CN117106968A - Primer group and kit for identifying female strength of cucumber and application of primer group and kit - Google Patents

Primer group and kit for identifying female strength of cucumber and application of primer group and kit Download PDF

Info

Publication number
CN117106968A
CN117106968A CN202311353549.4A CN202311353549A CN117106968A CN 117106968 A CN117106968 A CN 117106968A CN 202311353549 A CN202311353549 A CN 202311353549A CN 117106968 A CN117106968 A CN 117106968A
Authority
CN
China
Prior art keywords
general
cucumber
north china
female
offspring
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202311353549.4A
Other languages
Chinese (zh)
Inventor
毛爱军
温常龙
王航
张建
杨静静
罗江
张成栋
黄继君
张晓飞
夏昌选
赵泓
田守蔚
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Beijing Academy of Agriculture and Forestry Sciences
Original Assignee
Beijing Academy of Agriculture and Forestry Sciences
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Beijing Academy of Agriculture and Forestry Sciences filed Critical Beijing Academy of Agriculture and Forestry Sciences
Priority to CN202311353549.4A priority Critical patent/CN117106968A/en
Publication of CN117106968A publication Critical patent/CN117106968A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6851—Quantitative amplification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/13—Plant traits
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
    • Y02A40/80—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in fisheries management
    • Y02A40/81—Aquaculture, e.g. of fish

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Immunology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Botany (AREA)
  • Mycology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention relates to the technical field of biology, in particular to a primer group and a kit for identifying female strength of cucumber and application thereof. The primer group provided by the invention can be used for early identification in the seed or seedling stage of cucumbers, is used for identifying female strength of north China dense thorn type cucumber materials, especially hybrid first-generation varieties, and provides technical support for accelerating breeding of female and full female north China dense thorn type cucumber materials. In addition, the detection method provided by the invention has the advantages of high flux, accuracy, low cost, simplicity in operation and labor and time saving, and has a very wide application prospect.

