CN116694754A

CN116694754A - Marker for diagnosing neuropathic pain and application thereof

Info

Publication number: CN116694754A
Application number: CN202310703086.3A
Authority: CN
Inventors: 周俊; 唐思敏; 程久荣; 林子强; 邓英东; 张祥声; 曹誉
Original assignee: Third Affiliated Hospital Of Southern Medical University (academy Of Orthopaedics Guangdong Province)
Current assignee: Wuxi Huana Medical Technology Co ltd
Priority date: 2023-06-14
Filing date: 2023-06-14
Publication date: 2023-09-05

Abstract

The invention discloses a marker for diagnosing neuropathic pain and application thereof, wherein the marker comprises XLO_ 035479, miR-183 and mTOR, wherein XLO_ 035479 is located in 168847439-168849101 of chromosome 5 and has the total length of 1663bp. The invention discovers that LncRNA (XLOCR_ 035479) and miR-183 can be used for diagnosing neuropathic pain for the first time, further regulates and controls the effect research of mTOR-mediated spinal cord neuron autophagy in neuropathic pain, and can be used as a potential treatment target for neuropathic pain.

Description

Marker for diagnosing neuropathic pain and application thereof

Technical Field

The invention belongs to the technical field of biological medicines, and particularly relates to a marker for diagnosing neuropathic pain and application thereof.

Background

Neuropathic Pain (NP) is pain directly caused by injury or disease of the somatosensory system, such as diabetic peripheral neuropathy, trigeminal neuralgia, trauma or neuropathy after chemoradiotherapy, phantom limb pain, cancer pain, etc. The incidence of NP rises year by year with aging global population, increasing incidence of diabetes and post-chemotherapy cancer pain. The international pain community recognizes that NP morbidity is about 3.3% -8.2%, NP morbidity in the general population is as high as 8.0%, NP morbidity in diabetics is as high as 22%, and there are 9000 tens of thousands of NP patients in china. The NP has long disease course and prolonged duration, seriously affects the life quality of patients, brings heavy economic burden to the patients and families and society thereof, and becomes a main public health problem. However, since the pathogenesis of NP is not completely understood, diagnosis and treatment of NP still face significant challenges, finding new targets for intervention in NP has extremely important social and clinical value.

Long non-coding RNAs (LncRNA) are a class of RNAs that are longer than 200nt in length and that do not themselves possess or encode small amounts of protein, and were originally thought to have no biological function. With the wide application of high-throughput sequencing technology, the abundant biological functions of LncRNA are continuously discovered in various organisms, and the LncRNA can regulate gene expression in multiple layers and multiple levels, including mechanisms such as influencing protein ubiquitination degradation, regulating gene translation by combining with an initiation factor, forming complementary double-chain interference mRNA shearing, improving stability up-regulating gene expression after combining with mRNA, combining with microRNA (miRNA) into competitive endogenous RNA (ceRNA) and the like, thereby influencing the occurrence and development of diseases. To date, lncRNA has been reported to play a functional role in the etiology of various diseases in humans. More and more researchers have also demonstrated that LncRNA is involved in the pathogenesis of NP, which may appear as a biomarker for prognosis, diagnosis and treatment, but the biological function and mechanism by which LncRNA regulates NP is still unknown.

miRNAs are endogenous non-coding small single-stranded RNAs of 21-25 nucleotides in length, highly conserved during evolution, becoming "micromanipulators" of gene expression, widely regulating complex cellular vital activities. miRNAs cause degradation or inhibit translation of target gene mRNA primarily by binding to the 3' untranslated region (3 ' -untranslated region,3' -UTR). Current studies confirm that miRNA regulates cell autophagy after peripheral nerve injury plays an important role. Shi et al found that miR-195 was upregulated after peripheral nerve injury, and inhibition of miR-195 expression activated autophagy, inhibited neuroinflammation, and reduced NP. Xie et al found that miR-183 inhibited NP by targeted modulation of mTOR/VEGF signaling in a CCI rat model. Therefore, how to discover markers for neuropathic pain diagnosis from the molecular level has important clinical significance and practical value.

Disclosure of Invention

The present invention is directed to a marker for diagnosing neuropathic pain and uses thereof. In order to achieve the purpose of the invention, the following technical scheme is adopted:

the invention provides a marker for diagnosing neuropathic pain, which comprises XLO_ 035479, miR-183 and mTOR, wherein XLO_ 035479 is located in 168847439-168849101 of chromosome 5 and has a total length of 1663bp.

In a preferred embodiment of the invention, the expression of XLO_ 035479 and mTOR is up-regulated and the expression of miR-183 is down-regulated.

In another aspect the invention also relates to a kit for diagnosing neuropathic pain for use in quantitative detection of xloc_035479, miR-183 and mTOR expression.

In another aspect the invention also relates to a medicament for the treatment of neuropathic pain for knocking out, inactivating or down the expression of XLOC 035479.

In a preferred embodiment of the invention, the medicament further comprises an agent that overexpresses miR-183.

In a further aspect the invention relates to the use of a marker as described above for the preparation of a reagent for diagnosing neuropathic pain.

In another aspect, the invention also relates to the use of the above-mentioned medicament for the preparation of a medicament for the treatment of neuropathic pain.

