CN117164698A

CN117164698A - Pig melatonin receptor MTNR1B and application thereof

Info

Publication number: CN117164698A
Application number: CN202210582917.1A
Authority: CN
Inventors: 刘国世; 李广栋; 阎来庆; 于海颖; 王立凯; 朱天奇; 马文奎; 武海新; 关盛宇; 马骁
Original assignee: China Agricultural University
Current assignee: China Agricultural University
Priority date: 2022-05-26
Filing date: 2022-05-26
Publication date: 2023-12-05

Abstract

The present invention relates to an isolated porcine (Sus scrofa) melatonin receptor MTNR1B protein, the MTNR1B protein having: an amino acid sequence shown as SEQ ID NO. 3; or an amino acid sequence which is capable of binding melatonin by substituting, deleting or adding one or more amino acid residues in the amino acid sequence shown as SEQ ID NO. 3. The invention also relates to a coding gene and application of the MTNR1B protein. The pig (Sus scrofa) melatonin receptor MTNR1B can be applied to pig medicine and livestock production.

Description

Pig melatonin receptor MTNR1B and application thereof

Technical Field

The invention relates to the technical field of genetic engineering, in particular to an isolated pig melatonin receptor MTNR1B and application thereof.

Background

Melatonin (N-acetyl-5-methoxy tryptamine, MT) is also called as "brain platinum", and is an important indole active small molecular substance synthesized and secreted by organs such as pine cone and ovary of mammals, and is widely distributed in a plurality of tissues of animals. Melatonin is a very important endocrine hormone whose synthesis is inhibited by light, exhibiting diurnal, nocturnal rhythmic oscillations, and is therefore also called "dark hormone". Melatonin has a variety of physiological and pharmacological functions, such as improving sleep, regulating biorhythms, relieving stress, regulating the immune system, enhancing immunity, anti-tumor, anti-aging, and the like. In addition, melatonin is also a key reproductive hormone, and directly or indirectly regulates and controls secretion of the reproductive hormone, testis development, follicular development, embryo development, implantation and the like in animal reproductive activities, and also participates in regulating and controlling the estrus cycle of seasonal estrus animals.

Melatonin plays an important physiological role requiring its receptor mediation. Melatonin receptors belong to the G protein-coupled receptor (GPCR) superfamily. Melatonin receptors comprise three members, MTNR1A (also known as MT ₁ ) And MTNR1B (also called MT ₂ ) And a receptor GPR50 having a high degree of sequence homology with MTNR1A and MTNR1B but not binding melatonin or any other known ligand.

However, there is no report on the complete coding region (CDS) of the MTNR1B gene of swine (Sus scrofa), and only part of the mRNA of the MTNR1B gene is in the NCBI database. This results in the primers used being not specific for MTNR1B, and the amplification product may contain both homologous MTNR1A and GPR50, and the quantitative results are inaccurate and prevent the study of melatonin in pigs.

Disclosure of Invention

The present disclosure aims to provide a melatonin receptor MTNR1B protein of pig (Sus scrofa) and a coding gene thereof. The present disclosure specifically provides porcine melatonin receptor MTNR1B protein, and the complete coding region (CDS) of its coding gene.

According to one aspect of the present disclosure, there is provided a protein having: an amino acid sequence shown as SEQ ID NO. 3; or an amino acid sequence which is capable of binding melatonin by substituting, deleting or adding one or more amino acid residues in the amino acid sequence shown as SEQ ID NO. 3.

According to some embodiments, the protein is the porcine melatonin receptor MTNR1B.

According to some embodiments, the protein may be mutated to cysteine (Y241C) at tyrosine 241 of the amino acid sequence shown as SEQ ID NO. 3.

According to some embodiments, the protein may have a tag sequence attached to the N-terminus or the C-terminus. According to specific embodiments, the tag sequence may be selected from, but is not limited to, FLAG, HA, myc, poly-HIS, GST (glutathione-sulfhydryl transferase), strep, aviTag, GFP (green fluorescent protein), eGFP, eCFP, eYFP, MBP (maltose binding protein), halo, SUMO (small molecule ubiquitin-like modification protein), and the like.

According to another aspect of the present disclosure, there is provided a gene encoding an amino acid sequence as shown in SEQ ID NO. 3.

According to some embodiments, the gene is a gene encoding the pig (Sus scrrofa) melatonin receptor MTNR1B.

According to some embodiments, the gene has a nucleic acid sequence as shown in SEQ ID NO. 2. According to some embodiments, the gene has a nucleic acid sequence that hybridizes under stringent conditions to a nucleic acid sequence as set forth in SEQ ID NO. 2. According to some embodiments, the gene of the pig melatonin receptor MTNR1B has a nucleotide sequence having 85% or more, 86% or more, 87% or more, 88% or more, 89% or more, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more sequence identity with the nucleic acid sequence shown in SEQ ID NO 2.

According to some embodiments, the gene has one or more base mutations. According to a specific embodiment, the gene may be mutated from adenine to guanine (A722G) at position 722 of the nucleic acid sequence shown in SEQ ID NO. 2.

According to some embodiments, the gene encodes the complete coding sequence (CDS) of the porcine melatonin receptor MTNR1B.

According to yet another aspect, there is provided an expression vector comprising a gene as described in the present disclosure.

According to some embodiments, the expression vector comprises a gene encoding the porcine (Sus scrofa) melatonin receptor MTNR1B. According to some embodiments, the expression vector comprises a nucleic acid sequence as set forth in SEQ ID NO. 2.

According to some embodiments, the expression vector comprises a nucleic acid sequence that hybridizes under stringent conditions to a nucleic acid sequence as set forth in SEQ ID NO. 2.

According to some embodiments, the expression vector comprises a nucleotide sequence having 85% or more, 86% or more, 87% or more, 88% or more, 89% or more, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or 99% or more sequence identity to the nucleic acid sequence set forth in SEQ ID NO. 2.

According to some embodiments, any one of an enhanced promoter or a constitutive promoter may be added to the expression vector before the nucleotide at which transcription starts. According to some embodiments, the expression vector may further comprise an enhancer, including a translational enhancer or a transcriptional enhancer. These enhancers may be ATG initiation codons or adjacent region initiation codons, etc., but must be in the same reading frame as the coding sequence to ensure proper translation of the entire sequence. The sources of the translational control signals and initiation codons are broad, and can be either natural or synthetic. The translation initiation region may be derived from a transcription initiation region or a structural gene.

According to still another aspect of the present disclosure, there is provided a host cell expressing a swine MTNR1B gene.

According to some embodiments, the host cell comprises an expression vector as described above.

According to some embodiments, the host cell may be a prokaryotic cell or a eukaryotic cell. According to particular embodiments, the host cells may include, but are not limited to, E.coli (E.Coli), yeast cells, PK-15 cells, porcine fetal fibroblast cell lines, porcine ovarian granulosa cell lines, porcine endometrial cell lines, porcine testicular interstitial/supporting cell lines, and porcine peripheral blood mononuclear macrophage lines, among others.

According to still another aspect of the present disclosure, there is provided a primer set for amplifying the above-mentioned swine MTNR1B gene of the present disclosure.

According to some embodiments, the primer set comprises a pair of primers having a Tm difference of <1 ℃. According to some embodiments, the primer set comprises: a nucleic acid sequence as shown in SEQ ID NO. 4; and a nucleic acid sequence as shown in SEQ ID NO. 5.

According to still another aspect of the present disclosure, there is provided a method for amplifying the above-described swine MTNR1B gene of the present disclosure.

According to some embodiments, the method comprises: the swine MTNR1B gene was amplified using Touch-down PCR.

According to some specific embodiments, the Touch-down PCR comprises: pre-denaturation at 98℃for 2min;98℃10s,68℃15s,68℃66s,2 cycles; 98℃10s,67℃15s,68℃66s,2 cycles; 98℃10s,66℃15s,68℃66s,2 cycles; 98℃10s,65℃15s,68℃66s,2 cycles; 98℃10s,64℃15s,68℃66s,2 cycles; 98℃10s,63℃15s,68℃66s,2 cycles; 98℃10s,62℃15s,68℃66s,2 cycles; 98℃10s,61℃15s,68℃66s,2 cycles; 98℃10s,60℃15s,68℃66s,2 cycles; 98℃10s,59℃15s,68℃66s,2 cycles; 98℃10s,58℃15s,68℃66s,2 cycles; 98℃10s,57℃15s,68℃66s,2 cycles; 98℃10s,56℃15s,68℃66s,2 cycles; 98℃10s,55℃15s,68℃66s,10 cycles; and after the circulation is finished, the temperature is maintained at 72 ℃ for 10min.

According to yet another aspect of the present disclosure, the use of the presently disclosed porcine melatonin receptor MTNR1B or a gene encoding the same for modulating melatonin signaling in pigs.

According to some embodiments, the use of the pig melatonin receptor MTNR1B of the present disclosure or a gene encoding the same for modulating immunity, genital hormone secretion, testis development, follicular development, embryo attachment, or estrus cycle in pigs.

The complete CDS of the pig melatonin receptor MTNR1B gene is successfully separated for the first time, and can be used for regulating and controlling the immunity, reproductive hormone secretion, testis development, follicular development, embryo implantation or oestrus cycle of pigs in the animal husbandry, so that the healthy development of the pig industry and the stable supply of pork are promoted.

Drawings

FIG. 1 shows the results of sequence alignment analysis of MTNR1B genes of various species.

FIG. 2 shows the results of a common PCR amplification with six primer pairs having Tm difference of 1℃or more. Wherein M represents a molecular weight marker.

FIG. 3 shows the amplification results when the ordinary PCR procedure was used. Wherein M represents a molecular weight marker.

FIG. 4 shows the amplification results using the Touch-Down PCR method. Wherein M represents a molecular weight marker.

FIG. 5 shows an electropherogram of the swine MTNR1B gene (indicated by the arrow) successfully amplified by the Touch-down PCR method.

Detailed Description

The present invention will be described in further detail with reference to the following examples in order to make the objects, technical solutions and advantages of the present invention more apparent. The specific embodiments described herein are for purposes of illustration only and are not to be construed as limiting the invention in any way. In addition, in the following description, descriptions of well-known structures and techniques are omitted so as not to unnecessarily obscure the concepts of the present disclosure. Such structures and techniques are also described in a number of publications.

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly used in the art to which this invention belongs. For the purposes of explaining the present specification, the following definitions will apply, and terms used in the singular will also include the plural and vice versa, as appropriate.

The terms "a" and "an" as used herein include plural referents unless the context clearly dictates otherwise. For example, reference to "a cell" includes a plurality of such cells, equivalents thereof known to those skilled in the art, and so forth.

