e.g., an oligodendroglioma, an astrocytoma; WHO 3-4 may be referred to as high grade glioma, e.g., degenerative astrocytoma, glioblastoma.

Preferably, the reagent comprises a reagent used in detecting hsa_circ_0104727 expression level in the following method: detection methods based on PCR principle, southern hybridization methods, northern hybridization methods, dot hybridization methods, fluorescence in situ hybridization methods, DNA microarray methods, ASO methods, high throughput sequencing platform methods.

Specifically, the detection method based on the PCR principle comprises variable temperature amplification and constant temperature amplification.

In particular, the reagent may be a primer pair, probe or antisense nucleotide that specifically binds to hsa_circ_0104727.

Further, the reagent further comprises a detectable label.

Further, the detectable label includes a radioisotope, a nucleotide chromophore, an enzyme, a substrate, a fluorescent molecule, a chemiluminescent moiety, a magnetic particle, a bioluminescent moiety.

In another aspect, the invention provides a composition for treating glioma, comprising any one or more of the following:

1) hsa_circ_0104727 and/or hsa_circ_0104727 precursors,

2) A polynucleotide which is transcribed to form hsa_circ_0104727,

3) A delivery vehicle comprising 1) or 2) thereon,

4) An agent for promoting hsa_circ_0104727 expression,

5) A molecular pathway inhibitor, said molecular pathway comprising a PI3K/AKT signaling pathway and a Wnt/β -catenin signaling pathway.

Preferably, the composition contains a molecular pathway inhibitor.

Preferably, the delivery vehicle comprises an exosome, a viral vector, a lipid nanoparticle (lipid nanoparticle, LNP), a polymeric nanocarrier, an inorganic nanocarrier, or a protein carrier.

Preferably, the viral vector comprises a lentiviral vector, an adenoviral vector, an adeno-associated viral vector.

Preferably, a pharmaceutically acceptable solid/liquid excipient is also included in the composition.

Preferably, the pharmaceutically acceptable solid/liquid excipients include binders, fillers, lubricants and disintegrants.

The dosage form and mode of administration of the composition of the present invention are not particularly limited. Representative modes of administration include, but are not limited to: oral, intratumoral, rectal, parenteral (intravenous, intramuscular or subcutaneous) injection, and topical administration.

In a specific embodiment, solid dosage forms for oral administration include capsules, tablets, pills, powders, and granules. In these solid dosage forms, the active compound is admixed with at least one conventional inert excipient (or carrier), such as sodium citrate or dicalcium phosphate, or with the following ingredients: (a) Fillers or compatibilizers, for example, starch, lactose, sucrose, glucose, mannitol and silicic acid; (b) Binders, for example, hydroxymethyl cellulose, alginate, gelatin, polyvinylpyrrolidone, sucrose and acacia; (c) humectants, e.g., glycerin; (d) Disintegrants, for example, agar-agar, calcium carbonate, potato or tapioca starch, alginic acid, certain complex silicates, and sodium carbonate; (e) a slow solvent, such as paraffin; (f) an absorption accelerator, e.g., a quaternary amine compound; (g) Wetting agents, such as cetyl alcohol and glycerol monostearate; (h) an adsorbent, for example, kaolin; and (i) a lubricant, for example, talc, calcium stearate, magnesium stearate, solid polyethylene glycol, sodium lauryl sulfate, or mixtures thereof. In capsules, tablets and pills, the dosage forms may also comprise buffering agents. Solid dosage forms such as tablets, dragees, capsules, pills and granules can be prepared with coatings and shells, such as enteric coatings and other materials well known in the art. They may contain opacifying agents and the release of the active compound or compounds in such compositions may be released in a delayed manner in a certain part of the digestive tract. Examples of embedding components that can be used are polymeric substances and waxes. The active compound may also be in the form of microcapsules with one or more of the above excipients, if desired.

In a specific embodiment, the liquid dosage form for oral administration comprises a pharmaceutically acceptable emulsion, solution, suspension, syrup or tincture. In addition to the active compound, the liquid dosage forms may contain inert diluents commonly used in the art such as, for example, water or other solvents, solubilizing agents and emulsifiers such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, propylene glycol, 1, 3-butylene glycol, dimethylformamide and oils, in particular, cottonseed, groundnut, corn germ, olive, castor and sesame oils or mixtures of these substances. In addition to these inert diluents, the compositions can also include adjuvants such as wetting agents, emulsifying and suspending agents, sweetening, flavoring, and perfuming agents. Such as suspensions, may contain suspending agents as, for example, particularly ethoxylated isostearyl alcohols, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminum methoxide and agar or mixtures of these substances.