The invention has the beneficial effects that: the invention discovers that LncRNA (XLOCR_ 035479) and miR-183 can be used for diagnosing neuropathic pain for the first time, further regulates and controls the effect research of mTOR-mediated spinal cord neuron autophagy in neuropathic pain, and can be used as a potential treatment target for neuropathic pain.

Drawings

FIG. 1 in vitro assay to detect expression of XLO_ 035479, miR-183 and mTOR; and (3) injection: (A) qRT-PCR showed that glutamate stimulation can enhance mRNA expression of XlOC 035479 and mTOR in PC12 cells; whereas mRNA expression of miR-183 was down-regulated; (B-C) Western blotting showed that glutamate stimulation can enhance protein expression of mTOR in PC12 cells. * P <0.05; * P <0.01.

Figure 2 SNI rat mechanical pain was measured at different time points; and (3) injection: SNI rat mechanical pain was measured at different time points with P <0.05.

FIG. 3 in vivo experiments to detect expression of XLO_ 035479, miR-183 and mTOR; and (3) injection: (A) qRT-PCR showed that mRNA expression of XLOC_035479 and mTOR in spinal cord tissue was up-regulated after SNI; mRNA expression of miR-183 is down-regulated; (B) Western blotting showed that protein expression of mTOR was up-regulated in spinal cord tissue following valley SNI. * P <0.05; * P <0.01.

FIG. 4XLC_035479-/-rat tactile pain relief; and (3) injection: there was no significant difference between the two control groups (WT Sham group and KO Sham group); the mechanical pain threshold was increased for the KO SNI group compared to the WT SNI group, the difference was statistically significant, P <0.5.

FIG. 5 screen for XLOC_035479siRNA; and (3) injection: qRT-PCR detects the efficiency of siRNA transfection XLOC_ 035479.

FIG. 6 knockdown of XLOC_035479, inhibiting autophagy activity in PC12 cells; and (3) injection: (A) GFP-LC3 detection interfered with glutamate induced XLOCR_ 035479 of PC12 cells, decreasing autophagy activity of PC12 cells; (B-C) qRT PCR results showed that interference with glutamate induced XLOC_035479 of PC12 cells down-regulates LC3II/I mRNA expression; up-regulating mRNA expression of P62; (D-F) Western Blotting results showed that the interference of glutamate induced XLOC_035479 in PC12 cells down-regulates protein expression of LC3 II/I; up-regulating protein expression of P62.

FIG. 7XLOC_035479 and miR-183 regulate autophagy activity of PC12 cells; and (3) injection: LC3-GFP assay detects autophagy activity of PC12 cells under the control of XLO_ 035479 and miR-183. Blue: DAPI; green: LC3-GFP.

FIG. 8XLOC_035479 and miR-183 mediate autophagy events in PC12 cells; and (3) injection: (a-B) qRT-PCR showed that over-expression of miR-183 inhibited down-regulation of LC3II/I mRNA levels and elevation of p62 mRNA levels in glutamate-induced PC12 cells; (C-E) simultaneous knockdown of XLO_ 035479 and inhibition of miR-183 results in up-regulation of protein levels of LC3II/I and down-regulation of protein levels of p 62.

Detailed Description

In order to further understand the present invention, a technical solution in the embodiments of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention, and it is apparent that the described embodiments are only some embodiments of the present invention, but not all embodiments. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, are intended to be within the scope of the invention.

Unless otherwise specified, all reagents involved in the examples of the present invention are commercially available products and are commercially available.

Example 1:

1.1 materials and methods

1.1.1 laboratory animals

Healthy male SD rats (Sai Bai Nuo Biotech Co., ltd., beijing) had a weight of 220+ -20 g and a 6-8 week old. The rat raising environment is SPF clean grade, the indoor temperature is maintained at 20 ℃, the day and night period is 12/12h, and the rats can eat and drink water freely.

1.1.2 cell lines

Rat pheochromocytoma cells (PC 12 cells) were purchased from american culture collection (ATCC) agency.

1.2 Experimental methods

1.2.1 construction of SNI rat model

Male SD rats were randomly divided into 4 groups (6 per group) of 24: WT sham group, WT SNI group, KO sham group, and KO SNI group; the basal pain threshold was measured 1 day prior to modeling.

After anesthesia by intraperitoneal injection of 10% chloral hydrate (0.3 ml/100 g), the rat prone position was fixed on a rat holder, a hole towel was laid, the right lower limb of the rat was exposed and the rat hair was cut off. And (3) sterilizing the iodine and alcohol for three times, and filling a cushion block below the right hind limb, and fixing the right hind limb by using an adhesive tape, so as to expose subcutaneous muscles along the longitudinal line of the rear median line of the right thigh and the incision with the length of about 15-20 mm. After blunt separation of biceps femoris, semitendinosus and semimembranous muscle with hemostat, white and thick sciatic nerves (common fibular nerve, tibial nerve and sural nerve) were separated, and the right foot was drawn after stimulation. Ligature fibular nerve and tibial nerve, cut off the lower end of ligature with 9-0 noninvasive suture, intercept nerve tissue about 2mm, suture muscle and skin, and sterilize with iodophor. After the rats in the sham operation group were anesthetized, only the skin was cut to expose the right sciatic nerve (common fibular nerve, tibial nerve, sural nerve), but no clamp was used, the muscles and skin were sutured, and the iodophor was sterilized.

1.2.2 measurement of plantar mechanical pain

Rats were placed in separate compartments 3 days before the start of the experiment, each time for 30 minutes. The purpose is to make rats adapt to experimental environment and experimenters in advance, and reduce the risks of stress and bite. The experimental environment should be kept quiet and well controlled, constant temperature and humidity, and tested between 9:00 and 11:00 a day. Pain allergy testing was performed 1 day before surgery, 1 day after surgery, 3 days, 5 days, and 7 days, respectively.

On the day of testing, rats were placed in an overhead mesh floor test cage 30min before measuring plantar mechanical pain, allowing the cage to cease exploring and combing activities and the rats to become relaxed and resting. With plantar pain measuring system (Guangzhou Zhi Xiang Biotechnology Co., ltd.), the experimenter holds the stimulus sensor, stimulates the outer side of the sensor needle vertically with the last 2 paws, when the stimulus intensity gradually increases until the rats feel pain, the rats shrink the paws, and the system automatically records and displays the maximum force (in g) applied at this time. If a vague response (such as walking or combing) occurs, the stimulus is repeated and the threshold is again recorded. Licking or shaking the hind paw after stimulation is an indication of pain-related behavior. The mechanical stimulation was repeated 2 times at intervals of about 5min each, the threshold was recorded, and then the mean and standard deviation of the mechanical withdrawal threshold were calculated.

1.2.3 cardiac perfusion and Material availability

First, the infusion set and the infusion needle are installed. 4-5 syringes filled with pre-chilled PBS solution were prepared in advance, the tubing of the perfusion apparatus was flushed with 50ml pre-chilled 1 XPBS solution to remove the tube residue, and the remainder was ready for use. Scissors, forceps and hemostats are placed in the proper operative position on the console.

After the rats were anesthetized with 10% chloral hydrate (0.3 ml/100 g), the backs thereof were placed down on the console. The anesthesia degree was measured by a pinching reaction method. The animals were ensured to be nonreactive before starting the following procedure. A surgical knife is used to cut an opening along the diaphragm at the abdomen, and sharp scissors are used to cut off the tissue connected with the bottom of the diaphragm, so as to ensure that the tissue can enter the chest. The large scissors are taken, the blunt end is downward, and the left rib cage is cut through. The rib is cut transversely one to two cm across and the chest is opened. The heart was exposed by opening with hemostats. The blood-discharging and transfusion device is prepared. The heart (should still be beating) was held with forceps and the needle was inserted directly into the left ventricular beating site, exposed vertically for 5mm. Note that the needle is not inserted too much to puncture the ventricular wall and affect solution circulation. The needle is secured to the input port with a hemostatic forceps. Scissors are used for cutting an opening at the atrium, so that the free flow of the solution is ensured. The pre-chilled 1 XPBS solution is injected at a rate of about 20ml/min at a slow, steady flow rate, followed by a slow, steady flow rate, and typically 100-200ml of 1 XPBS solution is injected into a rat. If the solution does not flow freely or the solution flows from the nostrils or mouth of the animal, the needle is reset. When the blood is drained quickly, the perfusion is terminated. The spinal cord blowing method is adopted for material taking.

The dissecting instrument is sterilized with 70% ethanol and is rinsed in advance with normal saline or autoclave. Manufacturing a blowout method device: the 200ml pipette tip was placed in the exit port of a 5ml disposable syringe. The gun head is built until the tip round hole is slightly smaller than the thickness of the spinal canal of the spinal cord lumbar expansion section of the animal, and when the gun head is used, the gun head is tightly abutted against the spinal canal, so that the liquid pushed out by the injector is ensured to directly impact the spinal cord in the spinal canal through the gun head of the liquid transfer device.

After heart perfusion, the rat is directly broken, the bone rongeur is cut off from the two side ribs of the lumbar vertebra of the thoracic vertebra, and the spine of the required section is taken (2 sections with the head end upwards and 2 sections with the tail end downwards, so as to prevent the spinal cord of the required section from being damaged). 5ml of sterile pre-chilled 1 XPBS solution was aspirated with the device made as described above, and the exit port of the device was aligned with the end of the spinal canal obtained to ensure sealing, with the other end of the canal facing the petri dish containing pre-chilled 1 XPBS. The injector is quickly pushed, the spinal cord is separated from the vertebral canal under the action of water flow, falls into the culture dish, and the dura mater is peeled off.

The spinal cord was transected into 1cm 3 sections using scissors. And obtaining the corresponding equal-length specimens of the part of the false operation group by the same method. The treatment and fixation are carried out in three methods. Preserving the RNA later solution for qRT-PCR; fixing 4% paraformaldehyde of an isolated spinal cord for 1 hour, and then precipitating sugar in a gradient of 10% -20% -30%, embedding by an embedding agent, and preparing into frozen slices; freezing in liquid nitrogen, and preparing Western blotting.

1.2.4 acquisition of RNA sequences and protein information of XLOC_035479, miR-183, mTOR

RNA sequence information for XLO_ 035479 and mTOR was obtained by nucleotides (https:// www.ncbi.nlm.nih.gov/nucleotides /) in NCBI database. Sequence information for miR-183 was obtained using a miRbase (http:// www.mirbase.org). Protein sequence information for mTOR, AGO2 was obtained using Uniprot (https:// www.uniprot.org). All RNA, protein sequence information was saved using FASTA format.

1.2.5 analysis of homology and prediction of coding Capacity of LncRNA between different species

The sequence of the full length homology of XLO-035479 in the mouse and rat genomes was analyzed by UCSC database (http:// genome. UCSC. Edu /). The XLC_ 035479 protein encoding capacity was predicted using NCBI Open Reading Frame Finder (ORF Finder, https:// www.ncbi.nlm.nih.gov/orffinder /) and on-line sequence protein encoding capacity prediction tool Coding Potential Calculator (CPC, http:// cpc.cbi.pku.edu.cn /).

1.2.6 stimulation of PC12 cells with glutamate

And (5) performing drug treatment after the cells grow to the logarithmic phase.

Ultraviolet irradiation sterilization ultra-clean bench for 30min.

RPIM1640 complete medium containing 10% horse serum and 5% foetal calf serum, 0.25% trypsin solution, 1 XPBS were incubated in a water bath for 30min at 37 ℃.

The cell suspension was prepared at 1:3 ratio was inoculated into new dishes or flasks containing 4ml of complete medium.

Culturing in an incubator containing 5% CO2 at 37deg.C.

After 8h, cell adhesion was observed, and the medium was replaced with RPIM1640 medium containing 2% HS and 1% FBS, and allowed to stand overnight.

The corresponding volumes of glutamate were added to RPIM1640 medium containing 2% HS and 1% FBS to give a final glutamate concentration of 5mmol/L. PBS was added to the medium in the control group in a volume corresponding to glutamic acid as a control.

Each sample of the experimental and control groups was provided with 3 duplicate wells.

Placing the mixture into a 5% CO2 incubator at 37.5 ℃ for culturing for 24 hours respectively.

1.2.7RNA extraction and reverse transcription-real-time fluorescent quantitative PCR (Quantitative Real-time PCR, qRT-PCR)

(1) Extraction of total RNA from cells

The culture medium was removed by pipetting, and the dish was then inverted on filter paper, blotted as dry as possible, and placed on ice.

For 6-well plate dishes, 1000 μl Trizol was added and the cells were thoroughly lysed by repeated pipetting with a pipette, and the cell lysate was observed to change from viscous to clear without significant cell clumping.

The cell lysates were transferred to 1.5ml RNase-free EP tubes and left at room temperature for 5min.

200 μl of chloroform was added, the tube cap was closed, and the mixture was shaken well for 15s to mix the chloroform with the cell lysate well, and allowed to stand on ice for 3min.

Centrifuge at 12000RPM,4℃for 15min.

After centrifugation the visible solution was split into three phases: the upper layer is transparent water phase, the middle layer is protein, the lower layer is red chloroform and phenol component in TRIzol, and RNA is in water phase.

About 400. Mu.l of supernatant was carefully aspirated and transferred to a new enzyme-free EP tube, and no intermediate layer was aspirated.

Add 500 μl isopropanol, blow with a pipette, mix well with the aqueous phase, and rest on ice for 10min.

Centrifugation was carried out at 12000RPM at 4℃for 10min, and the supernatant was carefully discarded, and a white precipitate was observed to adhere to the bottom side wall of the EP tube.

Mu.l of 75% ethanol (75% ethanol was prepared with RNase-free ddH2O: absolute ethanol=1:3) was added and RNA pellet was washed.

7500RPM,4℃and 5min of centrifugation, carefully discard the supernatant and retain RNA pellet.

The tube lid was opened, and the RNA pellet was allowed to naturally dry, after which 20. Mu.l of RNase-free ddH2O was added to dissolve the RNA pellet.

The RNA is fully dissolved on a constant temperature heater or water bath for 10min at 55-60 ℃.

1. Mu.l of the RNA solution was measured for OD260 and OD280 of each RNA sample on a NanoDrop ND-1000 spectrophotometer, and the concentration was calculated. The remaining RNA should be immediately reverse transcribed or stored in a-80℃freezer for later use.

(2) Extraction of tissue Total RNA

The adapter of the tissue mill was placed in a-80 degree refrigerator pre-chill at least half an hour in advance. And 3mm and 4mm sized beads were placed in DEPC water overnight for use.

The tissue pieces were cut to the appropriate size and rinsed 1-2 times with sterile PBS. Samples and grinding beads (one each of 3mm and 4 mm) were placed in a 1.5ml EP tube.

Spinal cord tissue (i.e., spinal cord tissue taken after SNI model experiment group and Sham control group constructed by knockout rats and wild rats) stored in a-80-degree refrigerator is placed on clean filter paper, about 20-50mg of tissue blocks are taken from each sample, placed in a clean 1.5ml EP tube, and rapidly placed on ice for storage.

1000 μl Trizol was quickly added to the EP tube.

A1.5 ml EP tube was placed in the adapter, mounted in a tissue mill, set operating parameters, 65Hz,30s apart, 30s, repeated 3 times, and spinal cord tissue was milled.

After the operation of the apparatus was completed, it was centrifuged at 12000RPM at 4℃for 15 minutes. About 400. Mu.l of supernatant was carefully aspirated and transferred to a new enzyme-free EP tube, and no intermediate layer was aspirated.

500 μl of isopropanol was added, and the mixture was blown with a pipette to mix the aqueous phase thoroughly, and left on ice for 10min.

The tube lid was opened, and the RNA pellet was allowed to dry naturally, after which 50. Mu.l of RNase-free ddH2O was added to dissolve the RNA pellet.

(3) Primer design and Synthesis

Searching mRNA sequences of the genes to be detected by using a nucleotides tool (https:// www.ncbi.nlm.nih.gov/nucleotides /) of the NCBI database; and specific primers were designed using BLAST online software (https:// BLAST. Ncbi. Nlm. Nih. Gov/BLAST. Cgi); mature sequence of miRNA was obtained using a miRbase database (http:// www.mir base. Org); and submitting the designed primer sequence and the related information of the mature miRNA mature sequence to Guangzhou Ruibo biotechnology Co-Ltd for product synthesis.

TABLE 1 primer sequence information

(4) Reverse transcription

Reverse transcription of mRNA

The reverse transcription step of mRNA was performed strictly as described in TOYOBO FSK-101ReverTra Ace-a kit: the following mixtures were prepared in a Microtube.

Table 2 Mixed liquor (1)

After 5min of incubation at 65℃the product was rapidly cooled on ice for 1min.

The following reverse transcription reaction solutions were prepared in the above described Microtube in a total amount of 20. Mu.l.

Table 3 Mixed liquor (2)

Slowly mixing.

The reverse transcription reaction was performed under the following conditions:

30 ℃;10min (when Random Primer is used)

42℃；20min

99℃；5min

4℃；∞

The cDNA was stored at-20 ℃.

Reverse transcription of miRNAs

The reverse transcription step of miRNA is strictly carried out according to the instructions of TIANGEN KR-01 miRcute enhanced miRNA cDNA first strand synthesis kit.

The following solutions were prepared in RNase-free PCR tubes.

Table 4 shows the mixture (3)

Mixing the above solutions, and incubating at 85deg.C for 5min to open RNA secondary structure. Immediately thereafter, the mixture was placed on ice to prevent RNA renaturation from restoring the secondary structure again.

The following solutions were prepared in another RNase-free PCR tube.

Table 5 Mixed liquor (4)

Slowly mixing.

42 ℃;60min (miRNA and Poly A tail reaction and reverse transcription reaction)

95 ℃;3min (enzyme inactivation reaction)

4℃；∞

The cDNA was stored at-20 ℃.

(5) Real-time quantitative PCR reaction (qRT-PCR)

qRT-PCR reaction of mRNA

The qRT-PCR reaction procedure for mRNA was performed strictly as described for the TB Green Premix Ex Taq II (TII RNaseH Plus, taKaRa, RR 820A) kit.

Three complex wells are added to each gene to be detected, and qRT-PCR reaction liquid is prepared according to the following components of each well.

Table 6 shows the mixture (5)

qRT-PCR reactions were performed according to the following reaction parameters:

pre-denaturation:

95℃，30s(Ramp Rate 4.4℃/s)

1 cycle

And (3) PCR reaction:

95℃，5s(Ramp Rate 4.4℃/s)

60℃，30s(Ramp Rate 2.2℃/s，Acquisition Mode:Single)

40 cycles

Melting:

95℃，5s

60℃，60s(Ramp Rate 2.2℃/s)

1 cycle

And (3) cooling:

50℃，30s(Ramp Rate 2.2℃/s)

1 cycle

qRT-PCR reaction of miRNA

The qRT-PCR reaction steps of miRNA are strictly carried out according to the instructions of a Fastking one-step reverse transcription-fluorescence quantification (SYBR Green, TIANGEN, FP 313-01) kit.

Table 7 Mixed liquor (6)

reverse transcription:

50℃，30min

1 cycle

Pre-denaturation:

95℃，2min

1 cycle

And (3) PCR reaction:

94℃，20s

50-60℃，20s

68℃，20s

35-45 cycles

Analysis of experimental results

The analysis is carried out by using data analysis software matched with a light cycler/light cycler 480System (Roche Diagnostics) fluorescent quantitative PCR instrument, and the calculation is carried out by adopting a 2-delta Ct method.

1.2.8 Western Blotting (Western Blotting) detection

(1) Extraction of monolayer adherent cell total protein

Preparing RIPA cell lysate: mu.l of 100mM protease inhibitor PMSF was added to 1ml of RIPA lysate and the mixture was shaken on ice.

The culture supernatant was discarded, and the culture dish was back-fastened to the filter paper to suck the culture solution as dry as possible.

For 6-well plate dishes, 3ml of 4℃pre-chilled 1 XPBS was added to each well and washed 3 times. The plates were placed on a shaker for 1min, then 1 XPBS was discarded and the dishes were placed on ice.

400 μl of the pre-prepared cell lysate (containing PMSF) was added to each well and the mixture was subjected to shaking lysis on a shaker for 30min, preferably on ice.

After lysis, the cells were scraped rapidly to one side of the flask with a clean scraper and the cell debris and lysates were transferred to a 1.5ml EP tube using a pipette.

Cells were disrupted using an ultrasonic disrupter, power 35w,10s, 5s apart, and repeated 3 times.

Centrifuge at 12000RPM for 5min at 4 ℃.

The centrifuged supernatant was transferred to an EP tube of 0.5ml and stored at-20 ℃.

(2) Extraction of tissue Total protein

After 400. Mu.l of cell lysate (containing PMSF protease inhibitor) was added, the EP tube was placed in an adapter, mounted in a tissue mill, operating parameters were set, 65Hz,30s apart, 3 replicates, and spinal cord tissue was milled.

After the equipment operation is finished, the cells are crushed by using an ultrasonic crusher, the power is 35W and 10s, the interval is 5s, and the steps are repeated for 3 times.

Centrifuging at 12000RPM at 4deg.C for 10-20min, and collecting supernatant.

Split-packed in 0.5ml EP tubes and stored at-20 ℃.

(3) Protein concentration measurement by BCA method

The determination of the concentration of the sample protein is carried out strictly according to the instructions of the BCA protein quantification kit (Thermo, USA).

The sample was diluted by adding 4. Mu.l of the protein sample to 96. Mu.l of deionized water, and the sample was diluted 25-fold.

Mu.l of standard or protein samples are pipetted into each well of a 96-well plate.

200 μl BCA working fluid (fluid A: fluid B=50:1) was added to each well. Shaking was uniform for 30s. And (5) covering the cover.

Standard measurement: the reaction is incubated at 37℃for 30min or at room temperature for 2-16 hours.

Boosting assay: the reaction was incubated at 60℃for 15min.

The plate was cooled to room temperature.

Absorbance at 562nm was measured on a microplate reader.

Correcting the absorbance: the absorbance of the blank tube was subtracted from the absorbance of the standard and sample.

A standard curve is drawn in combination with the known concentration of BSA standard and corrected absorbance.

Protein concentration was calculated from the corrected absorbance of each protein sample with reference to the standard curve.

(4) Preparation of protein samples

Adjusting the concentration of protein sample with RIPA lysate, adding 1/4 of 5 XSDS loading buffer solution, water-bathing at 100deg.C for 5min to thoroughly denature protein, centrifuging at 12000RPM and 4deg.C for 15min, and storing in-80deg.C refrigerator for long term.

(5) SDS-PAGE protein electrophoresis

The SDS-PAGE protein electrophoresis step was performed strictly according to the instruction of the SDS-PAGE gel rapid preparation kit (Biyun, p0012 ac).

The gel concentration is selected according to the molecular weight of the target protein, and the laminated gel (upper gel) and the separating gel (lower gel) are prepared according to the specification, fixed on an electrophoresis tank and added with enough 1 times of electrophoresis buffer solution.

An equal amount (recommended: 50 mg) of total protein was added to the electrophoresis gel wells using a pipette and gel injection tip, and 10. Mu.l of marker protein was added to each of the blank wells on both sides.

Switching on the power supply, and running the laminated adhesive for 20min at 80V voltage; after the sample enters the separation gel, the voltage is adjusted to 180V, and when the indicator bromophenol blue strip in the sample runs to the bottom end, the electrophoresis is stopped.

(6) Transfer film

The PVDF film was cut and angle-cut in advance and placed in methanol for 3min for activation.

PVDF membrane, sponge and filter paper are placed in precooled 1X membrane transferring liquid for standby.

The transfer clip was opened to keep the black side horizontal. The whole operation is carried out in 1X membrane transferring liquid, and note that the filter papers on the two sides of the membrane cannot be contacted with each other, and short circuit can occur after contact.

And putting the film transfer clamp into a wet film transfer groove, adding precooled 1X film transfer liquid, and starting film transfer. Meanwhile, ice cubes are placed around the electrophoresis tank, so that overlarge heat generated during electric rotation is prevented.

The wet transfer condition is generally set at a constant current of 300mA for 1.5-2h.

(7) Antibody hybridization

1) Closure

Immediately after the transfer, the PVDF film was placed in a 1 XTBST washing solution prepared in advance, and rinsed for 1-2min to wash off the transfer solution on the film. The PVDF membrane was blocked for 1h with a shaking table at room temperature using 1 XTBST washing solution to prepare 5% skim milk, the blocking solution was recovered and washed 5min X3 times with 1 XTBST washing solution.

2) Incubation with primary antibody

Primary antibodies were diluted 1:1000 in 5% BSA and incubated overnight at 4 ℃. Recovering the primary antibody. The solution of 1 XTBST was added to wash 5min X5 times.

3) Second antibody incubation

Horseradish peroxidase (HRP) -labeled secondary antibodies were diluted 1:2000 in 1×tbst. Incubation on shaker for 1h. Recovering the secondary antibody. The solution of 1 XTBST was added to wash 5min X3 times.

(8) Protein detection and gel image analysis

1) Protein detection

Developing solution a in the fixing kit using Amersham ECL Prime Western Blotting Detection Regent (RPN 2232, cytova): and (3) uniformly dripping the solution B on the PVDF film after preparing the solution B according to the volume of 1:1, performing image exposure by using a chemiluminescent instrument, photographing and preserving pictures.

2) Gel image analysis

The molecular weight and net optical density values of the target bands were analyzed using a gel image processing system. Protein grayscale of the band was obtained with Image J.

1.2.8 statistical analysis

All data were repeated more than three times independently and data were expressed as Mean ± standard deviation (Mean ± SD). For data subject to normal distribution, the comparison between the two groups adopts t-test; the comparison of the differences between the groups adopts a single factor variance test method, and P <0.05 is taken as a test level. Statistical analysis and mapping were done by Prism 8.0 software.