The term "about" as used herein means a range of + -20% of the numerical values thereafter. In some embodiments, the term "about" means a range of ±10% of the numerical value following that. In some embodiments, the term "about" means a range of ±5% of the numerical value following that.

The term "stringent conditions" as used herein refers to conditions under which so-called specific hybridization products are formed, and non-specific hybridization products are not formed. For example, the following conditions may be mentioned: after formation of hybridization products in a solution containing 6 XSSC (10 XSSC in a solution containing 1.5M NaCl, 0.15M trisodium citrate) in 50% formamide at 45℃the hybridization products are washed with 2 XSSC at 50℃ (Molecular Biology, john Wiley & Sons, N.Y. (1989), 6.3.1-6.3.6); after hybridization products were formed at 54℃in a solution containing 3 XSSC/0.3 XSSC, the hybridization products were washed with washing solution A (10 XSSC/1% SDS solution), washing solution B (20 XSSC) and washing solution C (5 XSSC) in this order.

Examples and figures are provided below to aid in the understanding of the invention. It is to be understood that these examples and drawings are for illustrative purposes only and are not to be construed as limiting the invention in any way. The actual scope of the invention is set forth in the following claims. It will be understood that any modifications and variations may be made without departing from the spirit of the invention.

Examples

The pine cone tissue of 3 adult large white pigs was collected, and the collected tissue was rapidly placed in a 1.5mL EP tube (which had been DEPC water treated) and placed in a liquid nitrogen tank and then stored in a-80℃refrigerator.

(1) Extraction of Total RNA

(1) All glassware was baked for 6 hours at high temperature and sterilized before the test began. Soaking all EP tubes, gun heads and the like required for extracting RNA in 0.1% DEPC water for 12-18 h, sterilizing at 121 ℃ for 15min under high pressure, and drying in a vacuum drying oven at 60 ℃ for later use. Of particular note are: all steps of RNA extraction operation must be carried out in an RNA-specific working chamber and an RNA-specific ultra-clean working table, all pipetting guns, tips and the like used in the test are special for RNA, and 0.1% DEPC water is required for solution preparation.

(2) Opening a low-temperature high-speed centrifuge in advance to pre-cool the centrifuge at 4 ℃; 75% ethanol for washing RNA was prepared with DEPC water and placed in a refrigerator at 4℃for pre-cooling.

(3) Samples were taken from the-80 ℃ refrigerator and weighed rapidly (about 0.05-0.1 g) and tissue ground using a mortar pre-cooled with liquid nitrogen. The addition of liquid nitrogen is continued intermittently during the milling process until all the bulk tissue is milled to a powder. Then using a medicine spoon to grind the tissues; the powder was transferred to a 1.5mL centrifuge tube (this process requires quick and accurate) and 1mL TRIzol was added ^TM The reagent (Siemens) was shaken for 2-3 min to allow for sufficient cleavage.

(4) 200 mu L of chloroform was added to each sample, the mixture was vigorously shaken and allowed to stand at room temperature for 10min, and the mixture was centrifuged at 12000r/min for 15min at low temperature and at 4℃to aspirate the supernatant.

(5) Adding equal volume of isopropanol, repeatedly reversing and mixing, standing at room temperature for 10min, centrifuging at 12000r/min for 15min at low temperature, and discarding supernatant to obtain precipitate at the bottom of the tube.

(6) 500 μL of 75% pre-chilled alcohol was added, the pellet carefully washed, centrifuged at 7500r/min for 5min at low temperature, and the ethanol was discarded.

(7) Repeating the step (6) once.

(8) Placing the precipitate in a ventilation place, volatilizing excessive alcohol, and processing for about 12min until the precipitate turns from white to near transparent. Then 30. Mu.L of DEPC water was added to dissolve the precipitate. The total RNA purity was then checked with NanoDrop (Thermo Fisher Scientific).

(2) Reverse transcription of RNA

The genome in the RNA was removed and reverse transcribed using a kit PrimeScript RT reagent Kit with gDNA Eraser (Perfect Real Time) available from Takara. Specifically, 2. Mu.L of 5 XgDNA Eraser, 1. Mu. L gDNA Eraser Buffer, 1. Mu.L of DEPC water, 6. Mu.L of RNA were taken and the above-mentioned bodies were subjected to the reactionPlacing the mixture into a PCR instrument for reaction for 2min at 42 ℃; then 4. Mu.L was addedBuffer 2、1μL/>RT Enzyme Mix I, 1 mu L RT Primer Mix, 4 mu LDEPC water, and the reaction is carried out for 20min at 37 ℃ and 5s at 85 ℃ in a PCR instrument to obtain cDNA, and the cDNA is preserved at-20 ℃.

(3) Primer design and Synthesis

MTNR1B gene sequences from multiple species were analyzed using UCSC (http:// genome-asia. UCSC. Edu /) database. As a result, it was found that MTNR1B genes of sheep (Ovis aries), human (Homo sapiens), cow (Bos taurus), rat (Rattus norvegicus), mouse (Mus musculus), cynomolgus monkey (Macaca fascicularis), zebra fish (Danio rerio), dog fish (Esox reicherti) and chicken (Gallus gallus domesticus) each contained two exons, namely exon 1 and exon 2. As shown in square in fig. 1. Whereas mRNA (XM_ 021063941.1) of the MTNR1B gene of swine (Sus scrofa) given in the gene library of NCBI corresponds only to exon 2 of the MTNR1B gene of the above species, with the deletion of exon 1 being incomplete.

Further, referring to the sequence information of NCBI, the CDS region of the swine MTNR1B gene was predicted, and six sets of primer pairs (synthesized by Beijing Bio Inc.) having a Tm difference of 1℃or more across the complete CDS region of the swine MTNR1B gene were designed for the predicted ENSSSCT00000016297.3 sequence, as shown in Table 1 below. The following amplification procedure was used: 2min of pre-denaturation at 98 ℃,10 s at 98 ℃, 15s at 60 ℃,65 s at 68 ℃ and 35 cycles; after the cycle was completed, the mixture was stored at 72℃for 10min and 4 ℃.

Table 1.

Primer pair	Forward primer	Reverse primer
			1	CGCCACGGTCCAC(SEQ ID NO:6)	ATTGTCGCCCAGT(SEQ ID NO:7)
2	CCACGGTCCACGATGC(SEQ ID NO:8)	CAGGTTCACTCCCACCATCGC(SEQ ID NO:9)
			3	CGCCACGGTCCACGAT(SEQ ID NO:10)	ATTGTCGCCCAGTCAGT(SEQ ID NO:11)
4	CGCCACGGTCCAC(SEQ ID NO:12)	GTATCTGCCCCAACAGG(SEQ ID NO:13)
			5	CGCCACGGTCCA(SEQ ID NO:14)	CTGCCCGATCCTG(SEQ ID NO:15)
6	CGCCACGGTCCA(SEQ ID NO:16)	ATTGTCGCCCAGT(SEQ ID NO:17)

The amplification results are shown in FIG. 2, and it was found that none of the six primer sets described above yielded the target amplification product.

Further screening the parameters of the primer, setting the length between 15 and 30bp, GC content between 50% and 75%, and Tm difference <1 ℃. The upper and lower primers cross the complete CDS region of the swine MTNR1B gene.

The amplification of the MTNR1B gene was performed by the following PCR procedure using different annealing temperatures using primer set 1.

Sample 1: 2min of pre-denaturation at 98 ℃,10 s at 98 ℃, 15s at 70 ℃,65 s at 68 ℃ and 35 cycles; after the cycle was completed, the mixture was stored at 72℃for 10min and 4 ℃.

Sample 2: 2min of pre-denaturation at 98 ℃,10 s at 98 ℃, 15s at 69 ℃,65 s at 68 ℃ and 35 cycles; after the cycle was completed, the mixture was stored at 72℃for 10min and 4 ℃.

Sample 3: 2min of pre-denaturation at 98 ℃,10 s at 98 ℃, 15s at 68 ℃,65 s at 68 ℃ and 35 cycles; after the cycle was completed, the mixture was stored at 72℃for 10min and 4 ℃.

Sample 4: 2min of pre-denaturation at 98 ℃,10 s at 98 ℃, 15s at 67 ℃,65 s at 68 ℃ and 35 cycles; after the cycle was completed, the mixture was stored at 72℃for 10min and 4 ℃.

Sample 5: 2min of pre-denaturation at 98 ℃,10 s at 98 ℃, 15s at 66 ℃,65 s at 68 ℃ and 35 cycles; after the cycle was completed, the mixture was stored at 72℃for 10min and 4 ℃.

Sample 6: 2min of pre-denaturation at 98 ℃,10 s at 98 ℃, 15s at 65 ℃,65 s at 68 ℃ and 35 cycles; after the cycle was completed, the mixture was stored at 72℃for 10min and 4 ℃.

Sample 7: 2min of pre-denaturation at 98 ℃,10 s at 98 ℃, 15s at 64 ℃,65 s at 68 ℃ and 35 cycles; after the cycle was completed, the mixture was stored at 72℃for 10min and 4 ℃.

Sample 8: 2min of pre-denaturation at 98 ℃,10 s at 98 ℃, 15s at 63 ℃,65 s at 68 ℃ and 35 cycles; after the cycle was completed, the mixture was stored at 72℃for 10min and 4 ℃.

Sample 9: 2min of pre-denaturation at 98 ℃,10 s at 98 ℃, 15s at 62 ℃,65 s at 68 ℃ and 35 cycles; after the cycle was completed, the mixture was stored at 72℃for 10min and 4 ℃.

Sample 10: 2min of pre-denaturation at 98 ℃,10 s at 98 ℃, 15s at 61 ℃,65 s at 68 ℃ and 35 cycles; after the cycle was completed, the mixture was stored at 72℃for 10min and 4 ℃.

The PCR products were analyzed by electrophoresis, and the results are shown in FIG. 3. Lanes 1-10 in FIG. 3 correspond to samples 1-10, respectively, and it can be seen that none of the target products were amplified by the conventional PCR procedure.

Further, the GC content of the ENSSSCT00000016297.3 sequence was analyzed by using the online website bisoxyz (http:// www.bioxyz.net/GC-content/index. Html), and the GC content of the first exon of the MTNR1B gene was found to be very high, and the local GC content even reached 90%. It is speculated that its high GC content resulted in failure of the normal PCR amplification. Thus, the amplification procedure was optimized, using Touch-down PCR, while using specific primer pairs:

forward primer: 5'-CGCGCCACGGTCCACGA-3' (SEQ ID NO: 4);

reverse primer: 5'-AGGTTCACTCCCACCATCGCAT-3' (SEQ ID NO: 5).

