CN116785194A

CN116785194A - Milk exosome loaded alkylated cosmetic peptide and application thereof in cosmetics

Info

Publication number: CN116785194A
Application number: CN202311047717.7A
Authority: CN
Inventors: 葛啸虎; 董凤伟; 陆路; 王淼; 柏玮; 祁冬丽; 黄德亿; 韩春乐
Original assignee: Tianjin Exosome Technology Co ltd
Current assignee: Tianjin Exosome Technology Co ltd
Priority date: 2023-08-21
Filing date: 2023-08-21
Publication date: 2023-09-22

Abstract

The invention provides an alkylated cosmetic peptide loaded on a milk exosome and application thereof in cosmetics, and provides a milk exosome preparation loaded with the alkylated cosmetic peptide, comprising the alkylated cosmetic peptide and the milk exosome, wherein an alkane chain of the alkylated cosmetic peptide is inserted into a phospholipid bilayer membrane of the milk exosome, and the encapsulation rate of the alkylated cosmetic peptide in the milk exosome preparation is more than 25%. The pH value of the alkylated cosmetic peptide in the process of loading the alkylated cosmetic peptide into a milk exosome meets the following conditions: (1) the milk exosome preparation can observe complete and clear exosomes under an electron microscope, the purity measured by HPLC is more than 55%, and (2) the saturated concentration of the alkylated cosmetic peptide is more than or equal to 10 mug/mL. The milk exosome loaded with the alkylated cosmetic peptide is applied to cosmetics, and the transdermal effect of the cosmetic peptide is enhanced by utilizing the milk exosome, and the effect of the milk exosome is more than the effect of the milk exosome and the cosmetic peptide which are independently used.

Description

Milk exosome loaded alkylated cosmetic peptide and application thereof in cosmetics

Technical Field

The invention belongs to the field of cosmetics, and particularly relates to milk exosomes loaded alkylated cosmetic peptides and application thereof in cosmetics.

Background

Polypeptides and proteins are polymers of amino acids. Peptides are short amino acid chains. The name peptide is derived from pepton [ pepos: digested (greek) ]. Naturally occurring human polypeptides are used in cellular communication, such as protein regulation, cell proliferation, cell migration, inflammation, angiogenesis, and melanogenesis, which result in a wide variety of physiological processes including defense, immunity, stress, growth, homeostasis, and reproduction. The first peptide was described by emmer fischer and hofmeister in the early 19 th century. In 1901, fischer and Fourneauin published the first peptide synthesis. Fischer describes the first peptide as glycine and explains in his lecture the structure of more peptides such as dipeptides, tripeptides and polypeptides. After a few years scientists have synthesized new polypeptides, found more natural polypeptides, and have a greater understanding of their function. In addition to the growing knowledge about natural and synthetic peptides, different synthetic peptides have been developed. Copper glycine-histidine-lysine (Cu-GHK) was developed by Lorentz Picard (Loren Picard) in 1973. At the end of the 80 s, the first copper peptide was incorporated into skin care products. Until the early 2000, palmitoyl pentapeptide-4 was developed, since which many short, stable synthetic peptides have been developed by research and industry, playing a role in extracellular matrix synthesis, pigmentation, innate immunity and inflammation. These peptides are useful for collagen stimulation, wound healing, "botulinum-like" smoothing wrinkles, and antioxidant, antibacterial, and whitening effects.

Cosmetic peptides are a highly effective class of cosmetically active materials, which often have limited transdermal capabilities. Past studies have shown that only cosmetic peptides meeting relatively harsh conditions have a certain transdermal capacity: molecular weight below 500Da, mid-log of octanol/water partition coefficient between 1 and 3, melting point below 200deg.C, water solubility >1mg/mL, and substantially no polar center in molecular structure. Most peptides do not meet the above conditions. On the other hand, the anti-aging and whitening effects need to be achieved by the penetration of active molecules into the dermis. The peptide products have poor transdermal effect, so that the application of the peptide products in cosmetics is greatly limited, and the waste of raw materials is caused.

The prior research results reveal that the milk exosome has the skin care effects of moisturizing and repairing, resisting photoaging, whitening and removing freckles, and can be applied to cosmetics for moisturizing and repairing, tightening and anti-wrinkle, whitening and removing freckles. In addition, as a natural intercellular information transmission carrier, the milk exosomes have good transdermal functions.

Disclosure of Invention

In order to overcome the defects of the prior art and realize the natural transdermal function of the milk exosome, the alkylated cosmetic peptide is loaded on the exosome to assist in delivering the cosmetic peptide to permeate the epidermis and reach the target cells of the dermis, so that the synergistic cosmetic effect of the milk exosome can be exerted on one hand, the peptide is efficiently utilized on the other hand, and the waste of raw materials is avoided.

The invention provides a milk exosome preparation loaded with an alkylated cosmetic peptide, the preparation comprises the alkylated cosmetic peptide and a milk exosome, an alkane chain of the alkylated cosmetic peptide is inserted into a phospholipid bilayer membrane of the milk exosome, and the encapsulation rate of the alkylated cosmetic peptide in the milk exosome preparation is more than 25%. The encapsulation efficiency of the milk exosome formulation loaded with alkylated cosmetic peptides is preferably 25%, 30%, 35%, 40%.

Preferably, the milk exosome preparation loaded with the alkylated cosmetic peptide is obtained, and after the milk exosome is mixed with the alkylated cosmetic peptide, the pH of the mixed solution satisfies the following conditions: (1) the milk exosome preparation can observe exosome morphology under an electron microscope, and the exosome morphology is complete and clear exosome, namely typical tea-tray-shaped exosome. The purity measured by HPLC is above 55%, and (2) the saturated concentration of the alkylated cosmetic peptide is not less than 10 mug/mL, wherein the saturated concentration of the alkylated cosmetic peptide refers to the solubility of the peptide in the exosome preparation after pH adjustment. After incubation at a temperature below 37 ℃ for a period of time, the free peptides are removed by molecular sieve, ultrafiltration separation means.

The alkylated cosmetic peptides of the present invention are alkane-modified peptides from tetradecyl to octadecyl, which are peptides listed in the catalogue 2021 of used cosmetic raw materials approved by the national drug administration, including, but not limited to, palmitoyl tripeptide-1, palmitoyl pentapeptide-4, palmitoyl tetrapeptide-7, palmitoyl hexapeptide-12, myristoyl hexapeptide-5, palmitoyl hexapeptide-15, palmitoyl dipeptide-7, palmitoyl hexapeptide-14, palmitoyl tripeptide-5, palmitoyl tripeptide-8, palmitoyl tetrapeptide-10, palmitoyl tetrapeptide-5, palmitoyl pentapeptide-5, myristoyl pentapeptide-4, etc. Modifications to alkylation have made them less soluble in neutral aqueous solutions at pH 6.5-7.5. In cosmetic formulations with neutral pH, alkylated cosmetic peptides tend to be low in content or partially dissolved in the oil phase and do not perform adequately. But at the same time, the modification of alkylation, especially alkane modification from tetradecyl to octadecyl, enables the cosmetic peptide to be conveniently inserted into the exosome membrane to realize the loading of the peptide. Therefore, the aim of enhanced delivery can be achieved by virtue of the superior transdermal capacity of the exosomes.

The method of adjusting the pH of the present invention includes, but is not limited to, adding an acid, an alkali solution or a buffer, such as dilute hydrochloric acid, naOH. The alkylated cosmetic peptides of the present invention are preferably tetradecane-to-octadecane modified peptides having skin care efficacy, preferably peptides for collagen stimulation, wound healing, "botulinum-like" smooth wrinkles, and antioxidant, antibacterial and whitening effects.

The milk exosomes loaded with the alkylated cosmetic peptides obtained in the invention are loaded and loaded in relation to the milk exosomes, not simply mixed. Experiments show that the alkylated cosmetic peptide and the milk exosome have opposite static charges by adjusting the pH value of the preparation containing the alkylated cosmetic peptide and the milk exosome, the alkylated cosmetic peptide and the milk exosome are mutually attracted through electrostatic acting force, alkane chains of the alkylated cosmetic peptide are inserted into a phospholipid bilayer membrane of the milk exosome, the loading and loading relationship of the peptide and the milk exosome is realized (along with the interaction between the alkylated cosmetic peptide and the milk exosome, the supersaturated alkylated cosmetic peptide in solution is continuously dissolved in a mixed solution, the alkylated cosmetic peptide and the milk exosome are electrostatically attracted and further loaded into the milk exosome, the high-efficiency application of the peptide is realized), and the saturated concentration of the alkylated cosmetic peptide in the milk exosome preparation is greatly improved instead of simple physical mixing.

Preferably, in order to obtain the milk exosome preparation loaded with the alkylated cosmetic peptide according to the present invention, after mixing the milk exosome with the alkylated cosmetic peptide, the pH of the mixed solution satisfies the following conditions: (1) the milk exosome preparation can observe exosome morphology under an electron microscope, and the exosome morphology is complete and clear exosome, namely typical tea-tray-shaped exosome. Purity of 55% or more as measured by HPLC, and (2) the saturated concentration of the alkylated cosmetic peptide, which refers to the solubility of the peptide in the exosome formulation after pH adjustment, reaches or exceeds 10 μg/mL, 20 μg/mL, 30 μg/mL, 40 μg/mL or 50 μg/mL.

Preferably, the concentration of milk exosomes is: particle count 1X 10 ¹¹ -1×10 ¹² particles/mL, protein concentration 200-500 mug/mL; the protein concentration is preferably 300-400. Mu.g/mL, more preferably 200, 250, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 450, 500. Mu.g/mL; the grain number of milk exosomes is preferably 1×10 ¹¹ 、2×10 ¹¹ 、3×10 ¹¹ 、4×10 ¹¹ 、5×10 ¹¹ 、6×10 ¹¹ 、7×10 ¹¹ 、8×10 ¹¹ 、9×10 ¹¹ 、10×10 ¹¹ particles/mL.

Preferably, any of the above is added in an amount of 5 μg/mL to 10mg/mL, preferably 1 to 5mg/mL,4 to 10mg/mL, or 6 to 10 mg/mL. Further preferably, 5. Mu.g/mL, 10. Mu.g/mL, 20. Mu.g/mL, 50. Mu.g/mL, 100. Mu.g/mL, 200. Mu.g/mL, 300. Mu.g/mL, 400. Mu.g/mL, 500. Mu.g/mL, 600. Mu.g/mL, 700. Mu.g/mL, 800. Mu.g/mL, 900. Mu.g/mL, 1 mg/mL, 1.5 mg/mL, 2. 2 mg/mL, 2.5 mg/mL, 3 mg/mL, 3.5 mg/mL, 4. 4 mg/mL, 4.5 mg/mL, 5mg/mL, 6 mg/mL, 7 mg/mL, 8 mg/mL, 9 mg/mL, 10 mg/mL.

Preferably, any of the above mentioned cosmetic peptides comprises at least one of palmitoyl tripeptide-1, palmitoyl pentapeptide-4, palmitoyl tetrapeptide-7, palmitoyl hexapeptide-12, myristoyl hexapeptide-5, palmitoyl hexapeptide-15, palmitoyl dipeptide-7, palmitoyl hexapeptide-14, palmitoyl tripeptide-5, palmitoyl tripeptide-8, palmitoyl tetrapeptide-10, palmitoyl tetrapeptide-5, palmitoyl pentapeptide-5, myristoyl pentapeptide-4. The preferred alkylated cosmetic peptides of the invention are those which the administration allows to be added to cosmetics and which can be purchased commercially.

Preferably, any of the above is that the alkylated cosmetic peptide is palmitoyl tripeptide-1. To obtain a milk exosome preparation loaded with palmitoyl tripeptide-1, the pH of the mixed solution of milk exosome and palmitoyl tripeptide-1 satisfies the following conditions: (1) the milk exosome preparation can observe exosome morphology under an electron microscope, and the exosome morphology is complete and clear exosome, namely typical tea-tray-shaped exosome. The purity measured by HPLC is above 55%, and (2) the saturation concentration of the palmitoyl tripeptide-1 is more than or equal to 10 mug/mL.

Further preferably, the preparation method of the milk exosome preparation loaded with palmitoyl tripeptide-1 comprises the following steps: the addition of palmitoyl tripeptide-1 to milk exosomes is performed to achieve or not achieve a supersaturated state, and the preferable addition amount of palmitoyl tripeptide-1 is 5 mug/mL-10 mg/mL,5 mug/mL-1 mg/mL, 1-5mg/mL,4-10mg/mL, or 6-10 mg/mL. Preferred milk exosome particle count is 1×10 ¹¹ -1×10 ¹² particle/mL, or preferred milk exosome protein concentration 200500. Mu.g/mL. The pH value of the mixed solution is adjusted to meet the following conditions: the milk exosome preparation can observe complete and clear exosomes under an electron microscope, the purity measured by HPLC is above 55%, the saturated concentration of the alkylated cosmetic peptide is more than or equal to 10 mug/mL, and the preferable pH value is 4-6; stirring at below 37deg.C, physically loading for 1-12 hr, removing free palmitoyl tripeptide-1, adding lyoprotectant, and freeze drying. The preferred physical loading mode is stirring incubation or standing incubation, and the preferred mode for removing the free palmitoyl tripeptide-1 is molecular sieve, ultrafiltration and other separation means.

Preferably, any of the above is that the alkylated cosmetic peptide is palmitoyl pentapeptide-4. To obtain a milk exosome preparation loaded with palmitoyl pentapeptide-4, the pH of the mixed solution of milk exosome and palmitoyl pentapeptide-4 satisfies the following conditions: (1) the milk exosome preparation can observe exosome morphology under an electron microscope, and the exosome morphology is complete and clear exosome, namely typical tea-tray-shaped exosome. The purity measured by HPLC is above 55%, and (2) the saturation concentration of the palmitoyl pentapeptide-4 is more than or equal to 10 mug/mL.

Further preferably, the preparation method of the milk exosome preparation loaded with palmitoyl pentapeptide-4 comprises the following steps: the addition of palmitoyl pentapeptide-4 to milk exosomes can lead the milk exosomes to reach or not reach supersaturation state, and the preferable addition amount of palmitoyl pentapeptide-4 is 5 mug/mL-10 mg/mL,5 mug/mL-1 mg/mL, 1-5mg/mL,4-10mg/mL, or 6-10 mg/mL. Preferred milk exosome particle count is 1×10 ¹¹ -1×10 ¹² particle/mL, or preferably milk exosome protein concentration 200-500 μg/mL. The pH value of the mixed solution is adjusted to meet the following conditions: the milk exosome preparation can observe complete and clear exosomes under an electron microscope, the purity measured by HPLC is above 55%, the saturated concentration of the alkylated cosmetic peptide is more than or equal to 10 mug/mL, and the preferable pH value is 4-7; stirring at below 37deg.C, physically loading for 1-12 hr, removing free palmitoyl pentapeptide-4, adding lyoprotectant, and freeze drying. The preferred physical loading means is agitation incubation or static incubation, and the preferred means for removing free palmitoyl pentapeptide-4 is molecular sieve, ultrafiltration, or other separation means.

Preferably, any of the above is that the alkylated cosmetic peptide is palmitoyl tetrapeptide-7. To obtain a milk exosome preparation loaded with palmitoyl tetrapeptide-7, the pH of the mixed solution of milk exosome and palmitoyl tetrapeptide-7 satisfies the following conditions: (1) the milk exosome preparation can observe exosome morphology under an electron microscope, and the exosome morphology is complete and clear exosome, namely typical tea-tray-shaped exosome. The purity measured by HPLC is above 55%, and (2) the saturation concentration of the palmitoyl tetrapeptide-7 is more than or equal to 10 mug/mL.

Further preferably, the preparation method of the milk exosome preparation loaded with palmitoyl pentapeptide-4 comprises the following steps: the preferred addition amount of palmitoyl tetrapeptide-4 in milk exosomes is 5 μg/mL to 10mg/mL,5 μg/mL to 1mg/mL, 1 to 5mg/mL,4 to 10mg/mL, or 6 to 10mg/mL, with or without the addition of palmitoyl tetrapeptide-7 to the milk exosomes. Preferred milk exosome particle count is 1×10 ¹¹ -1×10 ¹² particle/mL, or preferably milk exosome protein concentration 200-500 μg/mL. The pH value of the mixed solution is adjusted to meet the following conditions: the milk exosome preparation can observe complete and clear exosomes under an electron microscope, the purity measured by HPLC is above 55%, and the saturated concentration of the alkylated cosmetic peptide is more than or equal to 10 mug/mL, preferably the pH is 4-8, and further preferably 5-6; stirring at below 37deg.C, physically loading for 1-12 hr, removing free palmitoyl tetrapeptide-7, adding lyoprotectant, and freeze-drying. The preferred physical loading mode is stirring incubation or standing incubation, and the preferred mode for removing the free palmitoyl tetrapeptide-7 is molecular sieve, ultrafiltration and other separation means.

Preferably, any of the above is that the alkylated cosmetic peptide is palmitoyl hexapeptide-12. To obtain a milk exosome preparation loaded with palmitoyl hexapeptide-12, the pH of the mixed solution of milk exosome and palmitoyl hexapeptide-12 satisfies the following conditions: (1) the milk exosome preparation can observe exosome morphology under an electron microscope, and the exosome morphology is complete and clear exosome, namely typical tea-tray-shaped exosome. The purity measured by HPLC is above 55%, and (2) the saturation concentration of the palmitoyl hexapeptide-12 is more than or equal to 10 mug/mL.

Further preferably, the preparation method of the milk exosome preparation loaded with palmitoyl hexapeptide-12 comprises the following steps: the addition of palmitoyl hexapeptide-12 to milk exosomes is carried out to enable the milk exosomes to reach or not reach a supersaturated state, and the preferable addition amount of palmitoyl hexapeptide-12 is 10 mug/mL-10 mg/mL, 1-5mg/mL,4-10mg/mL, or 6-10 mg/mL. Preferred milk exosome particle count is 1×10 ¹¹ -1×10 ¹² particle/mL, or preferably milk exosome protein concentration 200-500 μg/mL. The pH value of the mixed solution is adjusted to meet the following conditions: the milk exosome preparation can observe complete and clear exosomes under an electron microscope, the purity measured by HPLC is above 55%, the saturated concentration of the alkylated cosmetic peptide is more than or equal to 10 mug/mL, and the preferable pH value is 5-8; stirring at below 37deg.C, physically loading for 1-12 hr, removing free palmitoyl hexapeptide-12, adding lyoprotectant, and freeze-drying. The preferred physical loading means is agitation incubation or static incubation, and the preferred means for removing free palmitoyl hexapeptide-12 is molecular sieve, ultrafiltration, or other separation means.

Preferably, any of the above is that the alkylated cosmetic peptide is myristoyl hexapeptide-5. To obtain a milk exosome preparation loaded with myristoyl hexapeptide-5, the pH of the mixed solution of milk exosome and myristoyl hexapeptide-5 satisfies the following conditions: (1) the milk exosome preparation can observe exosome morphology under an electron microscope, and the exosome morphology is complete and clear exosome, namely typical tea-tray-shaped exosome. The purity measured by HPLC is 55% or more, and (2) the saturated concentration of myristoyl hexapeptide-5 is 10. Mu.g/mL or more.

Further preferably, the preparation method of the milk exosome preparation loaded with myristoyl hexapeptide-5 comprises the following steps: the myristoyl hexapeptide-5 is added to the milk exosome to achieve or not achieve supersaturation, preferably the myristoyl hexapeptide-5 is added in an amount of 5 μg/mL-10mg/mL,5 μg/mL-1mg/mL, 1-5mg/mL,4-10mg/mL, or 6-10 mg/mL. Preferred milk exosome particle count is 1×10 ¹¹ -1×10 ¹² particle/mL, or preferably milk exosome protein concentration 200-500 μg/mL. The pH value of the mixed solution is adjusted to meet the following conditions: the milkThe exosome preparation can observe complete and clear exosome under an electron microscope, the purity measured by HPLC is above 55%, and the saturated concentration of the alkylated cosmetic peptide is more than or equal to 10 mug/mL, and the preferential pH value is 4-6; stirring at below 37deg.C, physically loading for 1-12 hr, removing free myristoyl hexapeptide-5, adding lyoprotectant, and freeze-drying. The preferred physical loading means is agitation incubation or static incubation, and the preferred means for removing free myristoyl hexapeptide-5 is molecular sieves, ultrafiltration, and the like.

Preferably, any of the above is that the alkylated cosmetic peptide is palmitoyl hexapeptide-15. To obtain a milk exosome preparation loaded with palmitoyl hexapeptide-15, the pH of the mixed solution of the milk exosome and palmitoyl hexapeptide-15 satisfies the following conditions: (1) the milk exosome preparation can observe exosome morphology under an electron microscope, and the exosome morphology is complete and clear exosome, namely typical tea-tray-shaped exosome. The purity measured by HPLC is above 55%, and (2) the saturation concentration of the palmitoyl hexapeptide-15 is more than or equal to 10 mug/mL.

Further preferably, the preparation method of the milk exosome preparation loaded with palmitoyl hexapeptide-15 comprises the following steps: the addition of palmitoyl hexapeptide-15 to milk exosomes is performed to achieve or not achieve a supersaturated state, preferably, the addition amount of palmitoyl hexapeptide-15 is 5 μg/mL to 10mg/mL,5 μg/mL to 1mg/mL, 1 to 5mg/mL,4 to 10mg/mL, or 6 to 10 mg/mL. Preferred milk exosome particle count is 1×10 ¹¹ -1×10 ¹² particle/mL, or preferably milk exosome protein concentration 200-500 μg/mL. The pH value of the mixed solution is adjusted to meet the following conditions: the milk exosome preparation can observe complete and clear exosomes under an electron microscope, the purity measured by HPLC is above 55%, the saturated concentration of the alkylated cosmetic peptide is more than or equal to 10 mug/mL, and the preferable pH value is 4-8; stirring at below 37deg.C, physically loading for 1-12 hr, removing free palmitoyl hexapeptide-15, adding lyoprotectant, and freeze-drying. The preferred physical loading means is agitation incubation or static incubation, and the preferred means for removing free palmitoyl hexapeptide-15 is molecular sieve, ultrafiltration, or other separation means.

Any of the above is preferredWherein the alkylated cosmetic peptide is at least one of palmitoyl dipeptide-7, palmitoyl hexapeptide-14, palmitoyl tripeptide-5, palmitoyl tripeptide-8, palmitoyl tetrapeptide-10, palmitoyl tetrapeptide-5, palmitoyl pentapeptide-5, and myristoyl pentapeptide-4. In order to obtain the milk exosome preparation loaded with the alkylated cosmetic peptide, the pH of the mixed solution of the milk exosome and the alkylated cosmetic peptide satisfies the following conditions: (1) the milk exosome preparation can observe exosome morphology under an electron microscope, and the exosome morphology is complete and clear exosome, namely typical tea-tray-shaped exosome. The purity measured by HPLC is above 55%, and (2) the saturated concentration of the alkylated cosmetic peptide is more than or equal to 10 mug/mL. Further preferably, the preparation method of the milk exosome preparation loaded with the alkylated cosmetic peptide comprises the following steps: the alkylated cosmetic peptide is added into milk exosomes to enable the milk exosomes to reach or not reach a supersaturated state, and the preferable addition amount is 5 mug/mL-10 mg/mL,5 mug/mL-1 mg/mL, 1-5mg/mL,4-10mg/mL or 6-10 mg/mL; preferred milk exosome particle count is 1×10 ¹¹ -1×10 ¹² particles/mL, or preferably milk exosome protein concentration 200-500 μg/mL; the pH value of the mixed solution is adjusted to meet the following conditions: the milk exosome preparation can observe complete and clear exosomes under an electron microscope, the purity measured by HPLC is above 55%, the saturated concentration of the alkylated cosmetic peptide is more than or equal to 10 mug/mL, and the preferable pH value is 4-8; stirring at below 37deg.C, physically loading for 1-12 hr, removing free alkylated cosmetic peptide, adding lyoprotectant, and freeze-drying. The preferred physical loading means is agitation incubation or static incubation, and the preferred means for removing the free alkylated cosmetic peptide is molecular sieve, ultrafiltration, or the like.

Preferably, any of the above, the milk exosome formulation further comprises a solubilizing agent and/or a lyoprotectant.

Preferably, any of the above is that the solubilising agent is a cationic emulsifier. The cationic emulsifier solubilizes the alkylated cosmetic peptide, forms positive-charge cationic micelle with the alkylated cosmetic peptide, and attracts the alkylated cosmetic peptide and the cationic micelle with the positive-charge cationic micelle to each other through electrostatic acting force in the incubation process of the alkylated cosmetic peptide and the milk exosome with the negative charge surface at the temperature of below 37 ℃ and finally realizes loading of the alkylated cosmetic peptide in the milk exosome.

Preferably, any one of the above-mentioned materials is at least one of cetyltrimethylammonium chloride, tetradecyltrimethylammonium chloride and octadecyltrimethylammonium chloride. Any of the above is preferable that the amount of the solubilizer added is 3-10mg/mL. Further preferably 3, 4, 5, 6, 7, 8, 9, 10mg/mL.

Preferably, any of the above is that the solubilizing agent is 3-10mg/mL cetyltrimethylammonium chloride. Further preferred are cetyltrimethylammonium chloride at 3, 4, 5, 6, 7, 8, 9, 10mg/mL. Or preferably 3-10mg/mL tetradecyltrimethylammonium chloride; or preferably 3-10mg/mL octadecyl trimethyl ammonium chloride.

Preferably, any of the above is that the lyoprotectant is mannitol and/or trehalose.

The invention also provides a preparation method of the milk exosome preparation loaded with the alkylated cosmetic peptide, which comprises the following steps: step 1) adding alkylated cosmetic peptide into milk exosome solution; step 2) adjusting the pH value of the mixed solution to meet the following conditions: the milk exosome preparation can observe complete and clear exosomes under an electron microscope, the purity measured by HPLC is more than 55%, and the saturated concentration of the alkylated cosmetic peptide is more than or equal to 10 mug/mL.

Preferably, the preparation method further comprises the step 3) of stirring at the temperature below 37 ℃, physically loading for 1-12h, removing free peptide, adding a lyoprotectant, and freeze-drying for preservation.

Preferably, in step 1), the alkylated cosmetic peptide is added to the milk exosome solution, and the alkylated cosmetic peptide is loaded when the concentration of the alkylated cosmetic peptide is less than saturation after the addition.

Preferably, in step 1), an alkylated cosmetic peptide is added to the milk exosome solution so that the alkylated cosmetic peptide is in a supersaturated state; the alkylated cosmetic peptide is loaded in a supersaturated state, and the loading capacity of the alkylated cosmetic peptide is greatly improved.

Preferably, in step 3), the physical loading mode is stirring incubation or standing incubation, and the preferred mode for removing the free alkylated cosmetic peptide is molecular sieve, ultrafiltration and other separation means.

Preferably, the method for loading the alkylated cosmetic peptide into the milk exosome provided by the invention comprises the following steps: at 1X 10 ¹¹ -1×10 ¹² particles/mL, and protein concentration is 200-500 mug/mL, adding alkylated cosmetic peptide, wherein the final concentration of the alkylated cosmetic peptide is set to 0.1-10mg/mL. Adjusting the pH value of the mixed solution: the structure of the milk exosome is stable, the complete and clear exosome can be observed by an electron microscope, and the purity measured by HPLC is above 55%; and the saturated concentration of the alkylated cosmetic peptide is more than or equal to 10 mug/mL. A proper amount of solubilizer can be added. Stirring at below 37deg.C, physically loading for 1-12 hr, removing free peptide, adding mannitol and trehalose, and freeze drying for storage.

Preferably, the pH of the mixed solution is adjusted to meet the following conditions: (1) the milk exosome preparation can observe exosome morphology under an electron microscope, and the exosome morphology is complete and clear exosome, namely typical tea-tray-shaped exosome. Purity of 55% or more as measured by HPLC, and (2) the saturated concentration of the alkylated cosmetic peptide, which refers to the solubility of the peptide in the exosome formulation after pH adjustment, reaches or exceeds 10 μg/mL, 20 μg/mL, 30 μg/mL, 40 μg/mL or 50 μg/mL. Wherein the saturated concentration of the alkylated cosmetic peptide in the aqueous solution with the pH value of 6.5-7.5 is less than or equal to 50 mug/mL, and the alkylated cosmetic peptide comprises, but is not limited to, palmitoyl tripeptide-1, palmitoyl pentapeptide-4, palmitoyl tetrapeptide-7, palmitoyl hexapeptide-12, myristoyl hexapeptide-5, palmitoyl hexapeptide-15 and the like.

Preferably, the concentration of milk exosomes is 300-400 μg/mL;

preferably, the concentration of the alkylated cosmetic peptide is 1-5mg/mL, 6-10mg/mL or 4-10mg/mL;

in any of the above, it is preferable that 3 to 10mg/mL of cetyltrimethylammonium chloride as a solubilizer is added to the mixed solution.

Preferably, any of the above is removed by molecular sieve chromatography or ultrafiltration.

The invention also provides the application of the milk exosome preparation loaded with the alkylated cosmetic peptide in cosmetics.

Furthermore, the application of the milk exosome-alkylated cosmetic peptide composite raw material in cosmetics is provided, and the application technical scheme is as follows: the milk exosome composite material loaded with alkylated cosmetic peptide is added into cosmetic at a ratio of 0.01-10.00%.

In a preferred embodiment of the invention, the alkylated cosmetic peptide is preferably palmitoyl tripeptide-1.

Preferably, the pH is adjusted to 4-6, so that the milk exosome preparation (1) can observe complete and clear exosomes under an electron microscope, the purity measured by HPLC is more than 55%, and the saturation concentration of the palmitoyl tripeptide-1 (2) is more than or equal to 10 mug/mL.

In a preferred embodiment of the invention, the alkylated cosmetic peptide is preferably a tetrapeptide.

Preferably, the pH is adjusted to 5-6, so that the milk exosome preparation (1) can observe complete and clear exosomes under an electron microscope, the purity measured by HPLC is more than 55%, and the saturated concentration of tetrapeptides (2) is more than or equal to 10 mug/mL.

In a preferred embodiment of the invention, the alkylated cosmetic peptide is preferably palmitoyl hexapeptide-12.

Preferably, the pH is adjusted to be 5-6, so that the milk exosome preparation meets the requirements that (1) complete and clear exosomes can be observed under an electron microscope, the purity measured by HPLC is more than 55%, and the saturation concentration of the palmitoyl hexapeptide-12 is more than or equal to 10 mug/mL.

In a preferred embodiment of the invention there is provided the use of a preparation of milk exosomes loaded with palmitoyl tripeptide-1 (abbreviated herein as ME-GHK) for the manufacture of a cosmetic product, in particular for the manufacture of an ocular skin care product.

Preferably, the preparation method comprises the following steps:

1) Adding the component A into an oil phase pot, starting stirring at 1000rpm, heating to 80 ℃, and preserving heat for 10min to obtain an oil phase mixed solution;

2) Adding the component B into a water phase pot, starting stirring at 600rpm, heating to 85 ℃, and preserving heat for 15min to obtain a water phase mixed solution;

3) After the water phase mixed solution is sucked into the emulsifying pot, starting the emulsifying pot to stir at the rotating speed of 60rpm, slowly sucking the oil phase mixed solution into the emulsifying pot by controlling a vacuum valve, and then starting to homogenize for 5min at the rotating speed of 3000rpm;

4) After homogenization is completed, cooling to 30 ℃ by cooling water, adding the component C, stirring for 5min, and then starting homogenization for 5min, wherein the homogenization rotating speed is 1000rpm.

Preferred A components include lecithin, macadamia nut seed oil, wheat germ oil, 16/18 alcohol;

preferred B components include AVC (acrylic acid polymer), methyl paraben, dipropylene glycol, deionized water;

preferred C components include ME-GHK, phenoxyethanol.

Preferred A components: lecithin 1.0%, macadamia nut seed oil 1.5%, wheat germ oil 0.5%,16/18 alcohol 0.5%;

preferred component B: 0.5% of AVC (acrylic acid polymer), 0.1% of methyl hydroxybenzoate, 5% of dipropylene glycol and 90.1% of deionized water;

preferred C component: ME-GHK 0.5% and phenoxyethanol 0.3%.

Preferably ME-GHK 1.0%, phenoxyethanol 0.3%.

The milk exosome loaded with the alkylated cosmetic peptide provided by the invention is a powerful composite cosmetic raw material product. As a natural intercellular information transmission carrier, the milk exosome has good transdermal function. The milk exosome is used as a delivery carrier of the cosmetic peptide, the loading capacity, the delivery capacity and the skin care effect of the milk exosome are comprehensively utilized, the skin care and anti-aging effects of the cosmetic peptide are also utilized, and the transdermal effect of the cosmetic peptide can be enhanced by utilizing the milk exosome. The milk exosome loaded with the alkylated cosmetic peptide is applied to cosmetics, and the efficacy of the milk exosome is more than the sum of the efficacy of the milk exosome and the efficacy of the cosmetic peptide which are independently used, so that the comprehensive effect of 1+1>2 is achieved.

Drawings

FIG. 1 effect of pH on milk exosome stability at pH 1 and 2 in the preferred embodiment 1 of the present invention.

FIG. 2 effect of pH on milk exosome stability at pH 3 and 4 in the preferred embodiment 1 of the present invention.

FIG. 3 effect of pH on milk exosome stability at pH 5 and 6 in preferred embodiment 1 of the present invention.

FIG. 4 effect of pH on milk exosome stability at pH 7 and 8 in preferred embodiment 1 of the present invention.

FIG. 5 effect of pH on milk exosome stability at pH 9 and 10 in preferred embodiment 1 of the present invention.

FIG. 6 electron microscopy results of the effect of pH on milk exosome stability in preferred embodiment 1 of the present invention.

FIG. 7 shows the encapsulation efficiency of preferred embodiment 2 of the present invention, wherein FIG. A is a Mill-exo control group and FIG. B is ME-GHK loaded onto Milk exosomes in embodiment 2.

FIG. 8 is an electron micrograph of the milk secretion before and after loading in accordance with the preferred embodiment 2 of the present invention.

Fig. 9 is a schematic diagram of the loading process in the preferred embodiment 3 of the present invention.

FIG. 10 shows the detection of the encapsulation efficiency in the sample of comparative example 4 according to the present invention, wherein A is a blank sample of Milk exosomes of Milk-exo, and B is Milk exosomes of example 4 after mixing with Pal-GHK.

FIG. 11A cell assay in accordance with the preferred embodiment 5 of the present invention detects the effect of the samples of examples 2 and 4 on ColI expression.

FIG. 12A zebra fish assay in preferred example 6 of the invention detects the effect of sample three of example on ColI expression.

Detailed Description

The present invention will be more clearly and fully described by the following examples, which are intended to be illustrative of only some, but not all, of the examples. The examples are presented to aid in understanding the invention and should not be construed to limit the scope of the invention in any way.

Example 1

Stable pH of exosomes

The aqueous solution of milk exosomes was adjusted to different pH with dilute hydrochloric acid and NaOH solution. After incubation for 1h, the purity of the sample is detected by molecular exclusion chromatography, and the exosomes of the large particles show a peak first, and fragments after exosomes are cracked show a peak. Thus, the fewer exosome peaks, the higher the purity, the more complete the exosome, and the more stable the exosome in the corresponding pH environment. The results are shown in FIGS. 1-6 (the percentages in FIGS. 1-5 represent the exosome purity under each pH condition, and FIG. 6 is an exosome electron microscope), the exosome purity from pH4 to pH6 is high, and the exosome forms are clear and complete, so that the stable pH of the milk exosome is 4-6.

Example 2

Loading process 1

To 300. Mu.g/mL milk exosomes, pal-GHK (palmitoyl tripeptide-1) was added to a concentration of 3.7mg/mL. The mixed solution was adjusted to pH4.0 with dilute hydrochloric acid and NaOH, at which time the saturation concentration of Pal-GHK was 20. Mu.g/mL. Stirring at a temperature below 37deg.C, and physically loading.

After physical loading for 1-3h, removing free Pal-GHK small molecules by molecular sieve chromatography, adding mannitol and trehalose as lyoprotectants, and freeze-drying for preservation. The freeze-dried milk exosome-palmitoyl tripeptide-1 (ME-GHK) is subjected to reversed phase chromatography HPLC to detect the Pal-GHK in the sample, and the encapsulation efficiency is calculated.

Encapsulation% = HPLC detected loaded Pal-GHK/total Pal-GHK dose x 100%

As calculated from fig. 7, the encapsulation efficiency was 25.4%. In FIG. 7, panel A shows a Milk-exo control group, panel B shows ME-GHK loaded onto Milk exosomes in example 2, and the peak at the arrow in the ME-GHK plot corresponds to a time of 7.458min. At this time, on average, 4 x 10≡6 palmitoyl tripeptide-1 molecules were loaded on one exosome particle. Fig. 8 shows the electron microscope images of the exosomes before and after loading, and shows that the morphology of the exosomes after loading changes, the size becomes larger, and only sporadic two exosomes which are not loaded show the particle size within 100 nm.

Example 3

Loading Process 2

To 400. Mu.g/mL of milk exosomes, palmitoyl tripeptide-1 (Pal-GHK) was added to a concentration of 5mg/mL, cetyltrimethylammonium chloride as a solubilizer was added to 5mg/mL, and the mixed solution was adjusted to pH6.0 with dilute hydrochloric acid and NaOH. Stirring at a temperature below 37deg.C, and physically loading.

Fig. 9 illustrates the loading process, wherein the cationic emulsifier solubilizes Pal-GHK and forms cationic micelle with positive charges on the surface, and the cationic emulsifier and the exosome with negative charges on the surface attract each other through electrostatic force in the incubation process under the temperature condition of below 37 ℃, and finally the Pal-GHK loading in the exosome is realized. The cationic emulsifier is 3-10mg/mL cetyltrimethylammonium chloride.

Encapsulation% = HPLC detected loaded Pal-GHK/total Pal-GHK dose x 100%

Calculated, the encapsulation efficiency was 32.3%. In a 500mL loading system, the encapsulation efficiency of Pal-GHK is as high as 32.3%. Meaning that on average 1 molecule of milk exosomes are loaded with 10 ⁶ And Pal-GHK molecules.

Example 4 (comparative example)

Mixing process

To 300. Mu.g/mL of milk exosomes, pal-GHK was added to a concentration of 0.94mg/mL and the mixed solution was adjusted to pH7.0 with NaOH. Stirring at below 37deg.C, and physically mixing. After physical mixing for 1h, free Pal-GHK small molecules are removed by molecular sieve chromatography, and freeze-drying protecting agents mannitol and trehalose are added for freeze-drying preservation. The Pal-GHK in this example was identical to that in example 2, except that all of the Pal-GHK in example 2 was loaded on milk exosomes.

At pH7.0, the exosome structure was observed to be intact and clear under electron microscopy, but the saturation concentration of Pal-GHK was only 4.7. Mu.g/mL.

After physical mixing for 1h, it was checked whether Pal-GHK was loaded onto exosomes: centrifuging at 8000rpm for 30min to remove undissolved Pal-GHK, ultrafiltering supernatant to remove free soluble Pal-GHK small molecules, and retaining exosomes and exosomes after loading. The entrapment of the polypeptides in the Milk exosomes was only 0.06% by HPLC using reversed phase chromatography (fig. 10, panel a shows a blank sample of Milk exosomes of Milk-exo, panel B shows Milk exosomes of Milk-exo mixed with Pal-GHK of example 4, and panel B shows a peak of Pal-GHK corresponding to 7.729 min).

Thus, it is believed that in this example, the milk exosomes are only physically mixed with Pal-GHK.

Example 5

Cell testing

The lyophilized ME-GHK obtained in example 2 was added to the medium of human skin fibroblasts at a final concentration of 0.067% (w/w), at which time the corresponding milk exosomes were added in an amount of 2 μg/mL and pal-GHK was added in an amount of 6.3 μg/mL. A control blank (control) was set, milk exosomes 2 μg/mL control, pal-GHK 6.3 μg/mL control. An equal amount of the lyophilized sample of example 4 was added simultaneously to the exosome in an amount of 2 μg/mL.37 ℃,5% CO ₂ Culturing in incubator with irradiation dose of 50mJ/cm twice a day ² Is used for collecting cells after 48 hours. The ColI transcription level of the cell samples was detected by RT-PCR. As shown in FIG. 11, 2. Mu.g/mL of milk exosomes increased the Col I transcription level by 33.5%, 6.3. Mu.g/mL pal-GHK increased the Col I transcription level by 5.29-fold, and the composite material increased by 7.82-fold. From this, it was found that the transcription level of collagen I by the composite material was increased over the sum of the effects of exosomes and polypeptides in the same amount. The combination of the two achieves 1+1>2 effect.

On the other hand, the sample of example 4 increased ColI transcription level to 1.54-fold. However, this degree of change is not significantly different from the exosomes themselves. This result also demonstrates that the exosome sample of example 4 is substantially free of Pal-GHK.

Primer sequences for RT-PCR detection are shown in the following table:

TABLE 1 RT-PCR primer sequences for human fibroblasts

Primer	Sequences (5' to 3')	Bases number
			Seq ID NO：1 Col Ⅰ-F	CCAGAAGAACTGGTACATCA	20
Seq ID NO：2 Col Ⅰ-R	CCGCCATACTCGAACTGGAA	20
			Seq ID NO：3 GAPDH-F	CGCTCTCTGCTCCTCCTGTT	20
Seq ID NO：4 GAPDH-R	GCGACGCAAAAGAAGATG	18

Example 6

Zebra fish test

In order to quantitatively investigate the in vivo efficacy of ME-GHK, zebra fish experiments were used herein to examine the effect of ME-GHK, milk exosomes and pal-GHK on collagen ColI transcription levels.

180-tail 5 dpf (post-fertilization 5 d) wild type AB strain zebra fish were randomly selected for this experiment and placed in six well plates (capacity 3 mL) with 30-tail zebra fish in each well. Setting a sample group to be tested: the lyophilized milk exosome-palmitoyl tripeptide-1 composite material (ME-GHK, i.e., the milk exosome preparation loaded with palmitoyl tripeptide-1 provided in example 3 of the present invention) was added to a final concentration of 0.05% (w/w), at which time the corresponding milk exosome addition was 1.5. Mu.g/mL and pal-GHK addition was 8. Mu.g/mL. A control blank (control) was also set, a milk exosome control (milk exosome, 1.5. Mu.g/mL), a pal-GHK control (pal-GHK, 8. Mu.g/mL).

After 24 hours of sample treatment, the total RNA of each test group was extracted by Trizol method, and then the total RNA mass concentration and purity were measured.

The sequences of the primers used for the determination are shown in the following table:

TABLE 3 RT-PCR primer sequences of zebra fish

Primer	Sequences (5' to 3')	Bases number
			Seq ID NO：5 Col Ⅰ-F	ACCGTAATGTGCGACGAAGT	20
Seq ID NO：6 Col Ⅰ-R	CCTGGAAATCGTCGTCTGGG	20
			Seq ID NO：7 β-actin-F	TCGAGCAGGAGATGGGAACC	20
Seq ID NO：8 β-actin-R	CTCGTGGATACCGCAAGATTC	21

As shown in FIG. 12, 1.5. Mu.g/mL milk exosomes increased Col I transcription level by 5.5%, 8. Mu.g/mL pal-GHK increased Col I transcription level by 79%, and 182% of the composite material. From this, the effect of the composite material on increasing the collagen I transcription level was far more than the sum of the effects of exosomes and polypeptides in the same amount administered. The rate of elevation even exceeded experimental data for human skin fibroblasts. This demonstrates that the complex sample ME-GHK has the effect of promoting transdermal absorption of the polypeptide in addition to the up-regulation effect of collagen transcription by combining the two components.

Example 7

An eye essence containing ME-GHK comprises the following components in percentage by mass:

and (3) a component A: lecithin 1.0%, macadamia nut seed oil 1.5%, wheat germ oil 0.5%,16/18 alcohol 0.5%;

and the component B comprises the following components: 0.5% of AVC (acrylic acid polymer), 0.1% of methyl hydroxybenzoate, 5% of dipropylene glycol and 90.1% of deionized water;

and C, component: ME-GHK 0.5% and phenoxyethanol 0.3%.

Example 8

and the component B comprises the following components: 0.5% of AVC (acrylic acid polymer), 0.1% of methyl hydroxybenzoate, 5% of dipropylene glycol and 89.6% of deionized water;

and C, component: ME-GHK 1.0% and phenoxyethanol 0.3%.

Example 9 (comparative example)

An eye essence not containing ME-GHK comprises the following components in percentage by mass:

and the component B comprises the following components: 0.5% of AVC (acrylic acid polymer), 0.1% of methyl hydroxybenzoate, 5% of dipropylene glycol and 90.6% of deionized water;

and C, component: phenoxyethanol 0.3%

Example 10

The preparation method of the eye essence comprises the following steps:

1) Adding the component A in the examples 7, 8 and 9 into an oil phase pot, starting stirring, heating to 80 ℃ at the rotating speed of 1000rpm, and preserving heat for 10min to obtain an oil phase mixed solution;

4) After homogenization is completed, cooling to 30 ℃ by cooling water, adding the component C, stirring for 5min, and then starting homogenization for 5min, wherein the homogenization rotating speed is 1000rpm. And discharging to obtain the eye essence.

Example 11

Trial effect detection of three eye essences

Group of subjects: 30 adult females, between 45-55 years of age, are divided into three groups;

the test method comprises the following steps: the ocular essences prepared in examples 7, 8 and 9 were used in the periocular region, once a day and once a night, for 4 weeks, and skin texture changes were measured with FOITS (rapid photo imaging method of skin) to evaluate the number, depth and area of wrinkles and fine lines in the canthus and the tail area, and the test results were as follows

TABLE 3 Table 3

	Example 7	Example 8	Example 9 (comparative example)
				Variation in average wrinkle count	-9.0%*	-13.1%*	1.2%
Average wrinkle depth variation	-8.3%*	-15.3%*	0.0%
				Average wrinkle area variation	-37.4%*	-47.2%*	-3.4%

Example 12

Loading process

To 300. Mu.g/mL of milk exosomes, palmitoyl tetrapeptide-7 was added to a concentration of 8mg/mL, the mixed solution was adjusted to pH5.0-pH6.0 with dilute hydrochloric acid and NaOH, and cholesterol was added to 2mg/mL to aid solubilization. Stirring at a temperature below 37deg.C, and physically loading.

After physical loading for 1-3h, removing free palmitoyl tetrapeptide-7 small molecules and cholesterol by molecular sieve chromatography, adding mannitol and trehalose as lyoprotectant, and freeze-drying for preservation. The freeze-dried milk exosome-palmitoyl tetrapeptide-7 is subjected to reverse phase chromatography HPLC to detect the palmitoyl tetrapeptide-7 in the sample, and the encapsulation efficiency is calculated.

Encapsulation% = loaded palmitoyl tetrapeptide-7 detected by HPLC/total palmitoyl tetrapeptide-7 dose x 100%

Calculated, the encapsulation efficiency was 41.2%.

Example 13

The preparation method of the milk exosome preparation loaded with palmitoyl pentapeptide-4 comprises the following steps: the preferred addition amount of palmitoyl pentapeptide-4 is 5ug/mL-10mg/mL, 1-5mg/mL,4-10mg/mL, or 6-10 mg/mL in the milk exosome. The pH value of the mixed solution is adjusted to meet the following conditions: the milk exosome preparation can observe complete and clear exosomes under an electron microscope, the purity measured by HPLC is above 55%, the saturated concentration of the alkylated cosmetic peptide is more than or equal to 10 mug/mL, and the preferable pH value is 4-7; stirring at below 37deg.C, physically loading for 1-12 hr, removing free palmitoyl pentapeptide-4, adding lyoprotectant, and freeze drying. The preferred physical loading means is agitation incubation or static incubation, and the preferred means for removing free palmitoyl pentapeptide-4 is molecular sieve, ultrafiltration, or other separation means.

The palmitoyl pentapeptide-4 alkane chain is inserted into the phospholipid bilayer membrane of the milk exosome, so that the loading and loaded relation of the peptide and the milk exosome is realized, and the saturation concentration of the palmitoyl pentapeptide-4 in the milk exosome preparation is greatly improved.

Example 13 it is further preferred that the pH of the mixed solution is adjusted by adding palmitoyl pentapeptide-4 to the milk exosomes to reach a supersaturation state. The addition of palmitoyl pentapeptide-4 to supersaturate the milk exosomes loaded with palmitoyl pentapeptide-4 can further increase the encapsulation efficiency of the milk exosomes.

Example 14

The preparation method of the milk exosome preparation loaded with palmitoyl hexapeptide-12 comprises the following steps: the preferred addition amount of palmitoyl hexapeptide-12 is 5ug/mL-10mg/mL, 1-5mg/mL,4-10mg/mL, or 6-10 mg/mL in the milk exosome. The pH value of the mixed solution is adjusted to meet the following conditions: the milk exosome preparation can observe complete and clear exosomes under an electron microscope, the purity measured by HPLC is above 55%, the saturated concentration of the alkylated cosmetic peptide is more than or equal to 10 mug/mL, and the preferable pH value is 5-8; stirring at below 37deg.C, physically loading for 1-12 hr, removing free palmitoyl hexapeptide-12, adding lyoprotectant, and freeze-drying. The preferred physical loading means is agitation incubation or static incubation, and the preferred means for removing free palmitoyl hexapeptide-12 is molecular sieve, ultrafiltration, or other separation means.

The palmitoyl hexapeptide-12 alkane chain is inserted into the phospholipid bilayer membrane of the milk exosome, so that the loading and loaded relation of the peptide and the milk exosome is realized, and the saturation concentration of the palmitoyl hexapeptide-12 in the milk exosome preparation is greatly improved.

Example 14 it is further preferred that the pH of the mixed solution is adjusted by adding palmitoyl hexapeptide-12 to the milk exosomes to reach a supersaturation state. The addition of palmitoyl hexapeptide-12 to a supersaturated state can further increase the encapsulation efficiency of milk exosomes loaded with palmitoyl hexapeptide-12.

Example 15

The preparation method of the milk exosome preparation loaded with myristoyl hexapeptide-5 comprises the following steps: the preferred addition amount of myristoyl hexapeptide-5 to the milk exosomes is 10ug/mL to 10mg/mL, 1 to 5mg/mL,4 to 10mg/mL, or 6 to 10 mg/mL. The pH value of the mixed solution is adjusted to meet the following conditions: the milk exosome preparation can observe complete and clear exosomes under an electron microscope, the purity measured by HPLC is above 55%, the saturated concentration of the alkylated cosmetic peptide is more than or equal to 10 mug/mL, and the preferable pH value is 4-6; stirring at below 37deg.C, physically loading for 1-12 hr, removing free myristoyl hexapeptide-5, adding lyoprotectant, and freeze-drying. The preferred physical loading means is agitation incubation or static incubation, and the preferred means for removing free myristoyl hexapeptide-5 is molecular sieves, ultrafiltration, and the like.

The myristoyl hexapeptide-5 alkane chain is inserted into the phospholipid bilayer membrane of the milk exosome, so that the loading and loaded relation between the peptide and the milk exosome is realized, and the saturation concentration of myristoyl hexapeptide-5 in the milk exosome preparation is greatly improved.

Example 15 it is further preferable that myristoyl hexapeptide-5 is added to the milk exosome to bring it into supersaturation, and the pH of the mixed solution is adjusted. The encapsulation efficiency of the milk exosomes loaded with myristoyl hexapeptide-5 can be further improved by adding myristoyl hexapeptide-5 to a supersaturated state.

Example 16

The preparation method of the milk exosome preparation loaded with palmitoyl hexapeptide-15 comprises the following steps: the preferred addition amount of palmitoyl hexapeptide-15 is 5ug/mL-10mg/mL, 1-5mg/mL,4-10mg/mL, or 6-10 mg/mL in the milk exosome. The pH value of the mixed solution is adjusted to meet the following conditions: the milk exosome preparation can observe complete and clear exosomes under an electron microscope, the purity measured by HPLC is above 55%, the saturated concentration of the alkylated cosmetic peptide is more than or equal to 10 mug/mL, and the preferable pH value is 4-8; stirring at below 37deg.C, physically loading for 1-12 hr, removing free palmitoyl hexapeptide-15, adding lyoprotectant, and freeze-drying. The preferred physical loading means is agitation incubation or static incubation, and the preferred means for removing free palmitoyl hexapeptide-15 is molecular sieve, ultrafiltration, or other separation means.

The palmitoyl hexapeptide-15 alkane chain is inserted into the phospholipid bilayer membrane of the milk exosome, so that the loading and loaded relation of the peptide and the milk exosome is realized, and the saturation concentration of the palmitoyl hexapeptide-15 in the milk exosome preparation is greatly improved.

Example 16 it is further preferred that the pH of the mixed solution is adjusted by adding palmitoyl hexapeptide-15 to the milk exosome to bring it into supersaturation. The addition of palmitoyl hexapeptide-15 to a supersaturated state can further increase the encapsulation efficiency of milk exosomes loaded with palmitoyl hexapeptide-15.

Example 17

The preparation method of the milk exosome preparation loaded with palmitoyl dipeptide-7 comprises the following steps: the preferred addition amount of palmitoyl dipeptide-7 is 5ug/mL-10mg/mL, 1-5mg/mL,4-10mg/mL, or 6-10 mg/mL in the milk exosome. The pH value of the mixed solution is adjusted to meet the following conditions: the milk exosome preparation can observe complete and clear exosomes under an electron microscope, the purity measured by HPLC is above 55%, the saturated concentration of the alkylated cosmetic peptide is more than or equal to 10 mug/mL, and the preferable pH value is 4-8; stirring at below 37deg.C, physically loading for 1-12 hr, removing free palmitoyl dipeptide-7, adding lyoprotectant, and freeze-drying. The preferred physical loading means is agitation incubation or static incubation, and the preferred means for removing free palmitoyl dipeptide-7 is molecular sieve, ultrafiltration, or other separation means.

The palmitoyl dipeptide-7 alkane chain is inserted into the phospholipid bilayer membrane of the milk exosome, so that the loading and loaded relation of the peptide and the milk exosome is realized, and the saturation concentration of the palmitoyl dipeptide-7 in the milk exosome preparation is greatly improved.

Example 17 it is further preferred that the pH of the mixed solution is adjusted by adding palmitoyl dipeptide-7 to the milk exosome to bring it into supersaturation. The addition of palmitoyl dipeptide-7 to a supersaturated state can further increase the encapsulation efficiency of milk exosomes loaded with palmitoyl dipeptide-7.

Example 18

The preparation method of the milk exosome preparation loaded with palmitoyl hexapeptide-14 comprises the following steps: the preferred addition amount of palmitoyl hexapeptide-14 is 5ug/mL-10mg/mL, 1-5mg/mL,4-10mg/mL, or 6-10 mg/mL in the milk exosome. The pH value of the mixed solution is adjusted to meet the following conditions: the milk exosome preparation can observe complete and clear exosomes under an electron microscope, the purity measured by HPLC is above 55%, the saturated concentration of the alkylated cosmetic peptide is more than or equal to 10 mug/mL, and the preferable pH value is 4-8; stirring at below 37deg.C, physically loading for 1-12 hr, removing free palmitoyl hexapeptide-14, adding lyoprotectant, and freeze-drying. The preferred physical loading means is agitation incubation or static incubation, and the preferred means for removing free palmitoyl hexapeptide-14 is molecular sieve, ultrafiltration, or the like.

The palmitoyl hexapeptide-14 alkane chain is inserted into the phospholipid bilayer membrane of the milk exosome, so that the loading and loaded relation of the peptide and the milk exosome is realized, and the saturation concentration of the palmitoyl hexapeptide-14 in the milk exosome preparation is greatly improved.

Example 18 it is further preferred that the pH of the mixed solution is adjusted by adding palmitoyl hexapeptide-14 to the milk exosomes to reach a supersaturation state. The addition of palmitoyl hexapeptide-14 to a supersaturated state can further increase the encapsulation efficiency of milk exosomes loaded with palmitoyl hexapeptide-14.

Example 19

The preparation method of the milk exosome preparation loaded with palmitoyl tripeptide-5 comprises the following steps: the preferred addition amount of palmitoyl tripeptide-5 is 5ug/mL-10mg/mL, 1-5mg/mL,4-10mg/mL, or 6-10 mg/mL in the milk exosome. The pH value of the mixed solution is adjusted to meet the following conditions: the milk exosome preparation can observe complete and clear exosomes under an electron microscope, the purity measured by HPLC is above 55%, the saturated concentration of the alkylated cosmetic peptide is more than or equal to 10 mug/mL, and the preferable pH value is 4-8; stirring at below 37deg.C, physically loading for 1-12 hr, removing free palmitoyl tripeptide-5, adding lyoprotectant, and freeze drying. The preferred physical loading means is agitation incubation or static incubation, and the preferred means for removing free palmitoyl tripeptide-5 is molecular sieves, ultrafiltration, and the like.

The palmitoyl tripeptide-5 alkane chain is inserted into the phospholipid bilayer membrane of the milk exosome, so that the loading and loaded relation of the peptide and the milk exosome is realized, and the saturation concentration of the palmitoyl tripeptide-5 in the milk exosome preparation is greatly improved.

Example 19 it is further preferred that the pH of the mixed solution is adjusted by adding palmitoyl tripeptide-5 to the milk exosome to bring it into supersaturation. The addition of palmitoyl tripeptide-5 to achieve supersaturation can further increase the encapsulation efficiency of milk exosomes loaded with palmitoyl tripeptide-5.

Example 20

The preparation method of the milk exosome preparation loaded with palmitoyl tripeptide-8 comprises the following steps: the preferred addition amount of palmitoyl tripeptide-8 is 5ug/mL-10mg/mL, 1-5mg/mL,4-10mg/mL, or 6-10 mg/mL in the milk exosome. The pH value of the mixed solution is adjusted to meet the following conditions: the milk exosome preparation can observe complete and clear exosomes under an electron microscope, the purity measured by HPLC is above 55%, the saturated concentration of the alkylated cosmetic peptide is more than or equal to 10 mug/mL, and the preferable pH value is 4-8; stirring at below 37deg.C, physically loading for 1-12 hr, removing free palmitoyl tripeptide-8, adding lyoprotectant, and freeze drying. The preferred physical loading means is agitation incubation or static incubation, and the preferred means for removing free palmitoyl tripeptide-8 is molecular sieves, ultrafiltration, and the like.

The palmitoyl tripeptide-8 alkane chain is inserted into the phospholipid bilayer membrane of the milk exosome, so that the loading and loaded relation of the peptide and the milk exosome is realized, and the saturation concentration of the palmitoyl tripeptide-8 in the milk exosome preparation is greatly improved.

Example 20 it is further preferred that the pH of the mixed solution is adjusted by adding palmitoyl tripeptide-8 to the milk exosome to bring it to a supersaturation state. The addition of palmitoyl tripeptide-8 to achieve supersaturation can further increase the encapsulation efficiency of milk exosomes loaded with palmitoyl tripeptide-8.

Example 21

The preparation method of the milk exosome preparation loaded with palmitoyl tetrapeptide-10 comprises the following steps: the preferred addition amount of palmitoyl tetrapeptide-10 is 5ug/mL-10mg/mL, 1-5mg/mL,4-10mg/mL, or 6-10 mg/mL in milk exosomes. The pH value of the mixed solution is adjusted to meet the following conditions: the milk exosome preparation can observe complete and clear exosomes under an electron microscope, the purity measured by HPLC is above 55%, the saturated concentration of the alkylated cosmetic peptide is more than or equal to 10 mug/mL, and the preferable pH value is 4-8; stirring at below 37deg.C, physically loading for 1-12 hr, removing free palmitoyl tetrapeptide-10, adding lyoprotectant, and freeze-drying. The preferred physical loading mode is stirring incubation or standing incubation, and the preferred mode for removing the free palmitoyl tetrapeptide-10 is molecular sieve, ultrafiltration and other separation means.

The palmitoyl tetrapeptide-10 alkane chain is inserted into the phospholipid bilayer membrane of the milk exosome, so that the loading and loaded relation of the peptide and the milk exosome is realized, and the saturation concentration of the palmitoyl tetrapeptide-10 in the milk exosome preparation is greatly improved.

Example 21 it is further preferable that the mixed solution pH is adjusted by adding palmitoyl tetrapeptide-10 to the milk exosome to reach a supersaturation state. The addition of palmitoyl tetrapeptide-10 to achieve supersaturation can further increase the encapsulation efficiency of milk exosomes loaded with palmitoyl tetrapeptide-10.

Example 22

The preparation method of the milk exosome preparation loaded with palmitoyl tetrapeptide-5 comprises the following steps: the preferred addition amount of palmitoyl tetrapeptide-5 is 5ug/mL-10mg/mL, 1-5mg/mL,4-10mg/mL, or 6-10 mg/mL in the milk exosome. The pH value of the mixed solution is adjusted to meet the following conditions: the milk exosome preparation can observe complete and clear exosomes under an electron microscope, the purity measured by HPLC is above 55%, the saturated concentration of the alkylated cosmetic peptide is more than or equal to 10 mug/mL, and the preferable pH value is 4-8; stirring at below 37deg.C, physically loading for 1-12 hr, removing free palmitoyl tetrapeptide-5, adding lyoprotectant, and freeze-drying. The preferred physical loading mode is stirring incubation or standing incubation, and the preferred mode for removing the free palmitoyl tetrapeptide-5 is molecular sieve, ultrafiltration and other separation means.

The palmitoyl tetrapeptide-5 alkane chain is inserted into the phospholipid bilayer membrane of the milk exosome, so that the loading and loaded relation of the peptide and the milk exosome is realized, and the saturation concentration of the palmitoyl tetrapeptide-5 in the milk exosome preparation is greatly improved.

Example 22 it is further preferred that the pH of the mixed solution is adjusted by adding palmitoyl tetrapeptide-5 to the milk exosomes to reach a supersaturation state. The addition of palmitoyl tetrapeptide-5 to achieve supersaturation can further increase the encapsulation efficiency of milk exosomes loaded with palmitoyl tetrapeptide-5.

Example 23

The preparation method of the milk exosome preparation loaded with palmitoyl pentapeptide-5 comprises the following steps: the preferred addition amount of palmitoyl pentapeptide-5 is 5ug/mL-10mg/mL, 1-5mg/mL,4-10mg/mL, or 6-10 mg/mL in the milk exosome. The pH value of the mixed solution is adjusted to meet the following conditions: the milk exosome preparation can observe complete and clear exosomes under an electron microscope, the purity measured by HPLC is above 55%, the saturated concentration of the alkylated cosmetic peptide is more than or equal to 10 mug/mL, and the preferable pH value is 4-8; stirring at below 37deg.C, physically loading for 1-12 hr, removing free palmitoyl pentapeptide-5, adding lyoprotectant, and freeze drying. The preferred physical loading means is agitation incubation or static incubation, and the preferred means for removing free palmitoyl pentapeptide-5 is molecular sieve, ultrafiltration, or other separation means.

The palmitoyl pentapeptide-5 alkane chain is inserted into the phospholipid bilayer membrane of the milk exosome, so that the loading and loaded relation of the peptide and the milk exosome is realized, and the saturation concentration of palmitoyl pentapeptide-5 in the milk exosome preparation is greatly improved.

Example 23 it is further preferred that the pH of the mixed solution is adjusted by adding palmitoyl pentapeptide-5 to the milk exosomes to reach a supersaturation state. The addition of palmitoyl pentapeptide-5 to supersaturate the milk exosomes loaded with palmitoyl pentapeptide-5 can further increase the encapsulation efficiency.

Example 24

The preparation method of the milk exosome preparation loaded with myristoyl pentapeptide-4 comprises the following steps: the preferred addition amount of myristoyl pentapeptide-4 to the milk exosomes is 5ug/mL to 10mg/mL, 1 to 5mg/mL,4 to 10mg/mL, or 6 to 10 mg/mL. The pH value of the mixed solution is adjusted to meet the following conditions: the milk exosome preparation can observe complete and clear exosomes under an electron microscope, the purity measured by HPLC is above 55%, the saturated concentration of the alkylated cosmetic peptide is more than or equal to 10 mug/mL, and the preferable pH value is 4-8; stirring at below 37deg.C, physically loading for 1-12 hr, removing free myristoyl pentapeptide-4, adding lyoprotectant, and freeze-drying. The preferred physical loading means is agitation incubation or static incubation, and the preferred means for removing free myristoylpentapeptide-4 is molecular sieve, ultrafiltration, etc.

The myristoyl pentapeptide-4 alkane chain is inserted into the phospholipid bilayer membrane of the milk exosome, so that the loading and loaded relation between the peptide and the milk exosome is realized, and the saturation concentration of the myristoyl pentapeptide-4 in the milk exosome preparation is greatly improved.

Example 24 it is further preferred that the mixed solution pH is adjusted by adding myristoyl pentapeptide-4 to the milk exosomes to reach a supersaturation state. The encapsulation efficiency of milk exosomes loaded with myristoylpentapeptides-4 can be further improved by adding myristoylpentapeptides-4 to a supersaturated state.

Example 25

Example 25 is similar to examples 1-24 except that exosomes are added in particle count, preferably in examples 1, 2, 3, 5, 6, 7, 8, 10, 11, 12, 13, 14, 15, 16 with a particle count of 1×10 ¹¹ -1×10 ¹² particles/mL, milk exosomes with a protein concentration of 200-500 μg/mL.

Claims

1. A milk exosome formulation loaded with an alkylated cosmetic peptide comprising the alkylated cosmetic peptide and a milk exosome, wherein the alkane chain of the alkylated cosmetic peptide is inserted into the phospholipid bilayer membrane of the milk exosome, and wherein the encapsulation efficiency of the alkylated cosmetic peptide in the milk exosome formulation is greater than 25%.

2. The milk exosome preparation according to claim 1, wherein the protein concentration of milk exosomes is 200-500 μg/mL, or the number of exosomes particles is 1 x 10 ¹¹ -1×10 ¹² particles/mL.

3. The milk exosome formulation according to claim 2, wherein the alkylated cosmetic peptide is added in an amount of 5ug/mL to 10mg/mL.

4. The milk exosome formulation of claim 3, wherein the alkylated cosmetic peptide comprises at least one of palmitoyl tripeptide-1, palmitoyl pentapeptide-4, palmitoyl tetrapeptide-7, palmitoyl hexapeptide-12, myristoyl hexapeptide-5, palmitoyl hexapeptide-15, palmitoyl dipeptide-7, palmitoyl hexapeptide-14, palmitoyl tripeptide-5, palmitoyl tripeptide-8, palmitoyl tetrapeptide-10, palmitoyl tetrapeptide-5, palmitoyl pentapeptide-5, myristoyl pentapeptide-4.

5. The milk exosome formulation according to claim 4, further comprising a solubilizing agent and/or a lyoprotectant.

6. The milk exosome formulation according to claim 5, wherein the solubilizing agent is a cationic emulsifier.

7. The milk exosome formulation according to claim 6, wherein the solubilizing agent is added in an amount of 3-10mg/mL.

8. Milk exosome formulation according to claim 5, wherein the lyoprotectant is mannitol and/or trehalose.

9. A method for preparing a milk exosome formulation loaded with alkylated cosmetic peptides according to any of claims 1-8, comprising the steps of: adding an alkylated cosmetic peptide into the milk exosome solution; the pH value of the mixed solution is adjusted to meet the following conditions: the milk exosome preparation can observe complete and clear exosomes under an electron microscope, the purity measured by HPLC is more than 55%, and the saturated concentration of the alkylated cosmetic peptide is more than or equal to 10 mug/mL.

10. Use of a milk exosome formulation loaded with alkylated cosmetic peptides according to any of claims 1-8 in cosmetics.