Description

Primer group and kit for identifying female strength of cucumber and application of primer group and kit
Technical Field
The invention relates to the technical field of biology, in particular to a primer group and a kit for identifying female strength of cucumber and application thereof.
Background
North China dense thorn type cucumber is the variety with the largest production and consumption of cucumber in China, and plays an important role in vegetable production and supply guarantee. The hybrid generation commercial varieties of the North China dense thorn type cucumbers in the market in China are mostly hermaphroditic common types with female flowers and male flowers, and in recent years, the strong female and full female North China dense thorn type cucumbers with female flowers and little or no male flowers are favored by the market due to high yield, high seed production purity and low cost. However, means and primers for rapidly and accurately detecting female strength of the hybrid generation commercial varieties and strains of the North China dense thorn type cucumbers at present are lacking, and identification and breeding of the North China dense thorn type cucumbers with strong female and full female type are severely restricted.
Disclosure of Invention
In order to solve the problems, the invention provides a primer group and a kit for identifying female strength of cucumbers and application thereof. The primer group provided by the invention can be used for rapidly and accurately detecting female strength of the north China thorn type cucumber, and has a very wide application prospect.
In order to achieve the above object, the present invention provides the following technical solutions:
the invention provides a primer group for identifying cucumber sex type, which comprises a first primer pair and a second primer pair; the nucleotide sequence of the forward primer of the first primer pair is shown as SEQ ID NO.1, and the nucleotide sequence of the reverse primer of the first primer pair is shown as SEQ ID NO. 2; the nucleotide sequence of the forward primer of the second primer pair is shown as SEQ ID NO.3, and the nucleotide sequence of the reverse primer of the second primer pair is shown as SEQ ID NO. 4.
The invention provides a kit for identifying cucumber sex types, which comprises the primer set according to the technical scheme.
Preferably, the kit further comprises other reagents for PCR amplification.
Preferably, the other agents include 2X SYBR Premix Ex Taq and ddH 2 O。
The invention provides application of the primer set or the kit in the technical scheme in identifying cucumber sex types.
Preferably, the cucumber variety comprises a north China dense thorn type cucumber.
The invention provides a method for identifying cucumber sex types, which comprises the following steps:
taking genomic DNA of cucumber to be detected as a template, respectively carrying out real-time fluorescent quantitative PCR amplification by using a first primer pair and a second primer pair in the primer group in the technical scheme, and subtracting the Ct value amplified by the second primer pair from the Ct value amplified by the first primer pair to obtain delta Ct;
at 2 -ΔCt The value judges the shape of the cucumber to be tested, and the judgment comprises the following steps:
when 0.85< 2 -ΔCt <1.15, judging that the model is of a general type;
when 2 -ΔCt >1.35, the female type was judged.
Preferably, when 1.35< 2 -ΔCt <1.65, judging as strong female; when 2 -ΔCt >1.85, the whole female type was judged.
Preferably, the varieties of the cucumbers to be tested comprise north China dense thorn cucumbers.
The beneficial effects are that:
the invention provides a primer group for identifying cucumber sex type, which comprises a first primer pair and a second primer pair; the nucleotide sequence of the forward primer of the first primer pair is shown as SEQ ID NO.1, and the nucleotide sequence of the reverse primer of the first primer pair is shown as SEQ ID NO. 2; the nucleotide sequence of the forward primer of the second primer pair is shown as SEQ ID NO.3, and the nucleotide sequence of the reverse primer of the second primer pair is shown as SEQ ID NO. 4. The primer group provided by the invention can be used for early identification in the seed or seedling stage of cucumbers, is used for identifying female strength of north China dense thorn type cucumber materials, especially hybrid first-generation varieties, and provides technical support for accelerating breeding of female and full female north China dense thorn type cucumber materials. In addition, the detection method provided by the invention has the advantages of high flux, accuracy, low cost, simplicity in operation and labor and time saving, and has a very wide application prospect.
Drawings
In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings that are required to be used in the embodiments will be briefly described below.
FIG. 1 shows the results of a 20-fold re-sequencing of the correlation analysis of the North China dense thorn type cucumber genotype with female phenotype.
Detailed Description
The invention provides a primer group for identifying cucumber sex type, which comprises a first primer pair and a second primer pair; the nucleotide sequence of the forward primer of the first primer pair is shown as SEQ ID NO.1, and the nucleotide sequence of the reverse primer of the first primer pair is shown as SEQ ID NO. 2; the nucleotide sequence of the forward primer of the second primer pair is shown as SEQ ID NO.3, and the nucleotide sequence of the reverse primer of the second primer pair is shown as SEQ ID NO. 4. The first primer pair can specifically amplify the fragment of a female related gene (branched amino acid transaminase coding gene) of the cucumber, the second primer pair can specifically amplify the fragment of an internal reference gene related to the cucumber sex type, the sex type of the cucumber can be judged according to the relative copy number of the female related gene in the cucumber material to be detected, namely delta Ct=Ct (female related gene) -Ct (internal reference gene), the early identification can be carried out in the seed or seedling stage of the cucumber, and the method is used for identifying the female intensity of the cucumber material, particularly the hybrid generation variety, and provides technical support for accelerating the breeding of the strong female and full female type North China dense thorn cucumber material.
The invention also provides a kit for identifying cucumber sex types, which comprises the primer set according to the technical scheme. In the present invention, the kit preferably further comprises other reagents for PCR amplification; the PCR is preferably real-time fluorescent quantitative PCR; the other reagents preferably include 2X SYBR Premix Ex Taq and ddH 2 O。
The invention also provides application of the primer set or the kit in the technical scheme in identifying cucumber sex types. In the present invention, the variety of cucumber preferably includes a north China thorn type cucumber.
The invention also provides a method for identifying cucumber sex types, which comprises the following steps:
taking genomic DNA of cucumber to be detected as a template, respectively carrying out real-time fluorescent quantitative PCR amplification by using a first primer pair and a second primer pair in the primer group in the technical scheme, and subtracting the Ct value amplified by the second primer pair from the Ct value amplified by the first primer pair to obtain delta Ct; at 2 -ΔCt The value judges the shape of the cucumber to be tested, and the judgment comprises the following steps: when 0.85< 2 -ΔCt <1.15, judging that the model is of a general type; when 2 -ΔCt >1.35, the female type was judged.
In the present invention, the ratio of 2 -ΔCt The determination of the value determination of the sex form of the cucumber to be measured preferably further comprises: when 1.35< 2 -ΔCt <1.65, judging as strong female; when 2 -ΔCt >1.85, the whole female type was judged.
In the present embodiment, since it is recognized that the Δct of the north China dense thorn type cucumber pattern material 9930 is close to 0, the correction is not performed with 9930 at the time of the authentication. In order to further improve the identification accuracy, the invention preferably uses the genome DNA of the north China thorn type cucumber pattern material 9930 which is recognized as the common type as a template, and respectively carries out real-time fluorescence quantitative PCR amplification by utilizing the first primer pair and the second primer pair in the primer group in the technical scheme,subtracting the Ct value amplified by the second primer pair from the Ct value amplified by the first primer pair to obtain a delta Ct (9930); at 2 -ΔCt+ΔCt(9930) The value determines the shape of the cucumber to be tested, said determination preferably comprising: when 0.85< 2 -ΔCt+ΔCt(9930) <1.15, judging that the model is of a general type; when 2 -ΔCt+ΔCt(9930) >1.35, judging that the female type is obtained; when 1.35< 2 -ΔCt+ΔCt(9930) <1.65, judging as strong female; when 2 -ΔCt+ΔCt(9930) >1.85, the whole female type was judged.
The genotyping criteria according to the invention are preferably described in the general literature of Zhou Geng et al, 2019 [ Zhou Geng, chen, liu Xiaohong, lu Xiangyang, tian Yun, chen Huiming, development of cucumber sex determination studies, plant physiology report, 2019,55 (7): 902-914 ], female types including strong female and full female types, in particular:
general type: i.e. hermaphrodite plants, the main vines and the upper base parts of the side vines of the cucumber plants produce male flowers, the male flowers and the female flowers in the middle are alternately born, and the female flowers are produced at the tail ends; strong female type: the main vines and the upper bases of the side vines of the cucumber plants produce male flowers, and the middle and upper parts of the cucumber plants continuously produce female flowers; full female type: only female flowers are produced on the main vines and the side vines of the cucumber plant.
In the invention, the varieties of cucumbers to be tested preferably comprise north China thorn type cucumbers.
The detection method provided by the invention utilizes the primer pair in the primer group to carry out real-time fluorescence quantitative PCR amplification, can carry out early identification in the seed or seedling stage of the cucumber, can judge the sex type of the cucumber according to the relative copy number of female related genes in the cucumber material to be detected, has the advantages of high flux, accuracy, low cost, simple operation, labor and time saving, and has very wide application prospect.
For further explanation of the present invention, the primer set, the kit and the application thereof for identifying female strength of cucumber provided by the present invention are described in detail below with reference to the accompanying drawings and examples, but they should not be construed as limiting the scope of the present invention.
The experimental methods in the following examples are conventional methods unless otherwise specified. The test materials used in the examples described below, unless otherwise specified, were purchased from conventional Biochemical reagent companies. The quantitative tests in the following examples were all set up in triplicate and the results averaged.
Example 1
Acquisition of primer combination for identifying female strength of north China dense thorn type cucumber
The invention utilizes 10 common pure line materials separated from the north China dense thorn type cucumber and 10 full female pure line materials separated from European Asia filial generation, respectively carries out genome re-sequencing on the 20 pure line materials and carries out correlation analysis on female phenotype by a full genome correlation analysis method, and carries out genome position analysis based on a reference genome V3 of the cucumber 9930 and with reference, wherein the correlation analysis result is shown in figure 1, and points with different shapes respectively represent corresponding cucumber chromosome marks in a legend.
As is clear from FIG. 1, the 26.3Mb nearby site of chromosome 6 has a high linkage degree with female traits. Further analysis of the resequenced data of the 20 inbred material near this site by BLAST over the whole genome, found that copy number variation of the sequence (specifically shown as SEQ ID NO. 5: 5'-ATGGTGTTGGGGTTGTTTCACAACAACTCTATTCTGTACTTACCAGATTACAAATGGGGCTTATCGAAGATAAAATGAATTGGACCGTCAGTCTATCGTAGGCATAGGGTGATTTTGTAGAATCATCGTTTACCTTTTCTGCCAGTCCCAAG-3', designated sequence A, supra) near the physical position 26270506 within the CsaV3_6G044420 gene of chromosome 6 (noted Branched chain amino acid aminotransferase, i.e., the branched amino acid transaminase encoding gene) was significantly correlated with female trait. Specifically, 6.15kb of sequence B (shown in SEQ ID NO. 6: 5'-TCTGCAGCAAAGACGTAGGGGCAATACCTGAGTTTGATTGGGACAATCTTGGTTTTGGGATAATTCCTACTGATTATATGTATGTCATGAAATGTTCTCAAGGTGACAATTTTTCTAATGGTGAATTGAAGCGGTTTGGGAACATTGAGC-3', hereinafter the same) downstream of sequence A on the same chromosome had a copy number of 1 in each of the 20 pure line materials, and the sequence A had a copy number of 1 in 10 of the ordinary pure line materials, and a copy number of 2 or 4 in 10 of the all female pure line materials. Because the commercial varieties of the strong female and the full female type hualien dense thorn type cucumbers commonly contain the blood margin of the full female type cucumbers, the invention considers that the primer combination for identifying the female strength of the hualien dense thorn type cucumbers based on the real-time fluorescence quantitative PCR method can be developed by utilizing the rules.
Cucumber 9930 reference genome V3: cucumber 9930 has a version number V3 (download address: http:// cucurbstgenomics. Org/organosm/20) with reference to the genomic sequence.
2. Based on the step 1, the invention develops a primer combination for identifying female strength of the north China dense thorn type cucumber.
The primer set consisted of 2 primer pairs, each primer pair having the designation given in table 1, column 2. Each primer pair consists of 2 primer sequences, wherein the primer pair 1 is used for amplifying female related gene fragments, and the primer pair 2 is used for amplifying internal reference gene fragments. The nucleotide sequences of each of the 2 primer pairs are shown in column 4 of Table 1.
TABLE 1 primer combinations for identifying female strength of North China dense thorn type cucumber
Example 2
Example 1 validity test of primer combinations developed
The basic information of 265 tested north China dense thorn type cucumber materials in this example is shown in Table 2, and all the basic information is from the germplasm resource library of vegetable research institute of the national academy of sciences of agriculture and forestry in Beijing, and is a commercial variety or disclosed in Chinese patent CN 111485032A. According to the phenotype, 215 of 265 tested north China dense thorn type cucumber materials are of a common type, and the other 50 are female materials, wherein 43 strong female types and 7 full female types are adopted.
TABLE 2 basic information of 265 tested North China dense thorn cucumber materials
Numbering device Cucumber material name for test Phenotype of phenotype Female-related gene relative copy number Determination result
S1 9930 North China type cucumber pure line General 1 General
D63 06W1 European Asia filial generation purification Total female 2.00501568 Total female
D64 06W2 European Asia filial generation purification General 0.85668601 General
D65 06W3 European Asia filial generation purification General 1.01738671 General
D66 06W4 European Asia filial generation purification General 0.93815122 General
D67 06W5 European Asia filial generation purification General 0.86132422 General
D68 06W6 European Asia filial generation purification General 1.13749044 General
D69 06W7 European Asia filial generation purification General 0.95132061 General
D70 06W8 European Asia filial generation purification General 0.99067341 General
D49 10-31 North China dense thorn variety separation and purification General 0.983483 General
D50 10-32 North China dense thorn varieties are separated and purified General 1.0862039 General
B58 1181 North China cucumber offspring General 1.13657316 General
B59 1182 North China cucumber offspring General 1.05863869 General
B60 1183 North China cucumber offspring General 1.078664 General
D160 244856G1 European Asia filial generation purification Total female 1.49038867 Strong female
D161 244856G2 European Asia filial generation purification Total female 2.03635209 Total female
D80 Offspring of 305-11 North China dense thorn varieties General 1.11974775 General
D93 Offspring of 36-131 North China dense thorn variety General 1.11499051 General
D94 Offspring of 36-132 North China dense thorn varieties General 0.94137215 General
D90 36-31 North China dense thorn variety offspring General 0.99911832 General
D91 Offspring of 36-32 North China dense thorn varieties General 1.02494598 General
D92 36-9 North China dense thorn variety offspring General 0.94135573 General
Y2 382 North China dense thorn variety offspring General 0.98416568 General
C1 55B European Asia hybrid offspring purification General 1.12867664 General
D10 68210 separation and purification of greenhouse dense thorn variety General 1.08090964 General
D13 Separating and purifying dense thorn variety of 68213 greenhouse General 0.8604259 General
D14 Separating and purifying dense thorn variety of 68214 greenhouse General 0.9544144 General
D15 Separating and purifying dense thorn variety of 68215 greenhouse General 0.9736401 General
D2 6822 separation and purification of greenhouse dense thorn variety General 1.00204211 General
D3 6823 separation and purification of greenhouse dense thorn variety General 1.09990015 General
D4 6824 separation and purification of greenhouse dense thorn variety General 0.85201299 General
D5 6825 separation and purification of greenhouse dense thorn variety General 1.14771263 General
D6 6826 separation and purification of greenhouse dense thorn variety General 1.12120154 General
D7 6827 separation and purification of greenhouse dense thorn variety General 1.14111431 General
D8 6828 separation and purification of greenhouse dense thorn variety General 0.87870159 General
N28 BQ2231 North China cucumber offspring General 1.05493247 General
N29 BQ2232 North China cucumber offspring General 0.85399456 General
N133 BY North China cucumber offspring General 1.03171229 General
B56 CHHML1 North China cucumber offspring General 1.13995104 General
B57 CHHML2 North China cucumber offspring General 0.98336836 General
N32 CQDF North China cucumber offspring General 1.14051184 General
N116 CY1061 North China cucumber offspring General 0.94645119 General
N117 CY1062 North China cucumber offspring General 1.03071479 General
N118 CY1063 North China cucumber offspring General 1.07931081 General
N119 CY1064 North China cucumber offspring General 1.04673148 General
N120 CY1065 North China cucumber offspring General 1.05041453 General
N121 CY1066 North China cucumber offspring General 1.06635257 General
N122 CY1067 North China cucumber offspring General 0.88757293 General
N123 CY1068 North China cucumber offspring General 0.90728048 General
N124 CY1069 North China cucumber offspring General 1.11377979 General
N131 CY3353 North China cucumber offspring General 1.07553519 General
N128 Cyxsj North China cucumber offspring General 1.07917732 General
N114 CYZH1 North China cucumber offspring General 0.87294275 General
N115 CYZH2 North China cucumber offspring General 0.95510145 General
Y5 Offspring of DF3 North China dense thorn variety General 0.90164775 General
C20 FS110 North China cucumber separation and purification General 0.99235955 General
C21 FS111 North China cucumber separation and purification General 0.86500371 General
B39 FS112 North China cucumber separation and purification General 0.9797228 General
C11 FS11 North China cucumber separation and purification General 1.05610733 General
C12 FS12 North China cucumber separation and purification General 0.89238245 General
B29 FS13 North China cucumber separation and purification General 1.01319215 General
C30 FS14 North China cucumber separation and purification General 1.02079431 General
C15 FS15 North China cucumber separation and purification General 1.09686736 General
C16 FS16 North China cucumber separation and purification General 1.0048588 General
C17 FS17 North China cucumber separation and purification General 1.01864404 General
C18 FS18 North China cucumber separation and purification General 1.0374967 General
C19 FS19 North China cucumber separation and purification General 1.12590329 General
D54 Purification of G54H561 European Asia filial generation Total female 2.05700871 Total female
D55 Purification of G54H562 European Asia filial generation Total female 1.90048075 Total female
D158 Purification of G54H56JY363 European hybrid offspring Total female 2.02577116 Total female
D59 Purification of G54H56JY364 European Asia filial generation Total female 1.86194013 Total female
Y4 Offspring of HG122 North China dense thorn variety General 0.94382027 General
N164 HG1311 North China cucumber offspring General 1.02615889 General
C23 JS4 North China cucumber separation and purification General 0.96616896 General
N152 JW6151 North China cucumber offspring General 1.03468826 General
N153 JW6152 North China cucumber offspring General 1.06629387 General
N154 JW6153 North China cucumber offspring General 1.13861942 General
N155 JW6154 North China cucumber offspring General 0.89568188 General
N156 JW6155 North China cucumber offspring General 1.07879651 General
N157 JW6156 North China cucumber offspring General 0.96846154 General
N158 JW6157 North China cucumber offspring General 0.87529283 General
N26 JY6 North China cucumber offspring General 0.9141458 General
B48 JYCQL1 North China cucumber offspring General 1.01403126 General
N86 JYCQL2 North China cucumber offspring General 1.06715769 General
B50 JYCQL3 North China cucumber offspring General 0.89128301 General
B51 JYCQL4 North China cucumber offspring General 0.98974077 General
N89 JYCQL5 North China cucumber offspring General 0.86120487 General
N90 JYCQL6 North China cucumber offspring General 1.11984671 General
N91 JYCQL7 North China cucumber offspring General 1.02119506 General
N92 JYCQL8 North China cucumber offspring General 0.86649108 General
B52 JYXM1 North China cucumber offspring General 0.86973803 General
B53 JYXM2 North China cucumber offspring General 1.09715056 General
B54 JYXM3 North China cucumber offspring General 0.89943874 General
B55 JYXM4 North China cucumber offspring General 0.98509058 General
C24 K31 North China cucumber separation and purification method General 0.86646773 General
C25 K32 North China cucumber separation and purification method General 1.05278693 General
C2 Separating and purifying LDXX1 North China cucumber General 1.10969508 General
C3 LDXX2 North China cucumber separation and purification method General 1.05963479 General
C4 LDXX3 North China cucumber separation and purification method General 1.00970726 General
C5 Separation and purification of LDXX4 North China cucumber General 1.04739819 General
D61 LDXX5 North China cucumber separation and purification method General 0.87135168 General
N181 LH10 North China cucumber offspring General 0.95680303 General
N182 LH11 North China cucumber offspring General 0.98448276 General
N183 LH121 North China cucumber offspring General 1.13979954 General
N184 LH122 North China cucumber offspring General 1.06580387 General
N185 LH123 North China cucumber offspring General 1.00262914 General
N186 LH13 North China cucumber offspring General 0.94572552 General
N165 LH1 North China cucumber offspring General 1.02163574 General
N41 LH2 North China cucumber offspring General 0.90279305 General
N42 LH3 North China cucumber offspring General 0.90831141 General
N175 LH510 North China cucumber offspring General 1.01281839 General
N166 LH51 North China cucumber offspring General 0.94799159 General
N167 LH52 North China cucumber offspring General 1.14060758 General
N168 LH53 North China cucumber offspring General 0.87062972 General
N169 LH54 North China cucumber offspring General 0.86415967 General
N170 LH55 North China cucumber offspring General 1.14566377 General
N171 LH56 North China cucumber offspring General 1.03121442 General
N172 LH57 North China cucumber offspring General 0.97756193 General
N173 LH58 North China cucumber offspring General 0.95927217 General
N174 LH59 North China cucumber offspring General 1.12330493 General
N176 LH81 North China cucumber offspring General 1.05773627 General
N177 LH82 North China cucumber offspring General 1.14289757 General
N178 LH83 North China cucumber offspring General 0.98146445 General
N179 LH84 North China cucumber offspring General 0.92006393 General
N180 LH85 North China cucumber offspring General 0.91089223 General
N187 LY41 North China cucumber separation and purification General 1.10990248 General
C8 LY42 North China cucumber separation and purification General 1.02925377 General
C9 LY43 North China cucumber separation and purification General 1.0148289 General
C10 LY44 North China cucumber separation and purification General 0.96932241 General
N38 LYLJ1 North China cucumber offspring General 1.10826846 General
N39 LYLJ2 North China cucumber offspring General 1.06162004 General
N132 MS368 North China cucumber offspring General 1.10135434 General
N135 N181 North China cucumber offspring General 1.03595639 General
N136 N182 North China cucumber offspring General 1.06262373 General
N137 N183 North China cucumber offspring General 1.00456829 General
N138 N184 North China cucumber offspring General 0.95642656 General
N139 N185 North China cucumber offspring General 1.02734145 General
N140 N186 North China cucumber offspring General 1.03129904 General
N141 N187 North China cucumber offspring General 1.12559506 General
C26 N20 North China cucumber separation and purification General 0.89389344 General
D71 Offspring of N261 North China dense thorn variety General 1.08299769 General
D72 Offspring of N262 North China dense thorn variety General 0.96982525 General
D73 Offspring of N263 North China dense thorn variety General 0.86058126 General
D34 Q81 North China dense thorn variety separation and purification General 1.05917492 General
D35 Q82 North China dense thorn variety separation and purification General 0.8827801 General
D36 Q83 North China dense thorn variety separation and purification General 0.85036117 General
D37 Q84 north China dense thorn variety separation and purification General 0.8731331 General
D39 Q86 North China dense thorn variety separation and purification General 0.93772222 General
D40 Q87 north China dense thorn variety separation and purification General 0.91538119 General
D41 Q88 North China dense thorn variety separation and purification General 0.90665143 General
D43 Q8910 North China dense thorn variety separation and purification General 0.93319021 General
D44 Q8911 North China dense thorn variety separation and purification General 1.0938539 General
D45 Q8912 North China dense thorn variety separation and purification General 1.1089217 General
D46 Q8913 North China dense thorn variety separation and purification General 0.97627174 General
D47 Q8914 North China dense thorn variety separation and purification General 0.9656519 General
D48 Q8915 north China dense thorn variety separation and purification General 0.88985277 General
D42 Q89 North China dense thorn variety separation and purification General 1.10058272 General
N20 QD206 North China open field cucumber offspring General 1.13485989 General
N134 SCBY North China cucumber offspring General 0.91275283 General
N144 sX3031 North China cucumber offspring General 1.11258885 General
N145 sX3032 North China cucumber offspring General 1.03357208 General
N147 sX3151 North China cucumber offspring General 1.14201452 General
N148 sX3152 North China cucumber offspring General 0.86760966 General
Y20 Offspring of TW10 North China dense thorn variety General 1.1136604 General
Y21 Offspring of TW11 North China dense thorn variety General 1.03786246 General
Y23 Offspring of TW13 North China dense thorn variety General 0.9747828 General
Y24 Offspring of TW14 North China dense thorn variety General 0.99160978 General
Y25 Offspring of TW15 North China dense thorn variety General 1.09206109 General
Y11 Offspring of TW1 North China dense thorn variety General 1.01995104 General
Y13 Offspring of TW3 North China dense thorn variety General 0.95309683 General
Y14 Offspring of TW4 North China dense thorn variety General 1.01537836 General
Y16 Offspring of TW6 North China dense thorn variety General 1.05540137 General
Y17 Offspring of TW7 North China dense thorn variety General 0.91631948 General
Y18 Offspring of TW8 North China dense thorn variety General 1.06797898 General
D25 Separating and purifying W3510 North China dense thorn variety General 1.02243677 General
D26 Separating and purifying W3511 North China dense thorn variety General 1.01661939 General
D27 Separating and purifying W3512 north China dense thorn variety General 1.03973345 General
D28 Separating and purifying W3513 north China dense thorn variety General 0.85786501 General
D29 Separating and purifying W3514 north China dense thorn variety General 0.88026054 General
D30 Separating and purifying W3515 north China dense thorn variety General 0.97604677 General
D31 Separating and purifying W3516 north China dense thorn variety General 0.85373761 General
D32 W3517 north China dense thorn variety separation and purification General 1.01612473 General
D33 Separating and purifying W3518 North China dense thorn variety General 0.89825822 General
D16 W351 North China dense thorn variety separation and purification General 0.90621414 General
D17 Separating and purifying W352 North China dense thorn variety General 0.87203576 General
D18 W353 North China dense thorn variety separation and purification General 0.86540965 General
D19 Separating and purifying W354 North China dense thorn varietyA kind of electronic device General 0.86671056 General
D20 W355 North China dense thorn variety separation and purification General 1.11350275 General
D21 W356 North China dense thorn variety separation and purification General 1.07286496 General
D22 W357 north China dense thorn variety separation and purification General 0.95254463 General
D23 W358 North China dense thorn variety separation and purification General 1.08725304 General
D24 W359 North China dense thorn variety separation and purification General 0.93071778 General
N163 XL North China cucumber offspring General 1.02380887 General
N109 XW1 North China cucumber offspring General 1.04856013 General
N110 XW2 North China cucumber offspring General 1.07356977 General
N111 XW3 North China cucumber offspring General 0.95126874 General
N112 XW4 North China cucumber offspring General 0.85268256 General
N142 XX1 North China cucumber offspring General 0.95961848 General
N143 XX2 North China cucumber offspring General 0.89242546 General
N146 XX3 North China cucumber offspring General 0.93810596 General
N17 XY6 North China cucumber offspring General 1.00564717 General
B43 YNLS1 North China cucumber offspring General 1.12446768 General
B44 YNLS2 North China cucumber offspring General 1.14712511 General
B45 YNLS3 North China cucumber offspring General 0.91578281 General
B46 YNLS4 North China cucumber offspring General 0.9267527 General
N34 North China cucumber offspring of YNLS General 0.96455656 General
N37 ZHLG north-China cucumber offspring General 0.87087185 General
N159 North China cucumber offspring of ZY3061 General 0.93036313 General
N160 ZY3062 North China cucumber offspring General 1.02584786 General
N161 ZY3063 North China cucumber offspring General 0.8573755 General
N162 ZY3064 North China cucumber offspring General 0.95040587 General
H35 Beijing 204 North China cucumber hybrid generation General 0.88650685 General
H38 Bomei No.1 North China cucumber hybrid generation Strong female 1.57852387 Strong female
H40 Bomei No.2 North China cucumber hybrid generation Strong female 1.54483896 Strong female
H39 Bomei No.4 North China cucumber hybrid generation Strong female 1.52905634 Strong female
H36 Bomei No. 8 North China cucumber hybrid generation Strong female 1.5645934 Strong female
H37 Derett 10 North China cucumber hybrid generation Strong female 1.37953627 Strong female
H49 Hybrid generation of cucumber of North China type No.3 Jinchun General 1.09740105 General
H48 Hybrid generation of North China cucumber No.4 Jinchun General 0.98857269 General
H44 Jindong 365 North China cucumber hybrid generation General 1.00778456 General
H43 Jinmei 79 North China cucumber hybrid generation Strong female 1.50714008 Strong female
S3 Jinyan No.2 North China cucumber pure line General 1.02994783 General
S4 Jinyan No.4 North China cucumber pure line General 0.87761701 General
H33 Jinyou No.1 North China cucumber hybrid generation General 0.9875357 General
H46 Jinyou 219 North China cucumber hybrid generation Strong female 1.618581 Strong female
H42 Jinyou 355 North China cucumber hybrid generation Strong female 1.42269866 Strong female
H22 Jinyou 35 North China cucumber hybrid generation Strong female 1.52998831 Strong female
H7 Jinyou 369 North China cucumber hybrid generation Strong female 1.42861982 Strong female
H50 Jinyou No.3 North China cucumber hybrid generation General 1.10467529 General
H34 Jinyou No.4 North China cucumber hybrid generation General 1.10600602 General
H45 Hybrid generation of cucumber for moistening North China in jin early garden Strong female 1.63589575 Strong female
H27 Jingfeng 16 huarou cucumber hybrid generation Strong female 1.59301332 Strong female
H28 Jingfeng 235 North China cucumber hybrid generation Strong female 1.50143058 Strong female
H21 Jingfeng 298 North China cucumber hybrid generation Strong female 1.62715677 Strong female
H29 Jingfeng 320 North China cucumber hybrid generation Strong female 1.41224656 Strong female
H30 Jingfeng 440 North China cucumber hybrid generation Strong female 1.4459136 Strong female
H31 Jingfeng 459 North China cucumber hybrid generation Strong female 1.35362003 Strong female
H20 Jingfeng 68 North China cucumber hybrid generation Strong female 1.38080752 Strong female
H11 Jing-yan 106 North China cucumber hybrid generation Strong female 1.373192 Strong female
H12 Beijing-research 107 North China cucumber hybrid generation Strong female 1.46184898 Strong female
H2 Beijing-research 1081 North China cucumber hybrid generation Strong female 1.59647019 Strong female
H3 Beijing-research 1083 North China cucumber hybrid generation Strong female 1.57005526 Strong female
H23 Jing-Ji 108 North China cucumber hybrid generation Strong female 1.49178145 Strong female
H6 Jing-sheng 109 huali cucumber hybrid generation Strong female 1.37309693 Strong female
H4 Jing-sheng 118 North China cucumber hybrid generation Strong female 1.40925684 Strong female
H5 Jing-Shang 128 North China cucumber hybrid generation Strong female 1.53068438 Strong female
H8 Jing-Ji 15163 North China cucumber hybrid generation Strong female 1.53755023 Strong female
H9 Jing-sheng 1567 North China cucumber hybrid generation Strong female 1.36624806 Strong female
H10 Jing-developed 1568 North China cucumber hybrid generation Strong female 1.39709331 Strong female
H1 Jing-Shang 207 North China cucumber hybrid generation Strong female 1.54267088 Strong female
H24 Beijing-research 405 North China type cucumber hybrid generation Strong female 1.42459466 Strong female
H25 Jing-Yan 407 North China cucumber hybrid generation Strong female 1.57250686 Strong female
H32 Jing-Mean E31 North China cucumber hybrid generation Strong female 1.43329405 Strong female
H14 Jing-Shang spring-autumn-green No.2 North China cucumber hybrid generation Strong female 1.6006587 Strong female
H15 Jing-Shang spring-autumn-green No.3 North China cucumber hybrid generation Strong female 1.39619935 Strong female
H16 Beijing-research spring-autumn-green No.4 North China cucumber hybrid generation Strong female 1.49312483 Strong female
H13 Jing-Shang spring-autumn-green North China cucumber hybrid generation Strong female 1.56705198 Strong female
H19 Jing-Sha-Mei No.2 North China cucumber hybrid generation Strong female 1.5306182 Strong female
H26 Jing-Sha-Mei No.3 North China cucumber hybrid generation Strong female 1.40970913 Strong female
H18 Jing-Shang-Xiamei North China cucumber hybrid generation Strong female 1.59168712 Strong female
H17 Jing-sheng-superior North China cucumber hybrid generation Strong female 1.45078762 Strong female
S2 Xintaimi thorn North China cucumber pure line General 1.11066299 General
S5 Vinpocetine North China cucumber pure line General 0.92691023 General
H41 Hybrid generation of Zhongnong No. 46 North China cucumber Strong female 1.36432426 Strong female
H47 Hybrid generation of middle and agricultural large No. 22 North China cucumber Strong female 1.40886882 Strong female
1. Obtaining genomic DNA of test North China dense thorn type cucumber material
And respectively extracting 265 genome DNA of leaves (mixed 10 seed roots) of the tested North China close thorn type cucumber material by adopting a CTAB method to obtain the genome DNA of the tested North China close thorn type cucumber material.
The quality and the concentration of the genome DNA of the cucumber material to be tested are required to meet the PCR requirement, and the standard is as follows: agarose electrophoresis showed single DNA bands without significant dispersion; ultraviolet spectrophotometer Nanodrop2000 (Thermo) detection A260/A280 ratio is about 1.8, A260/A230 ratio is greater than 1.8; the concentration of genome DNA of the north China dense thorn type cucumber material to be tested is 10-30 ng/mu L.
2. And respectively taking 265 genome DNAs of the to-be-tested North China dense thorn type cucumber materials as templates, and respectively adopting 2 primer pairs in the embodiment 1 to carry out real-time fluorescence quantitative PCR amplification to obtain corresponding PCR amplification products.
In each PCR reaction system, the total volume was 20. Mu.L, in which the DNA template was 1. Mu.L, and the forward and reverse primers in the primer set (final concentrations were 10. Mu.M) were 0.5. Mu.L, 2X SYBR Premix Ex Taq. Mu.L and ddH, respectively 2 O 8μL。
The reaction procedure is: pre-denaturation at 95 ℃ for 30s; denaturation at 95℃for 10s, annealing at 60℃for 20s, extension at 72℃for 20s, amplification for 30 cycles.
3. After the step 2 is completed, firstly, the Ct value of each north China dense thorn type cucumber material to be detected, which is amplified by the primer pair 1 (used for amplifying female related genes) and the primer pair 2 (used for amplifying internal reference genes), is the cycle number when the fluorescent signal in the PCR tube reaches a set threshold value, is read; the fluorescence threshold (threshold) set by the invention is 10 times of the standard deviation of the fluorescence signal of the 3 rd to 15 th cycle of the reaction, namely: threshold=10×sd cycle 3-15 。
Then, the delta Ct value of the cucumber material to be measured, delta ct=ct (female-related gene) -Ct (reference gene) is calculated.
Finally with 2 -ΔCt Measurement of female in cucumber material to be measuredThe relative copy number of the related gene was corrected by the detection result of the north China dense thorn type cucumber pattern material 9930 recognized as the general type. I.e. the relative copy number of female related genes in the cucumber material to be tested=2 Delta Ct (test material) +delta Ct (9930) . The specific results are shown in Table 2, column 4 (results retain 8-bit decimal).
4. And (3) judging female strength by using the relative copy number of the female related genes in the cucumber material to be detected obtained in the step (3). The specific standard is as follows: the relative copy number of female related genes in the cucumber material to be detected is marked as c (the same applies below), and when the relative copy number of female related genes in the cucumber material to be detected is 0.85< c <1.15, the cucumber material is judged to be of a common type; when c >1.35, a female type is judged, wherein when 1.35< c <1.65, a strong female type is judged, and when c >1.85, a full female type is judged. The specific results are shown in Table 2, column 5.
5. Efficiency evaluation of identification of 265 tested north China dense thorn type cucumber materials female strength by two primer pairs
The results in Table 2 show that the number of tested cucumber materials with the relative copy number c of female-related genes between 0.85 and 1.15 (not included) is 215, and the female-related genes are judged to be of the general type; the phenotype of the 215 tested cucumber materials is common, and the consistency is 100% (215/215×100% = 100%).
c, 50 tested cucumber materials with the number of c being more than 1.35 (without) are judged to be female; the 50 cucumber material phenotypes tested were female and identical was 100% (50/50×100% = 100%). Wherein, the number of tested cucumber materials with the c between 1.35 and 1.65 (without the tested cucumber materials) is 44, and the tested cucumber materials are judged to be of a strong female type; 43 of the above 44 cucumber material phenotypes were strongly female and 1 was fully female, with a consistency of 97.73% (43/44×100% = 97.73%). c, 6 tested cucumber materials with the number of c being more than 1.85 (without) are judged to be full female; the 6 cucumber material phenotypes tested were all female and identical was 100% (6/6×100% = 100%).
From this, the primer combination developed in example 1 can identify female strength of the north China dense thorn type cucumber.
Example 3
Primer combination developed in example 1 is adopted to detect female strength of north China dense thorn type cucumber material to be detected
The phenotypes of the North China close-thorn type cucumber material 1 to the North China close-thorn type cucumber material 12 to be detected are detected, the detection method is the same as that of the steps 1-4 in the embodiment 2, and specific results are shown in the table 3.
TABLE 3 female strength determination of 12 North China dense thorn type cucumber materials to be detected
The results show that the results of the primer combination developed in the example 1 for identifying female strength of the north China dense thorn type cucumber material are completely consistent with the results of phenotype identification. From this, it can be seen that the primer combination developed based on example 1 can identify female strength of the north China dense thorn type cucumber material.
Although the foregoing embodiments have been described in some, but not all, embodiments of the invention, it should be understood that other embodiments may be devised in accordance with the present embodiments without departing from the spirit and scope of the invention.

Claims (9)

1. A primer group for identifying cucumber sex type, which is characterized by comprising a first primer pair and a second primer pair; the nucleotide sequence of the forward primer of the first primer pair is shown as SEQ ID NO.1, and the nucleotide sequence of the reverse primer of the first primer pair is shown as SEQ ID NO. 2; the nucleotide sequence of the forward primer of the second primer pair is shown as SEQ ID NO.3, and the nucleotide sequence of the reverse primer of the second primer pair is shown as SEQ ID NO. 4.
2. A kit for identifying cucumber phenotype comprising the primer set of claim 1.
3. The kit of claim 2, further comprising additional reagents for PCR amplification.
4. A kit according to claim 3, wherein the other reagents comprise 2 x SYBR Premix Ex Taq and ddH 2 O。
5. Use of the primer set of claim 1 or the kit of any one of claims 2 to 4 for identifying cucumber sex types.
6. The use according to claim 5, characterized in that the cucumber variety comprises north China honey thorn type cucumber.
7. A method for identifying cucumber phenotype comprising the steps of:
taking genomic DNA of cucumber to be detected as a template, carrying out real-time fluorescent quantitative PCR amplification on each of a first primer pair and a second primer pair in the primer set of claim 1, and subtracting the Ct value amplified by the second primer pair from the Ct value amplified by the first primer pair to obtain delta Ct;
at 2 -ΔCt The value judges the shape of the cucumber to be tested, and the judgment comprises the following steps:
when 0.85< 2 -ΔCt <1.15, judging that the model is of a general type;
when 2 -ΔCt >1.35, the female type was judged.
8. The method according to claim 7, wherein when 1.35< 2 -ΔCt <1.65, judging as strong female; when 2 -ΔCt >1.85, the whole female type was judged.
9. Method according to claim 7 or 8, characterized in that the variety of cucumbers to be tested comprises north China honey thorn type cucumbers.
CN202311353549.4A 2023-10-19 2023-10-19 Primer group and kit for identifying female strength of cucumber and application of primer group and kit Pending CN117106968A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202311353549.4A CN117106968A (en) 2023-10-19 2023-10-19 Primer group and kit for identifying female strength of cucumber and application of primer group and kit