Different Touch-down PCR amplification parameters were tried. The results of electrophoresis of 7 Touch-down PCR amplification products using different parameters are shown in FIG. 4. Lanes 1-7 also show FIG. 4, in which none of the target products was amplified. Lanes 1-7 each used the following Touch-Down PCR program.

Lane 1: 2min of pre-denaturation at 98 ℃,10 s at 98 ℃, 15s at 68 ℃ and 66s at 68 ℃ for 3 cycles; 98℃10s,67℃15s,68℃66s,3 cycles; 98℃10s,66℃15s,68℃66s,3 cycles; 98℃10s,65℃15s,68℃66s,3 cycles; 98℃10s,64℃15s,68℃66s,3 cycles; 98℃10s,63℃15s,68℃66s,3 cycles; 98℃10s,62℃15s,68℃66s,3 cycles; 98℃10s,61℃15s,68℃66s,3 cycles; 98℃10s,60℃15s,68℃66s,3 cycles; 98℃10s,59℃15s,68℃66s,3 cycles; 98℃10s,58℃15s,68℃66s,5 cycles; after the cycle was completed, the mixture was stored at 72℃for 10min and 4 ℃.

Lane 2: 2min of pre-denaturation at 98 ℃,10 s at 98 ℃, 15s at 68 ℃,66 s at 68 ℃ and 1 cycle; 98℃10s,67℃15s,68℃66s,1 cycle; 98℃10s,66℃15s,68℃66s,1 cycle; 98℃10s,65℃15s,68℃66s,1 cycle; 98℃10s,64℃15s,68℃66s,1 cycle; 98℃10s,63℃15s,68℃66s,1 cycle; 98℃10s,62℃15s,68℃66s,1 cycle; 98℃10s,61℃15s,68℃66s,1 cycle; 98℃10s,60℃15s,68℃66s,1 cycle; 98℃10s,59℃15s,68℃66s,1 cycle; 98℃10s,58℃15s,68℃66s,1 cycle; 98℃10s,57℃15s,68℃66s,1 cycle; 98℃10s,56℃15s,68℃66s,1 cycle; 98℃10s,55℃15s,68℃66s,22 cycles; after the cycle was completed, the mixture was stored at 72℃for 10min and 4 ℃.

Lane 3: 2min of pre-denaturation at 98 ℃,10 s at 98 ℃, 15s at 68 ℃ and 65s at 68 ℃ for 3 cycles; 98℃10s,67℃15s,68℃65s,3 cycles; 98℃10s,66℃15s,68℃65s,3 cycles; 98℃10s,65℃15s,68℃65s,3 cycles; 98℃10s,64℃15s,68℃65s,3 cycles; 98℃10s,63℃15s,68℃65s,3 cycles; 98℃10s,62℃15s,68℃65s,3 cycles; 98℃10s,61℃15s,68℃65s,3 cycles; 98℃10s,60℃15s,68℃65s,3 cycles; 98℃10s,59℃15s,68℃65s,3 cycles; 98℃10s,58℃15s,68℃65s,5 cycles; after the cycle was completed, the mixture was stored at 72℃for 10min and 4 ℃.

Lane 4: 2 cycles of pre-denaturation at 98℃for 2min, 10s at 98℃for 15s at 68℃for 65s at 68 ℃;98℃10s,67℃15s,68℃65s,2 cycles; 98℃10s,66℃15s,68℃65s,2 cycles; 98℃10s,65℃15s,68℃65s,2 cycles; 98℃10s,64℃15s,68℃65s,2 cycles; 98℃10s,63℃15s,68℃65s,2 cycles; 98℃10s,62℃15s,68℃65s,2 cycles; 98℃10s,61℃15s,68℃65s,2 cycles; 98℃10s,60℃15s,68℃65s,2 cycles; 98℃10s,59℃15s,68℃65s,2 cycles; 98℃10s,58℃15s,68℃65s,2 cycles; 98℃10s,57℃15s,68℃65s,2 cycles; 98℃10s,56℃15s,68℃65s,2 cycles; 98℃10s,55℃15s,68℃65s,10 cycles; after the cycle was completed, the mixture was stored at 72℃for 10min and 4 ℃.

Lane 5: 2min of pre-denaturation at 98 ℃,10 s at 98 ℃, 15s at 68 ℃,65 s at 68 ℃ and 1 cycle; 98℃10s,67℃15s,68℃65s,1 cycle; 98℃10s,66℃15s,68℃65s,1 cycle; 98℃10s,65℃15s,68℃65s,1 cycle; 98℃10s,64℃15s,68℃65s,1 cycle; 98℃10s,63℃15s,68℃65s,1 cycle; 98℃10s,62℃15s,68℃65s,1 cycle; 98℃10s,61℃15s,68℃65s,1 cycle; 98℃10s,60℃15s,68℃65s,1 cycle; 98℃10s,59℃15s,68℃65s,1 cycle; 98℃10s,58℃15s,68℃65s,1 cycle; 98℃10s,57℃15s,68℃65s,1 cycle; 98℃10s,56℃15s,68℃65s,1 cycle; 98℃10s,55℃15s,68℃65s,22 cycles; after the cycle was completed, the mixture was stored at 72℃for 10min and 4 ℃.