1.3 experimental results

1.3.1XLOC_035479 molecular characterization

XLOC 035479 is a new, unexplored lncRNA with distinct features in terms of gene sequence, localization and bioinformation. XLO_ 035479 is located on chromosome 5 (chr 5: 168847439-168849101), full length 1663bp. Through the UCSC database, XLOC 035479 was observed to have a highly relatively conserved region between human, mouse and rat, which suggests important biological significance from its high degree of homology and evolutionarily high conservation among species.

1.3.2 in vitro experiments to detect the expression of XLOC_035479, miR-183 and mTOR

To preliminarily verify the analysis results of sequencing, PC12 cells were stimulated with 10mmol of glutamic acid, after 24 hours, qRT-PCR experiments were performed on XLO-035479 and miR-183, and qRT-PCR and Western blotting experiments were performed on mTOR. The results show that: expression of xloc_035479 and mTOR was significantly up-regulated with glutamate stimulated PC12 cells, the difference being statistically significant (P < 0.01); whereas miR-183 was down-regulated, the difference was statistically significant (P < 0.05) (FIG. 1).

1.3.3SNI rat model induced NP

To study lncRNA in the SNI rat model to induce differential expression in NP spinal cord tissue, the SNI rat model was first constructed and the mechanical footstrike reflex threshold (Mechanical Withdrawl Threshold, MWT) of the rats was measured 1 day before, 1 day after, 3 days, 5 days, and 7 days after surgery, to verify whether the rat SNI model was successfully established. The measurement results show that the Sham rats have no obvious change after operation compared with the preoperation. The MWT fell to 3.07+0.49g immediately after surgery on day 1 in SNI group rats, significantly lower than that of Sham group, and thereafter its MWT remained at this level, indicating successful establishment of SNI-induced NP model (FIG. 2; table 9).

Table 9 MWT comparison (g) at different time points for two groups of rats

Note that: * P <0.05.

1.3.4 in vivo experiments to detect expression of XLOC_035479, miR-183 and mTOR

To analyze whether xloc_035479 functions in NP model, a SNI rat model was further constructed, total RNA was extracted for qRT-PCR after spinal cord tissue was taken on day 8, and xloc_035479, miR-183, and mTOR expression was analyzed. The results show that: the SNI group compared with Sham group, xloc_035479 and mTOR expression were significantly up-regulated, the differences were statistically significant (P < 0.01); whereas miR-183 expression was significantly down-regulated, the differences were statistically significant (P < 0.01) (fig. 3). In vitro and in vivo experiments preliminarily verify that the expression changes of XLO_ 035479, miR-183 and mTOR accord with the results of bioinformatics analysis, and a research foundation is laid for further experiments.

Preliminary demonstration shows that expression of XLOC 035479, mTOR was significantly up-regulated, while expression of miR-183 was down-regulated after nerve injury. The experimental results are basically consistent with the bioinformatics analysis results, and a foundation is laid for further researching the relationship among XLO_ 035479, mTOR and miR-183.

1.4 conclusion

In this example, a new LncRNA was found by the first analysis of the LncRNA chip, designated XLOCR_ 035479, which was significantly up-regulated in NP and significantly associated with autophagy activity. Next, by taking the full length sequence of XLO_ 035479 and subsequent bioinformatics analysis, XLO_ 035479 was found to be incapable of encoding proteins. Meanwhile, xloc_035479 and mTOR were significantly elevated after nerve injury, while miR-183 was down-regulated, as demonstrated in vitro and in vivo.

Example 2

2.1 materials and methods

2.1.1 laboratory animals

CRISPR/Cas9 technology construction xloc_035479 knockout rats were purchased (racing biosciences, inc., guangzhou) and subsequently bred under the same conditions as SD rats.

2.1.2 Experimental methods

(1) Constructing an SNI rat model: the procedure was as in example 1.

(2) Pain behavioural measurements: the procedure was as in example 1.

(3) Heart perfusion and material drawing: the procedure was as in example 1.

(4) Cell culture: the procedure is as in example 1 (including cell resuscitation, cell passaging and cell cryopreservation).

(5) Cell transfection

The cell lines are passaged to 30-50% confluence the day before transfection, and Lipofectamine2000 or Lipofectamine is adopted for transfection ^TM RNAiMAX transfection reagent, siRNA/miRNA working concentration of 50nM, using Opti-MEM medium at transfection.

For example, a 24-well plate was used, the surface area of each well was 1.9cm2, and the amount of the medium was 500. Mu.l, i.e., 1.25. Mu.l of siRNA mother liquor (20. Mu.M) was pipetted into 100. Mu.l of Opti-MEM medium as solution A, and 1. Mu.l of Lipofectamine2000 or Lipofectamine was pipetted ^TM RNAiMAX is dissolved in Opti-MEM culture medium as solution B, after mixing solution B for 5min, solution A and solution B are mixed, and after resting for 20min, added to cell culture plate.The above procedure was the amount per well.

After 4 hours of incubation, the medium was changed to cell growth medium.

The samples were collected 24-36 hours later and 36-48 hours later for subsequent experiments.

Synthesis and design of specific siRNA

TABLE 10siRNA sequence information

(6) MicroRNA mimics and inhibitors

mimetics and inhibitors of miR-183 were commissioned for synthesis and design by Ruibo biotechnology Co., ltd.

Basic information: miRNA mimic Ncontrol #24 for human, mouse and rat

Mature miRNA name: cel-miR-67-3p

Mature miRNA numbering: MIMAT0000039

Mature miRNA sequence: UCACAACCUCCUAGAAAGAGUAGA

The product specification is as follows: 5nmol

The purification mode is as follows: standard purification

(7) Western Blotting (Western Blotting) detection

The procedure was as in example 1.

(8)qRT-PCR

The procedure was as in example 1.

TABLE 11 primer sequence information

(9) Statistical analysis

2.3 experimental results

2.3.1 XLOC_035479-/-rats relieve mechanical pain

We constructed xloc_035479 whole-gene knockout rats (xloc_ 035479-/-) using the CRISPR/Cas9 system and performed mechanical threshold measurements on the same animal at different time points by constructing the SNI model. The mechanical threshold measurement results show that: the WT Sham group was not significantly different from the KO Sham group; the KO SNI group was upregulated for mechanical pain relative to the WT SNI group, and the differences were statistically significant (P < 0.5). This suggests that xloc_035479 is involved in the progress of NP (fig. 4, table 12).

Table 12 MWT comparison (g) at different time points for four groups of rats

2.3.2 screening XLOC 035479siRNA

To explore the biological function of xloc_035479 in PC12 cells, siRNA at three different binding sites of xloc_035479 were designed to transfect PC12 cells and transfection efficiency was detected by qRT-PCR. Finally, si-xloc_035479-1 was chosen for further experiments due to its high inhibition efficiency (fig. 5).

2.3.3XLOC_035479 activating autophagy Activity in PC12 cells

Previously we know that xloc_035479 was significantly up-regulated in glutamate-induced PC12 cells. Bioinformatics analysis, xloc_035479, was involved in autophagy. Thus, we next explored the autophagy activity changes of xloc_035479 in PC12 cells. GFP-LC3 analysis demonstrated a significant enhancement of PC12 autophagy following glutamate stimulation (FIG. 6A); whereas the knockdown of XLOC 035479 significantly inhibited glutamate-induced autophagy. qRT-PCR and Western Blotting experiments further prove that after glutamic acid stimulation, the LC3II/I level is obviously increased, the p62 level is obviously down-regulated, and autophagy activity is activated; and the opposite is true after the xloc_035479 is knocked down (fig. 6B-F). These data indicate that expression of XLOC 035479 is capable of activating autophagy, and that inhibition of XLOC 035479 inhibits autophagy, suggesting that XLOC 035479 affects NP development by mediating autophagy events.

2.3.4 inhibition of autophagy Activity by miR-183 in PC12 cells

Co-expression analysis has shown that XLO_ 035479 has an interactive relationship with miR-183. Xloc_035479 is able to activate autophagy activity in PC12 cells, how miR-183 affects autophagy in PC12 cells, xloc_035479 and miR-183 mediate autophagy activity with the ceRNA mechanism, deserving discussion.

GFP-LC3 analysis demonstrated that PC12 cell autophagy activity was significantly enhanced following glutamate stimulation; overexpression of miR-183 significantly inhibited glutamate-induced autophagy, while simultaneous knockdown of XLOC_035479 and inhibition of miR-183 enhanced autophagy events inhibited by miR-183 (FIG. 7). qRT-PCR and Western blot experiments further prove that after glutamic acid stimulation, the LC3II/I level is obviously increased, the p62 level is obviously down-regulated, and autophagy activity is activated; and the result is opposite after miR-183 is over-expressed. Knocking down XLOC 035479 and inhibiting miR-183 increased autophagy-related markers (fig. 8). Through the analysis, XLO_ 035479 and miR-183 regulate autophagy activity of PC12 cells.

2.4 conclusion

In this example, we provided a series of evidence that XLO_ 035479 and miR-183 are novel regulatory factors involved in autophagy. First, the use of siRNA to knock down xloc_035479 can specifically inhibit autophagy-related markers; second, the use of miRNA mimics to overexpress miR-183 can specifically inhibit autophagy-related markers; third, treatment of PC12 cells with both miRNA inhibitor and xloc_035479siRNA found that miR-183 was able to reverse the inhibition of autophagy by xloc_ 035479.

The foregoing describes preferred embodiments of the present invention, but is not intended to limit the invention thereto. Modifications and variations to the embodiments disclosed herein may be made by those skilled in the art without departing from the scope and spirit of the invention.

Claims

1. A marker for diagnosing neuropathic pain, the marker comprising xloc_035479, miR-183, and mTOR, wherein xloc_035479 is located at 168847439-168849101 of chromosome 5, full length 1663bp.

2. The marker of claim 1, wherein expression of xloc_035479 and mTOR is up-regulated and expression of miR-183 is down-regulated.

3. A kit for diagnosing neuropathic pain for use in quantitatively detecting expression of xloc_035479, miR-183 and mTOR, wherein xloc_035479 is located at 168847439-168849101 of chromosome 5, full length 1663bp.

4. A medicament for treating neuropathic pain for knocking out, inactivating or down the expression of xloc_035479, wherein xloc_035479 is located at 168847439-168849101 of chromosome 5, full length 1663bp.

5. The medicament of claim 4, further comprising an agent that overexpresses miR-183.

6. Use of the marker of claim 1 or 2 for the preparation of a reagent for diagnosing neuropathic pain.

7. Use of a medicament according to claim 4 or 5 for the preparation of a medicament for the treatment of neuropathic pain.