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202311353549.4A CN117106968A (en) 2023-10-19 2023-10-19 Primer group and kit for identifying female strength of cucumber and application of primer group and kit

Publications (1)

Publication Number Publication Date
CN117106968A true CN117106968A (en) 2023-11-24

Family

ID=88800474

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202311353549.4A Pending CN117106968A (en) 2023-10-19 2023-10-19 Primer group and kit for identifying female strength of cucumber and application of primer group and kit

Country Status (1)

Country Link
CN (1) CN117106968A (en)

Citations (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101861827A (en) * 2010-01-12 2010-10-20 南京农业大学 Cultivation and application of full female processing cucumber Youjia full female 09
CN102816860A (en) * 2012-09-10 2012-12-12 浙江省农业科学院 Molecular marker assisted selection method for female line breeding of cucumber
CN103190281A (en) * 2013-04-25 2013-07-10 山东省农业科学院蔬菜研究所 Cucumber female line induced screening method
KR20170050462A (en) * 2015-10-30 2017-05-11 세종대학교산학협력단 Composition for identifying cucumber genotype and method using thesame
CN106957911A (en) * 2017-03-19 2017-07-18 西北农林科技大学 A kind of molecular identification method for identifying cucumber gynoecy shape
CN109207574A (en) * 2018-11-21 2019-01-15 山东省农业科学院蔬菜花卉研究所 A kind of cucumber female SNP marker and its application
CN109234446A (en) * 2018-11-21 2019-01-18 山东省农业科学院蔬菜花卉研究所 Cucumber female SNP marker and its application
CN111485032A (en) * 2020-06-12 2020-08-04 北京市农林科学院 Method for identifying cucumber female line and SNP primer combination used by same
US20200407805A1 (en) * 2017-05-05 2020-12-31 Tianjin Kernel Agricultural Science And Technology Corporation Ltd. Cucumber Research Institute Cucumber Male Sterility Gene, Molecular Marker, Screening Method and Application Thereof
CN114908182A (en) * 2022-04-13 2022-08-16 天津德瑞特种业有限公司 Cucumber full-female-shape related SNP (Single nucleotide polymorphism) marker and application thereof

Patent Citations (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101861827A (en) * 2010-01-12 2010-10-20 南京农业大学 Cultivation and application of full female processing cucumber Youjia full female 09
CN102816860A (en) * 2012-09-10 2012-12-12 浙江省农业科学院 Molecular marker assisted selection method for female line breeding of cucumber
CN103190281A (en) * 2013-04-25 2013-07-10 山东省农业科学院蔬菜研究所 Cucumber female line induced screening method
KR20170050462A (en) * 2015-10-30 2017-05-11 세종대학교산학협력단 Composition for identifying cucumber genotype and method using thesame
CN106957911A (en) * 2017-03-19 2017-07-18 西北农林科技大学 A kind of molecular identification method for identifying cucumber gynoecy shape
US20200407805A1 (en) * 2017-05-05 2020-12-31 Tianjin Kernel Agricultural Science And Technology Corporation Ltd. Cucumber Research Institute Cucumber Male Sterility Gene, Molecular Marker, Screening Method and Application Thereof
CN109207574A (en) * 2018-11-21 2019-01-15 山东省农业科学院蔬菜花卉研究所 A kind of cucumber female SNP marker and its application
CN109234446A (en) * 2018-11-21 2019-01-18 山东省农业科学院蔬菜花卉研究所 Cucumber female SNP marker and its application
CN111485032A (en) * 2020-06-12 2020-08-04 北京市农林科学院 Method for identifying cucumber female line and SNP primer combination used by same
CN114908182A (en) * 2022-04-13 2022-08-16 天津德瑞特种业有限公司 Cucumber full-female-shape related SNP (Single nucleotide polymorphism) marker and application thereof

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
PAN.J: ""Cucumis sativus 1-aminocyclopropane-1-carboxylic acid synthase(ACS1G) gene, promoter region, 5\'UTR, and partical cds"", 《GENE BANK》, pages 2 *
QING LI等: ""A chromosome-scale genome assembly of cucumber(Cucumis sativusL.)"", 《GIGA SCIENCE》, no. 8, pages 1 - 10 *
周赓等: ""黄瓜性别决定研究进展"", 《植物生理学报》, vol. 7, no. 55, pages 902 - 914 *
张圣平等: ""黄瓜重要农艺性状的分子生物学"", 《中国农业科学》, vol. 1, no. 53, pages 117 - 121 *

Similar Documents

Publication Publication Date Title
CN103757113B (en) Microsatellite fluorescent multiple PCR (Polymerase Chain Reaction) method used in paternity testing of grass carps
CN108103211B (en) Microsatellite primer and identification method for tridacna elongata and tridacna nova
Ward et al. Microsatellite diversity in rainbow trout (Oncorhynchus mykiss) introduced to Western Australia
Sekino et al. Microsatellite DNA markers of Ezo abalone (Haliotis discus hannai): a preliminary assessment of natural populations sampled from heavily stocked areas
CN107267618B (en) Genetic marker related to fineness of sheep wool and application thereof
Mohammadabadi et al. Using inter simple sequence repeat multi-loci markers for studying genetic diversity in Guppy fish
Nazari et al. Association between myostatin gene (MSTN-1) polymorphism and growth traits in domesticated rainbow trout (Oncorhynchus mykiss)
CN112063725B (en) Chicken shin length and shin diameter related AGO3 gene molecular marker and application
CN111187852A (en) SNP (single nucleotide polymorphism) site related to wheat yield and application thereof
CN105200160A (en) SNP marker relevant to low dissolved oxygen tolerance of Litopenaeus vannamei as well as screening method and application of SNP marker
Gent et al. The maize gene maternal derepression of r1 encodes a DNA glycosylase that demethylates DNA and reduces siRNA expression in the endosperm
CN117106968A (en) Primer group and kit for identifying female strength of cucumber and application of primer group and kit
CN105624307B (en) Microsatellite primers and identification method for identifying crassostrea hongkongensis, crassostrea gigas and crassostrea pacificus and hybrid species thereof
CN105624318A (en) SNP site related to growth trait of paralichthys olivaceus as well as screening method and application of SNP site
Darvishzadeh Association of SSR markers with partial resistance to Sclerotinia sclerotiorum isolates in sunflower ('Helianthus annuus' L.)
Liang et al. Heterosis and genetic diversity of intraspecific hybrids crosses between two selected lines of the Pacific oyster Crassostrea gigas
CN101892318A (en) Method and kit for detecting correlated mutation allele of total farrow number of sow as well as application
CN1302111C (en) Bluish dogbean micro satellite DNA label
Karamura et al. Genotyping the local banana landrace groups of East Africa
Zheng et al. QTLs for days to silking in a recombinant inbred line maize population subjected to high and low nitrogen regimes
CN108251419B (en) Indel molecular marker P23 linked with anti-clubroot property of Degao CR117 Chinese cabbage, kit and application thereof
CN105671189A (en) Molecular breeding method based on single nucleotide polymorphism of cattle Angpt18 genes
CN101078030A (en) Micro-satellite molecule marking method for indicating and identifying chicken abdomen fat content
CN103088109B (en) Method for auxiliary identification of corn haploid induction line, and special primer pair thereof
Luo et al. Genetic diversity and genetic structure of consecutive breeding generations of golden mandarin fish (Siniperca scherzeri Steindachner) using microsatellite markers

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination