CN116694765A

CN116694765A - Kit for detecting endometrial cancer and application thereof

Info

Publication number: CN116694765A
Application number: CN202310671281.2A
Authority: CN
Inventors: 周俊; 董兰兰; 苏雅婷; 王方媛; 郑义慧
Original assignee: Wuhan Aimisen Life Technology Co ltd
Current assignee: Wuhan Aimisen Life Technology Co ltd
Priority date: 2023-06-08
Filing date: 2023-06-08
Publication date: 2023-09-05

Abstract

The application belongs to the technical field of gene detection, and particularly relates to a kit for detecting endometrial cancer and application thereof. The application adopts the traditional cervical exfoliated cell sampling method, takes the PCDHGA1 gene as a target point, adds a DNA methylation diagnosis technology, has higher sensitivity and specificity, is used for auxiliary diagnosis of precancerous lesions and early endometrial cancers, optimizes medical configuration resources, locates early outpatient screening, improves endometrial cancer screening and diagnosis and treatment efficiency, and provides more reliable reference basis for clinical diagnosis and medication of endometrial cancers.

Description

Kit for detecting endometrial cancer and application thereof

Technical Field

The application belongs to the technical field of gene detection, and particularly relates to a kit for detecting endometrial cancer and application thereof.

Background

Endometrial cancer (endometrial cancer), also known as endometrial cancer, is one of the three most common gynaecological malignancies in women in China. The national cancer center data in 2015 shows that the incidence rate of endometrial cancer is 10.28/10 ten thousand and the mortality rate is 5.04/10 ten thousand, and researches show that the incidence rate of endometrial cancer is in a year-by-year increasing trend, and the incidence rate of urban residents is higher than that of rural residents, and the incidence rate of endometrial cancer is the first place of gynecological malignant tumors in partial developed cities in China. With the improvement of nutritional structure, the change of lifestyle and the increase of life expectancy, the incidence of endometrial cancer may further increase, becoming a serious public health problem.

Endometrial cancer presents a relatively high-grade situation in the 40-65 year old population, however, the pathogenesis is not clear, and obesity, diabetes, infertility, early onset, late menopausal age, continuous stimulation of estrogen and the like are all high-risk factors for causing endometrial cancer. Studies have shown that 50% of untreated patients with endometrial dysplasia develop endometrial cancer within 10 years. The relative survival rate of the endometrial cancer patients after operation is more than 70% in 5 years, and the survival rate of the endometrial cancer patients in stage I reaches about 80%. Therefore, the early detection of the precancerous lesions of the endometrium and the early endometrial cancer is of great significance for early diagnosis and early treatment of the endometrial cancer, and a better prognosis can be obtained.

Currently, the main detection methods of endometrial cancer include blood biochemical examination, tumor marker examination (CA 125, CA19-9, CEA, CP2 or HE 4), imaging examination (trans-abdominal or trans-vaginal ultrasound, MRI, CT, PET-CT), cytological examination, segmental diagnostic curettage, etc. Although these detection techniques are widely used for diagnosis of endometrial cancer, there are problems such as low detection sensitivity, invasive damage, and oversubscription. Therefore, according to the problems in early screening of endometrial cancer, a highly sensitive and noninvasive effective screening method needs to be established to improve the compliance of early screening.

Disclosure of Invention

Based on the above, the application provides a kit for detecting endometrial cancer and application thereof, so as to solve the technical problems that the traditional technology needs to be invasive and has low detection sensitivity.

In one aspect, the application provides the use of a reagent for detecting the methylation level of a target nucleic acid molecule, characterized in that the target nucleic acid molecule comprises a nucleotide sequence derived from the full length or a partial region of the PCDHGA1 gene, and the target nucleic acid molecule comprises at least one CpG site, for the preparation of a kit for detecting endometrial cancer.

In one embodiment, GRCh38.p14 is used as the reference genome, and the partial region is selected from one or more of the negative strand DNA region of Ch5: 141431876-141432274, the positive strand DNA region of Ch5: 141417405-141417806, and the negative strand DNA region of Ch5: 141417468-141417963.

In one embodiment, the target nucleic acid molecule is a nucleic acid molecule isolated from a biological sample, or is an artificially synthesized nucleic acid molecule.

In another aspect, the application provides a kit for detecting endometrial cancer, said kit comprising reagents for detecting the methylation level of a target nucleic acid molecule comprising a nucleotide sequence derived from the full length or a partial region of the PCDHGA1 gene, said target nucleic acid molecule comprising at least one CpG site.

In one embodiment, the partial areas include one or more of areas 1-6, area 7, and one or more of areas 8-9, wherein:

the region 1 is Chr5:141431961-141432134;

the region 2 is Chr5:141431961-141432143;

the region 3 is Chr5:141432026-141432134;

the region 4 is Chr5:141432026-141432143;

the region 5 is Chr5:141432055-141432134;

the region 6 is Chr5:141432055-141432143;

the region 7 is Chr5:141417583-141417733;

the region 8 is Chr5:141417612-141417817;

the region 9 is Chr5:141417647-141417817.

In one embodiment, the reagent comprises at least one of a primer pair and a probe.

In one embodiment, the primer pair comprises the region 1 primer pair having the nucleotide sequence shown in SEQ ID NO.10 and SEQ ID NO. 11; and/or the nucleotide sequences of the region 2 primer pair are shown as SEQ ID NO.10 and SEQ ID NO. 14; and/or the nucleotide sequences of the primer pairs in the region 3 are shown as SEQ ID NO.16 and SEQ ID NO. 11; and/or the nucleotide sequences of the region 4 primer pair are shown as SEQ ID NO.16 and SEQ ID NO. 14; and/or the nucleotide sequences of the primer pair in the region 5 are shown as SEQ ID NO.18 and SEQ ID NO. 11; and/or the nucleotide sequences of the region 6 primer pair are shown as SEQ ID NO.18 and SEQ ID NO. 14; and/or the nucleotide sequence of the region 7 primer pair is shown as SEQ ID NO.20 and SEQ ID NO. 21; and/or the nucleotide sequence of the primer pair in the region 8 is shown as SEQ ID NO.24 and SEQ ID NO. 25; and/or the nucleotide sequence of the region 9 primer pair is shown as SEQ ID NO.28 and SEQ ID NO. 25.

In one embodiment, the probe comprises at least one of the probes shown as SEQ ID NO.30, SEQ ID NO.31 and SEQ ID NO.32.

In one embodiment, the kit further comprises at least one of cervical exfoliated cell preservation reagent, nucleic acid extraction reagent, nucleic acid conversion reagent, PCR reaction reagent, positive control sample and negative control sample.

The application provides a kit for detecting endometrial cancer and application thereof. The kit takes the PCDHGA1 gene as a target point, and is added with DNA methylation diagnosis technology, so that the kit has higher sensitivity and specificity, is used for auxiliary diagnosis of precancerous lesions and early endometrial cancers, optimizes medical configuration resources, locates early outpatient screening, improves endometrial cancer screening and diagnosis efficiency, and provides more reliable reference basis for clinical diagnosis and medication of endometrial cancers.

Detailed Description

The present application will be described in further detail with reference to embodiments and examples. It should be understood that these embodiments and examples are provided solely for the purpose of illustrating the application and are not intended to limit the scope of the application in order that the present disclosure may be more thorough and complete. It will also be appreciated that the present application may be embodied in many different forms and is not limited to the embodiments and examples described herein, but may be modified or altered by persons skilled in the art without departing from the spirit of the application, and equivalents thereof are also intended to fall within the scope of the application. Furthermore, in the following description, numerous specific details are set forth in order to provide a more thorough understanding of the application, it being understood that the application may be practiced without one or more of these details.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs.

Terminology

In the application, the technical characteristics described in an open mode comprise a closed technical scheme composed of the listed characteristics and also comprise an open technical scheme comprising the listed characteristics.

The term "and/or" and/or "is intended to include any and all combinations of one or more of the associated listed items.

The term "diagnosis" includes auxiliary diagnosis, recurrence risk assessment, assessment of risk and extent of cancerous lesions, prognosis, and the like.

The term "gene" refers to a segment of DNA encoding a polypeptide chain that produces amino acids, and includes sequences located in coding and non-coding regions, as well as exon and intron sequences involved in gene transcription/translation and transcriptional/translational regulation.

The term "oligonucleotide" or "polynucleotide" or "nucleotide" or "nucleic acid" refers to a molecule having two or more deoxyribonucleotides or ribonucleotides, preferably more than three, and typically more than ten. The exact size will depend on many factors, which in turn depend on the ultimate function or use of the oligonucleotide. The oligonucleotides may be produced in any manner, including chemical synthesis, DNA replication, reverse transcription, or a combination thereof. Typical deoxyribonucleotides of DNA are thymine, adenine, cytosine and guanine. Typical ribonucleotides of RNA are uracil, adenine, cytosine and guanine.

The term "methylation" is a form of chemical modification of DNA that can alter genetic manifestations without altering the DNA sequence. DNA methylation refers to covalent binding of a methyl group at the 5 th carbon position of cytosine of a genomic CpG dinucleotide under the action of a DNA methyltransferase. DNA methylation can cause alterations in chromatin structure, DNA conformation, DNA stability, and the manner in which DNA interacts with proteins, thereby controlling gene expression.

The term "methylation level" refers to whether or not cytosine in one or more CpG dinucleotides in a DNA sequence is methylated, or the frequency/proportion/percentage of methylation, representing both qualitative and quantitative concepts. In practical application, different detection indexes can be adopted to compare the DNA methylation level according to practical conditions. As in some cases, the comparison may be made based on Ct values detected by the sample; in some cases, the ratio of gene methylation in the sample, i.e., number of methylated molecules/(number of methylated molecules+number of unmethylated molecules). Times.100, can be calculated and then compared; in some cases, statistical analysis and integration of each index is also required to obtain a final decision index.

The term "primer" refers to an oligonucleotide that can be used in an amplification method (e.g., polymerase chain reaction, PCR) to amplify a sequence of interest based on a polynucleotide sequence corresponding to a gene of interest or a portion thereof. Typically, at least one of the PCR primers used to amplify a polynucleotide sequence is sequence specific for that polynucleotide sequence. The exact length of the primer will depend on many factors, including temperature, source of primer, and method used. For example, for diagnostic and prognostic applications, the oligonucleotide primers will typically contain at least 10, 15, 20, 25 or more nucleotides, but may also contain fewer nucleotides, depending on the complexity of the target sequence. In the present disclosure, the term "primer pair" refers to a pair of primers that hybridizes to a double strand of a target DNA molecule or to regions of the target DNA molecule flanking the nucleotide sequence to be amplified.

The term "methylation-specific PCR" is one of the most sensitive experimental techniques currently studied for methylation, and a minimum of about 50pg of DNA methylation can be found. After the single-stranded DNA is subjected to bisulfite conversion, all unmethylated cytosines are deaminated to uracil, and methylated cytosines in CpG sites are kept unchanged, so that two pairs of primers aiming at methylated and unmethylated sequences are respectively designed, and the methylated and unmethylated DNA sequences can be distinguished through PCR amplification. In the present disclosure, methylation primers are added when performing real-time quantitative methylation-specific PCR, and if the Ct value meets the requirement (e.g., ct.ltoreq.38 in a tissue sample), it indicates that the target sequence is methylated.

The term "methylation specific fluorescent quantitative PCR (QMSP)" is an experimental technique combining fluorescent quantitative PCR technology and methylation specific PCR technology. The technology also designs a proper primer pair based on the sequence difference of DNA with different methylation states after being converted by bisulfite so as to distinguish methylated sequences from unmethylated sequences, but the final detection index of QMSP is a fluorescent signal, so that a fluorescent probe or a fluorescent dye is required to be added in addition to a methylation detection primer in a QMSP reaction system. Compared with the traditional methylation specific PCR technology, the QMS detection DNA methylation level has higher sensitivity and specificity, is more suitable for detecting trace amounts of abnormally methylated DNA fragments mixed in the DNA of patients in early cancer, does not need gel electrophoresis detection, and is simpler and more convenient to operate.

The term "TaqMan probe" refers to a stretch of oligonucleotide sequences comprising a 5 'fluorescent group and a 3' quenching group. When the probe binds to the corresponding site on the DNA, the probe does not fluoresce because of the presence of a quenching group near the fluorescent group. During amplification, if the probe binds to the amplified strand, the 5'-3' exonuclease activity of the DNA polymerase (e.g., taq enzyme) digests the probe and the fluorescent group is far from the quenching group, its energy is not absorbed, i.e., a fluorescent signal is generated. The fluorescence signal is also identical to the target fragment with a synchronous exponential increase per PCR cycle.

The term "non-atypical hyperplasia" refers to a disorder of the ratio of glands to intimal space, increased endometrial glands, irregular gland shape, tubular, branched and/or saccular expansion, similar to a proliferative endometrium; but without cytologic atypical.

The term "proliferation associated with atypical" refers to a cellular atypical condition in which glandular epithelial cells are significantly different from the surrounding non-neoplastic gonads of the endometrium, based on a deregulated proportion of glandular and endometrium.

In a specific example, GRCh38.p14 is used as the reference genome, and the partial region is selected from one or more of the negative strand DNA region of Ch5: 141431876-141432274, the positive strand DNA region of Ch5: 141417405-141417806, and the negative strand DNA region of Ch5: 141417468-141417963. The partial region of "Chr5:141431876-141432274" means a one-step region in the range of Chr5:141431876-141432274, such as Chr5:141431961-141432134, chr5:141431961-141432143, chr5:141432026-141432134, and the like, and other similar processes.

Alternatively, the target nucleic acid molecule is a nucleic acid molecule isolated from a biological sample, or is an artificially synthesized nucleic acid molecule.

In a specific example, GRCh38.p14 is used as the reference genome, and the partial region is selected from one or more of the negative strand DNA region of Ch5: 141431876-141432274, the positive strand DNA region of Ch5: 141417405-141417806, and the negative strand DNA region of Ch5: 141417468-141417963.

Optionally, the partial areas include one or more of areas 1 to 6, area 7 and one or more of areas 8 to 9, wherein: the region 1 is Chr5:141431961-141432134; the region 2 is Chr5:141431961-141432143; the region 3 is Chr5:141432026-141432134; the region 4 is Chr5:141432026-141432143; the region 5 is Chr5:141432055-141432134; the region 6 is Chr5:141432055-141432143; the region 7 is Chr5:141417583-141417733; the region 8 is Chr5:141417612-141417817; the region 9 is Chr5:141417647-141417817.

Further optionally, the reagent comprises at least one of a primer pair and a probe.

In a specific example, the primer pair comprises the region 1 primer pair having the nucleotide sequence shown in SEQ ID No.10, SEQ ID No. 11; and/or the nucleotide sequences of the region 2 primer pair are shown as SEQ ID NO.10 and SEQ ID NO. 14; and/or the nucleotide sequences of the primer pairs in the region 3 are shown as SEQ ID NO.16 and SEQ ID NO. 11; and/or the nucleotide sequences of the region 4 primer pair are shown as SEQ ID NO.16 and SEQ ID NO. 14; and/or the nucleotide sequences of the primer pair in the region 5 are shown as SEQ ID NO.18 and SEQ ID NO. 11; and/or the nucleotide sequences of the region 6 primer pair are shown as SEQ ID NO.18 and SEQ ID NO. 14; and/or the nucleotide sequence of the region 7 primer pair is shown as SEQ ID NO.20 and SEQ ID NO. 21; and/or the nucleotide sequence of the primer pair in the region 8 is shown as SEQ ID NO.24 and SEQ ID NO. 25; and/or the nucleotide sequence of the region 9 primer pair is shown as SEQ ID NO.28 and SEQ ID NO. 25.

In one embodiment, the probe comprises at least one of the probes shown as SEQ ID NO.31, SEQ ID NO.32 and SEQ ID NO. 33.

Optionally, the detection probe has a fluorescent group attached thereto. In some embodiments, the detection probe is a taqman probe. Further, a fluorescent group and a quenching group are attached to the detection probe. Alternatively, the fluorescent moiety is located at the 5 'end of the probe and the quenching moiety is located at the 3' end of the probe. Optionally, the fluorophores attached to the detection probes are each independently selected from one of FAM, HEX, VIC, CY, ROX, texa Red, JOE, and Quasar 705. Of course, when two or more types of probes are present in the same reaction system, the fluorescent groups attached to different probes are different. It is to be understood that the fluorescent groups attached to the detection probes of the target region and the detection probes of the reference gene are not limited to the above, and may be other fluorescent groups.

In a specific example, the kit further comprises at least one of a cervical exfoliated cell preservation reagent, a nucleic acid extraction reagent, a nucleic acid conversion reagent, a PCR reaction reagent, a positive control sample, and a negative control sample.

Embodiments of the present application will be described in detail below with reference to examples. It is to be understood that these examples are illustrative of the present application and are not intended to limit the scope of the present application. The experimental methods in the following examples, in which specific conditions are not noted, are preferably referred to the guidelines given in the present application, and may be according to the experimental manual or conventional conditions in the art, the conditions suggested by the manufacturer, or the experimental methods known in the art.

In the specific examples described below, the measurement parameters relating to the raw material components, unless otherwise specified, may have fine deviations within the accuracy of weighing. Temperature and time parameters are involved, allowing acceptable deviations from instrument testing accuracy or operational accuracy.

Example 1 screening methylation detection primer pairs and probes

The methylation specific fluorescent quantitative PCR technology (QMSP) obtains a kinetic curve of reaction PCR amplification by combining methods such as a fluorescent labeled oligonucleotide probe or an embedded dye with a corresponding fluorescent quantitative PCR instrument, and obtains relative or absolute quantity information of an initial methylation template by a Ct value (the number of reaction cycles required by a fluorescence value of a product reaching a set threshold), and the method has the advantages of accurate result, simplicity and rapidness in operation, capability of processing a large number of samples at one time and becomes a mainstream method for DNA methylation detection.

This example uses the negative strand DNA region (SEQ ID NO. 1) located at Chr5:141431876-141432274, the positive strand DNA region (SEQ ID NO. 2) located at Chr5:141417405-141417806, and the negative strand DNA region (SEQ ID NO. 3) located at Chr5:141417468-141417963 as the original DNA sequences, respectively, to obtain the fully methylated and bisulfite-converted sequences SEQ ID NO. 4-6 and the fully unmethylated and bisulfite-converted sequences SEQ ID NO. 7-9 corresponding to SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO. 3. After the DNA is subjected to bisulfite treatment, unmethylated cytosine is converted to uracil, which is converted to thymine by subsequent PCR, while methylated cytosine remains unchanged, so that the sequences of SEQ ID No.1, SEQ ID No.2 and SEQ ID No.3, which have different methylation states, are subjected to bisulfite conversion. The modified DNA sequences shown in SEQ ID No. 4-9 were then synthesized artificially and constructed onto pUC57 plasmid vectors, respectively.

The nucleotide sequence of SEQ ID NO.1 is shown below:

GGACACGTAGGACGATAGGCTTGCCCCTTGGATGGTGTTCTCAGCCAGGGAATAAGTGATCTGGGCGTTCTCTTCACAGTCGGGGTCGTGGGCGGTCACAGAGACGAGGGAAACTCCTCTGGGATTGTTCTCTGGGATATAAGCGGAATAGGAGGCCTGAGGGAAGACCGGCGGGTTGTCGTTGGTGTCTGCCACGTTCAGCGAGATATGAGTTTCCGTGGATAGGGGCGGGGTTCCCCGGTCAGTGGCGGTCACTGTGATGTTGTAGCTAGGAACCTGTTCCCTATCCAAGACTATGTCTGTGACTAAACTATAGTAATTTCCGTAAGATTTTTCTAATTTAAAGGGCAGATTTCCTTGGATGAAACAGATCACCTGTCCGTTTTCCTCAGAATCTTG(SEQ ID NO.1)

the nucleotide sequence of SEQ ID NO.2 is shown below:

TCAAGATATATGTAAATTCAGTAAATAAAAAGATATGATAGTTATGACCAAGTGGAAATATATTTCCTGATGTAAAAGGAATCACTGAGGAAAAAGATTAAAATATTTTGGCTGTCAACTCGTAGTTTAAAAAAAATTCCTTGAAAGAGGTAGAGAAAAGTCAAGTTGCAGTCCCACACAGAGCCTCTGGGCGCCGCCGTCGGCCAGTGCAGAGCAAGCGCTGACGCCGGGGATCCCTCAGCCTCTAGCCTGGGATTCCCTGCGCAGCCAACAACAGAAAAGAAAACCAGCTCCCACACAGAGGCTCCCGGCTGCGCAGACCTTGCCCAGCACACCAGATTGCCAGCTCCGAGACCCGGGACTCCTCCTGTCCTGGGCCGAATGCTCTTTTAGCGCGGTAGA(SEQ ID NO.2)

the nucleotide sequence of SEQ ID NO.3 is shown below:

TAGCGGATCGGCTCACACAGCGTGGGGTAGAACAAAGGCAGCAGCAAAGGAAATAGTACCTGCCGCGGGCCGGCCCGGCGCCTCTGCGCGCAGCTCCCTCCCATCGTTCGCTCGGGTTCTCGCTGGGTCCCCGCTTTTCCAGTTGGAGAAAGTGCACTCTACCGCGCTAAAAGAGCATTCGGCCCAGGACAGGAGGAGTCCCGGGTCTCGGAGCTGGCAATCTGGTGTGCTGGGCAAGGTCTGCGCAGCCGGGAGCCTCTGTGTGGGAGCTGGTTTTCTTTTCTGTTGTTGGCTGCGCAGGGAATCCCAGGCTAGAGGCTGAGGGATCCCCGGCGTCAGCGCTTGCTCTGCACTGGCCGACGGCGGCGCCCAGAGGCTCTGTGTGGGACTGCAACTTGACTTTTCTCTACCTCTTTCAAGGAATTTTTTTTAAACTACGAGTTGACAGCCAAAATATTTTAATCTTTTTCCTCAGTGATTCCTTTTACATCAGGAA(SEQ ID NO.3)

the nucleotide sequence of SEQ ID NO.4 is shown below:

GGATACGTAGGACGATAGGTTTGTTTTTTGGATGGTGTTTTTAGTTAGGGAATAAGTGATTTGGGCGTTTTTTTTATAGTCGGGGTCGTGGGCGGTTATAGAGACGAGGGAAATTTTTTTGGGATTGTTTTTTGGGATATAAGCGGAATAGGAGGTTTGAGGGAAGATCGGCGGGTTGTCGTTGGTGTTTGTTACGTTTAGCGAGATATGAGTTTTCGTGGATAGGGGCGGGGTTTTTCGGTTAGTGGCGGTTATTGTGATGTTGTAGTTAGGAATTTGTTTTTTATTTAAGATTATGTTTGTGATTAAATTATAGTAATTTTCGTAAGATTTTTTTAATTTAAAGGGTAGATTTTTTTGGATGAAATAGATTATTTGTTCGTTTTTTTTAGAATTTTG(SEQ ID NO.4)

the nucleotide sequence of SEQ ID NO.5 is shown below:

TTAAGATATATGTAAATTTAGTAAATAAAAAGATATGATAGTTATGATTAAGTGGAAATATATTTTTTGATGTAAAAGGAATTATTGAGGAAAAAGATTAAAATATTTTGGTTGTTAATTCGTAGTTTAAAAAAAATTTTTTGAAAGAGGTAGAGAAAAGTTAAGTTGTAGTTTTATATAGAGTTTTTGGGCGTCGTCGTCGGTTAGTGTAGAGTAAGCGTTGACGTCGGGGATTTTTTAGTTTTTAGTTTGGGATTTTTTGCGTAGTTAATAATAGAAAAGAAAATTAGTTTTTATATAGAGGTTTTCGGTTGCGTAGATTTTGTTTAGTATATTAGATTGTTAGTTTCGAGATTCGGGATTTTTTTTGTTTTGGGTCGAATGTTTTTTTAGCGCGGTAGA(SEQ ID NO.5)

the nucleotide sequence of SEQ ID NO.6 is shown below:

TAGCGGATCGGTTTATATAGCGTGGGGTAGAATAAAGGTAGTAGTAAAGGAAATAGTATTTGTCGCGGGTCGGTTCGGCGTTTTTGCGCGTAGTTTTTTTTTATCGTTCGTTCGGGTTTTCGTTGGGTTTTCGTTTTTTTAGTTGGAGAAAGTGTATTTTATCGCGTTAAAAGAGTATTCGGTTTAGGATAGGAGGAGTTTCGGGTTTCGGAGTTGGTAATTTGGTGTGTTGGGTAAGGTTTGCGTAGTCGGGAGTTTTTGTGTGGGAGTTGGTTTTTTTTTTTGTTGTTGGTTGCGTAGGGAATTTTAGGTTAGAGGTTGAGGGATTTTCGGCGTTAGCGTTTGTTTTGTATTGGTCGACGGCGGCGTTTAGAGGTTTTGTGTGGGATTGTAATTTGATTTTTTTTTATTTTTTTTAAGGAATTTTTTTTAAATTACGAGTTGATAGTTAAAATATTTTAATTTTTTTTTTTAGTGATTTTTTTTATATTAGGAA(SEQ ID NO.6)

the nucleotide sequence of SEQ ID NO.7 is shown below:

GGATATGTAGGATGATAGGTTTGTTTTTTGGATGGTGTTTTTAGTTAGGGAATAAGTGATTTGGGTGTTTTTTTTATAGTTGGGGTTGTGGGTGGTTATAGAGATGAGGGAAATTTTTTTGGGATTGTTTTTTGGGATATAAGTGGAATAGGAGGTTTGAGGGAAGATTGGTGGGTTGTTGTTGGTGTTTGTTATGTTTAGTGAGATATGAGTTTTTGTGGATAGGGGTGGGGTTTTTTGGTTAGTGGTGGTTATTGTGATGTTGTAGTTAGGAATTTGTTTTTTATTTAAGATTATGTTTGTGATTAAATTATAGTAATTTTTGTAAGATTTTTTTAATTTAAAGGGTAGATTTTTTTGGATGAAATAGATTATTTGTTTGTTTTTTTTAGAATTTTG(SEQ ID NO.7)

the nucleotide sequence of SEQ ID NO.8 is shown below:

TTAAGATATATGTAAATTTAGTAAATAAAAAGATATGATAGTTATGATTAAGTGGAAATATATTTTTTGATGTAAAAGGAATTATTGAGGAAAAAGATTAAAATATTTTGGTTGTTAATTTGTAGTTTAAAAAAAATTTTTTGAAAGAGGTAGAGAAAAGTTAAGTTGTAGTTTTATATAGAGTTTTTGGGTGTTGTTGTTGGTTAGTGTAGAGTAAGTGTTGATGTTGGGGATTTTTTAGTTTTTAGTTTGGGATTTTTTGTGTAGTTAATAATAGAAAAGAAAATTAGTTTTTATATAGAGGTTTTTGGTTGTGTAGATTTTGTTTAGTATATTAGATTGTTAGTTTTGAGATTTGGGATTTTTTTTGTTTTGGGTTGAATGTTTTTTTAGTGTGGTAGA(SEQ ID NO.8)

the nucleotide sequence of SEQ ID NO.9 is shown below:

TAGTGGATTGGTTTATATAGTGTGGGGTAGAATAAAGGTAGTAGTAAAGGAAATAGTATTTGTTGTGGGTTG

GTTTGGTGTTTTTGTGTGTAGTTTTTTTTTATTGTTTGTTTGGGTTTTTGTTGGGTTTTTGTTTTTTTAGTTGG

AGAAAGTGTATTTTATTGTGTTAAAAGAGTATTTGGTTTAGGATAGGAGGAGTTTTGGGTTTTGGAGTTGGT

AATTTGGTGTGTTGGGTAAGGTTTGTGTAGTTGGGAGTTTTTGTGTGGGAGTTGGTTTTTTTTTTTGTTGTTG

GTTGTGTAGGGAATTTTAGGTTAGAGGTTGAGGGATTTTTGGTGTTAGTGTTTGTTTTGTATTGGTTGATGGT

GGTGTTTAGAGGTTTTGTGTGGGATTGTAATTTGATTTTTTTTTATTTTTTTTAAGGAATTTTTTTTAAATTATGAGTTGATAGTTAAAATATTTTAATTTTTTTTTTTAGTGATTTTTTTTATATTAGGAA(SEQ ID NO.9)

the primer design of methylation specific PCR needs to meet the principle of common primer design, for example, 1) the length of the primer is generally 15-30 bp; 2) The GC base content in the primer is between 40% and 60%; 3) The primer has specificity; 4) Avoiding more than 3 identical bases at the 3' end of the primer as much as possible; 5) The energy value of the primer dimer and the hairpin structure is not more than 4.5kcals/mol as much as possible.

Furthermore, primer design for methylation-specific PCR also requires consideration: the upstream primer and the downstream primer respectively comprise at least one CpG site, the more the CpG sites are, the higher the specificity of the primer is, in order to avoid nonspecific amplification, the 3' -end of the primer is at least one CpG site, and the amplification of the primer depends on the methylation level of the template.

Methylation specific primer pairs are designed for the fully methylated fragments shown in SEQ ID NOS.4-6, and unmethylated primer pairs are designed for the fully unmethylated fragments shown in SEQ ID NOS.7-9. In order to detect target segments in the exfoliated cells as much as possible and improve the efficiency of PCR amplification, different primers are respectively designed at different positions in the areas shown by SEQ ID NO. 4-6 and SEQ ID NO. 7-9 for detection, and the fragment length of the amplicon is less than 200bp. Wherein the sequence after transformation in the forward DNA region of Chr5:141417405-141417806 (SEQ ID NO. 2) is based on the basic principle of primer design, only one pair of methylated and unmethylated primers can be designed. Specifically, the results are shown in Table 1.

TABLE 1 nucleotide sequences of unmethylated primer pair, methylated primer pair and probe for target region

/>

The primers in Table 1 were each synthesized artificially and diluted to the appropriate concentration for use. In order to ensure that the amplification efficiency of the fluorescent quantitative PCR reaction is between 95% and 105%, and that no nonspecific amplification and primer dimer are present, a plasmid vector of the target region after bisulfite conversion is used as a template, and a SYBR Green system is used for the fluorescent quantitative PCR reaction.

Multiple pairs of primers were designed for methylation fluorescent quantitative PCR reactions. Adding the diluted methylation primer pair and the diluted unmethylation primer pair of the template into a PCR reaction tube, and designing the methylation primer pair and the unmethylation primer pair with the specificity of each sequence. The methylation primer pair and the unmethylation primer pair have good amplification specificity, namely the methylation primer pair does not amplify an unmethylated template, and the unmethylated primer pair does not amplify a methylated template; in addition, the methylation primer pair has good detection sensitivity, namely when the template contains more than or equal to 1% of methylated DNA sequences, the amplified product is only the methylated DNA sequences. The methylated primer pairs and unmethylated primer pairs satisfying the above requirements are screened. And plasmid vectors containing methylated sequences SEQ ID No. 4-6 and unmethylated sequences SEQ ID No. 7-9 are used as templates, the concentration of each template is 10 ³ The copies/. Mu.L were mixed in equal volumes and then SYBR Green PCR mix was added to carry out the amplification reaction, the PCR configuration system was as shown in Table 2, and the reaction procedure was as shown in Table 3. Then, the primer pairs were verified, a SYBR Green PCR system was used to amplify the target fragment, and 1 pair of primers for amplifying the Chr5:141431876-141432274, 1 pair of primers for amplifying the Chr5:141417405-141417806 and 1 pair of primers for amplifying the partial region of the Chr5:141417468-141417963, which meet the above requirements, were screened out by analysis of a dissolution curve and a standard curve, and the optimal primer pairs for detecting the target region are shown in Table 4.

TABLE 2 SYBR Green PCR System configuration

2×SYBR Green PCR mix	12.5μL
		Upstream primer	1μL
Downstream primer	1μL
		Template	5μL
Ultrapure water	Make up 25. Mu.L

TABLE 3 SYBR Green PCR reaction procedure

TABLE 4 optimal methylation detection primer pairs

Target area	Upstream primer sequence (5 '-3')	Downstream primer sequence (5 '-3')
			SEQ ID NO.4	SEQ ID NO.18	SEQ ID NO.11
SEQ ID NO.5	SEQ ID NO.20	SEQ ID NO.21
			SEQ ID NO.6	SEQ ID NO.28	SEQ ID NO.25

TaqMan detection probes SEQ ID NO.30, SEQ ID NO.31, SEQ ID NO.32 designed for QMS detection and matched to each pair of methylation detection primer pairs. The TaqMan probe is connected with a fluorescent group such as FAM, ROX, CY, VIC and the like at the 5 'end, and a fluorescence quenching group such as BHQ, BHQ1 and the like at the 3' end. In the PCR process, the TaqMan detection probe is specifically combined with a template to be detected, if a methylated primer pair extends, taq enzyme with 5'-3' exonuclease activity can cut off a fluorescent group at the 5 'end of the probe, at the moment, the 3' end quenching group loses the quenching effect on the fluorescent group, the fluorescent group emits fluorescence, and the methylation level of a specific site of the region can be obtained by measuring the reported fluorescence intensity in each cycle. The fluorescent probes for detecting each subregion have FAM as the 5 '-end fluorescent reporter gene and MGB as the 3' -end fluorescent quenching group, and the designed fluorescent probes are synthesized artificially and the effect of the methylation detection primer and the detection probe combined is analyzed in a TaqMan PCR system. The amplification curve for the target region was required to be S-shaped, and the negative control tube without template added was not amplified, but added with a solution containing 10 ³ In the case of plasmid vectors of the target region of the copies/. Mu.L, ct values are less than 30. The sequences of the resulting methylation detection primer pair and detection probe for TaqMan PCR system and the detectable methylated cytosine sites are shown in Table 5.

TABLE 5 methylation cytosine sites recognizable by primers and probes

Endometrial cancer cells Hec-1A, and human immortalized keratinocytes Hacat were collected and genomic DNA of the cultured cells was extracted for later use using the root blood/cell/tissue genomic DNA extraction kit (DP 304). The conversion and purification of DNA was performed using the root DNA bisulfite conversion kit (DP 215). Subsequently, QMS reactions were performed using the methylation detection primer pairs and probes provided in Table 5 using the recovered genomic DNA as a template, the specific PCR reaction system was as shown in Table 6, and the PCR reaction procedure was as shown in Table 7. In addition to the detection target region, an amplification primer pair and a detection probe of an internal reference gene ACTB are added into an amplification system to monitor sample quality, and the sequences of an upstream primer, a downstream primer and a detection probe of the amplified ACTB gene are 5'-AAGGTGGTTGGGTGGTTGTTTTG-3' (SEQ ID NO. 33), 5'-AATAACACCCCCACCCTGC-3' (SEQ ID NO. 34) and 5'-GGAGTGGTTTTTGGGTTTG-3' (SEQ ID NO. 35) respectively. The fluorescent groups at the 5 'end of the ACTB gene detection probe are ROX, and the fluorescent quenching groups at the 3' end of the ACTB gene detection probe are BHQ. The QMSP experiments found that when genomic DNA of the transformed endometrial cancer cell line was used as a template, the Ct value of each sub-target region amplified by the methylation detection primer pair and probe in table 5 was lower than 34; when genomic DNA of the transformed human normal skin immortalized epidermal cell line is used as a template, the Ct value of each sub-target region amplified by the methylation detection primer pair and the probe in table 5 is higher than 38; the above results indicate that the methylation level of each sub-target region in Table 5 is higher in endometrial cancer cell lines than in human normal epithelial cell lines.

TABLE 6TaqMan PCR amplification System

TABLE 7QMSP reaction procedure

Example 2 performance of QMS P method for detecting methylation level of target region in diagnosis of endometrial cancer tissue samples

Applicants have found that by testing tumor tissue samples from patients with endometrial cancer, selected from the group consisting of by testing the negative strand DNA region located at Chr5:141431876-141432274, the positive strand DNA region located at Chr5:141417405-141417806 and the negative strand DNA region located at Chr5:141417468-141417963, endometrial cancer samples can be effectively distinguished from healthy tissue samples, as detailed below.

1. Collection of tissue samples

A total of 50 cancer tissue samples of patients diagnosed with endometrial cancer by pathological examination and 50 corresponding paracancerous normal tissue samples were collected, and 65 pathological tissue samples of patients with atypical endometrial hyperplasia were collected. All samples were formalin-immersed, paraffin-embedded tissue samples. All samples were approved by the ethics committee, all volunteers signed informed consent, and all samples were anonymized.

2. Extraction of sample DNA

DNA from the tissue samples was extracted using QIAamp DNA FFPE Tissue Kit (Cat: 56404) and the specific procedure was as per the kit.

3. Transformation and purification of sample DNA

The kit for the transformation and purification of the sample DNA is a nucleic acid transformation reagent (20200843) of the life technology limited company of Wuhan Ai Misen, and specific operation steps are shown in the specification of the kit.

4.QMSP

The DNA of the tissue sample subjected to bisulfite conversion and purification is used as a template, a specific methylation detection primer pair and a detection probe in Table 5 are respectively added, a detection primer pair and a detection probe of an internal reference gene ACTB are simultaneously added, and then a QMS is added according to the necessary components in Table 6 to prepare an amplification system. At this time, positive control and negative control are also required. Negative ofThe control amplification system was similar to the experimental tube, but the template was an equal volume of ultrapure water; the amplification system of the positive control was also similar to that of the experimental tube, but the template was 10 ³ copies/. Mu.L of plasmid containing the region of interest to be tested (sequence after transformation) and 10 ³ The copies/. Mu.L of the plasmid containing the transformed ACTB sequence were mixed in equal volumes. The reaction was then carried out on a fluorescent quantitative PCR instrument according to the procedure set forth in Table 7. After the PCR reaction is finished, a baseline is adjusted, a fluorescence value of a sample before 1-2 cycles is advanced in one PCR is set as a baseline value, and a threshold value is set at the inflection point of an S-type amplification curve to obtain the Ct value of each gene of the sample. And removing samples which are not successfully detected according to the quality control requirement, and reading Ct values of qualified samples. The quality control standard is as follows: 1) The negative control was not amplified; 2) The positive control tube amplification curve is S-shaped, and Ct values of all genes are between 26 and 30; 3) The Ct value of the reference gene in the experimental tube is less than or equal to 34. If the quality control requirements are not met, the sample is re-tested.

5. Analysis of results

And judging the methylation level of the sample to be tested according to the Ct value detected by each target area. For a tissue sample, if the Ct value of an amplified region is less than or equal to 38, the region in the sample is considered to be methylation positive, and if the Ct value of an amplified region is greater than 38, the region in the sample is considered to be methylation negative. When detecting a single area, if the sample to be detected is methylation positive in the area, the sample is a cancer positive sample, and if the sample to be detected is methylation negative in the area, the sample is a cancer negative sample. The performance of diagnosing endometrial tissue samples for detecting the methylation level of the target region using the methylation fluorescent quantitative PCR assay is shown in Table 8.

TABLE 8 Performance of sub-target area for diagnosis of endometrial cancer tissue samples

As can be seen from Table 8, by detecting methylation levels of the sub-target regions SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6 of the gene PCDHGA1, it is possible to effectively detect pre-endometrial lesions and early endometrial cancer tissue samples.

The diagnostic performance of each sub-target area is good according to the performance of the detection tissue sample, and the sensitivity range of the detection early endometrial cancer tissue sample is 92-96%; the sensitivity range of the detection of the non-accompanying typical proliferation tissue sample of the endometrial precancerous lesions is 76.92-84.62%.

Example 3 QMS method for detecting methylation level of target region Performance of diagnosis of cervical exfoliated cell sample of endometrial cancer patient

In order to further improve the detection performance of the endometrial cancer diagnosis kit, the single marker methylation level of endometrial cancer is detected by the QMS method based on the cervical exfoliated cell sample, so that the detection convenience and the patient compliance can be effectively improved.

By detecting the negative strand DNA region located in Chr5:141431876-141432274, the positive strand DNA region located in Chr5:141417405-141417806 and the negative strand DNA region located in Chr5:141417468-141417963, early endometrial cancer and precancerous lesions thereof can be effectively detected, and the specific detection process is shown below.

1. Collection of exfoliated cell samples

A total of 41 cervical exfoliated cell samples of the patients with endometrial cancer, which are confirmed by pathological detection, and of the healthy people with 153 conventional physical examination, 50 cervical exfoliated cell samples of the patients with endometrial precancerous lesions, 10 cervical exfoliated cells of benign diseases of other reproductive systems of females and 10 cervical exfoliated cell samples of malignant tumors of other reproductive systems of females are collected. Of 41 patients with endometrial cancer, 23 patients with stage I and 18 patients with stage II. Of the 50 cases of endometrial precancerous lesions, 15 cases of patients with atypical hyperplasia were not accompanied, and 35 cases of patients with atypical hyperplasia were accompanied. All samples were approved by the ethics committee, all volunteers signed informed consent, and all samples were anonymized. Endometrial cancer in stages I, II, III and IV, referred to herein, may be a FIGO staging system as defined with reference to the international union of gynaecology and obstetrics.

2. Extraction of sample DNA

The DNA of the exfoliated cell sample was extracted using the nucleic acid extraction kit (Huhan apparatus 20210836) from the Living technologies Co., ltd., wuhan Ai Misen, and the specific operations were performed according to the kit instructions.

3. Transformation and purification of sample DNA

4.QMSP

The DNA of the exfoliated cell sample subjected to bisulfite conversion and purification is used as a template, a specific methylation detection primer pair and a detection probe in Table 5 are respectively added, a detection primer pair and a detection probe of an internal reference gene ACTB are simultaneously added, and then a QMS is added according to the necessary components in Table 6 to prepare an amplification system. At this time, positive control and negative control are also required. The amplification system of the negative control is similar to that of the experimental tube, but the template is ultrapure water with equal volume; the amplification system of the positive control was also similar to that of the experimental tube, but the template was 10 ³ copies/. Mu.L of plasmid containing the region of interest to be tested (sequence after transformation) and 10 ³ The copies/. Mu.L of the plasmid containing the transformed ACTB sequence were mixed in equal volumes. The reaction was then carried out on a fluorescent quantitative PCR instrument according to the procedure set forth in Table 7. After the PCR reaction is finished, a baseline is adjusted, a fluorescence value of a sample before 1-2 cycles is advanced in one PCR is set as a baseline value, and a threshold value is set at the inflection point of an S-type amplification curve to obtain the Ct value of each gene of the sample. And removing samples which are not successfully detected according to the quality control requirement, and reading Ct values of qualified samples. The quality control standard is as follows: 1) The negative control was not amplified; 2) The positive control tube amplification curve is S-shaped, and Ct values of all genes are between 27 and 30; 3) The Ct value of the reference gene in the experimental tube is less than or equal to 34. If the quality control requirements are not met, the sample is re-tested.

5. Analysis of results

And judging the methylation level of the sample to be tested according to the Ct value detected by each target area. For the exfoliated cell sample, if the Ct value of the amplified region is less than or equal to 38.6, the region in the sample is considered to be methylation positive, and if the Ct value of the amplified region is more than 38.6, the region in the sample is considered to be methylation negative. When detecting a single area, if the sample to be detected is methylation positive in the area, the sample is a cancer positive sample, and if the sample to be detected is methylation negative in the area, the sample is a cancer negative sample. The performance of the methylation level diagnostic cervical exfoliated cell sample for detecting the target region using the methylation fluorescent quantitative PCR assay is shown in Table 9.

Table 9 methylation level of cervical exfoliated cells of sub-target area for diagnosis of endometrial cancer

As can be seen from Table 9, three different regions of the target gene PCDHGA can be used to effectively distinguish endometrial cancer patients from non-endometrial cancer patients by detecting the methylation level of the target region in the cervical exfoliated cell sample by means of methylation specific fluorescent quantitative PCR. Specifically, the sensitivity range of the target area for detecting cervical exfoliated cell samples of patients with pre-endometrial cancer lesions is 58% -62%, and the sensitivity range of the target area for detecting cervical exfoliated cell samples of patients with early endometrial cancer is 80.49% -85.37%; the specificity of the target area for detecting cervical exfoliated cell samples of benign patients of other female reproductive systems is 90%, the specificity range for detecting malignant tumors of the female reproductive systems is 80% -90%, and the specificity range for detecting cervical exfoliated cell samples of healthy females is 92% -93.33%. In addition, the detection rate of the target area on the cervical cancer patient cell sample is not high, so that the detected sample is cervical exfoliated cells, but misdiagnosis is not caused.

Based on the above, the embodiment provides the in-vitro diagnosis kit for diagnosing the endometrial cancer based on the methylation level of the cervical exfoliated cell analysis target area, has higher detection rate for the endometrial cancer pre-lesion and early endometrial cancer patients, can solve the clinical pain point of excessive medical treatment of the patients, greatly improves the compliance of the patients in a noninvasive sampling mode, and is more convenient and more accurate for assisting the clinical diagnosis.

The above examples merely illustrate a few embodiments of the present application, which are convenient for a specific and detailed understanding of the technical solutions of the present application, but should not be construed as limiting the scope of the claims. It should be noted that it will be apparent to those skilled in the art that several variations and modifications can be made without departing from the spirit of the application, which are all within the scope of the application. Further, it is understood that various changes and modifications of the present application may be made by those skilled in the art after reading the above teachings, and equivalents thereof are intended to fall within the scope of the present application. It should also be understood that, based on the technical solutions provided by the present application, those skilled in the art obtain technical solutions through logical analysis, reasoning or limited experiments, all of which are within the scope of protection of the appended claims. The scope of the patent of the application should therefore be determined with reference to the appended claims, which are to be construed as in accordance with the doctrines of claim interpretation.

Claims

1. Use of a reagent for detecting the methylation level of a target nucleic acid molecule comprising a nucleotide sequence derived from the full length or a partial region of the PCDHGA1 gene, said target nucleic acid molecule comprising at least one CpG site, for the preparation of a kit for detecting endometrial cancer.

2. The use according to claim 1, wherein the reference genome is grch38.p14 and the partial region is selected from one or more of the negative strand DNA region of chr5:141431876-141432274, the positive strand DNA region of chr5:141417405-141417806 and the negative strand DNA region of chr5: 141417468-141417963.

3. The use according to claim 1 or 2, characterized in that the target nucleic acid molecule is a nucleic acid molecule isolated from a biological sample or is an artificially synthesized nucleic acid molecule.

4. A kit for detecting endometrial cancer, comprising a reagent for detecting the methylation level of a target nucleic acid molecule comprising a nucleotide sequence derived from the full length or a partial region of the PCDHGA1 gene, said target nucleic acid molecule comprising at least one CpG site.

5. The diagnostic kit of claim 4, wherein the partial region is selected from one or more of the group consisting of the negative strand DNA region of Chr5:141431876-141432274, the positive strand DNA region of Chr5:141417405-141417806 and the negative strand DNA region of Chr5:141417468-141417963 using GRCh38.p14 as a reference genome.

6. The kit of claim 5, wherein the partial regions comprise one or more of regions 1-6, region 7, and one or more of regions 8-9, wherein:

the region 1 is Chr5:141431961-141432134;

the region 2 is Chr5:141431961-141432143;

the region 3 is Chr5:141432026-141432134;

the region 4 is Chr5:141432026-141432143;

the region 5 is Chr5:141432055-141432134;

the region 6 is Chr5:141432055-141432143;

the region 7 is Chr5:141417583-141417733;

the region 8 is Chr5:141417612-141417817;

the region 9 is Chr5:141417647-141417817.

7. The kit of any one of claims 4 to 6, wherein the reagents comprise at least one of a primer pair and a probe.

8. The kit according to claim 7, wherein the primer pair comprises the region 1 primer pair having the nucleotide sequences shown in SEQ ID NO.10 and SEQ ID NO. 11; and/or the nucleotide sequences of the region 2 primer pair are shown as SEQ ID NO.10 and SEQ ID NO. 14; and/or the nucleotide sequences of the primer pairs in the region 3 are shown as SEQ ID NO.16 and SEQ ID NO. 11; and/or the nucleotide sequences of the region 4 primer pair are shown as SEQ ID NO.16 and SEQ ID NO. 14; and/or the nucleotide sequences of the primer pair in the region 5 are shown as SEQ ID NO.18 and SEQ ID NO. 11; and/or the nucleotide sequences of the region 6 primer pair are shown as SEQ ID NO.18 and SEQ ID NO. 14; and/or the nucleotide sequence of the region 7 primer pair is shown as SEQ ID NO.20 and SEQ ID NO. 21; and/or the nucleotide sequence of the primer pair in the region 8 is shown as SEQ ID NO.24 and SEQ ID NO. 25; and/or the nucleotide sequence of the region 9 primer pair is shown as SEQ ID NO.28 and SEQ ID NO. 25.

9. The kit of claim 7, wherein the probe comprises at least one of the probes shown as SEQ ID NO.30, SEQ ID NO.31 and SEQ ID NO.32.

10. The kit of any one of claims 4 to 6, further comprising at least one of cervical exfoliated cell preservation reagent, nucleic acid extraction reagent, nucleic acid conversion reagent, PCR reaction reagent, positive control sample and negative control sample.