In a particular embodiment, a composition for parenteral injection may comprise a physiologically acceptable sterile aqueous or anhydrous solution, dispersion, suspension or emulsion, and a sterile powder for reconstitution into a sterile injectable solution or dispersion. Suitable aqueous or nonaqueous carriers, diluents, solvents or excipients include water, ethanol, polyols and suitable mixtures thereof.

In a specific embodiment, the dosage forms for topical administration include ointments, powders, patches, sprays and inhalants. Is prepared by mixing the active ingredient under aseptic condition with pharmaceutically acceptable carrier and any preservative, buffer or propellant as required.

Preferably, the dosage form of the composition comprises a capsule, tablet, pill, powder, granule, emulsion, solution, suspension, syrup or tincture.

In another aspect, the invention provides the use of the above composition in the manufacture of a medicament for the treatment of glioma.

Preferably, the glioma comprises a WHO 1-4 grade glioma.

Preferably, the glioma comprises an oligodendroglioma, an astrocytoma, a modified astrocytoma or a glioblastoma.

Preferably, the glioma is glioblastoma.

In another aspect, the invention provides a method of diagnosing glioblastoma, typing glioma, or predicting a prognosis in a patient with glioma, the method comprising detecting the expression level of hsa_circ_0104727 in a sample from a subject.

Preferably, the sample comprises: peripheral blood, tissue, blood, serum, plasma, urine, saliva, semen, milk, cerebrospinal fluid, tears, sputum, mucous, lymph, cytosol, ascites, pleural effusion, amniotic fluid, bladder irrigation fluid, and bronchoalveolar lavage fluid.

Preferably, the sample is tissue.

In another aspect, the invention provides a method of inhibiting proliferation and invasion of glioma cells, the method comprising increasing the expression level of hsa_circ_0104727 in a target cell.

Preferably, the method is non-therapeutic.

Preferably, the method is performed in vitro.

Preferably, the target cell is a glioma cell, including glioblastoma cells.

Specifically, in the specific embodiment of the invention, an overexpression experiment is performed on a LN229 glioblastoma cell line with low hsa_circ_0104727 expression and a U251 glioblastoma cell line as examples, and it is proved that the proliferation and invasion capacity of cells are inhibited after the hsa_circ_0104727 is overexpressed, and in addition, a knockout experiment is performed on a U87 (also called ATCC HTB-14) glioblastoma cell line with high hsa_circ_0104727 expression and the opposite result is obtained.

In another aspect, the invention provides a method of treating glioma comprising administering to a patient the aforementioned composition or hsa_circ_0104727.

Specifically, the administration mode of the administration is not particularly limited. Representative modes of administration include, but are not limited to: oral, intratumoral, rectal, parenteral (intravenous, intramuscular or subcutaneous) injection, and topical administration.

Specifically, glioblastoma cells are included in the glioma.

In another aspect, the present invention provides a system having a judging device for giving any one of the following results by the expression level of hsa_circ_ 0104727:

1) Whether the subject has glioblastoma,

2) Glioma typing of the subject,

3) Prognosis of glioma patients.

The prognosis index of the present invention includes objective remission rate (Objective Response Rate, ORR), overall survival rate (Overall survival rate, overall survival, OS), progression-free survival (PFS), time To Progression (TTP), disease-free survival (DFS), treatment failure time (time to treatment failure, TTF), response Rate (RR), complete Response (CR), partial Response (PR).

Drawings

FIG. 1 is a cluster map of the detection of the expression profile of circRNA between clinical GBM specimens and corresponding paired adjacent normal tissues.

FIG. 2 is a graph of qRT-PCR detection results of circRNA0071539, circRNA0104727 and circRNA 0104722.

FIG. 3 is a comparison of the expression levels of circSH3GL3 in different cases.

FIG. 4 is a graph showing the result of electrophoresis of amplified linear genes SH3GL3 and circSH3GL3.

FIG. 5 is a graph of Sanger sequencing results.

FIG. 6 is a graph showing the results of RNase enzyme digestion of linear mRNA and circSH3GL3.

FIG. 7 is a graph showing the results of subcellular localization of circSH3GL3.

FIG. 8 is a graph of the detection results of over-expression and knock-down efficiency.

FIG. 9 is a graph showing the results of CCK8 experiments.

Fig. 10 is a graph showing the results of Edu experiments.

FIG. 11 is a graph showing the results of a Transwell experiment.

FIG. 12 is a cluster map of mRNA sequencing enrichment.

FIG. 13 is a plasmid vector map of the luciferase reporter plasmid vector pmirGLO.

FIG. 14 is a graph showing the results of luciferase activity assay.

FIG. 15 is a graph of the results of RNA pull Down experiments with biomarker miR-21-5p.

FIG. 16 is a graph of experimental results of LN229 and U87 cell proliferation assays transfected with miR21-5pmimic alone and with cotransfected circSH3GL3.

FIG. 17 is a flowchart showing the selection of differentially expressed genes from U87-circSH3GL3 cells compared to U87-vector cells.

FIG. 18 is a graph of qRT-PCR results for TIMP3, SMAD7, FMN1 and CREB5 mRNA.

FIG. 19 is a schematic representation of a miR-21-5p seed sequence for TIMP3 matching the SMAD 7' UTR.

FIG. 20 is a graph showing the results of Western blot experiments.

FIG. 21 is a graph showing the results of detection of a luciferase reporter gene.

FIG. 22 is a graph showing the results of Western blot detection of the amounts of PI3K, P-PI3K, AKT1, P-AKT, caspase3 protein expression.

FIG. 23 is a graph showing the results of TOP/FOP luciferase reporter experiments.

FIG. 24 is a graph showing the results of immunofluorescence detection of the relative expression of β -catenin in the nucleus and cytoplasm of different treatment groups.

FIG. 25 is a graph showing the results of protein expression levels of TCF4, c-myc, cyclD 1 and MMP 2.

Fig. 26 is a graph showing the results of in vivo experiments.

FIG. 27 is a graph showing the results of measuring the expression levels of TIMP3, SMAD7, p-AKT, c-Myc, and cyclinD 1.

FIG. 28 is a graph of the results of immunohistochemical staining.

FIG. 29 is a schematic representation of the action of CircSH3GL3 on ceRNA.

Detailed Description

The present invention will be further described with reference to specific embodiments, but the scope of the present invention is not limited thereto, and any person skilled in the art, who is within the scope of the present invention, should make equivalent substitutions or modifications according to the technical scheme of the present invention and the inventive concept thereof, and should be covered by the scope of the present invention.

Materials, reagents and the like used in the examples described below are commercially available unless otherwise specified.

Experimental materials

Reverse transcription kit for RNAse and circRNAII First Strand cDNA Synthesis Kit), quantitative PCR detection kit (A.sub.L.)>qPCR/>Green Master Mix), circ_0104727FISH probes, circRNAs primers, RNA lmmunoprecipitation kit kit were purchased from Gicemetery Biotechnology Inc. of Guangzhou. Actinomycin D was purchased from sigma corporation of America. RNA nucleoplasm isolation extraction kit was purchased from Ambion company. The CircSH3GL3 siRNA and validated clear overexpressing lentiviruses were constructed by the biosciences of geese, inc. The circ0104727 double luciferase reporter plasmid and the mutant plasmid combined with miR-21-5p are also constructed and synthesized by Shanghai Ji Ma gene Limited. Immunohistochemical detection kit, gDNA extraction kit was purchased from beijing solebao biotechnology limited.

H4, NHA cell lines were purchased from Beijing North nano-InnovaThe technical institute, U251, U87, LN229, A172, T98G were purchased from Shanghai cell biosciences, national academy of medical science. The above cell lines were cultured in 1640 or DMEM containing 10% fetal bovine serum (Gibco), 100U/ml penicillin and 0.1mg/ml streptomycin (Sangon biotech), 37℃and 5% CO ₂ Culturing in a humidified atmosphere. All cell lines were tested as mycoplasma negative. Cell transfection was performed using Lipofectamine3000 (Invitrogen), and cells were collected for detection after 48-72 hours.

Example one, identification of the expression profile of circRNAG in GBM tissue and paracancerous Normal brain tissue

To explore the role of circRNA in GBM development, we analyzed 3 clinical GBM specimens and corresponding paired ribosomal RNA deletion total RNA of adjacent normal tissues using microarray chips and constructed a circRNA database.

3 cases of fresh primary glioblastoma tissue and paracancestral normal brain tissue specimens were collected from neurosurgical treatment of GBM patients. The corresponding "normal brain tissue" is taken after the "normal boundary" of the resected tumor is determined by the intraoperative quick frozen section. Each tissue was about 0.5 cm. Times.0.5 cm in size, washed with physiological saline and placed in a labeled cryopreservation tube. Rapidly placing into a liquid nitrogen tank, transferring to a laboratory, and freezing at-80 ℃. All specimens were diagnosed as primary glioblastoma after surgery, and paracancestral histopathology confirmed that no cancer cell invasion was seen. All patients were not treated with chemotherapy prior to surgery. All patients were informed consent and signed with the consent of the owner or family.

3 examples the circRNA expression profile was detected on GBM specimens by the chip Arraystar Human circRNA Array from Beijing Boao Biotechnology Co. In GBM tissues, 1812 expression-abnormal circRNAs were identified in total, of which 711 expression was up-regulated and 1101 circular expression was down-regulated (FIG. 1A) (fold change >5, p < 0.05). In these differentially expressed circrnas, most are less than 1000 nucleotides in length, with different circRNA length distributions (fig. 1B), as well as the genomic origins of these significantly expressed circrnas. qRT-PCR validated 20 most significantly different circrnas, including the first 10 significantly up-regulated and the first 10 most significantly down-regulated circrnas, based on the source of the circBase database and the criteria that the original detected signal value was greater than 200. The cluster heatmap in fig. 1C shows 20 up-and down-regulated circrnas. Only the circRNA0071539, circRNA0104727 and circRNA0104722 were consistent with the expression propensity of GBM chip assays as verified by qRT-PCR and sanger sequences (FIG. 2).

Based on the abundance of expression, we focused on down-regulating the most significant circRNA0104727. Meanwhile, we found that 4 out of 10 down-regulated circrnas were derived from the linear gene SH3GL3, which was associated with GBM progression, according to bioinformatic analysis. Thus, we selected circRNA0104727 (the remainder of the invention is referred to as circSH3GL 3) for further functional and molecular mechanism studies.

To further verify the down-regulation of circSH3GL3, we examined 52 different grades of glioma, of which the low grade (WHOI-II) was 15 and the high grade (WHO III-IV) was 37.

Clinical 52 glioma specimens of different pathological tissue types were derived from the biomedical specimen library of the department of neurosurgery of the Tianjin city, including 9 oligodendroglioma encryptions (WHO grade), 6 astrocytomas (WHO grade 2 and WHO grade 4), 5 anaplastic oligodendrogliomas (WHO grade III), 3 anaplastic astrocytomas (WHO grade III), 29 primary glioblastomas (WHO grade IV), all patients were presented with consent from either the individual or the family, and informed consent was signed.

The results show that the expression of circSH3GL3 in GBM is significantly down-regulated compared to low grade gliomas and normal controls, negatively correlated with WHO grade, and that high expression of circSH3GL3 suggests a good prognosis. Furthermore, the Real-timeepcr assay of the expression of circSH3GL3 in glioma cell lines revealed that, except for U251 cells, circSH3GL3 was significantly down-regulated in GBM cell lines compared to NHA cell lines (fig. 3).

Thus, we further selected U251 cells for the circSH3GL3 loss of function experiment, while LN229 and U87 cells were selected for the restoration of function experiment.

Example two, features of circSH3GL3

1. Stability of circSH3GL3

We assessed the exon structure of circSH3GL3, which is derived from exons 5 to 11 of the SH3GL3 gene on chromosome 15. We designed a specific primer (Divergent primers) across the circularization site to identify and specifically detect circSH3GL3 by PCR amplification and agarose gel electrophoresis in U251 cell cDNA and genomic gDNA.

The specific PCR primer is F:5'-GTGAAGACGACAGCTATTTA-3' (SEQ ID NO. 1); 5'-GACACAGTGTTCAGCATTCC-3' (SEQ ID NO. 2), the amplified fragment of hsa_circ_0104727 has a size of 192bp.

The electrophoresis results showed that the primers were amplified only in cDNA and not in gDNA, whereas the linear gene SH3GL3 was amplified in both cDNA and gDNA (FIG. 4), and further Sanger sequencing was performed by PCR products amplified from cDNA, and specific circularization sites are shown in FIG. 5. These results confirm that the circSH3GL3 is a closed circular RNA formed at posttranscriptional level by reverse cleavage, and that the dissimilarity primer (Divergent primers) can specifically amplify.

After RNase enzyme digestion treatment of U251 cell RNA, quantitative PCR was used to detect the expression of circSH3GL3 and its corresponding linear RNA molecule SH3GL3, respectively. The results showed that circSH3GL3 was indeed more resistant to digestion by the RNaseR enzyme than the linear mRNA, whereas SH3GL3, compared to the RNaseR (-) group, the expression level of the RNaseR (+) group was significantly reduced (fig. 6A). Further, the stability of circSH3GL3 was indirectly verified by treatment of U251 cells with actinomycin D, and qRT-PCR results showed that after 24h of treatment with actinomycin D, the circSH3GL3 showed significant degradation compared to the linear RNA molecule SH3GL3 (FIG. 6B). As a result, it was confirmed that the circSH3GL3 molecule was more stable than the linear SH3GL3 molecule.

2. Subcellular localization of circSH3GL3

Subcellular localization of the circRNA molecule is closely related to its diverse biological functions. The circRNAs that are predominantly located in the cytoplasm act primarily through competing ceRNA mechanisms, whereas the circRNAs that are located in the nucleus act primarily through binding to RNA-binding proteins to regulate downstream target gene transcription and splicing.

We first extracted the nuclear and cytoplasmic RNAs of U251 cells using RNA nucleoplasm isolation experiments, respectively, and after reverse transcription of equal volumes of RNA, the intracellular distribution of circSH3GL3 was detected by quantitative PCR, and GAPDH and U6mRNA distribution in the nucleus and cytoplasm served as controls, showing that circSH3GL3 was mainly located in the cytoplasm of glioma cells (fig. 7A).

We then applied Fluorescence In Situ Hybridization (FISH) to further define the cell localization of circTOP 2A. FISH in situ hybridization probe sequence: hsa_circ_0104727 (5 ', 3' cy3 Labeled): TTCACTAAATAGCTGTCGTCTTCA (SEQ ID NO. 3). The single-stranded DNA probe specifically corresponding to the cleavage site of circSH3GL3 carries Cy 3-labeled red fluorescence, and the result observed by a laser confocal microscope is consistent with the result of RNA nucleoplasm separation experiment, and the circSH3GL3 is mainly located in cytoplasm (FIG. 7B).

The cytoplasmic localization of the circSH3GL3 is definitely established as a theoretical basis for the competitive miRNA binding effect by two methods.

Example three, high expression of circSH3GL3 significantly inhibited glioma cell proliferation and invasion

The role of circSH3GL3 in glioma progression was evaluated by gain-of-function and loss-of-function assays.

Based on the expression of circSHGL3 in glioma cell lines, circSH3GL3 was overexpressed in LN229 and U87 cells (circSH 3GL3 wild-type expression plasmid lentivirus, work done by the guangzhou gemini biosciences company for sequencing identification, recombinant lentiviral vector packaging, titer assay, expression validation, etc., contract No. GS200413-CZQ 034), and expression of circSH3GL3 knocked down in U251 cells.

qRT-PCR validated overexpression and knockdown efficiency of circSH3GL3 and indicated that transfection had no effect on the parental SH3GL3 gene (fig. 8A-B).

CCK8, edu and Transwell experiments show that compared with a vector group, the overexpression of the circSH3GL3 can remarkably inhibit proliferation and invasion capacity of tumor cells. Whereas si-circSH3GL 3-mediated inhibition of circSH3GL3 may significantly promote cell growth and invasiveness (fig. 9-11).

Example four competitive binding of CircSH3GL3 to miR-21-5p

The above results indicate that circSH3GL3 is mainly located in the cytoplasm, and that circSH3GL3 may exert an anti-tumor gene effect in GBM through competitive binding with miRNA in a ceRNA mechanism.

To identify downstream mirnas of circSH3GL3, we performed biotinylated circSH3GL3 probe RNA pull down experiments and miRNA high throughput sequencing of the enriched RNAs. Sequence results showed that 20 miRNAs were enriched. Based on the enrichment and Fold change > 2, qRT-PCR further validated 7 miRNAs, including has-miR-1-3p, has-miR-1246, has-miR-615-3p, has-miR-21-5p, hsa-miR-125b-1-3p, hsa-miR-4787-3p and hsa-miR-191-3p. Wherein, the specific enrichment of miR-1-3p, miR-21-5p and miR-615-3p is significantly higher than that of NC group, as shown in FIG. 12A.

Furthermore, in combination with our previous miRNA chip analysis of 3 pairs of GBM and adjacent non-tumor tissues, miR-21-5p is one of the most upregulated mirnas, abundant in GBM (fig. 12B). Thus, we selected miR-21-5p for further validation. miR-21-5p contains a putative targeting site for the circSH3GL3 region, as shown in FIG. 12C.

To verify the binding capacity of mirnas to circSH3GL3, we constructed a circSH3GL3 luciferase reporter plasmid system. The miR-21-5p seed sequences combined with TIMP3 and SMAD 7' UTR regions are predicted by using target gene prediction websites, mutant (MT) and Wild (WT) of the specific binding regions are respectively constructed on a luciferase reporter gene plasmid vector pmirGLO, and a plasmid vector map is shown in figure 13. The construction process is synthesized by Shanghai Ji Ma gene limited company, and the experimental method refers to the publication of the subject group: jikui Sun; jinhuan Wang; meng Li; shengjie Li; hanyun Li; yan Lu; feng Li; tao Xin; feng Jin; circTOP2A functions as a ceRNA to promote glioma progression by upregulating RPN2, cancer Science,2023,114 (2): 490-503.

MiR-21-5p mimic was co-transfected with the circSH3GL3 luciferase reporter gene into LN229 and U87 cells. The results demonstrate that miR-21-5p is able to significantly reduce the luciferase activity of the circSH3GL3-WT compared to the NC group, whereas there is no difference in the luciferase activity of the circSH3GGL3-MUT group (FIG. 14).

Then, the use of biotin labeled miR-21-5p pull down experiments demonstrated that the circSH3GL3 was significantly enriched in the miR-21-5p capture fraction compared to the negative control (FIG. 15).

In addition, further EDU and CCK8 functional experiments demonstrated that overexpression of miR-21-5p promoted cell proliferation, while overexpression of circSH3GL3 reversed miR-21-5p mimic-mediated proliferation promotion (FIG. 16).

These results indicate that circSH3GL3 competitively binds miR-21-5p and participates in glioma malignancy progression.

Example five, circSH3GL3 Regulation of TIMP3 and SMAD7 by competitive binding to miR-21-5p targeting

The research at present shows that miR-21-5p serves as a star molecule, and plays an important role in the occurrence and development of glioma by inhibiting various anticancer genes. Therefore, we hypothesize that circSH3GL3 inhibits tumor progression by protecting the miR-21-5p direct target gene. RNA-seq analysis after increasing the expression of circSH3GL3 revealed that 293 Different Expressed Genes (DEGs) were up-regulated (fold > 1.5) and 254 DEGs were down-regulated (fold > 0.5) in U87-circSH3GL3 cells compared to U87-Vector cells (FIG. 17). Applying up-regulated deg together with the miRanda database to predict potential targets for miR-21-5p we obtained 10 overlapping genes including TIMP3, SMAD7, TRIM2, ABCA1, FMN1, RAB27B, SEMA5A, SAMD, CYBRD1, CREB5. Finally TIMP3, SMAD7, FMN1 and CREB5 were selected for qRT-PCR validation, and the detailed screening flow chart is shown in FIG. 17.

qRT-PCR results showed that upregulation of circSH3GL3 could significantly increase mRNA levels of TIMP3 and SMAD7 without significant effect on mRNA levels of FMN1 and CREB5 (fig. 18).

Combining with a plurality of target gene prediction software such as ENCORI online database, PITA, picTar, microT, targetscan and the like, TIMP3 and SMAD7 are direct targets of miR-21-5p. MiR-21-5p seed sequences matched to the 3' UTR of TIMP3 and PDCD4 genes are shown in FIG. 19.

To determine whether circSH3GL3 could regulate the downstream genes TIMP3 and SMAD7, western blot detection was first performed, showing that upregulation of circSH3GL3 could significantly increase TIMP3 and SMAD7 protein levels, whereas miR-21-5p mimc partially reversed this effect (fig. 20A). Next, it was further confirmed whether TIMP3 and SMAD7 were direct targets for miR-21-5p, and western blot and dual luciferase reporter plasmid assays were performed. As a result, it was found that TIMP3 and SMAD7 proteins were significantly up-regulated after knockdown of miR-21-5p expression in LN229 and U87 cells (20B).

Furthermore, luciferase reporter assays demonstrated that downregulation of miR-21-5p resulted in a significant increase in pmirGLO-TIMP3-WT and pmirGLO-SMAD7-WT group luciferase activity, whereas pmirGLO-TIMP3-MT and pmirGLO-SMAD7-MT group luciferase activity did not change (FIG. 21), suggesting that miR-21-5p regulates TIMP3 and SMAD7 expression by direct binding to the 3' UTR of TIMP3 and SMAD 7. Finally, luciferase reporter assays showed that TIMP3 and SMAD7 wild-type significantly increased luciferase activity upon stable upregulation of circSH3GL3 expression compared to the mutated luciferase reporter (fig. 21), again confirming the regulatory effect of circSH3GL3 on miR-21-5p.

Example six, circSH3GL3 regulates PI3K/AKT and Wnt/beta-catenin signaling pathway through TIMP3 and SMAD7, respectively

Based on the mRNA sequences of U87 cells that were previously overexpressed by circSH3GL3, bioinformatic analysis showed various signaling pathway enrichment, including PI3K/AKT and Wnt/β -catenin signaling pathways, which are two major targets for GBM drug design. Further searching the literature in the Pubmed database, there is increasing evidence that TIMP3 can significantly inhibit the PI3K/AKT signaling pathway, while SMAD7 is an inhibitor of the Wnt/β -catenin signaling pathway. One glioma study reported that exosome-mediated MIF further activated PI3K/AKT signaling by down-regulating TIMP3, thereby promoting glioma TMZ resistance.

Therefore, we next examined whether circSH3GL3 regulates PI3K/AKT and Wnt/β -catenin signaling pathways by targeting TIMP3 and SMAD7, respectively. Western blot analysis showed that the overexpression of circSH3GL3 significantly inhibited p-PI3K, P-AKT and expression, with no effect on the total expression levels of PI3K and AKT (FIG. 22), whereas in LN229 and U87 cells that stably overexpressed circSH3GL3, siRNA-mediated TIMP3 inhibition could partially reverse the circSH3GL 3-mediated inhibition of PI3K/AKT pathway, as shown in FIG. 22.

The effects of the targeting SMAD7 on Wnt/β -catenin pathway were analyzed using TOP/FOP luciferase reporter assays (specific methods of experiments refer to the subject group publication: ma Q, li B, wang C, mo L, zhang X, tang F, wang Q, yan X, yano X et al: RPN2 is targeted by miR-181C and mediates glioma progression and temozolomide sensitivity via the Wnt/beta-catenin signaling pathway. Cell gap & disease 2020,11 (10): 890.), immunofluorescence assays of western blot and β -catenin. TOP/FOP luciferase reporter plasmid experiments demonstrated that the luciferase activity of the TOP plasmid group was significantly reduced by lentivirus-mediated circSH3GL3. In cell lines U251 and LN229, which stably knockdown the expression of circTOP2A, simultaneous knockdown of SMAD7 expression was able to reverse to some extent the reduction in luciferase activity mediated by circSH3GL3 (FIG. 23).

Western blot experimental results of important factors downstream of wnt signal transduction paths prove that: the expression of TCF4, c-myc, cyclinD1 and MMP2 was significantly inhibited by circSH3GL3, and likewise, expression levels of TCF4, c-myc, cyclinD1 were significantly up-regulated after simultaneous knockdown of SMAD7 expression (fig. 24). In addition, the expression change condition of the wnt pathway core factor beta-catenin in different treatment groups is detected through immunofluorescence analysis, and the result shows that after the circumsh 3GL3 is over-expressed, the level of the beta-catenin in the cell nucleus is obviously reduced, and the beta-catenin transcriptional activity mediated by the circumsh 3GL3 is reversed by knocking down SMAD7 (figure 25).

Example seven, effect of circSH3GL3 on glioma in vivo growth

To study the effect of circSH3GL3 on glioma growth, stereotactic in situ injection was 5×10 ⁵ U87 cells marked by luciferase and stably over-expressing circSH3GL3 (Lv-circSH 3GL 3) or Lv-miR-21-5p are used for constructing a nude mouse intracranial model. Tumor progression was tracked by in vivo bioluminescence. The experiments were divided into three groups: lv-NC, lv-circSH3GL3, lv-circSH3GL3+LV-miR-21-5p group.

The volume of xenograft tumor formed by Lv-circSH3GL 3U 87 cells was significantly smaller than that of the control group (Lv-NC) (FIG. 26A), and the Kaplan-Meier analysis result showed that the survival period of the Lv-circSH3GL3 group was significantly prolonged (FIG. 26B).

The western blot results show that: protein levels of TIMP3, SMAD7 were significantly increased in LV-circSH3GL3 group and expression of p-AKT, c-Myc, cyclinD1 was significantly decreased (FIG. 27). Immunohistochemical staining showed increased expression of TIMP3 and SMAD7 in the Lv-circSH3GL3 group, consistent with western blot results (fig. 28). However, the results of the Lv-circSH3GL3+LV-miR-21-5p group suggest that: restoration of miR-21-5p expression to a certain extent reversed the upregulation of TIMP3 and SMAD7 by circSH3GL3 and the inhibition of PI3K/AKT and wnt/beta-catenin signaling pathways (FIG. 29), with consistent in vivo and in vitro results.

The foregoing is a further detailed description of the invention in connection with the preferred embodiments, and it is not intended that the invention be limited to the specific embodiments described. It will be apparent to those skilled in the art that several simple deductions or substitutions may be made without departing from the spirit of the invention, and these should be considered to be within the scope of the invention.

Claims (10)

1. Application of hsa_circ_0104727 in regulation of glioma occurrence;

   more specifically, the hsa_circ_0104727 as ceRNA modulates glioma occurrence by competitive binding to miRNA-21-5 p;

   preferably, the glioma comprises an oligodendroglioma, an astrocytoma, a modified astrocytoma or a glioblastoma.
2. Use of a miRNA-circRNA-TIMP3 or miRNA-circRNA-SMAD7 regulatory module for modulating glioma occurrence, wherein the circRNA is hsa_circ_0104727 and the miRNA is miR-21-5p;

   preferably, the glioma comprises an oligodendroglioma, an astrocytoma, a modified astrocytoma or a glioblastoma;

   preferably, the circRNA module in the regulation module eliminates the inhibition effect of the miRNA module on the TIMP3 module or SMAD7 module, thereby regulating the occurrence of glioma;

   more preferably, the TIMP3 inhibits the PI3K/AKT signaling pathway;

   more preferably, the SMAD7 inhibits the Wnt/β -catenin signaling pathway.
3. 3. Use of a reagent for detecting hsa_circ_0104727 expression level in the preparation of a product having any one of the following functions:

   1) Diagnosing glioblastoma, and diagnosing the glioblastoma,

   2) The glioma is classified into a grade and a grade,

   3) Predicting prognosis of glioma patients;

   preferably, the glioblastoma is one of gliomas;

   preferably, the grading is to identify the glioma patient as a low grade glioma or a high grade glioma;

   preferably, the glioma comprises a WHO 1-4 grade, in particular, WHO 1-2 grade is a low grade glioma and WHO 3-4 is a high grade glioma;

   preferably, the glioma comprises an oligodendroglioma, an astrocytoma, a modified astrocytoma or a glioblastoma.
4. 4. The use according to claim 3, wherein the reagent comprises a reagent used in the following method for detecting hsa_circ_0104727 expression: detection method based on PCR principle, southern hybridization method, northern hybridization method, dot hybridization method, fluorescence in situ hybridization method, DNA microarray method, ASO method, high throughput sequencing platform method;

   specifically, the detection method based on the PCR principle comprises variable temperature amplification and constant temperature amplification;

   specifically, the reagent is a primer pair, probe or antisense nucleotide that specifically binds to hsa_circ_ 0104727;

   further, the reagent further comprises a detectable label;

   further, the detectable label includes a radioisotope, a nucleotide chromophore, an enzyme, a substrate, a fluorescent molecule, a chemiluminescent moiety, a magnetic particle, a bioluminescent moiety.
5. 5. A composition for treating glioma, said composition comprising any one or more of the following:

   1) hsa_circ_0104727 and/or hsa_circ_0104727 precursors,

   2) A polynucleotide which is transcribed to form hsa_circ_0104727,

   3) A delivery vehicle comprising 1) or 2) of,

   4) An agent for promoting hsa_circ_0104727 expression,

   5) A molecular pathway inhibitor, the molecular pathway comprising a PI3K/AKT signaling pathway and a Wnt/β -catenin signaling pathway;

   preferably, the composition contains a molecular pathway inhibitor;

   preferably, a pharmaceutically acceptable solid/liquid excipient is also included in the composition;

   preferably, the pharmaceutically acceptable solid/liquid excipients include binders, fillers, lubricants and disintegrants.
6. 6. The composition of claim 5, wherein the delivery vehicle comprises an exosome, a viral vector, a lipid nanoparticle, a polymeric nanocarrier, an inorganic nanocarrier, or a protein carrier;

   preferably, the viral vector comprises a lentiviral vector, an adenoviral vector, an adeno-associated viral vector.
7. Use of hsa_circ_0104727 or a composition according to claim 5 for the manufacture of a medicament for the treatment of glioma;

   preferably, the glioma comprises a WHO 1-4 grade glioma;

   preferably, the glioma comprises an oligodendroglioma, an astrocytoma, a modified astrocytoma or a glioblastoma;

   preferably, the glioma is glioblastoma.
8. 8. A method of inhibiting glioma cell proliferation and invasion, the method comprising increasing the expression level of hsa_circ_0104727 in a target cell;

   preferably, the method is non-therapeutic;

   preferably, the method is performed in vitro.
9. 9. A system having a judging means for giving any one of the following results by the expression level of hsa_circ_ 0104727:

   1) Whether the subject has glioblastoma,

   2) Glioma typing of the subject,

   3) Prognosis of glioma patients.
10. 10. The system of claim 9, further comprising one or more of a detection device, an input device, an output device, and a communication device.