Lane 6: 2min of pre-denaturation at 98 ℃,10 s at 98 ℃, 15s at 68 ℃ and 64s at 68 ℃ for 3 cycles; 98℃10s,67℃15s,68℃64s,3 cycles; 98℃10s,66℃15s,68℃64s,3 cycles; 98℃10s,65℃15s,68℃64s,3 cycles; 98℃10s,64℃15s,68℃64s,3 cycles; 98℃10s,63℃15s,68℃64s,3 cycles; 98℃10s,62℃15s,68℃64s,3 cycles; 98℃10s,61℃15s,68℃64s,3 cycles; 98℃10s,60℃15s,68℃64s,3 cycles; 98℃10s,59℃15s,68℃64s,3 cycles; 98℃10s,58℃15s,68℃64s,5 cycles; after the cycle was completed, the mixture was stored at 72℃for 10min and 4 ℃.

Lane 7: 2 cycles of pre-denaturation at 98℃for 2min, 10s at 98℃for 15s at 68℃for 64s at 68 ℃;98℃10s,67℃15s,68℃64s,2 cycles; 98℃10s,66℃15s,68℃64s,2 cycles; 98℃10s,65℃15s,68℃64s,2 cycles; 98℃10s,64℃15s,68℃64s,2 cycles; 98℃10s,63℃15s,68℃64s,2 cycles; 98℃10s,62℃15s,68℃64s,2 cycles; 98℃10s,61℃15s,68℃64s,2 cycles; 98℃10s,60℃15s,68℃64s,2 cycles; 98℃10s,59℃15s,68℃64s,2 cycles; 98℃10s,58℃15s,68℃64s,2 cycles; 98℃10s,57℃15s,68℃64s,2 cycles; 98℃10s,56℃15s,68℃64s,2 cycles; 98℃10s,55℃15s,68℃64s,10 cycles; after the cycle was completed, the mixture was stored at 72℃for 10min and 4 ℃.

Finally, the following Touch-Down PCR amplification procedure was used to successfully amplify a PCR product of approximately 1160bp, as shown in FIG. 5.

Pre-denaturation at 98℃for 2min;

98℃10s,68℃15s,68℃66s,2 cycles;

98℃10s,67℃15s,68℃66s,2 cycles;

98℃10s,66℃15s,68℃66s,2 cycles;

98℃10s,65℃15s,68℃66s,2 cycles;

98℃10s,64℃15s,68℃66s,2 cycles;

98℃10s,63℃15s,68℃66s,2 cycles;

98℃10s,62℃15s,68℃66s,2 cycles;

98℃10s,61℃15s,68℃66s,2 cycles;

98℃10s,60℃15s,68℃66s,2 cycles;

98℃10s,59℃15s,68℃66s,2 cycles;

98℃10s,58℃15s,68℃66s,2 cycles;

98℃10s,57℃15s,68℃66s,2 cycles;

98℃10s,56℃15s,68℃66s,2 cycles;

98℃10s,55℃15s,68℃66s,10 cycles;

after the cycle was completed, the temperature was 72℃for 10min.

The PCR product contained the complete CDS of the swine MTNR1B gene, as well as the sequences of part of the 5 'and 3' untranslated regions. The cloned PCR product sequence was subjected to Sanger sequencing, the sequence of which is shown in SEQ ID NO. 1. It can be seen that the 23 rd to 25 th bases of the amplified PCR product are the translation initiation codon ATG and the 1115 th to 1117 th bases are the translation termination codon TAG. That is, the present invention amplified the complete CDS region (SEQ ID NO: 2) of swine MTNR1B for the first time, and the corresponding amino acid sequence was shown as SEQ ID NO: 3.

In addition, the sequence of the PCR product was compared with a part of mRNA of swine MTNR1B in NCBI gene library, XM_021063941.1, and it was found that there was 99% sequence uniformity, and that the actually amplified nucleotide at position 722 (starting from the initiation codon ATG) of CDS of swine MTNR1B was subjected to G > A mutation, resulting in amino acid change from cysteine to tyrosine (C > Y).

While the invention has been described in detail in the foregoing general description, embodiments and experiments, it will be apparent to those skilled in the art that modifications and improvements can be made thereto. Accordingly, such modifications or improvements may be made without departing from the spirit of the invention and are intended to be within the scope of the invention as claimed.

Sequence listing

<110> Chinese university of agriculture

<120> pig melatonin receptor MTNR1B and application thereof

<141> 2022-05-26

<160> 17

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1177

<212> DNA

<213> Sus scrofa

<400> 1

gcccttcgcg ccacggtcca cgatgccgga gaacggctcc ttcgccaact gctgcgaggc 60

gggcggccta gcggagcacc cgggatggct aggggcgggc gacgcgccgc cctccaggac 120

cccccggcct ccctgggtgg cgcccgcgct gtcggctgtg ctcatcgtca ccaccgcggt 180

ggatatcgtg ggcaacctcc tggtcatcct ctcggtgctc gggaaccgca aactccggaa 240

cgcaggtaac ttgttcttgg tgagtctggc cttggccgac ctggtggtgg ccttgtaccc 300

ttacccacta gtcctcgtgg ccatcttcca ggacggctgg gcccaggggg aggtgcactg 360

caaggccagt gcctttgtga tgggcctgag cgtcattggc tccgtcttca acatcactgc 420

catcgccatt aaccgctact gctacatctg ccacagcctg gcctaccacc gcctctgccg 480

ccgctggcac acccccctct acatctgcct ggtctggctg ctcaccctgg cagccctggt 540

gcccaacttc ttcgtggggt ccctggagta cgacccgcgc atctactcct gcaccttcgt 600

ccagacggcc agcgcccggt acacgggggc agtggtggcc gtccacttcc tccttcccat 660

ggcggtcgtg tgcttctgtt acctgcgcat ctgggtgctg gtgctccggg cccgcaggaa 720

ggtcaagtcg gacaacaagc tgtaccccag gtccagcaac gtccggagct tcctgagcat 780

gttcgtggtg ttcgtgatct tcgccgtctg ctgggcgccg ctgaactgca tcggcctcgc 840

cgtggccgtc aacccagaag cagtggctcc ccaagtcccc gaggggctct tcgttgctag 900

ctactacctg gcttatttca atagctgcct taacgccatc atctatgggc tcctgaacca 960

gaacttccgc agggaattcc agaagatcat ctctgccctc tggaacccac ggcgctgcat 1020

gcaggactct tccaagggca gccaggccga ggggccagag agccaagctc tccccgaggt 1080

tagcgcccag cgccctgttg gggcagatac tctgtagagc gctcactgac tgggcgacaa 1140

tctcatgcga tggtgggagt gaacctaagg gcgacac 1177

<210> 2

<211> 1095

<212> DNA

<213> Sus scrofa

<400> 2

atgccggaga acggctcctt cgccaactgc tgcgaggcgg gcggcctagc ggagcacccg 60

ggatggctag gggcgggcga cgcgccgccc tccaggaccc cccggcctcc ctgggtggcg 120

cccgcgctgt cggctgtgct catcgtcacc accgcggtgg atatcgtggg caacctcctg 180

gtcatcctct cggtgctcgg gaaccgcaaa ctccggaacg caggtaactt gttcttggtg 240

agtctggcct tggccgacct ggtggtggcc ttgtaccctt acccactagt cctcgtggcc 300

atcttccagg acggctgggc ccagggggag gtgcactgca aggccagtgc ctttgtgatg 360

ggcctgagcg tcattggctc cgtcttcaac atcactgcca tcgccattaa ccgctactgc 420

tacatctgcc acagcctggc ctaccaccgc ctctgccgcc gctggcacac ccccctctac 480

atctgcctgg tctggctgct caccctggca gccctggtgc ccaacttctt cgtggggtcc 540

ctggagtacg acccgcgcat ctactcctgc accttcgtcc agacggccag cgcccggtac 600

acgggggcag tggtggccgt ccacttcctc cttcccatgg cggtcgtgtg cttctgttac 660

ctgcgcatct gggtgctggt gctccgggcc cgcaggaagg tcaagtcgga caacaagctg 720

taccccaggt ccagcaacgt ccggagcttc ctgagcatgt tcgtggtgtt cgtgatcttc 780

gccgtctgct gggcgccgct gaactgcatc ggcctcgccg tggccgtcaa cccagaagca 840

gtggctcccc aagtccccga ggggctcttc gttgctagct actacctggc ttatttcaat 900

agctgcctta acgccatcat ctatgggctc ctgaaccaga acttccgcag ggaattccag 960

aagatcatct ctgccctctg gaacccacgg cgctgcatgc aggactcttc caagggcagc 1020

caggccgagg ggccagagag ccaagctctc cccgaggtta gcgcccagcg ccctgttggg 1080

gcagatactc tgtag 1095

<210> 3

<211> 364

<212> PRT

<213> Sus scrofa

<400> 3

Met Pro Glu Asn Gly Ser Phe Ala Asn Cys Cys Glu Ala Gly Gly Leu

1 5 10 15

Ala Glu His Pro Gly Trp Leu Gly Ala Gly Asp Ala Pro Pro Ser Arg

20 25 30

Thr Pro Arg Pro Pro Trp Val Ala Pro Ala Leu Ser Ala Val Leu Ile

35 40 45

Val Thr Thr Ala Val Asp Ile Val Gly Asn Leu Leu Val Ile Leu Ser

50 55 60

Val Leu Gly Asn Arg Lys Leu Arg Asn Ala Gly Asn Leu Phe Leu Val

65 70 75 80

Ser Leu Ala Leu Ala Asp Leu Val Val Ala Leu Tyr Pro Tyr Pro Leu

85 90 95

Val Leu Val Ala Ile Phe Gln Asp Gly Trp Ala Gln Gly Glu Val His

100 105 110

Cys Lys Ala Ser Ala Phe Val Met Gly Leu Ser Val Ile Gly Ser Val

115 120 125

Phe Asn Ile Thr Ala Ile Ala Ile Asn Arg Tyr Cys Tyr Ile Cys His

130 135 140

Ser Leu Ala Tyr His Arg Leu Cys Arg Arg Trp His Thr Pro Leu Tyr

145 150 155 160

Ile Cys Leu Val Trp Leu Leu Thr Leu Ala Ala Leu Val Pro Asn Phe

165 170 175

Phe Val Gly Ser Leu Glu Tyr Asp Pro Arg Ile Tyr Ser Cys Thr Phe

180 185 190

Val Gln Thr Ala Ser Ala Arg Tyr Thr Gly Ala Val Val Ala Val His

195 200 205

Phe Leu Leu Pro Met Ala Val Val Cys Phe Cys Tyr Leu Arg Ile Trp

210 215 220

Val Leu Val Leu Arg Ala Arg Arg Lys Val Lys Ser Asp Asn Lys Leu

225 230 235 240

Tyr Pro Arg Ser Ser Asn Val Arg Ser Phe Leu Ser Met Phe Val Val

245 250 255

Phe Val Ile Phe Ala Val Cys Trp Ala Pro Leu Asn Cys Ile Gly Leu

260 265 270

Ala Val Ala Val Asn Pro Glu Ala Val Ala Pro Gln Val Pro Glu Gly

275 280 285

Leu Phe Val Ala Ser Tyr Tyr Leu Ala Tyr Phe Asn Ser Cys Leu Asn

290 295 300

Ala Ile Ile Tyr Gly Leu Leu Asn Gln Asn Phe Arg Arg Glu Phe Gln

305 310 315 320

Lys Ile Ile Ser Ala Leu Trp Asn Pro Arg Arg Cys Met Gln Asp Ser

325 330 335

Ser Lys Gly Ser Gln Ala Glu Gly Pro Glu Ser Gln Ala Leu Pro Glu

340 345 350

Val Ser Ala Gln Arg Pro Val Gly Ala Asp Thr Leu

355 360

<210> 4

<211> 17

<212> DNA

<213> Artificial Sequence

<400> 4

cgcgccacgg tccacga 17

<210> 5

<211> 22

<212> DNA

<213> Artificial Sequence

<400> 5

aggttcactc ccaccatcgc at 22

<210> 6

<211> 13

<212> DNA

<213> Artificial Sequence

<400> 6

cgccacggtc cac 13

<210> 7

<211> 13

<212> DNA

<213> Artificial Sequence

<400> 7

attgtcgccc agt 13

<210> 8

<211> 16

<212> DNA

<213> Artificial Sequence

<400> 8

ccacggtcca cgatgc 16

<210> 9

<211> 21

<212> DNA

<213> Artificial Sequence

<400> 9

caggttcact cccaccatcg c 21

<210> 10

<211> 16

<212> DNA

<213> Artificial Sequence

<400> 10

cgccacggtc cacgat 16

<210> 11

<211> 17

<212> DNA

<213> Artificial Sequence

<400> 11

attgtcgccc agtcagt 17

<210> 12

<211> 13

<212> DNA

<213> Artificial Sequence

<400> 12

cgccacggtc cac 13

<210> 13

<211> 17

<212> DNA

<213> Artificial Sequence

<400> 13

gtatctgccc caacagg 17

<210> 14

<211> 12

<212> DNA

<213> Artificial Sequence

<400> 14

cgccacggtc ca 12

<210> 15

<211> 13

<212> DNA

<213> Artificial Sequence

<400> 15

ctgcccgatc ctg 13

<210> 16

<211> 12

<212> DNA

<213> Artificial Sequence

<400> 16

cgccacggtc ca 12

<210> 17

<211> 13

<212> DNA

<213> Artificial Sequence

<400> 17

attgtcgccc agt 13

Claims

1. A protein, characterized in that the protein has: an amino acid sequence shown as SEQ ID NO. 3; or an amino acid sequence which is capable of binding melatonin by substituting, deleting or adding one or more amino acid residues in the amino acid sequence shown as SEQ ID NO. 3.

2. The protein according to claim 1, wherein the protein is porcine (Sus scrofa) melatonin receptor MTNR1B,

preferably, tyrosine 241 of the amino acid sequence shown in SEQ ID NO. 3 is mutated to cysteine.

3. A gene is characterized in that the gene codes for an amino acid sequence shown as SEQ ID NO. 3.

4. A gene according to claim 3, wherein the gene encodes a pig (Sus scrrofa) melatonin receptor MTNR1B gene.

5. The gene according to claim 3 or 4, characterized in that it has: a nucleic acid sequence as shown in SEQ ID NO. 2; a nucleic acid sequence which hybridizes under stringent conditions to a nucleic acid sequence as set forth in SEQ ID NO. 2; alternatively, a nucleotide sequence having 85% or more, 86% or more, 87% or more, 88% or more, 89% or more, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or 99% or more sequence identity with the nucleic acid sequence represented by SEQ ID NO. 2,

preferably, adenine at position 722 of the nucleic acid sequence shown in SEQ ID NO. 2 is mutated to guanine.

6. An expression vector comprising the gene of any one of claims 3 to 5.

7. A host cell expressing a gene according to any one of claims 3 to 5.

8. The host cell of claim 7, wherein the host cell is selected from the group consisting of escherichia coli (e.coli), yeast cells, PK-15 cells, porcine fetal fibroblast cell lines, porcine ovarian granulosa cell lines, porcine endometrial cell lines, porcine testicular interstitial/supporting cell lines, and porcine peripheral blood mononuclear macrophage lines.

9. A method for amplifying a gene according to claim 3, wherein the method uses a primer pair having a Tm difference of <1 ℃,

preferably, the primer pair comprises: a nucleic acid sequence as shown in SEQ ID NO. 4; and a nucleic acid sequence as shown in SEQ ID NO. 5.

10. Use of a protein according to claim 1 or 2 or a gene according to any one of claims 3 to 5 for modulating melatonin signaling in a pig, preferably for modulating immunity, testis development, follicular development, embryo implantation or estrus cycle in a pig.