CN117363733B - Application of detection primer probe group for PER1 and LOX double-gene methylation joint diagnosis in preparation of bladder cancer diagnosis reagent - Google Patents
Application of detection primer probe group for PER1 and LOX double-gene methylation joint diagnosis in preparation of bladder cancer diagnosis reagent Download PDFInfo
- Publication number
- CN117363733B CN117363733B CN202311665778.XA CN202311665778A CN117363733B CN 117363733 B CN117363733 B CN 117363733B CN 202311665778 A CN202311665778 A CN 202311665778A CN 117363733 B CN117363733 B CN 117363733B
- Authority
- CN
- China
- Prior art keywords
- gene
- per1
- lox
- methylation
- bladder cancer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
- 230000011987 methylation Effects 0.000 title claims abstract description 48
- 238000007069 methylation reaction Methods 0.000 title claims abstract description 48
- 239000000523 sample Substances 0.000 title claims abstract description 46
- 206010005003 Bladder cancer Diseases 0.000 title claims abstract description 42
- 208000007097 Urinary Bladder Neoplasms Diseases 0.000 title claims abstract description 38
- 201000005112 urinary bladder cancer Diseases 0.000 title claims abstract description 37
- 238000001514 detection method Methods 0.000 title claims abstract description 32
- 101000579484 Homo sapiens Period circadian protein homolog 1 Proteins 0.000 title claims abstract description 27
- 102100028293 Period circadian protein homolog 1 Human genes 0.000 title claims abstract description 25
- 238000003745 diagnosis Methods 0.000 title claims abstract description 16
- 239000003153 chemical reaction reagent Substances 0.000 title claims abstract description 10
- 238000002360 preparation method Methods 0.000 title claims abstract description 7
- 101001126582 Homo sapiens Post-GPI attachment to proteins factor 3 Proteins 0.000 title claims abstract 5
- 101150008094 per1 gene Proteins 0.000 claims abstract description 17
- 101150070593 lox gene Proteins 0.000 claims abstract description 15
- 101150082216 COL2A1 gene Proteins 0.000 claims description 10
- 108090000623 proteins and genes Proteins 0.000 abstract description 29
- 230000035945 sensitivity Effects 0.000 abstract description 9
- 230000006870 function Effects 0.000 abstract description 7
- 230000000295 complement effect Effects 0.000 abstract description 6
- 238000003753 real-time PCR Methods 0.000 abstract description 6
- 102000044209 Tumor Suppressor Genes Human genes 0.000 abstract description 4
- 108700025716 Tumor Suppressor Genes Proteins 0.000 abstract description 4
- 238000013461 design Methods 0.000 abstract description 3
- 238000005516 engineering process Methods 0.000 abstract description 3
- 108010003894 Protein-Lysine 6-Oxidase Proteins 0.000 description 22
- 102000004669 Protein-Lysine 6-Oxidase Human genes 0.000 description 19
- 108020004414 DNA Proteins 0.000 description 16
- 238000006243 chemical reaction Methods 0.000 description 14
- 210000002700 urine Anatomy 0.000 description 14
- LSNNMFCWUKXFEE-UHFFFAOYSA-M Bisulfite Chemical compound OS([O-])=O LSNNMFCWUKXFEE-UHFFFAOYSA-M 0.000 description 10
- 206010028980 Neoplasm Diseases 0.000 description 7
- 201000011510 cancer Diseases 0.000 description 7
- 210000004027 cell Anatomy 0.000 description 5
- 102000053602 DNA Human genes 0.000 description 4
- 230000007067 DNA methylation Effects 0.000 description 4
- 101000771163 Homo sapiens Collagen alpha-1(II) chain Proteins 0.000 description 4
- 230000033228 biological regulation Effects 0.000 description 4
- OPTASPLRGRRNAP-UHFFFAOYSA-N cytosine Chemical class NC=1C=CNC(=O)N=1 OPTASPLRGRRNAP-UHFFFAOYSA-N 0.000 description 4
- 238000000034 method Methods 0.000 description 4
- 230000001114 myogenic effect Effects 0.000 description 4
- 239000002773 nucleotide Substances 0.000 description 4
- 125000003729 nucleotide group Chemical group 0.000 description 4
- 238000012216 screening Methods 0.000 description 4
- 102100029136 Collagen alpha-1(II) chain Human genes 0.000 description 3
- 238000007400 DNA extraction Methods 0.000 description 3
- 230000003321 amplification Effects 0.000 description 3
- 230000000694 effects Effects 0.000 description 3
- 230000001973 epigenetic effect Effects 0.000 description 3
- 230000014509 gene expression Effects 0.000 description 3
- 239000003550 marker Substances 0.000 description 3
- 238000007855 methylation-specific PCR Methods 0.000 description 3
- 238000003199 nucleic acid amplification method Methods 0.000 description 3
- 210000001519 tissue Anatomy 0.000 description 3
- 210000004881 tumor cell Anatomy 0.000 description 3
- 208000005623 Carcinogenesis Diseases 0.000 description 2
- 108091029523 CpG island Proteins 0.000 description 2
- KDXKERNSBIXSRK-UHFFFAOYSA-N Lysine Natural products NCCCCC(N)C(O)=O KDXKERNSBIXSRK-UHFFFAOYSA-N 0.000 description 2
- 239000004472 Lysine Substances 0.000 description 2
- 108700019961 Neoplasm Genes Proteins 0.000 description 2
- 102000048850 Neoplasm Genes Human genes 0.000 description 2
- 102000004316 Oxidoreductases Human genes 0.000 description 2
- 108090000854 Oxidoreductases Proteins 0.000 description 2
- 230000002159 abnormal effect Effects 0.000 description 2
- 230000009286 beneficial effect Effects 0.000 description 2
- 238000001574 biopsy Methods 0.000 description 2
- 230000036952 cancer formation Effects 0.000 description 2
- 231100000504 carcinogenesis Toxicity 0.000 description 2
- 230000008995 epigenetic change Effects 0.000 description 2
- 230000007614 genetic variation Effects 0.000 description 2
- 230000003902 lesion Effects 0.000 description 2
- 238000011528 liquid biopsy Methods 0.000 description 2
- 230000004048 modification Effects 0.000 description 2
- 238000012986 modification Methods 0.000 description 2
- 102000004169 proteins and genes Human genes 0.000 description 2
- 238000005070 sampling Methods 0.000 description 2
- RWQNBRDOKXIBIV-UHFFFAOYSA-N thymine Chemical compound CC1=CNC(=O)NC1=O RWQNBRDOKXIBIV-UHFFFAOYSA-N 0.000 description 2
- 206010069754 Acquired gene mutation Diseases 0.000 description 1
- 102100021569 Apoptosis regulator Bcl-2 Human genes 0.000 description 1
- 108091012583 BCL2 Proteins 0.000 description 1
- 102000008186 Collagen Human genes 0.000 description 1
- 108010035532 Collagen Proteins 0.000 description 1
- RYGMFSIKBFXOCR-UHFFFAOYSA-N Copper Chemical compound [Cu] RYGMFSIKBFXOCR-UHFFFAOYSA-N 0.000 description 1
- 230000033616 DNA repair Effects 0.000 description 1
- 102100038587 Death-associated protein kinase 1 Human genes 0.000 description 1
- 108010014258 Elastin Proteins 0.000 description 1
- 102000016942 Elastin Human genes 0.000 description 1
- 108700039691 Genetic Promoter Regions Proteins 0.000 description 1
- 101000956145 Homo sapiens Death-associated protein kinase 1 Proteins 0.000 description 1
- 206010027476 Metastases Diseases 0.000 description 1
- 102000008297 Nuclear Matrix-Associated Proteins Human genes 0.000 description 1
- 108010035916 Nuclear Matrix-Associated Proteins Proteins 0.000 description 1
- 108091028043 Nucleic acid sequence Proteins 0.000 description 1
- 102000043276 Oncogene Human genes 0.000 description 1
- 108700020796 Oncogene Proteins 0.000 description 1
- 238000003556 assay Methods 0.000 description 1
- 230000004791 biological behavior Effects 0.000 description 1
- 239000000090 biomarker Substances 0.000 description 1
- 238000004364 calculation method Methods 0.000 description 1
- 230000027288 circadian rhythm Effects 0.000 description 1
- 229920001436 collagen Polymers 0.000 description 1
- 210000002808 connective tissue Anatomy 0.000 description 1
- 229910052802 copper Inorganic materials 0.000 description 1
- 239000010949 copper Substances 0.000 description 1
- 238000004132 cross linking Methods 0.000 description 1
- 229940104302 cytosine Drugs 0.000 description 1
- 238000011161 development Methods 0.000 description 1
- 230000018109 developmental process Effects 0.000 description 1
- 230000004069 differentiation Effects 0.000 description 1
- 201000010099 disease Diseases 0.000 description 1
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 description 1
- 230000009977 dual effect Effects 0.000 description 1
- 229920002549 elastin Polymers 0.000 description 1
- 230000013020 embryo development Effects 0.000 description 1
- 239000012530 fluid Substances 0.000 description 1
- 230000002068 genetic effect Effects 0.000 description 1
- PCHJSUWPFVWCPO-UHFFFAOYSA-N gold Chemical compound [Au] PCHJSUWPFVWCPO-UHFFFAOYSA-N 0.000 description 1
- 230000006607 hypermethylation Effects 0.000 description 1
- 230000006872 improvement Effects 0.000 description 1
- 230000008595 infiltration Effects 0.000 description 1
- 238000001764 infiltration Methods 0.000 description 1
- 210000004072 lung Anatomy 0.000 description 1
- 230000007246 mechanism Effects 0.000 description 1
- 230000009401 metastasis Effects 0.000 description 1
- 108091070501 miRNA Proteins 0.000 description 1
- 239000002679 microRNA Substances 0.000 description 1
- 230000035772 mutation Effects 0.000 description 1
- 230000002632 myometrial effect Effects 0.000 description 1
- 208000002154 non-small cell lung carcinoma Diseases 0.000 description 1
- 238000010827 pathological analysis Methods 0.000 description 1
- 230000001575 pathological effect Effects 0.000 description 1
- 102000054765 polymorphisms of proteins Human genes 0.000 description 1
- 230000002265 prevention Effects 0.000 description 1
- 230000008569 process Effects 0.000 description 1
- 238000000575 proteomic method Methods 0.000 description 1
- 238000003908 quality control method Methods 0.000 description 1
- 238000011002 quantification Methods 0.000 description 1
- 238000010791 quenching Methods 0.000 description 1
- 230000000171 quenching effect Effects 0.000 description 1
- 230000022983 regulation of cell cycle Effects 0.000 description 1
- 230000001105 regulatory effect Effects 0.000 description 1
- 238000011160 research Methods 0.000 description 1
- 238000002271 resection Methods 0.000 description 1
- 230000033764 rhythmic process Effects 0.000 description 1
- 238000012163 sequencing technique Methods 0.000 description 1
- 210000002966 serum Anatomy 0.000 description 1
- 210000003765 sex chromosome Anatomy 0.000 description 1
- 230000037439 somatic mutation Effects 0.000 description 1
- 238000011895 specific detection Methods 0.000 description 1
- 238000013517 stratification Methods 0.000 description 1
- 238000010998 test method Methods 0.000 description 1
- 238000012360 testing method Methods 0.000 description 1
- 229940113082 thymine Drugs 0.000 description 1
- 208000029729 tumor suppressor gene on chromosome 11 Diseases 0.000 description 1
- 230000005760 tumorsuppression Effects 0.000 description 1
- 238000012795 verification Methods 0.000 description 1
- 230000037314 wound repair Effects 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/154—Methylation markers
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Pathology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Hospice & Palliative Care (AREA)
- Biophysics (AREA)
- Oncology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides an application of a detection primer probe group for PER1 and LOX double-gene methylation joint diagnosis in preparation of a bladder cancer diagnosis reagent, wherein a target region is selected from any one of the following methylation sequences and regions in PER1 genes and LOX genes: the chr17:8055550-8055835 region of the PER1 gene; the chr5:121413300-121413650 region of the LOX gene. The invention selects methylation in at least one target region of PER1 gene and LOX gene as key cancer suppressor gene and target region of bladder cancer, and designs proper primer probes for the gene; the fluorescent quantitative PCR technology of automatic detection is adopted, so that the requirement on the number of sample cells is low; and PER1 and LOX double-gene methylation are combined, the functions are complementary, and the clinical sensitivity is improved.
Description
Technical Field
The invention relates to the technical field of bladder cancer detection, in particular to application of a detection primer probe group for PER1 and LOX double-gene methylation joint diagnosis in preparation of a bladder cancer diagnosis reagent.
Background
Bladder Cancer (BC) is one of the most common malignant tumors, and bladder cancer patients are usually staged by transurethral resection of the bladder tumor and sent to pathological analysis. Bladder cancer is classified into non-myogenic invasive bladder cancer (NMIBC) and Myogenic Invasive Bladder Cancer (MIBC) according to the depth of infiltration. The gold standard for bladder cancer detection is cystoscopic biopsy of suspicious lesions. However, 10% to 40% of malignant tumors were not found by biopsies.
Urine cytology is affected by subjective factors and has poor sensitivity. Genetic mutations have also been used to detect bladder cancer from urine residue DNA; some of the over-expressed proteins in cancer tissues or urine identified by proteomic analysis, including nuclear matrix proteins in urine, have also been tested in bladder cancer screening. None of these markers have achieved clinically satisfactory results.
Clinical professionals are continually exploring the development of liquid biopsy tools to overcome the reliance on invasive, expensive endoscopic procedures in bladder cancer diagnosis, follow-up and risk stratification. Epigenetic changes in gene regulation are of great biological importance in tumorigenesis. Promoter CpG island hypermethylation of tumor suppressor genes (oncogenes) and global hypomethylation of genomic DNA frequently occur in human cancers. Epigenetic changes (e.g., DNA methylation) are more likely to alter tumorigenesis than genetic variations, and are more early and specific than somatic mutations, which typically occur in the middle and late stages of cancer. Thus, many studies have attempted to better detect bladder cancer using tumor-associated DNA methylation tests. The use of bisulfite treatment of total DNA changes unmethylated cytosine C to thymine T, which allows for the differentiation of cytosine from methylated cytosine residues by methylation-specific PCR (MSP), which forms the basis of detection of cancer by humoral DNA methylation, with only 1-10 tumor cells being detectable in about 100 normal cells of a clinical sample. Clinical samples include bronchoalveolar lavage fluid, stool, serum/plasma, and urine residues. Studies show that abnormal methylation states of DAPK, BCL2 and HTERT genes are detected in urine residual DNA of 78% of bladder cancer patients, but sensitivity is low, and we need to find methylation genes with complementary functions, and reasonably and scientifically combine the methylation genes to improve sensitivity under the condition that specificity is slightly reduced.
Disclosure of Invention
The invention aims to provide a non-invasive sampling and detection method which is simple to operate, rapid and automatic in the detection process; and the application of the detection primer probe group which has complementary screening functions, can scientifically and reasonably combine and can improve clinical sensitivity on the premise of ensuring high specificity in preparing the bladder cancer diagnosis reagent.
The invention provides an application of a detection primer probe group for PER1 and LOX double-gene methylation joint diagnosis in preparation of a bladder cancer diagnosis reagent, wherein the methylation sequences and regions of PER1 genes and LOX genes are as follows:
the chr17:8055550-8055835 region of the PER1 gene;
the chr5:121413300-121413650 region of the LOX gene.
Preferably, the primer sequences for PER1 and LOX double gene methylation are specifically expressed as follows:
forward primer of PER1 gene: 5'-GGTCGAAAGTAGTTTATTAGA-3';
reverse primer of PER1 gene: 5'-CATCCTAAAACCGATCTC-3';
forward primer of LOX gene: 5'-CGGTTAGCGGTGATTTTAG-3';
reverse primer of LOX gene: 5'-CCTACTAATCCGCGACAA-3'.
Preferably, a probe is further designed for the primer, and the probe sequence is specifically expressed as follows:
probe of PER1 gene: 5'-CCGAACCGCTACCACTTCCA-3';
probes for LOX gene: 5'-CGAACGCGAACGACCGACTC-3'.
Preferably, the kit further comprises a pair of primer sequences corresponding to the reference marker COL2A1 gene, and the primer sequences are specifically expressed as follows:
forward primer of COL2A1 gene: 5'-GTAGTTTGTTTAGTTTAGG-3';
reverse primer of COL2A1 gene: 5'-CACTCTAAAACTCTACACTAA-3'.
Preferably, a probe is further designed for the primer corresponding to the reference marker COL2A1 gene, and the probe sequence is specifically expressed as follows:
probes for the COL2A1 gene: 5'-ATCCATTCATCCCACCCTCTCAC-3'. Compared with the prior art, the invention has the following beneficial effects:
the invention selects methylation in at least one target region of PER1 gene and LOX gene as key cancer suppressor gene and target region of bladder cancer, and designs proper primer probes for the gene; the fluorescent quantitative PCR technology of automatic detection is adopted, so that the requirement on the number of sample cells is low; and PER1 and LOX double-gene methylation are combined, the functions are complementary, and the clinical sensitivity is improved. The DNA methylation mark can well meet clinical requirements, is applied to screening and auxiliary diagnosis of bladder cancer, and is beneficial to prevention and treatment of bladder cancer.
In addition to the objects, features and advantages described above, the present invention has other objects, features and advantages. The present invention will be described in further detail with reference to the drawings.
Drawings
The accompanying drawings, which are included to provide a further understanding of the invention and are incorporated in and constitute a part of this specification, illustrate embodiments of the invention and together with the description serve to explain the invention. In the drawings:
FIG. 1 is a graphical representation of the area under the characteristic curve (AUC) of a subject diagnosed with bladder cancer for PER1 and LOX methylation detection in an embodiment of the invention.
Detailed Description
The following are specific embodiments of the present invention and the technical solutions of the present invention will be further described with reference to the accompanying drawings, but the present invention is not limited to these embodiments.
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terminology used herein in the description of the invention is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention.
Example 1:
the primer pair for diagnosing bladder cancer gene methylation provided by the invention comprises at least any pair of biomarkers which at least comprise a PER1 gene of human genome GRCh37/hg19 version and a nucleotide sequence of methylation in at least one target region of LOX gene, which are used as primer sequences corresponding to methylation markers. The methylated regions of the PER1 gene and the LOX gene are shown in Table 1.
TABLE 1 methylation regions in PER1 Gene and LOX Gene
Specifically, the methylation sequence and region of the gene are screened out by differential methylation gene screening in an epigenetic database, and the methylation degree of the CpG island of the gene promoter region on the non-sex chromosome in the bladder cancer sample is obviously higher than that of the benign sample. The methylation difference sequence is inquired in https/genome. Ucsc. Edu/functional network, methylation specific PCR amplification primer probe design is carried out, and the PER1 and LOX genes can be used as markers for diagnosing bladder cancer through clinical sample urine verification, and the clinical sensitivity can be greatly improved through joint detection.
Specifically, PER1 (Period circadian regulator 1) is a core member of the Period gene family, is a circadian rhythm regulating gene, is an important component of a biological rhythm molecular system, and participates in other physiological and biochemical activities of an organism. Polymorphisms in the PER1 gene may increase the risk of developing certain cancers, which are tumor suppressor genes. For example, the expression level of the Per1 gene is higher in normal lung tissue, but lower in tissue samples and cell lines from a large number of non-small cell lung cancer patients. The regulation and control mechanism of Per1 gene on the biological behavior of malignant tumor cells is closely related to DNA repair, cell cycle regulation, miRNA regulation and control and metastasis of tumor cells.
The region for detecting PER1 gene methylation is selected from the region of hg19_dnarange=chr17: 8055550-8055835, and the nucleotide sequence of the region is as follows:
CAGTGTGCCCTCTGCCTGGGCCGAAAGTAGCCCATCAGATTGGAAGTGGCAGCGGTCCGGCTCAGGGACGGAGATCGGCCCCAGGATGGCCGCAGAGATGCCTACCTGGTCGCAGGAGTGTCCTCCGCACGCCTGCCCGCCGCCGCTCCAGCCCGCAGCCGAGTGGAAGCTCCACCGGGCGGGCGGGGAGGCGGGTTGCATAATGCCGGGCACTGCCCCCTCATTGGCCTCTTGCCGACGGAGCCGCAGGCCCCGCCCCCGATTGGCTGGGGATCTCTTCCCGGCG
the DNA strand was subjected to bisulfite conversion (unmethylated C to T, methylated C remained unchanged), yielding a converted DNA strand:
TAGTGTGTTTTTTGTTTGGGTCGAAAGTAGTTTATTAGATTGGAAGTGGTAGCGGTTCGGTTTAGGGACGGAGATCGGTTTTAGGATGGTCGTAGAGATGTTTATTTGGTCGTAGGAGTGTTTTTCGTACGTTTGTTCGTCGTCGTTTTAGTTCGTAGTCGAGTGGAAGTTTTATCGGGCGGGCGGGGAGGCGGGTTGTATAATGTCGGGTATTGTTTTTTTATTGGTTTTTTGTCGACGGAGTCGTAGGTTTCGTTTTCGATTGGTTGGGGATTTTTTTTCGGCG
the underlined part of the sequence is the sequence position of the primer probe of PER1 (chr 17: 8055550-8055835) finally obtained.
Specifically, the LOX (lysyl oxidase) gene is a major member of the protein family encoding lysine oxidase. Plays an important role in normal connective tissue function, embryonic development and wound repair, and thus abnormal expression and activity of LOX can lead to disease occurrence. Alternative splicing of the RNA transcribed from this gene results in multiple transcript variants, where copper plays a role in collagen and elastin cross-linking by lysine oxidase activity, whereas the propeptide may play a role in tumor suppression.
The region for detecting LOX gene methylation is selected from the hg19_dnarange=chr5: 121413300-121413650 region, and the nucleotide sequence of the region is as follows:
AGCTTGGAACCAGTGACGGGCGGTGGGCCTGGGGCGGCCAGCGGTGACTCCAGATGAGCCGGCCGTCCGCGTTCGCGCCGCGGCGGTGCGGTTGTCGCGGATCAGCAGGATCGGAGTGCGGGGCTGCTGGGCGGAGGCGTTGGCTGCACCAGGGACGGCGGCGCCCGGGTCCCGGCGGCGCTGAGGCTGGTACTGTGAGCCCAGGCTCAGCAAGCTGAACACCTGCCCGTTGTTCTCCCATTGGATCTGCTGGCGCCAGGCGCCCGGAGCCGCCGGCGGCTCGCGCGGGGGCTGCTGTTGGCCGGCGGCGGGAGGGGCGCAGTGCACTAGCGCGCAGAGCTGCAAAGGCCC
the DNA strand was subjected to bisulfite conversion (unmethylated C to T, methylated C remained unchanged), yielding a converted DNA strand:
AGTTTGGAATTAGTGACGGGCGGTGGGTTTGGGGCGGTTAGCGGTGATTTTAGATGAGTCGGTCGTTCG CGTTCGCGTCGCGGCGGTGCGGTTGTCGCGGATTAGTAGGATCGGAGTGCGGGGTTGTTGGGCGGAGGCGTTGGTTGTATTAGGGACGGCGGCGTTCGGGTTTCGGCGGCGTTGAGGTTGGTATTGTGAGTTTAGGTTTAGTAAGTTGAATATTTGTTCGTTGTTTTTTTATTGGATTTGTTGGCGTTAGGCGTTCGGAGTCGTCGGCGGTTCGCGCGGGGGTTGTTGTTGGTCGGCGGCGGGAGGGGCGTAGTGTATTAGCGCGTAGAGTTGTAAAGGTTT
the underlined sequence is the sequence position of the primer probe of LOX (chr 5: 121413300-121413650) finally obtained.
Specifically, the nucleotide sequences of the primers and probes before and after detection of each methylation target gene region are shown in Table 2.
TABLE 2 base sequences of primers and probes for detecting regions of each methylated target gene
Note that: in this table, the probe sequences shown are not fluorescently labeled and quenching group labeled. Wherein COL2A1 is an internal reference gene.
Example 2:
the kit provided by the invention is used for a detection test method for detecting a bladder cancer gene methylation reagent, and comprises the following steps:
1. sample DNA extraction
The urine has less exfoliated cells and low DNA content, is difficult to extract, and adopts the urine residue DNA extraction kit to efficiently enrich and extract DNA in the urine.
2. DNA bisulfite conversion
Epigenetic is a genetic branch discipline that investigates the genetic variation of gene expression and regulation without altering the nucleotide sequence of the gene. The most dominant form of epigenetic is methylation of DNA, which is widely studied and used in cancer detection. Sequencing after bisulfite treatment of DNA is the primary method of methylation research. In the embodiment 1, a bisulfite conversion kit (Hunan Hongya Gene technology Co., ltd., hunan Long mechanical preparation No. 20200131) which is independently developed by the applicant and is a methylation detection sample pretreatment kit is adopted as a DNA bisulfite conversion reagent, and the conversion efficiency is 99.6-100.0% and is higher than that of most bisulfite conversion kits on the market.
3. Methylation specific fluorescent quantitative PCR amplification
3.1, preparing a fluorescence quantitative PCR reaction system, and table 3.
TABLE 3 PCR reaction system (20 ul/person)
Wherein the DNA is sample DNA after bisulfite conversion, negative or positive quality control product
3.2 PCR reaction
PCR reactions were performed according to the procedure parameters in Table 4.
TABLE 4 PCR on-machine program parameters
4. Relative quantification of gene methylation
After the sample is subjected to methylation specific primer probe PCR, cp value of each gene can be obtained. The methylation result of the gene is delta Cp value, the smaller the delta Cp value is, the higher the methylation degree is, and the specific calculation formula is as follows:
ΔCp PER1 =Cp PER1 -Cp COL2A1
ΔCp LOX =Cp LOX -Cp COL2A1 。
5. single gene detection result interpretation
After the PCR reaction was completed, the amplification curve and Cp of the internal reference gene COL2A1 were observed to determine whether the reading was normal.
TABLE 5 Single gene methylation detection results interpretation
6. PER1 and LOX double-gene methylation combined detection result interpretation
TABLE 6 interpretation of PER1, LOX double Gene methylation Joint detection results
Experimental example 1:
96 urine samples with known clear pathological information results were selected. 58 cases of benign lesions of the bladder; bladder cancer 38, non-myogenic invasive bladder cancer (NMIBC) 9 and Myogenic Invasive Bladder Cancer (MIBC) 29.
DNA extraction of sample urine residue, bisulfite conversion followed by specific detection of PER1 and LOX target region methylation by fluorescent quantitative PCR was performed according to example 1, and the ability of the reagents of the invention to identify bladder cancer was shown in FIG. 1 and specifically analyzed as follows:
PER1 (chr 17: 8055550-8055835) methylation detection the area under the characteristic curve (AUC) of a subject diagnosed with bladder cancer is 0.931 (95% CI = 0.861-0.973);
the area under the characteristic curve (AUC) of the subjects diagnosed with bladder cancer for LOX (chr 5: 121413300-121413650) methylation detection was 0.907 (95% ci= 0.831-0.957).
The diagnostic performance of the single and dual gene combination assays was analyzed according to the interpretation of the methylation results of the PER1, LOX genes in example 1, see Table 7.
TABLE 7 Performance of PER1, LOX Single-gene methylation detection and double Gene combination detection
PER1 and LOX gene methylation detection respectively detect 34 cases and 35 cases in urine of 38 cases of bladder cancer, and respectively miss 4 cases and 3 cases; in the case of the combined detection of PER1 and LOX double gene methylation, the specificity is maintained to be more than 80%, 37 cases of 38 cases of bladder cancer are detected, and 1 case of myometrial invasive bladder cancer is missed. The sensitivity is as high as 97.37%, and PER1 and LOX are complementary in the functions, so that the missed diagnosis of bladder cancer is reduced.
The advantages of the present invention over the prior art include:
(1) the invention screens out the double-gene methylation marker of bladder cancer with complementary functions;
(2) the invention belongs to liquid biopsy, which can be detected by noninvasive sampling and urine detection;
(3) the invention adopts fluorescent quantitative PCR technology, has low requirement on the number of sample cells, has high sensitivity and specificity for diagnosing bladder cancer, and provides a new detection means for early discovery and early treatment of bladder cancer.
The above description is only of the preferred embodiments of the present invention and is not intended to limit the present invention, but various modifications and variations can be made to the present invention by those skilled in the art. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.
Claims (5)
1. Application of a detection primer probe group for PER1 and LOX double-gene methylation joint diagnosis in preparation of bladder cancer diagnosis reagents.
2. The use according to claim 1, wherein the primer sequences of the primer probe set are specifically expressed as follows:
forward primer of PER1 gene: 5'-GGTCGAAAGTAGTTTATTAGA-3';
reverse primer of PER1 gene: 5'-CATCCTAAAACCGATCTC-3';
forward primer of LOX gene: 5'-CGGTTAGCGGTGATTTTAG-3';
reverse primer of LOX gene: 5'-CCTACTAATCCGCGACAA-3'.
3. The use according to claim 2, characterized in that the primer probe set is further designed with probes, the probe sequences being specifically expressed as follows:
probe of PER1 gene: 5'-CCGAACCGCTACCACTTCCA-3';
probes for LOX gene: 5'-CGAACGCGAACGACCGACTC-3'.
4. The use according to claim 2, wherein the primer probe set further comprises a set of primer sequences corresponding to a pair of reference markers COL2A1 gene, specifically expressed as follows:
forward primer of COL2A1 gene: 5'-GTAGTTTGTTTAGTTTAGG-3';
reverse primer of COL2A1 gene: 5'-CACTCTAAAACTCTACACTAA-3'.
5. The use according to claim 4, wherein the primer-probe set further comprises a probe for the COL2A1 gene, the probe sequence being specifically represented as follows:
probes for the COL2A1 gene: 5'-ATCCATTCATCCCACCCTCTCAC-3'.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202311665778.XA CN117363733B (en) | 2023-12-07 | 2023-12-07 | Application of detection primer probe group for PER1 and LOX double-gene methylation joint diagnosis in preparation of bladder cancer diagnosis reagent |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202311665778.XA CN117363733B (en) | 2023-12-07 | 2023-12-07 | Application of detection primer probe group for PER1 and LOX double-gene methylation joint diagnosis in preparation of bladder cancer diagnosis reagent |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN117363733A CN117363733A (en) | 2024-01-09 |
| CN117363733B true CN117363733B (en) | 2024-02-23 |
Family
ID=89393252
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202311665778.XA Active CN117363733B (en) | 2023-12-07 | 2023-12-07 | Application of detection primer probe group for PER1 and LOX double-gene methylation joint diagnosis in preparation of bladder cancer diagnosis reagent |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN117363733B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN117701718B (en) * | 2024-02-04 | 2024-05-07 | 湖南宏雅基因技术有限公司 | Gene methylation marker for diagnosing cervical cancer, primer pair and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111826446A (en) * | 2020-03-24 | 2020-10-27 | 亚能生物技术（深圳）有限公司 | Primer, probe and kit for early screening and auxiliary diagnosis of bladder cancer |
| CN113943799A (en) * | 2020-07-16 | 2022-01-18 | 广州达健生物科技有限公司 | Composition for detecting bladder cancer, kit and application thereof |
| CN116479132A (en) * | 2023-04-26 | 2023-07-25 | 上海交通大学医学院附属仁济医院 | Methylation site marker for bladder cancer and application thereof |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20180045727A1 (en) * | 2015-03-03 | 2018-02-15 | Caris Mpi, Inc. | Molecular profiling for cancer |
-
2023
- 2023-12-07 CN CN202311665778.XA patent/CN117363733B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111826446A (en) * | 2020-03-24 | 2020-10-27 | 亚能生物技术（深圳）有限公司 | Primer, probe and kit for early screening and auxiliary diagnosis of bladder cancer |
| CN113943799A (en) * | 2020-07-16 | 2022-01-18 | 广州达健生物科技有限公司 | Composition for detecting bladder cancer, kit and application thereof |
| CN116479132A (en) * | 2023-04-26 | 2023-07-25 | 上海交通大学医学院附属仁济医院 | Methylation site marker for bladder cancer and application thereof |
Non-Patent Citations (1)
| Title |
|---|
| The diagnostic accuracy of methylation markers in urine for the detection of bladder cancer: a systematic review;Judith Bosschieter等;《Epigenomics》;第1-16页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN117363733A (en) | 2024-01-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN113755603B (en) | Marker, primer probe and kit for early screening and diagnosis of endometrial cancer | |
| WO2023071890A1 (en) | Methylation biomarker related to lymph node metastasis of gastric cancer, and combination and detection kit thereof | |
| US11377694B2 (en) | Unbiased DNA methylation markers define an extensive field defect in histologically normal prostate tissues associated with prostate cancer: new biomarkers for men with prostate cancer | |
| CN117363733B (en) | Application of detection primer probe group for PER1 and LOX double-gene methylation joint diagnosis in preparation of bladder cancer diagnosis reagent | |
| US20210404018A1 (en) | Unbiased dna methylation markers define an extensive field defect in histologically normal prostate tissues associated with prostate cancer: new biomarkers for men with prostate cancer | |
| US20120135877A1 (en) | DNA Methylation Markers For Prostate Cancer Field Defect | |
| CN112646888B (en) | Kit for detecting mammary tumor specific methylation | |
| JP6381020B2 (en) | Method for obtaining information on colorectal cancer, and marker and kit for obtaining information on colorectal cancer | |
| CN115896281A (en) | Methylated biomarker, kit and application | |
| US20090186360A1 (en) | Detection of GSTP1 hypermethylation in prostate cancer | |
| CN108707667B (en) | Kit for early diagnosis of colorectal cancer and use method thereof | |
| EP3162899A1 (en) | Biomarker for breast cancer | |
| CN116144782A (en) | Combined marker for lung cancer detection and application thereof | |
| CN116083588A (en) | DNA methylation site combination as prostate cancer marker and application thereof | |
| CN115961038A (en) | Composition for detecting gastric cancer, kit and application thereof | |
| CN116064786A (en) | Composition for detecting gastric cancer, kit and application thereof | |
| EP2978861B1 (en) | Unbiased dna methylation markers define an extensive field defect in histologically normal prostate tissues associated with prostate cancer: new biomarkers for men with prostate cancer | |
| US20210079482A1 (en) | Methylation-based biomarkers in breast cancer screening, diagnosis, or prognosis | |
| CN117344010B (en) | DNA methylation biomarker for diagnosing gastric cancer, kit and application | |
| WO2024001602A1 (en) | Composition for detecting gastric cancer, kit, and use thereof | |
| CN117887849A (en) | Methylation marker of benign and malignant endometrial lesions and application thereof | |
| CN116219023A (en) | Gel method kit for detecting methylation of lung cancer specific marker and application | |
| CN118006781A (en) | Marker, primer set, high-sensitivity and high-specificity kit and detection method for detecting urothelial cancer | |
| CN117604095A (en) | Methylation detection reagent and kit for esophageal cancer diagnosis | |
| CN116083586A (en) | Nucleic acid product, kit and application for diagnosing esophageal cancer |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |