CN116676304A

CN116676304A - Transgenic corn event LP016-1 and detection method thereof

Info

Publication number: CN116676304A
Application number: CN202310889855.3A
Authority: CN
Inventors: 李晓娇; 梅方明; 李树秀; 李胜兵; 卢娟; 韩雨颖
Original assignee: Longping Biotechnology Hainan Co ltd
Current assignee: Longping Biotechnology Hainan Co ltd
Priority date: 2023-07-20
Filing date: 2023-07-20
Publication date: 2023-09-01
Anticipated expiration: 2043-07-20
Also published as: CN116676304B

Abstract

The present invention provides a nucleic acid sequence comprising one or more selected from the sequences SEQ ID NO. 1-7 or the complement thereof, said nucleic acid sequence being derived from transgenic maize event LP016-1, a representative sample of seed comprising said event having been deposited with the accession number CCTCC NO. P202310. The transgenic corn event LP016-1 of the invention not only has good resistance to ingestion by coleopteran pests, but also is tolerant to glufosinate-containing agricultural herbicides, and has the following advantages: is protected from economic losses due to coleopteran pests; corn crops that can tolerate the common commercial herbicide glufosinate; the corn yield is not reduced; enhancing breeding efficiency, enabling the use of molecular markers to track transgene inserts in the breeding populations and their offspring. Meanwhile, the detection method provided by the invention can rapidly, accurately and stably identify the existence of the plant material derived from the transgenic corn event LP 016-1.

Description

Transgenic corn event LP016-1 and detection method thereof

Technical Field

The invention belongs to the technical field of molecular biology, relates to a detection method of transgenic plants and products thereof, and in particular relates to a transgenic corn event LP016-1 which is resistant to target insects and resistant to application of glufosinate herbicide, and a nucleic acid sequence and a method for detecting the transgenic corn LP 016-1.

Background

Corn (Zea mays l.) is the predominant food crop in many parts of the world. Biotechnology has been applied to corn to improve its agronomic traits and quality. Insect resistance is an important agronomic trait in corn production, particularly resistance to lepidopteran insects (e.g., corn borer, cotton bollworm, spodoptera frugiperda, etc.) and coleoptera (western corn rootworm, northern corn rootworm, mexico corn rootworm, etc.). Resistance of maize to lepidopteran and coleopteran insects can be obtained by transgenic methods to express lepidopteran and coleopteran insect resistance genes in maize plants. Another important agronomic trait is herbicide tolerance, in particular glufosinate herbicide tolerance. Tolerance of maize to glufosinate herbicide can be achieved by transgenic approaches to express a glufosinate herbicide tolerance gene (e.g., pat) in maize plants.

In addition to the functional gene itself, the choice of regulatory elements and their sequential arrangement are critical for obtaining good transformation events and their technical effects are unpredictable. In addition, the expression of exogenous genes in plants is affected by their insertion into the maize genome, possibly due to the proximity of chromatin structures (e.g., heterochromatin) or transcriptional regulatory elements (e.g., enhancers) to the integration site. For this reason, it is often necessary to screen a large number of events to make it possible to identify events that can be commercialized (i.e., events in which the introduced target gene is optimally expressed). For example, it has been observed in plants and other organisms that the expression level of the introduced gene may vary greatly between events; there may also be differences in the spatial or temporal pattern of expression, such as differences in the relative expression of transgenes between different plant tissues, which differences may be manifested in actual expression patterns that are inconsistent with the expression patterns expected for the transcriptional regulatory elements in the introduced gene construct. Thus, it is often desirable to generate hundreds or thousands of different events and screen those events for a single event having transgene expression levels and patterns that are expected for commercialization purposes. Such transformation events have excellent coleopteran pest and herbicide resistance and do not affect corn yield, and conventional breeding methods can be used to backcross transgenic traits into other genetic backgrounds by crossing. The progeny produced by this crossing maintains the transgene expression characteristics and trait performance of the original transformant. The application of the strategy mode can ensure reliable gene expression in a plurality of varieties, has stable coleopteran pests and herbicide resistance, prevents the varieties from being damaged by main coleopteran pests, has broad-spectrum weed control capability, and can be well suitable for the growth conditions of places.

It would be beneficial to be able to detect the presence of a particular event to determine whether the progeny of a sexual cross contain a gene of interest. In addition, methods of detecting specific events will also help to comply with relevant regulations, such as the need for formal approval and marking of foods derived from recombinant crops prior to their being put on the market. It is possible to detect the presence of the transgene by any well known polynucleotide detection method, such as Polymerase Chain Reaction (PCR) or DNA hybridization using polynucleotide probes. These detection methods are generally focused on commonly used genetic elements such as promoters, terminators, marker genes, and the like. Thus, unless the sequence of chromosomal DNA adjacent to the inserted transgenic DNA ("flanking DNA") is known, such a method as described above cannot be used to distinguish between different events, particularly those generated with the same DNA construct. Therefore, it is common today to identify a transgene specific event by PCR using a pair of primers spanning the junction of the inserted T-DNA and flanking DNA, specifically a first primer comprising the flanking sequence and a second primer comprising the inserted sequence.

Disclosure of Invention

The invention aims to provide a transgenic corn event LP016-1, a nucleic acid sequence for detecting corn plant LP016-1 event and a detection method thereof, which can accurately and rapidly identify whether a biological sample contains a DNA molecule of a specific transgenic corn event LP 016-1.

To achieve the above object, the present invention provides a nucleic acid sequence comprising one or more selected from the sequences SEQ ID NO 1-7 (i.e., SEQ ID NO 1, SEQ ID NO 2, SEQ ID NO 3, SEQ ID NO 4, SEQ ID NO 5, SEQ ID NO 6, SEQ ID NO 7) or the complement thereof. In some embodiments, the nucleic acid sequence is derived from a plant, seed, or cell comprising transgenic maize event LP016-1, a representative sample of seed comprising the event having been deposited at the chinese collection center (CCTCC, address: eight of the university of arms and kangaroo, wuhan, the university of arms and kangaroo, postal code 430072) under the accession number cctccc No. P202310 on day 25 of 2023, classification nomenclature: corn (Zea mays l.). In some embodiments, the nucleic acid sequence is an amplicon diagnostic for the presence of transgenic maize event LP 016-1.

In some embodiments of the invention, the invention provides a nucleic acid sequence comprising at least 11 consecutive nucleotides of SEQ ID NO. 3 or a complement thereof and/or at least 11 consecutive nucleotides of SEQ ID NO. 4 or a complement thereof. In some embodiments, the nucleic acid sequence comprises SEQ ID NO. 1 or a complement thereof, and/or SEQ ID NO. 2 or a complement thereof. In some embodiments, the nucleic acid sequence comprises SEQ ID NO. 3 or a complement thereof, and/or SEQ ID NO. 4 or a complement thereof. In some embodiments, the nucleic acid sequence comprises SEQ ID NO. 5 or a complement thereof.

The SEQ ID NO. 1 or the complementary sequence thereof is a sequence with the length of 22 nucleotides, which is positioned near the insertion junction at the 5 '-end of the insertion sequence in the transgenic corn event LP016-1, the SEQ ID NO. 1 or the complementary sequence thereof spans the flanking genome DNA sequence of the corn insertion site and the DNA sequence at the 5' -end of the insertion sequence, and the existence of the transgenic corn event LP016-1 can be identified by the SEQ ID NO. 1 or the complementary sequence thereof. The SEQ ID NO. 2 or the complementary sequence thereof is a sequence with the length of 22 nucleotides, which is positioned near the insertion junction at the 3 '-end of the insertion sequence in the transgenic corn event LP016-1, the SEQ ID NO. 2 or the complementary sequence thereof spans the DNA sequence at the 3' -end of the insertion sequence and the flanking genomic DNA sequence of the corn insertion site, and the existence of the transgenic corn event LP016-1 can be identified by the SEQ ID NO. 2 or the complementary sequence thereof.

The nucleic acid sequences provided herein can be at least 11 or more contiguous polynucleotides (first nucleic acid sequences) of any portion of the transgene insert sequence in SEQ ID No. 3 or its complement, or at least 11 or more contiguous polynucleotides (second nucleic acid sequences) of any portion of the 5' flanking maize genomic DNA region in SEQ ID No. 3 or its complement. The nucleic acid sequence may further be homologous or complementary to a portion of the SEQ ID NO. 3 comprising the complete SEQ ID NO. 1. When the first nucleic acid sequence and the second nucleic acid sequence are used together, these nucleic acid sequences comprise a pair of DNA primers in a DNA amplification method that produces an amplification product. The presence of transgenic maize event LP016-1 or a progeny thereof can be diagnosed when the amplification product generated in the DNA amplification method using the DNA primer pair is an amplification product comprising SEQ ID NO. 1. It is well known to those skilled in the art that the first and second nucleic acid sequences need not consist of only DNA, but may include RNA, a mixture of DNA and RNA, or a combination of DNA, RNA, or other nucleotides or analogs thereof that do not serve as templates for one or more polymerases. Furthermore, the probes or primers described in the present invention should be at least about 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or 22 consecutive nucleotides in length, which may be selected from the nucleotides set forth in SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4 and SEQ ID NO. 5. When selected from the group consisting of the nucleotides set forth in SEQ ID NO. 3, SEQ ID NO. 4 and SEQ ID NO. 5, the probes and primers may be about 17 to 50 or more consecutive nucleotides in length. The sequence of SEQ ID NO. 3 or its complement is a 1330 nucleotide long sequence located near the 5 'end of the insertion junction in the transgenic maize event LP016-1, the SEQ ID NO. 3 or its complement consists of a 838 nucleotide maize flanking genomic DNA sequence (nucleotides 1-838 of SEQ ID NO. 3), a 376 nucleotide pLP016 construct DNA sequence (nucleotides 839-1214 of SEQ ID NO. 3) and a 116 nucleotide 3' end DNA sequence of the tNos terminator (nucleotides 1215-1330 of SEQ ID NO. 3), comprising the SEQ ID NO. 3 or its complement can be identified as the presence of the transgenic maize event LP 016-1.

The nucleic acid sequence may be at least 11 or more contiguous polynucleotides (third nucleic acid sequence) of any portion of the transgene insert sequence in the SEQ ID NO. 4 or its complement, or at least 11 or more contiguous nucleotides (fourth nucleic acid sequence) of any portion of the 3' flanking maize genomic DNA region in the SEQ ID NO. 4 or its complement. The nucleic acid sequence may further be homologous or complementary to a portion comprising the complete SEQ ID NO. 2 or SEQ ID NO. 4. When the third nucleic acid sequence and the fourth nucleic acid sequence are used together, the method of amplifying DNA to produce an amplified product includes a pair of DNA primers. The presence of transgenic maize event LP016-1 or a progeny thereof can be diagnosed when the amplification product generated in the DNA amplification method using the DNA primer pair is an amplification product comprising SEQ ID NO. 2. The sequence of SEQ ID NO. 4 or its complement is 1228 nucleotides in length near the 3' -end of the insertion junction in the transgenic maize event LP016-1, the SEQ ID NO. 4 or its complement consists of a t35S transcription terminator sequence of 195 nucleotides (nucleotides 1-195 of SEQ ID NO. 4), a pLP016 construct DNA sequence of 186 nucleotides (nucleotides 196-381 of SEQ ID NO. 4) and a maize integration site flanking genomic DNA sequence of 847 nucleotides (nucleotides 387-1228 of SEQ ID NO. 4), comprising the SEQ ID NO. 4 or its complement can be identified as the presence of the transgenic maize event LP 016-1.

The sequence of SEQ ID NO. 5 or its complement is a sequence of 11934 nucleotides in length characterizing transgenic maize event LP016-1, which specifically contains the genome and genetic elements as shown in Table 1. The presence of transgenic maize event LP016-1 can be identified by inclusion of the SEQ ID NO. 5 or its complement.

Table 1, genome and genetic element contained in SEQ ID NO. 5

Genetic element	Length of	At position on SEQ ID NO. 5
			5' genome	838bp	1-838
RB	376bp	839-1214
			tNos	253bp	1215-1467
Cry3Bb	1962bp	1474-3435
			iZmHSP70	812bp	3442-4253
p35s	322bp	4254-4575
			pOsAct1	1418bp	4584-6001
Cry3Aa	1797bp	6002-7798
			tIn2	348bp	7799-8146
pZmUbi1	1993bp	8153-10145
			PAT	253bp	10146-10697
t35s	195bp	10707-10901
			LB	186bp	10902-11087
3' genome	847bp	11088-11934

The nucleic acid sequence or the complement thereof can be used in a DNA amplification method to produce an amplification product, the presence of transgenic corn event LP016-1 or its progeny in a biological sample being diagnosed by detection of the amplification product; the nucleic acid sequence or its complement can be used in a nucleotide assay to detect the presence of transgenic maize event LP016-1 or its progeny in a biological sample.

The present invention provides a DNA primer pair comprising a first primer and a second primer, wherein the first primer and the second primer each comprise a fragment of SEQ ID No. 5 or a complement thereof and when used in an amplification reaction with DNA comprising transgenic maize event LP016-1, produce an amplification product that detects transgenic maize event LP016-1 in a sample.

In some embodiments, the first primer is selected from the group consisting of SEQ ID NO. 1 or a complement thereof, SEQ ID NO. 8 or SEQ ID NO. 12; the second primer is selected from SEQ ID NO. 2 or a complementary sequence thereof, SEQ ID NO. 11 or SEQ ID NO. 14.

In some embodiments of the invention, the amplification product comprises at least 11 consecutive nucleotides of SEQ ID NO. 3 or its complement, or at least 11 consecutive nucleotides of SEQ ID NO. 4 or its complement.

Further, the amplification product comprises consecutive nucleotides 1 to 10 or 11 to 22 in SEQ ID NO. 1 or its complement, or consecutive nucleotides 1 to 11 or 12 to 22 in SEQ ID NO. 2 or its complement.

Still further, the amplification product comprises SEQ ID NO. 1 or its complement, SEQ ID NO. 2 or its complement, SEQ ID NO. 6 or its complement, or SEQ ID NO. 7 or its complement.

In the above technical scheme, the primer comprises at least one of the nucleic acid sequences. Specifically, the primer comprises a first primer and a second primer, wherein the first primer is selected from SEQ ID NO. 1 or a complementary sequence thereof, SEQ ID NO. 8 or SEQ ID NO. 12, and the second primer is selected from SEQ ID NO. 9 or SEQ ID NO. 13; or the first primer is selected from SEQ ID NO. 2 or a complementary sequence thereof, SEQ ID NO. 10 or SEQ ID NO. 15, and the second primer is selected from SEQ ID NO. 11 or SEQ ID NO. 14.

The present invention also provides a DNA probe comprising a fragment of SEQ ID NO. 5 or a complementary sequence thereof, which hybridizes under stringent hybridization conditions to a DNA molecule comprising a nucleic acid sequence selected from SEQ ID NO. 1-7 or a complementary sequence thereof and does not hybridize under stringent hybridization conditions to a DNA molecule not comprising a nucleic acid sequence selected from SEQ ID NO. 1-7 or a complementary sequence thereof.

In some embodiments, the DNA probe comprises a sequence selected from the group consisting of SEQ ID NO. 1 or its complement, SEQ ID NO. 2 or its complement, SEQ ID NO. 6 or its complement, and SEQ ID NO. 7 or its complement.

In some embodiments, the DNA probe is labeled with a fluorescent group.

In some embodiments, the probe comprises at least 11 consecutive nucleotides of SEQ ID NO. 3 or its complement, or at least 11 consecutive nucleotides of SEQ ID NO. 4 or its complement; further, the probe comprises continuous nucleotides at positions 1-10 or 11-22 in SEQ ID NO. 1 or the complementary sequence thereof, or continuous nucleotides at positions 1-11 or 12-22 in SEQ ID NO. 2 or the complementary sequence thereof.

The present invention also provides a marker nucleic acid molecule comprising a fragment of SEQ ID NO. 5 or a complement thereof, which hybridizes under stringent hybridization conditions with a DNA molecule comprising a nucleic acid sequence selected from the group consisting of SEQ ID NO. 1-7 or a complement thereof and does not hybridize under stringent hybridization conditions with a DNA molecule not comprising a nucleic acid sequence selected from the group consisting of SEQ ID NO. 1-7 or a complement thereof.

In some embodiments, the marker nucleic acid molecule comprises a sequence selected from the group consisting of SEQ ID NO. 1 or its complement, SEQ ID NO. 2 or its complement, SEQ ID NO. 6 or its complement, and SEQ ID NO. 7 or its complement.

In one embodiment, the marker nucleic acid molecule comprises at least 11 consecutive nucleotides of SEQ ID NO. 3 or its complement, or at least 11 consecutive nucleotides of SEQ ID NO. 4 or its complement;

in some embodiments, the marker nucleic acid molecule comprises consecutive nucleotides 1-10 or 11-22 of SEQ ID NO. 1 or its complement, or consecutive nucleotides 1-11 or 12-22 of SEQ ID NO. 2 or its complement.

Further, the present invention provides a method for detecting the presence of DNA comprising transgenic maize event LP016-1 in a sample, comprising:

(1) Contacting a sample to be detected with the pair of DNA primers in a nucleic acid amplification reaction;

(2) Performing a nucleic acid amplification reaction;

(3) Detecting the presence of an amplification product;

the amplification product comprises a nucleic acid sequence selected from the sequences SEQ ID NO. 1-7 or the complement thereof, i.e.a DNA representing the presence of the transgenic maize event LP016-1 in the test sample.

The invention also provides a method of detecting the presence of DNA comprising transgenic maize event LP016-1 in a sample, comprising:

(1) Contacting a sample to be detected with said DNA probe, and/or said marker nucleic acid molecule;

(2) Hybridizing the sample to be detected with the probe and/or the marker nucleic acid molecule under stringent hybridization conditions;

(3) Detecting hybridization of the sample to be detected with the probe and/or the marker nucleic acid molecule.

The stringent conditions may be hybridization in 6 XSSC (sodium citrate), 0.5% SDS (sodium dodecyl sulfate) solution at 65℃and then washing the membrane 1 time with 2 XSSC, 0.1% SDS and 1 XSSC, 0.1% SDS, respectively.

Wherein hybridization of the sample to be tested and the marker nucleic acid molecule is detected, and further by marker assisted breeding analysis to determine that insect resistance and/or herbicide tolerance is genetically linked to the marker nucleic acid molecule.

The invention also provides a DNA detection kit, comprising: a DNA primer pair that produces an amplicon diagnostic for transgenic maize event LP016-1, a probe specific for SEQ ID NOs 1-7 or a marker nucleic acid molecule specific for SEQ ID NOs 1-7. Specifically, the detection kit comprises the probe, the primer pair or the marker nucleic acid molecule.

In some embodiments, the invention provides a DNA detection kit comprising at least one DNA molecule comprising at least 11 contiguous nucleotides of the homologous sequence of SEQ ID NO. 3 or the complement thereof, or at least 11 contiguous nucleotides of the homologous sequence of SEQ ID NO. 4 or the complement thereof, which can be used as a DNA primer or probe specific for transgenic maize event LP016-1 or a progeny thereof.

Further, the DNA molecule comprises continuous nucleotides at positions 1-10 or 11-22 in SEQ ID NO. 1 or the complementary sequence thereof, or continuous nucleotides at positions 1-11 or 12-22 in SEQ ID NO. 2 or the complementary sequence thereof.

Still further, the DNA molecule comprises a homologous sequence of SEQ ID NO. 1 or a complement thereof, a homologous sequence of SEQ ID NO. 2 or a complement thereof, a homologous sequence of SEQ ID NO. 6 or a complement thereof, or a homologous sequence of SEQ ID NO. 7 or a complement thereof. To achieve the above object, the present invention also provides a plant cell comprising a nucleic acid sequence encoding insect-resistant Cry3Aa, cry3Bb proteins, a nucleic acid sequence encoding a glufosinate herbicide tolerance PAT protein, and a nucleic acid sequence of a specific region comprising the sequence shown as SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 6 or SEQ ID NO. 7.

The sequences provided by the present invention include the sequences listed in table 2 below:

TABLE 2 related sequences of the invention

Sequence number (SEQ ID NO)	DESCRIPTION OF THE SEQUENCES
		1	RB end crossing junction sequence (containing partial T-DNA RB end sequence and genome sequence, 22 bp)
2	LB terminal cross junction sequence (containing partial T-DNA LB terminal sequence and genome sequence, 22 bp)
		3	The nucleotide sequence located near the insertion binding site at the 5' -end of the insertion sequence is the RB-end (containing genome for T-DNA About 800bp sequence, T-DNA about 500 bp)
4	The nucleotide sequence located near the insertion binding site at the 3' -end of the insertion sequence is the LB-end (genome-containing for T-DNA About 800bp sequence, T-DNA about 400 bp)
		5	T-DNA full-length sequence (comprising LB and RB end about 200bp and 300bp respectively, genome sequence, about 800bp extended at both ends)
6	Sequence located within SEQ ID NO. 3, LP 016T-DNA sequence
		7	Sequence located within SEQ ID NO. 4, LP 016T-DNA sequence
8	First primer for amplifying SEQ ID NO. 3, primer 9
		9	Second primer for amplifying SEQ ID NO. 3, primer 10
10	First primer for amplifying SEQ ID NO. 4, primer 11
		11	Second primer, primer 12, for amplifying SEQ ID NO. 4
12	Primer on 5' flanking genome, primer 13
		13	Primer 14 on T-DNA paired with sequence 12
14	Primer on 3' flanking genome, primer 15
		15	Primer 16 on T-DNA paired with sequence 14
16	Taqman detection Cry3Bb primer 1
		17	Taqman detection Cry3Bb primer 2
18	Taqman Cry3Bb detection probe 1
		19	Taqman detection Cry3Aa primer 3
20	Taqman detection Cry3Aa primer 4
		21	Taqman Cry3Aa detection probe 2
22	Taqman assay PAT primer 5
		23	Taqman assay PAT primer 6
24	Taqman detection PAT Probe 3
		25	First primer 7 of maize endogenous gene Ubiqutin
26	Second primer 8 of maize endogenous gene Ubiqutin
		27	Probe 4 for Cry3Bb in Southern hybridization detection
28	Probe 5 of Cry3Aa in Southern hybridization detection
		29	Probe 6 of PAT in Southern hybridization detection
30	Primer 17 located on the T-DNA, which hybridizes to SEQ ID NO:13 are consistent in direction
		31	Primer 18 located on the T-DNA, which hybridizes to SEQ ID NO:13 opposite direction
32	Primer 19 located on the T-DNA, which hybridizes to SEQ ID NO:13 opposite direction
		33	Primer 20 located on the T-DNA, which hybridizes to SEQ ID NO:15 direction is consistent
34	Primer 21 located on the T-DNA, which hybridizes to SEQ ID NO:15 opposite directions
		35	Primer 22 located on the T-DNA, which hybridizes to SEQ ID NO:15 opposite directions

The present invention also provides a method of protecting a maize plant from insect infestation comprising providing at least one cell comprising a transgenic maize plant comprising in sequence SEQ ID NO. 1, SEQ ID NO. 5, nucleotide sequence from position 850 to 11076 and SEQ ID NO. 2 in the diet of a target insect; or the genome of the transgenic corn plant comprises a sequence shown in SEQ ID NO. 5; target insects that ingest the transgenic corn plant cells are inhibited from further ingest the corn plant.

The present invention also provides a method of protecting a maize plant from injury caused by a herbicide, planting at least one transgenic maize plant comprising in sequence SEQ ID NO. 1, SEQ ID NO. 5, nucleotide sequence from position 850 to 11076, and SEQ ID NO. 2 in the genome of the transgenic maize plant; or the genome of the transgenic corn plant comprises a sequence shown in SEQ ID NO. 5. In some embodiments, the method comprises applying an effective dose of glufosinate herbicide to a field in which at least one transgenic corn plant is grown, the transgenic corn plant comprising in its genome the nucleic acid sequence of SEQ ID NO. 1, SEQ ID NO. 5, positions 850-11076, and SEQ ID NO. 2; or the genome of the transgenic corn plant comprises a sequence shown in SEQ ID NO. 5.

The present invention also provides a method of controlling weeds in a field in which corn plants are grown, comprising applying to the field in which at least one transgenic corn plant is grown an effective dose of glufosinate herbicide, said transgenic corn plant comprising in its genome the nucleic acid sequence of SEQ ID NO. 1, SEQ ID NO. 5, positions 850-11076 and SEQ ID NO. 2; or the genome of the transgenic corn plant comprises a sequence shown in SEQ ID NO. 5.

The present invention also provides a method of growing a maize plant that is resistant to insects comprising: planting at least one corn seed, wherein the genome of the corn seed sequentially comprises a nucleic acid sequence of SEQ ID NO. 1, SEQ ID NO. 5 from 850 th to 11076 th positions and SEQ ID NO. 2; or the genome of the corn seed comprises a sequence shown as SEQ ID NO. 5;

growing the corn seed into a corn plant;

the corn plants are affected with the target insect and/or sprayed with an effective dose of glufosinate herbicide, and plants are harvested having reduced plant damage compared to other plants not the corn seeds.

In some embodiments, the present invention provides a method of growing a corn plant that is resistant to insects and tolerant to glufosinate herbicide comprising:

planting at least one corn seed, wherein the genome of the corn seed sequentially comprises a nucleic acid sequence of SEQ ID NO. 1, SEQ ID NO. 5 from 850 th to 11076 th positions and SEQ ID NO. 2; or the genome of the corn seed comprises a sequence shown in SEQ ID NO. 5;

growing the corn seed into a corn plant;

spraying said maize plants with an effective dose of glufosinate herbicide to harvest plants having reduced plant damage as compared to other plants not said maize seeds, said plants having reduced plant damage also being resistant to insect feeding damage.

In some embodiments, the invention also provides a method of producing a maize plant that is resistant to insects, comprising introducing into the genome of said maize plant a transgenic maize event LP016-1, selecting a maize plant that has reduced plant damage to insect ingestion. In some embodiments, the method comprises: sexual crossing a transgenic corn event LP016-1 first parent corn plant having resistance to an insect with a second parent corn plant lacking insect resistance, thereby producing a plurality of progeny plants; attack the progeny plant with a target insect; selecting said progeny plants having reduced plant damage compared to other plants not having transgenic maize event LP 016-1.

In some embodiments, the invention also provides a method of producing a maize plant that is tolerant to glufosinate herbicide comprising introducing into the genome of the maize plant transgenic maize event LP016-1 and selecting a glufosinate tolerant maize plant. In some embodiments, the method comprises: sexual crossing a transgenic corn event LP016-1 first parent corn plant having tolerance to glufosinate herbicide with a second parent corn plant lacking glufosinate tolerance, thereby producing a plurality of progeny plants; treating said progeny plants with a glufosinate herbicide; selecting said progeny plants that are tolerant to glufosinate.

In some embodiments, the invention also provides a method of producing a maize plant that is resistant to insects and tolerant to glufosinate herbicide application, comprising: transgenic maize event LP016-1 was introduced into the genome of the maize plant, selecting maize plants resistant to glufosinate and insect resistance. In some embodiments, the methods comprise sexually crossing a glufosinate-tolerant and insect-resistant transgenic corn event LP016-1 first parent corn plant with a second parent corn plant lacking glufosinate tolerance and/or insect resistance, thereby producing a plurality of progeny plants; treating said progeny plants with glufosinate; selecting said progeny plants that are resistant to glufosinate, said progeny plants that are resistant to glufosinate also being resistant to insect feeding damage.

The invention also provides a composition produced from transgenic corn event LP016-1, which is corn meal, corn flour, corn oil, corn starch. In some embodiments, the composition may be an agricultural product or commodity such as corn meal, corn flour, corn oil, corn starch, corn gluten, tortilla, cosmetics, or bulking agent. If sufficient expression is detected in the composition, the composition is expected to contain a nucleic acid sequence capable of diagnosing the presence of transgenic corn event LP016-1 material in the composition. In particular, the compositions include, but are not limited to, corn oil, corn meal, corn flour, corn gluten, tortilla, corn starch, any other food product to be consumed by an animal as a food source, or otherwise used for cosmetic purposes, etc., as an ingredient in an expanding agent or cosmetic composition.

The probe or primer pair-based detection methods and/or kits of the invention can be employed to detect a transgenic maize event LP016-1 nucleic acid sequence, such as that shown in SEQ ID NO. 1 or SEQ ID NO. 2, in a biological sample, wherein the probe sequence or primer sequence is selected from the group consisting of the sequences shown in SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4 and SEQ ID NO. 5, to diagnose the presence of transgenic maize event LP 016-1.

In conclusion, the transgenic corn event LP016-1 has the dual characteristics of insect resistance and herbicide resistance, and has the following advantages: 1) Is free from economic losses caused by coleopteran pests (diabrotica, corn rootworm, etc.); 2) The ability to apply glufosinate-containing agricultural herbicides to corn crops for broad spectrum weed control; 3) The corn yield was not reduced. In particular, event LP016-1 of the present invention reaches a high level of resistance to the target pest; the herbicide composition has high tolerance to glufosinate-ammonium herbicide, and can protect plants to ensure that the damage rate is as low as 0% under the condition that the application amount of the glufosinate-ammonium herbicide is four times of the recommended dosage; and the agronomic characters of the plants containing the event are excellent, and the yield percentage can reach 103 percent. Furthermore, genes encoding insect resistance and glufosinate tolerance traits are linked on the same DNA segment and are present at a single locus in the transgenic maize event LP016-1 genome, which increases breeding efficiency and enables molecular markers to be used to track transgene inserts in the breeding populations and their progeny. Meanwhile, the primer or probe sequence provided in the detection method can generate an amplification product identified as the transgenic corn event LP016-1 or a progeny thereof, and can rapidly, accurately and stably identify the existence of plant materials derived from the transgenic corn event LP 016-1.

Terminology

The following definitions and methods may better define the present invention and instruct those of ordinary skill in the art to practice the present invention, and unless otherwise indicated, terms are understood according to their conventional usage by those of ordinary skill in the art.

The term "maize" refers to maize (Zea mays) and includes all plant varieties that can be mated to maize, including wild maize varieties.

The term "comprising" means "including but not limited to. The "processed product" refers to a product obtained by processing a raw material such as a plant or a seed, for example, a composition.

The term "plant" includes whole plants, plant cells, plant organs, plant protoplasts, plant cell tissue cultures from which plants can be regenerated, plant calli, plant clumps (plant cones), and intact plant cells in plants or plant parts, such as embryos, pollen, ovules, seeds, leaves, flowers, branches, fruits, stems, roots, root tips, anthers, and the like. It is to be understood that parts of transgenic plants within the scope of the present invention include, but are not limited to, plant cells, protoplasts, tissues, calli, embryos and flowers, stems, fruits, leaves and roots, which are derived from transgenic plants or their progeny which have been previously transformed with the DNA molecules of the present invention and thus at least partially consist of the transgenic cells.

The term "gene" refers to a nucleic acid fragment that expresses a particular protein, including regulatory sequences preceding (5 'non-coding sequences) and regulatory sequences following (3' non-coding sequences) the coding sequences. "native gene" refers to a gene that is found naturally to have its own regulatory sequences. By "chimeric gene" is meant any gene that is not a native gene, comprising regulatory and coding sequences found in a non-native manner. "endogenous gene" refers to a native gene that is located in its natural location in the genome of an organism. "exogenous gene" is a foreign gene that is present in the genome of an organism and that is not originally present, and also refers to a gene that has been introduced into a recipient cell by a transgenic procedure. The exogenous gene may comprise a native gene or chimeric gene inserted into a non-native organism. A "transgene" is a gene that has been introduced into the genome by a transformation procedure. The site in the plant genome where the recombinant DNA has been inserted may be referred to as an "insertion site" or "target site".

"flanking DNA" may comprise genomic or foreign (heterologous) DNA introduced by a transformation process, such as fragments associated with a transformation event, naturally occurring in an organism such as a plant. Thus, flanking DNA may include a combination of native and foreign DNA. In the present invention, a "flanking region" or "flanking sequence" or "genomic border region" or "genomic border sequence" refers to a sequence of at least 3, 5, 10, 11, 15, 20, 50, 100, 200, 300, 400, 1000, 1500, 2000, 2500, or 5000 base pairs or more that is immediately upstream or downstream of and adjacent to the initial exogenous inserted DNA molecule. When this flanking region is located downstream, it may also be referred to as a "left border flanking" or a "3 'genomic border region" or a "genomic 3' border sequence", etc. When this flanking region is located upstream, it may also be referred to as a "right-hand border flanking" or a "5 'genomic border region" or a "genomic 5' border sequence", etc.

Transformation procedures that cause random integration of the foreign DNA will result in transformants that contain different flanking regions that each transformant specifically contains. When recombinant DNA is introduced into plants by conventional hybridization, its flanking regions are generally not altered. Transformants will also contain unique junctions between the heterologous insert DNA and segments of genomic DNA or between two segments of heterologous DNA. "ligation" is the point at which two specific DNA fragments are ligated. For example, the junction exists where the insert DNA joins the flanking DNA. The junction point is also present in transformed organisms, where the two DNA fragments are joined together in a manner that modifies what is found in the native organism. "adapter DNA" refers to DNA that contains an adapter.

The present invention provides transgenic corn event, designated as LP016-1, and progeny thereof, wherein the transgenic corn event LP016-1 is corn plant LP016-1, which includes plants and seeds of transgenic corn event LP016-1 and plant cells thereof or regenerable parts thereof, and plant parts of transgenic corn event LP016-1, including but not limited to cells, pollen, ovules, flowers, shoots, roots, stems, silks, inflorescences, ears, leaves and products from corn plant LP016-1, such as corn meal, corn oil, corn steep liquor, corn cobs, corn starch and biomass left in the corn crop field.

The transgenic maize event LP016-1 of the invention comprises a DNA construct that, when expressed in a plant cell, confers resistance to insects and tolerance to glufosinate herbicide to said transgenic maize event LP 016-1.

In some embodiments of the invention, the DNA construct comprises four expression cassettes in tandem, the first expression cassette comprising a suitable promoter for expression in a plant operably linked to a nucleic acid sequence of a bacillus thuringiensis insect-resistant Cry3Bb protein (Cry 3 Bb) having coleopteran insect resistance and a suitable polyadenylation signal sequence; the second expression cassette consists of a nucleic acid sequence comprising a suitable promoter for expression in plants operably linked to an insect-resistant Cry3Aa protein (Cry 3 Aa) of bacillus thuringiensis, said Cry3Aa having coleopteran insect resistance, and a suitable polyadenylation signal sequence; the third expression cassette comprises a suitable promoter for expression in plants operably linked to a nucleic acid sequence encoding a glufosinate acetyltransferase (PAT) protein, which is tolerant to glufosinate herbicide. Further, the promoter may be a suitable promoter isolated from plants, including constitutive, inducible, and/or tissue-specific promoters, including, but not limited to, the cauliflower mosaic virus (CaMV) 35S promoter, the Figwort Mosaic Virus (FMV) 35S promoter, the Ubiquitin protein (Ubiquitin) promoter, the Actin (action) promoter, the agrobacterium (Agrobacterium tumefaciens) nopaline synthase (NOS) promoter, the octopine synthase (OCS) promoter, the night yellow leaf curly virus (cestron) promoter, the tuber storage protein (Patatin) promoter, the ribulose-1, 5-bisphosphate carboxylase/oxygenase (rusco) promoter, the Glutathione S Transferase (GST) promoter, the E9 promoter, the GOS promoter, the alcA/alcR promoter, the agrobacterium (Agrobacterium rhizogenes) roller promoter, and the arabidopsis (Arabidopsis thaliana) promoter. The polyadenylation signal sequence may be a suitable polyadenylation signal sequence for functioning in plants, including, but not limited to, polyadenylation signal sequences derived from the Agrobacterium tumefaciens nopaline synthase (NOS) gene, the 35S terminator derived from cauliflower mosaic virus (CaMV), the polyadenylation signal sequence derived from the protease inhibitor II (PIN II) gene, and the polyadenylation signal sequence derived from the alpha-tubulin (alpha-tubulin) gene.

In addition, the expression cassette may also include other genetic elements including, but not limited to, enhancers and signal peptide/transit peptide nucleic acid coding sequences. The enhancer may enhance the expression level of a gene, including, but not limited to, tobacco Etch Virus (TEV) translational activator, caMV35S enhancer, and FMV35S enhancer. The signal peptide/transit peptide may direct the transport of the PAT protein to a specific organelle or compartment outside or inside the cell, for example, targeting to the chloroplast using a sequence encoding a chloroplast transit peptide, or targeting to the endoplasmic reticulum using a 'KDEL' retention sequence.

The cry3Bb and cry3Aa genes can be isolated from Bacillus thuringiensis (Bacillus thuringiensis, bt for short), and the nucleic acid sequences of the cry3Bb and cry3Aa genes can be modified by optimizing codons or otherwise to achieve the purpose of increasing the stability and availability of transcripts in transformed cells.

In some embodiments of the invention, the maize cell, seed or plant comprising transgenic maize event LP016-1 comprises in its genome the nucleic acid sequence of SEQ ID NO. 1, SEQ ID NO. 5 from positions 850-11076 and SEQ ID NO. 2, or SEQ ID NO. 5, in that order.

The term Coleoptera is the most widely distributed 1 st order of the class of insects and even of the kingdom animalia. The variety is large and the system is complex. This group of anterior fins keratinized, stiff, and finless, known as "coleopterans". The main pests of corn include diabrotica, corn rootworm, etc.

The glufosinate acetyltransferase (PAT) gene may be isolated from streptomyces viridochromogenes (Streptomyces viridochromogenes) and the polynucleotides encoding PAT genes may be modified by codon optimization or otherwise to increase transcript stability and availability in transformed cells. The glufosinate acetyltransferase (PAT) gene may also be used as a selectable marker gene. The choice of the rate of use of a certain glufosinate formulation in order to achieve an effective biological dose is not beyond the skills of the average agronomic technician. Treatment of a field containing plant material derived from transgenic corn event LP016-1 with any herbicide formulation containing glufosinate will control weed growth in the field and not affect the growth or yield of plant material derived from transgenic corn event LP 016-1.

The DNA construct is introduced into a plant using transformation methods including, but not limited to, agrobacterium-mediated transformation, gene gun transformation, and pollen tube channel transformation.

The agrobacterium-mediated transformation method is a common method for plant transformation. The foreign DNA to be introduced into the plant is cloned between the left and right border consensus sequences of the vector, i.e., the T-DNA region. The vector is transformed into an agrobacterium cell, which is subsequently used to infect plant tissue, and the T-DNA region of the vector comprising exogenous DNA is inserted into the plant genome.

The gene gun transformation method is to bombard plant cells (particle-mediated biolistic transformation) with a vector containing exogenous DNA.

The pollen tube channel transformation method utilizes a natural pollen tube channel (also called pollen tube guiding tissue) formed after plant pollination to carry exogenous DNA into embryo sacs through a bead core channel.

After transformation, the transgenic plants must be regenerated from the transformed plant tissue and offspring with the exogenous DNA selected using appropriate markers.

A DNA construct is a combination of DNA molecules that are linked to one another to provide one or more expression cassettes. The DNA construct is in particular a plasmid capable of self-replication in bacterial cells and containing various restriction enzyme sites for the introduction of DNA molecules providing functional genetic elements, i.e. promoters, introns, leader sequences, coding sequences, 3' terminator regions and other sequences. The expression cassette contained in the DNA construct includes the genetic elements necessary to provide for transcription of messenger RNA, and can be designed for expression in prokaryotic or eukaryotic cells. The expression cassette of the invention is designed to be most specifically expressed in plant cells.

A transgenic "event" is obtained by transforming a plant cell with a heterologous DNA construct, i.e., comprising at least one nucleic acid expression cassette containing a gene of interest, inserting into the plant genome by transgenic means to produce a plant population, regenerating the plant population, and selecting a particular plant having the characteristics of being inserted into a particular genomic locus. The term "event" refers to both the original transformant comprising the heterologous DNA and the progeny of the transformant. The term "event" also refers to the progeny of a sexual cross between a transformant and other species of individuals containing heterologous DNA, even after repeated backcrosses with a backcross parent, the inserted DNA and flanking genomic DNA from the transformant parent are present at the same chromosomal location in the hybrid progeny. The term "event" also refers to a DNA sequence from an original transformant that comprises an inserted DNA and flanking genomic sequences immediately adjacent to the inserted DNA, which DNA sequence is expected to be transferred into progeny resulting from sexual crossing of a parental line containing the inserted DNA (e.g., the original transformant and progeny resulting from its selfing) with a parental line not containing the inserted DNA, and which progeny received the inserted DNA comprising the gene of interest.

"recombinant" in the context of the present invention refers to forms of DNA and/or proteins and/or organisms that are not normally found in nature and are therefore produced by manual intervention. Such manual intervention may result in recombinant DNA molecules and/or recombinant plants. The "recombinant DNA molecule" is obtained by artificially combining two otherwise isolated sequence segments, for example by chemical synthesis or by manipulation of isolated nucleic acid segments by genetic engineering techniques. Techniques for performing nucleic acid manipulations are well known.

The term "transgene" includes any cell, cell line, callus, tissue, plant part or plant, the genotype of which is altered by the presence of a heterologous nucleic acid, and includes the transgene originally so altered as well as progeny individuals produced from the original transgene by sexual crosses or asexual propagation. In the present invention, the term "transgene" does not include genomic (chromosomal or extrachromosomal) alterations by conventional plant breeding methods or naturally occurring events such as random allofertilisation, non-recombinant viral infection, non-recombinant bacterial transformation, non-recombinant transposition or spontaneous mutation.

By "heterologous" in the present invention is meant that the first molecule is not normally found in combination with the second molecule in nature. For example, a molecule may originate from a first species and be inserted into the genome of a second species. Such molecules are thus heterologous to the host and are artificially introduced into the genome of the host cell.

Culturing a transgenic corn event LP016-1 resistant to coleopteran insects and resistant to a glufosinate herbicide can be accomplished by the steps of: first sexually crossing a first parent corn plant consisting of a corn plant grown from a transgenic corn event LP016-1 and progeny thereof obtained by transformation with an expression cassette of the invention that is resistant to coleopteran insects and tolerant to a glufosinate herbicide, with a second parent corn plant lacking resistance to coleopteran insects and/or tolerant to a glufosinate herbicide, thereby producing a multiplicity of first generation progeny plants; then selecting progeny plants that are resistant to attack by coleopteran insects and/or resistant to a glufosinate herbicide, corn plants that are resistant to coleopteran insects and resistant to a glufosinate herbicide can be grown. These steps may further include backcrossing a coleopteran insect-resistant and/or glufosinate-tolerant progeny plant with the second parent corn plant or the third parent corn plant, and selecting the progeny plant by infestation with a coleopteran insect, application of a glufosinate herbicide, or by identification of a molecular marker associated with the trait (e.g., a DNA molecule comprising the junction site identified at the 5 'and 3' ends of the insertion sequence in transgenic corn event LP 016-1), thereby producing a corn plant that is resistant to coleopteran insects and tolerant to the glufosinate herbicide.

It will also be appreciated that two different transgenic plants can also be crossed to produce offspring containing two independent, separately added exogenous genes. Selfing of appropriate offspring can result in offspring plants that are homozygous for both added exogenous genes. Backcrossing of parent plants and outcrossing with non-transgenic plants as previously described are also contemplated, as are asexual propagation.

The term "probe" is an isolated nucleic acid molecule to which a conventional detectable label or reporter molecule, e.g., a radioisotope, ligand, chemiluminescent agent, or enzyme, can be attached. Such a probe is complementary to one strand of the target nucleic acid, and in the present invention, the probe is complementary to one strand of DNA from the genome of transgenic maize event LP016-1, whether the genomic DNA is from transgenic maize event LP016-1 or seed or plant or seed or extract derived from transgenic maize event LP 016-1. Probes of the present invention include not only deoxyribonucleic acid or ribonucleic acid, but also polyamides and other probe materials that specifically bind to a target DNA sequence and can be used to detect the presence of the target DNA sequence.

The term "primer" is an isolated nucleic acid molecule that binds to a complementary target DNA strand by nucleic acid hybridization, anneals to form a hybrid between the primer and the target DNA strand, and then extends along the target DNA strand under the action of a polymerase (e.g., DNA polymerase). The primer pairs of the invention relate to their use in the amplification of a target nucleic acid sequence, for example, by the Polymerase Chain Reaction (PCR) or other conventional nucleic acid amplification methods.

Methods of designing and using primers and probes are well known in the art. The DNA molecules comprising the full length or fragments of SEQ ID NOS: 1-7 can be used as primers and probes for detecting transgenic maize event LP016-1 and can be readily designed by one skilled in the art using the sequences provided herein.

The length of the probes and primers is generally 11 polynucleotides or more, preferably 18 polynucleotides or more, more preferably 24 polynucleotides or more, and most preferably 30 polynucleotides or more. Such probes and primers hybridize specifically to the target sequence under highly stringent hybridization conditions. Although probes other than the target DNA sequence and maintaining hybridization ability to the target DNA sequence can be designed by conventional methods, it is preferred that the probes and primers of the present invention have complete DNA sequence identity to a contiguous nucleic acid of the target sequence.

Primers and probes based on flanking genomic DNA and insert sequences of the invention may be determined by conventional methods, for example, by isolating the corresponding DNA molecule from plant material derived from transgenic maize event LP016-1 and determining the nucleic acid sequence of the DNA molecule. The DNA molecule comprises a transgene insert and maize genomic flanking regions, and fragments of the DNA molecule may be used as primers or probes.

The nucleic acid probes and primers of the invention hybridize to a target DNA sequence under stringent conditions. Any conventional nucleic acid hybridization or amplification method can be used to identify the presence of DNA derived from transgenic maize event LP016-1 in a sample. The nucleic acid molecule or fragment thereof is capable of specifically hybridizing to other nucleic acid molecules under certain conditions. As used herein, two nucleic acid molecules can be said to specifically hybridize to each other if they are capable of forming antiparallel double-stranded nucleic acid structures. Two nucleic acid molecules are said to be "complements" of one nucleic acid molecule if they exhibit complete complementarity. As used herein, a nucleic acid molecule is said to exhibit "complete complementarity" when each nucleotide of the two molecules is complementary to a corresponding nucleotide of the other nucleic acid molecule. Two nucleic acid molecules are said to be "minimally complementary" if they are capable of hybridizing to each other with sufficient stability such that they anneal and bind to each other under at least conventional "low stringency" conditions. Similarly, two nucleic acid molecules are said to have "complementarity" if they are capable of hybridizing to each other with sufficient stability such that they anneal and bind to each other under conventional "highly stringent" conditions. Deviations from complete complementarity are permissible provided that such deviations do not completely prevent the formation of double-stranded structures by the two molecules. In order to enable a nucleic acid molecule to act as a primer or probe, it is only necessary to ensure sufficient complementarity in sequence to allow the formation of a stable double-stranded structure at the particular solvent and salt concentration employed.

As used herein, a substantially homologous sequence is a nucleic acid molecule that is capable of specifically hybridizing under highly stringent conditions to the complementary strand of a matching other nucleic acid molecule. Suitable stringent conditions for promoting DNA hybridization, for example, treatment with 6.0 XSSC/sodium citrate (SSC) at about 45℃followed by washing with 2.0 XSSC at 50℃are well known to those skilled in the art. For example, the salt concentration in the washing step may be selected from about 2.0 XSSC at low stringency conditions, about 0.2 XSSC at 50℃to high stringency conditions, about 50 ℃. In addition, the temperature conditions in the washing step may be raised from about 22 ℃ at room temperature under low stringency conditions to about 65 ℃ under high stringency conditions. The temperature conditions and salt concentration may both be varied, or one may remain unchanged while the other variable is varied. In particular, a nucleic acid molecule of the invention may specifically hybridize under moderately stringent conditions, e.g., at about 2.0 XSSC and about 65℃to one or more of SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4, SEQ ID NO. 5, SEQ ID NO. 6 and SEQ ID NO. 7, or to a complement thereof, or to any fragment of the foregoing. More specifically, a nucleic acid molecule of the invention hybridizes specifically under highly stringent conditions to one or more of SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4, SEQ ID NO. 5, SEQ ID NO. 6 and SEQ ID NO. 7, or to the complement thereof, or to any fragment of the above sequences. In the present invention, preferred marker nucleic acid molecules have SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 6 or SEQ ID NO. 7 or a sequence complementary thereto, or a fragment of any of the above sequences. Another preferred marker nucleic acid molecule of the invention has 80% to 100% or 90% to 100% sequence identity with SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 6 or SEQ ID NO. 7 or the complement thereof, or any fragment of the above sequences. SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 6 and SEQ ID NO. 7 can be used as markers in plant breeding methods to identify offspring of genetic crosses. Hybridization of the probe to the target DNA molecule may be detected by any method known to those skilled in the art, including, but not limited to, fluorescent labels, radiolabels, antibody-based labels, and chemiluminescent labels.

With respect to amplification (e.g., by PCR) of a target nucleic acid sequence using specific amplification primers, "stringent conditions" refer to conditions that allow hybridization of only the primer pair to the target nucleic acid sequence in a DNA thermal amplification reaction, and primers having a wild-type sequence (or its complement) corresponding to the target nucleic acid sequence are capable of binding to the target nucleic acid sequence and preferably produce a unique amplification product, i.e., an amplicon.

The term "specific binding (target sequence)" means that under stringent hybridization conditions, the probe or primer hybridizes only to the target sequence in a sample containing the target sequence.

As used herein, "amplified DNA," "amplification product," or "amplicon" refers to a nucleic acid amplification product of a target nucleic acid sequence that is part of a nucleic acid template. For example, to determine whether a maize plant is produced by sexual hybridization with the transgenic maize event LP016-1 of the invention, or whether a maize sample collected from the field contains the transgenic maize event LP016-1, or whether a maize extract, such as meal, flour or oil, contains the transgenic maize event LP016-1, DNA extracted from a maize plant tissue sample or extract can be amplified by a nucleic acid amplification method using a primer pair to produce an amplicon diagnostic for the presence of DNA of the transgenic maize event LP 016-1. The primer pair includes a first primer derived from a flanking sequence in the genome of the plant adjacent to the insertion site of the inserted foreign DNA, and a second primer derived from the inserted foreign DNA. The amplicon has a length and sequence that is also diagnostic for the transgenic maize event LP 016-1. The length of the amplicon may range from the combined length of the primer pair plus one nucleotide base pair, preferably plus about fifty nucleotide base pairs, more preferably plus about two hundred fifty nucleotide base pairs, and most preferably plus about four hundred fifty nucleotide base pairs or more.

Alternatively, the primer pair may be derived from flanking genomic sequences flanking the inserted DNA to produce an amplicon comprising the entire inserted nucleic acid sequence. One of the primer pairs derived from the plant genomic sequence may be located at a distance from the inserted DNA sequence that may range from one nucleotide base pair to about twenty thousand nucleotide base pairs. The use of the term "amplicon" specifically excludes primer dimers formed in the DNA thermal amplification reaction.

The nucleic acid amplification reaction may be accomplished by any nucleic acid amplification reaction method known in the art, including the Polymerase Chain Reaction (PCR). Various methods of nucleic acid amplification are well known to those skilled in the art. PCR amplification methods have been developed to amplify 22kb genomic DNA and 42kb phage DNA. These methods, as well as other DNA amplification methods in the art, may be used in the present invention. The inserted exogenous DNA sequence and flanking DNA sequences from transgenic maize event LP016-1 can be amplified by using the provided primer sequences to amplify the genome of transgenic maize event LP016-1, after which standard DNA sequencing can be performed on the PCR amplicon or cloned DNA.

DNA detection kits based on DNA amplification methods may contain DNA primer molecules that specifically hybridize to target DNA and amplify diagnostic amplicons under appropriate reaction conditions. The kit may provide agarose gel-based detection methods or a number of methods known in the art for detecting diagnostic amplicons. Kits comprising DNA primers homologous or complementary to any portion of the maize genomic region of SEQ ID NO. 3 or SEQ ID NO. 4 and homologous or complementary to any portion of the transgene insertion region of SEQ ID NO. 5 are provided by the invention. In particular, primer pairs identified as useful in DNA amplification methods are SEQ ID NO. 8 and SEQ ID NO. 9, which amplify a diagnostic amplicon homologous to a portion of the 5' transgene/genomic region of transgenic maize event LP016-1, wherein the amplicon comprises SEQ ID NO. 1. Other DNA molecules used as DNA primers may be selected from SEQ ID NO. 5.

Amplicons produced by these methods can be detected by a variety of techniques. One of the methods is Genetic Bit Analysis, which designs a DNA oligonucleotide strand that spans the insert DNA sequence and adjacent flanking genomic DNA sequences. The oligonucleotide strand is immobilized in a microwell of a microwell plate, and after PCR amplification of the target region (using one primer in each of the insert sequence and adjacent flanking genomic sequences), the single-stranded PCR product can hybridize to the immobilized oligonucleotide strand and serve as a template for a single base extension reaction using DNA polymerase and ddNTPs specifically labeled for the next desired base. The results may be obtained by fluorescence or ELISA-like methods. The signal represents the presence of an insertion/flanking sequence, which indicates that the amplification, hybridization and single base extension reactions were successful.

Another method is Pyrosequencing technology. The method contemplates an oligonucleotide strand spanning the insertion DNA sequence and adjacent genomic DNA binding sites. The oligonucleotide strand and the single stranded PCR product of the target region (using one primer in each of the insert sequence and adjacent flanking genomic sequences) are hybridized and then incubated with DNA polymerase, ATP, sulfurylase, luciferase, apyrase, adenosine-5' -phosphosulfate and luciferin. dNTPs are added separately and the resulting optical signal is measured. The optical signal represents the presence of an insertion/flanking sequence, which indicates that amplification, hybridization, and single base or multiple base extension reactions were successful.

Fluorescence polarization as described by Chen et al (Genome Res.) 9:492-498, 1999) is also one method that may be used to detect the amplicons of the present invention. The use of this method requires the design of an oligonucleotide strand spanning the insertion DNA sequence and adjacent genomic DNA binding sites. The oligonucleotide strand is hybridized to a single stranded PCR product of the target region (using one primer in each of the insert sequence and adjacent flanking genomic sequences) and then incubated with DNA polymerase and a fluorescent-labeled ddNTPs. Single base extension results in insertion of ddNTPs. Such an insertion can measure the change in its polarization using a fluorometer. The change in polarization represents the presence of an insertion/flanking sequence, which indicates that amplification, hybridization, and single base extension reactions were successful.

Taqman is described as a method for detecting and quantifying the presence of a DNA sequence, which is described in detail in the instructions provided by the manufacturer. Briefly, a FRET oligonucleotide probe is designed that spans the intervening DNA sequence and adjacent genomic flanking binding sites, as described below. The FRET probe and PCR primers (one primer in each of the insert sequence and adjacent flanking genomic sequences) are cycled in the presence of a thermostable polymerase and dNTPs. Hybridization of the FRET probe results in cleavage of the fluorescent moiety and the quencher moiety on the FRET probe and release of the fluorescent moiety. The generation of a fluorescent signal is representative of the presence of the insertion/flanking sequences, which indicates that amplification and hybridization were successful.

Suitable techniques for detecting plant material derived from transgenic maize event LP016-1 based on hybridization principles may also include Southern blot hybridization, northern blot hybridization, and in situ hybridization. In particular, the suitable technique includes incubating the probe and sample, washing to remove unbound probe and detecting whether the probe has hybridized. The detection method depends on the type of label attached to the probe, for example, radiolabeled probes can be detected by X-ray exposure and development, or enzymatically labeled probes can be detected by substrate conversion to effect a color change.

Tyangi et al (Nat. Biotech.) 14:303-308, 1996) describe the use of molecular markers in sequence detection. Briefly described, a FRET oligonucleotide probe is designed that spans the intervening DNA sequence and adjacent genomic flanking binding sites. The unique structure of the FRET probe results in it containing a secondary structure that is capable of retaining both the fluorescent moiety and the quenching moiety in close proximity. The FRET probe and PCR primers (one primer in each of the insert sequence and adjacent flanking genomic sequences) are cycled in the presence of a thermostable polymerase and dNTPs. Upon successful PCR amplification, hybridization of the FRET probe to the target sequence results in a loss of secondary structure of the probe, thereby spatially separating the fluorescent moiety from the quenching moiety, producing a fluorescent signal. The generation of a fluorescent signal is representative of the presence of the insertion/flanking sequences, which indicates that amplification and hybridization were successful.

Other described methods, such as microfluidics (microfluidics), provide methods and apparatus for isolating and amplifying DNA samples. The photodyes are used to detect and determine specific DNA molecules. A nano tube (nano tube) device comprising an electronic sensor for detecting DNA molecules or a nano bead binding to a specific DNA molecule and thus being detectable is useful for detecting the DNA molecules of the invention.

DNA detection kits may be developed using the compositions of the present invention and methods described in or known to the DNA detection arts. The kit facilitates the identification of the presence or absence of DNA from transgenic corn event LP016-1 in a sample and can also be used to cultivate corn plants containing DNA from transgenic corn event LP 016-1. The kit may contain DNA primers or probes homologous to or complementary to at least a portion of SEQ ID NO. 1, 2, 3, 4 or 5, or other DNA primers or probes homologous to or complementary to DNA contained in the transgenic genetic element of DNA, which DNA sequences may be used in DNA amplification reactions or as probes in DNA hybridization methods.

The DNA structure of the transgene insert contained in the corn genome and the binding site to the corn genome illustrated in fig. 1 and table 1 comprises: a maize LP016-1 flanking genomic region at the 5' end of the transgene insert, a portion of the insert from the right border Region (RB) of agrobacterium, a first expression cassette consisting of a cauliflower mosaic virus (CaMV) p35S promoter operably linked to the maize heat shock protein gene HSP70 protein intron (iZmHSP 70), operably linked to the insect-resistant Cry3Bb protein of bacillus thuringiensis (Cry 3 Bb), and operably linked to the transcription terminator of nopaline synthase (tNos); the second expression cassette consisted of a promoter containing rice pOsAct1 operably linked to the insect resistance gene Cry3Aa (Cry 3 Aa) of Bacillus thuringiensis operably linked to a terminator from the maize In gene (tIn); the third expression cassette consisted of the pZmUbi1 promoter of the maize polyubbiquitin-1 gene operably linked to a gene encoding glufosinate acetyltransferase Protein (PAT) and to a mosaic virus (FMV) t35S terminator. A part of the insert from the left border region (LB) of Agrobacterium, and the region flanking the maize plant LP016-1 genome (SEQ ID NO: 5) at the 3' -end of the transgenic insert. In the DNA amplification method, the DNA molecule used as a primer may be any part derived from the transgene insert sequence in transgenic maize event LP016-1 or any part derived from the DNA region of flanking maize genome in transgenic maize event LP 016-1.

The transgenic corn event LP016-1 can be combined with other transgenic corn varieties, such as herbicide (e.g., glufosinate, dicamba, etc.) tolerant corn, or transgenic corn varieties carrying other insect-resistant genes (e.g., chafer, grub, diabrotica, etc.). Various combinations of all of these different transgenic events, when bred with transgenic maize event LP016-1 of the present invention, can provide improved hybrid transgenic maize varieties that are resistant to multiple pests and tolerant to multiple herbicides. These varieties may exhibit superior characteristics such as yield enhancement compared to non-transgenic varieties and transgenic varieties of single trait.

The present invention provides a transgenic corn event LP016-1, a nucleic acid sequence for detecting a corn plant comprising the event, and methods of detecting the same, the transgenic corn event LP016-1 being resistant to ingestion damage by a coleopteran pest and tolerant to the phytotoxic effects of glufosinate-containing agricultural herbicides. The dual trait maize plants express the Cry3Bb, cry3Aa proteins of bacillus thuringiensis, which provide resistance to feeding injury by coleopteran (e.g., diabrotica, corn rootworm) pests; and which expresses a glufosinate-resistant glufosinate-acetyltransferase (PAT) protein of streptomyces viridochromogenes that confers tolerance to glufosinate on plants.

Drawings

FIG. 1 is a schematic structural diagram of a transgene insert sequence and a maize genomic binding site for detecting a nucleic acid sequence of maize plant LP016-1 and a method for detecting the same according to the present invention;

FIG. 2 is a schematic diagram showing the structure of a recombinant expression vector pLP016 for detecting the nucleic acid sequence of maize plant LP016-1 and the detection method thereof;

FIG. 3 is a plot of the field effect of the recommended spray concentration of transgenic corn of the invention comprising transgenic corn event LP016-1 in a field sprayed with 4-fold doses of glufosinate herbicide.

Detailed Description

The technical scheme of the invention for detecting the nucleic acid sequence of the corn plant LP016-1 and the detection method thereof are further described below by specific examples.

EXAMPLE 1 cloning and transformation

1.1 vector cloning

The recombinant expression vector pLP016 (as shown in FIG. 2) was constructed using standard gene cloning techniques. The vector pLP016 comprises 4 transgene expression cassettes in tandem, the first expression cassette consisting of a cauliflower mosaic virus (CaMV) p35S promoter operably linked to the maize heat shock protein gene HSP70 protein intron (iZmHSP 70), operably linked to the insect-resistant Cry3Bb protein of bacillus thuringiensis (Cry 3 Bb), and operably linked to the nopaline synthase transcription terminator (tNos); the second expression cassette consisted of a promoter containing rice pOsAct1 operably linked to the insect resistance gene Cry3Aa (Cry 3 Aa) of Bacillus thuringiensis operably linked to a terminator from the maize In gene (tIn); the third expression cassette consisted of the pZmUbi1 promoter of the maize polyubbiquitin-1 gene operably linked to a gene encoding glufosinate acetyltransferase Protein (PAT) and to a mosaic virus (FMV) t35S terminator. The vector pLP016 was transformed into Agrobacterium LBA4404 (Invitrogen, chicago, USA; cat. No. 18313-015) by liquid nitrogen method, and transformed cells were screened using acetyltransferase Protein (PAT) as a selection marker.

1.2 plant transformation

Transformation was performed using conventional Agrobacterium infection, and the aseptically cultured maize (variety: AX 808) young embryo was co-cultured with the Agrobacterium described in this example 1.1 to transfer the T-DNA in the constructed recombinant expression vector pLP016 into the maize chromosome set to generate transgenic maize events.

For Agrobacterium-mediated transformation of maize, briefly, immature chick embryos are isolated from maize, the chick embryos are contacted with an Agrobacterium suspension, wherein the Agrobacterium is capable of transferring the nucleic acid sequences of the cry3Bb, cry3Aa genes and the nucleic acid sequence of the pat gene to at least one cell of one of the chick embryos (step 1: the infection step), in which step the chick embryos are specifically immersed in the Agrobacterium suspension (OD ₆₆₀ =0.4-0.6, in infection medium (MS salt 4.3g/L, MS vitamin, casein 300mg/L, sucrose 68.5g/L, glucose 36g/L, acetosyringone (AS) 40mg/L, 2, 4-dichlorophenoxyacetic acid (2, 4-D) 1mg/L, ph 5.3) to initiate inoculation. The young embryo is co-cultured with Agrobacterium for a period of time (3 days) (step 2: co-culturing step). Specifically, the young embryo is cultured on a solid medium (MS salt 4.3g/L, MS vitamin, casein 300mg/L, sucrose 20g/L, glucose 10g/L, acetosyringone (AS) 100mg/L, 2, 4-dichlorophenoxyacetic acid (2, 4-D) 1mg/L, agar 8g/L, pH 5.8) after the infection step. After this co-cultivation stage, there may be an optional "recovery" step. In the "recovery" step, at least one antibiotic (cephalosporin) known to inhibit the growth of Agrobacterium was present in the recovery medium (MS salt 4.3g/L, MS vitamin, casein 300mg/L, sucrose 30g/L, 2, 4-dichlorophenoxyacetic acid (2, 4-D) 1mg/L, plant gel 3g/L, pH 5.8) without addition of a selection agent for plant transformants (step 3: recovery step). Specifically, young embryos are cultured on solid medium with antibiotics but no selection agent to eliminate agrobacterium and provide a recovery period for the infected cells. Next, the inoculated chick embryos are cultured in the presence of a selection agent (N- (phosphonomethyl) glycine) Transformed calli grown were cultured and selected on the substrate (step 4: selection step). Specifically, the young embryos are cultured on a selective solid medium (MS salt 4.3g/L, MS vitamin, casein 300mg/L, sucrose 30g/L, N- (phosphonomethyl) glycine 0.25mol/L, 2, 4-dichlorophenoxyacetic acid (2, 4-D) 1mg/L, plant gel 3g/L, pH 5.8) with a selective agent, resulting in selective growth of the transformed cells. Then, the callus is regenerated into plants (step 5: regeneration step), specifically, the callus grown on the medium containing the selection agent is cultured on solid medium (MS differentiation medium and MS rooting medium) to regenerate the plants.

The selected resistant calli were transferred to MS differentiation medium (MS salt 4.3g/L, MS vitamin, casein 300mg/L, sucrose 30g/L, 6-benzyl adenine 2mg/L, N- (phosphonomethyl) glycine 0.125mol/L, plant gel 3g/L, pH=5.8) and cultured at 25 ℃. The differentiated plantlets were transferred to the MS rooting medium (MS salt 2.15 g/L, MS vitamin, casein 300mg/L, sucrose 30g/L, indole-3-acetic acid 1mg/L, agar 8g/L, pH=5.8), cultured to about 10cm high at 25℃and transferred to a greenhouse for cultivation until set. In the greenhouse, the cells were cultured at 28℃for 16 hours and at 20℃for 8 hours each day.

1.3 identification and screening of transgenic events

A total of 3000 independent transgenic T0 individuals were generated. Through means of multi-generation agronomic character screening, insect resistance screening, copy number screening and the like, the LP016-1 with good agronomic character performance, high resistance to corn rootworm and other pests and high resistance to glufosinate is obtained.

Example 2 detection of transgenic maize event LP016-1 with TaqMan

About 100mg of leaves of transgenic corn event LP016-1 was taken as a sample, genomic DNA was extracted by Qiagen DNeasyPlant Maxi Kit, and the copy numbers of cry3Bb, cry3Aa and pat were detected by Taqman probe fluorescent quantitative PCR method. Meanwhile, wild-type maize (non-transgenic, transformed recipient) plants were used as controls for detection analysis as described above. Experiments were repeated 3 times and averaged.

The specific method comprises the following steps:

step 1, taking 100mg of leaves of transgenic corn event LP016-1, grinding into homogenate in a mortar by using liquid nitrogen, and taking 3 repeats of each sample;

step 2, extracting genomic DNA of the sample by using DNeasy Plant Mini Kit of Qiagen, wherein the specific method refers to the product instruction;

step 3, determining the concentration of the genomic DNA of the sample by using NanoDrop 2000 (Thermo Scientific);

Step 4, adjusting the concentration of the genome DNA of the sample to the same concentration value, wherein the concentration value ranges from 80 ng/mu l to 100 ng/mu l;

step 5, identifying the copy number of the sample by adopting a Taqman probe fluorescent quantitative PCR method, taking the sample with the identified known copy number as a standard substance, taking the sample of the wild type corn plant as a control, repeating each sample for 3 times, and taking the average value; the fluorescent quantitative PCR primer and the probe sequences are respectively as follows:

the following primers and probes were used to detect cry3Bb gene sequences:

primer 1: AATCTGCCCG ACCACTGAGA, as shown in SEQ ID NO. 16 of the sequence Listing;

primer 2: GAGGTGCTGG ATAATTCTAC TGTCAA, as shown in SEQ ID NO. 17 of the sequence Listing;

probe 1: CCCGGTGCCA ACCGCGTC, as shown in SEQ ID NO. 18 of the sequence Listing;

the following primers and probes were used to detect cry3Aa gene sequences:

primer 3: ACTCCCAGGG CAGGATCAG, as shown in SEQ ID NO 19 of the sequence Listing;

primer 4: GGCGAAAGAA GGCATCGA, as shown in SEQ ID NO. 20 of the sequence Listing;

probe 2: CTTCTCCCAGGCTGAGAGCCATTTCC, as shown in SEQ ID NO. 21 of the sequence Listing;

the following primers and probes were used to detect the pat gene sequence:

primer 5: CCGCGGTTTGTGATATCGT, as shown in SEQ ID NO. 22 of the sequence Listing;

Primer 6: TCTTGCAACCTCTCTAGATCATCAA, as shown in SEQ ID NO. 23 of the sequence Listing;

probe 3: TAGGACAGAGCCACAAACACCACAAGAGTG, as shown in SEQ ID NO. 24 of the sequence Listing;

the PCR reaction system is that

The 50 Xprimer/probe mixture contained 45. Mu.L of each primer at a concentration of 1mM, 50. Mu.L of probe at a concentration of 100. Mu.M and 860. Mu.L of 1 XTE buffer, and was stored in amber tubes at 4 ℃.

The PCR reaction conditions were

Data were analyzed using SDS2.3 software (applied biosystems) to obtain a single copy of transgenic maize event LP016-1.

Example 3 transgenic maize event LP016-1 detection

3.1 genomic DNA extraction

DNA extraction according to the conventionally employed CTAB (cetyltrimethylammonium bromide) method: 2 g of tender transgenic corn event LP016-1 leaves are ground into powder in liquid nitrogen, 0.5mL of DNA preheated at 65 ℃ is added to extract CTAB Buffer [20g/L CTAB,1.4M NaCl,100mM Tris-HCl,20mM EDTA (ethylenediamine tetraacetic acid) ], naOH is used for regulating the pH to 8.0, and the mixture is fully and uniformly mixed and extracted for 90min at 65 ℃; adding 0.5 volume of phenol and 0.5 volume of chloroform, and mixing the mixture upside down; centrifuging at 12000rpm for 10min; sucking the supernatant, adding 1-time volume of isopropanol, gently shaking the centrifuge tube, and standing at-20deg.C for 30min; further centrifuging at 12000rpm for 10min; collecting DNA to the bottom of the tube; discarding the supernatant, washing the precipitate with 0.5mL of 70% ethanol by volume; centrifuging at 12000rpm for 5min; vacuum pumping or blow-drying in an ultra clean bench; the DNA precipitate was dissolved in an appropriate amount of TE buffer (10 mM Tris-HCl,1mM EDTA,pH 8.0), and stored at a temperature of-20 ℃.

3.2 analysis of flanking DNA sequences

Concentration measurement of the above-mentioned extracted DNA sampleThe concentration of the sample to be measured is set between 80 and 100 ng/. Mu.L. Genomic DNA was digested with selected restriction enzymes SpeI, pstI, bssHII (5 'end assay) and SacI, kpnI, xmaI, nheI (3' end assay), respectively. 26.5. Mu.L of genomic DNA, 0.5. Mu.L of the above-selected restriction enzyme and 3. Mu.L of the cleavage buffer were added to each cleavage system, and the cleavage was performed at an appropriate temperature for 1 hour. After the enzyme digestion is finished, 70 mu L of absolute ethyl alcohol is added into an enzyme digestion system, ice bath is carried out for 30min, centrifugal separation is carried out for 7min at the rotating speed of 12000rpm, supernatant is discarded, drying is carried out, and then 8.5 mu L of double distilled water (ddH) is added ₂ O), 1. Mu.L of 10 XT 4 Buffer and 0.5. Mu. L T4 ligase were ligated overnight at 4 ℃. PCR amplification was performed with a series of nested primers to isolate 5 'and 3' transgenes/genomic DNA. Specifically, the isolated 5' transgene/genomic DNA primer combination includes SEQ ID NO. 13, SEQ ID NO. 30 as a first primer, SEQ ID NO. 31, SEQ ID NO. 32 as a second primer, and SEQ ID NO. 13 as a sequencing primer. The isolated 3' transgene/genomic DNA primer combination included SEQ ID NO. 15, SEQ ID NO. 33 as the first primer, SEQ ID NO. 34, SEQ ID NO. 35 as the second primer, SEQ ID NO. 15 as the sequencing primer, and the PCR reaction conditions are shown in Table 3.

The resulting amplicons were electrophoresed on a 2.0% agarose Gel to isolate the PCR reaction, followed by isolation of the fragment of interest from the agarose matrix using the QIAquick Gel extraction kit (catalogue # 28704, qiagen Inc., valencia, CA). The purified PCR product is then sequenced (e.g., ABI prism 377, PE Biosystems, foster City, CA) and analyzed (e.g., DNASTAR sequence analysis software, DNASTAR inc., madison, WI).

The 5 'and 3' flanking sequences and the junction sequences were confirmed using standard PCR methods. The 5' flanking sequences and the junction sequences can be confirmed using SEQ ID NO. 8 or SEQ ID NO. 12 in combination with SEQ ID NO. 9, SEQ ID NO. 13 or SEQ ID NO. 30. The 3' flanking sequences and the junction sequences can be confirmed using SEQ ID NO. 11 or SEQ ID NO. 14 in combination with SEQ ID NO. 10, SEQ ID NO. 15 or SEQ ID NO. 33. The PCR reaction system and the amplification conditions are shown in tables 3 and 4. Those skilled in the art will appreciate that other primer sequences may be used to confirm flanking and junction sequences.

DNA sequencing of the PCR product provides DNA that can be used to design other DNA molecules as primers and probes for identification of maize plants or seeds derived from transgenic maize event LP 016-1.

It was found that nucleotide 1-838 of SEQ ID NO. 5 shows the maize genomic sequence flanking the right border of the insert sequence of transgenic maize event LP016-1 (5 'flanking sequence) and nucleotide 11088-11934 of SEQ ID NO. 5 shows the maize genomic sequence flanking the left border of the insert sequence of transgenic maize event LP016-1 (3' flanking sequence). The 5 'junction sequence is set forth in SEQ ID NO. 1 and the 3' junction sequence is set forth in SEQ ID NO. 2.

3.3 PCR zygosity assay

The junction sequence is a relatively short polynucleotide molecule, which is a novel DNA sequence that is diagnostic for the DNA of transgenic maize event LP016-1 when detected in a polynucleic acid detection assay. The binding sequence of SEQ ID NO. 1 consists of 11bp each on one side of the T-DNARB region insertion site and the maize genomic DNA insertion site of transgenic maize event LP016-1, and the binding sequence of SEQ ID NO. 2 consists of 11bp each on the other side of the T-DNALB region insertion site and the maize genomic DNA insertion site of transgenic maize event LP 016-1. Longer or shorter polynucleotide binding sequences may be selected from SEQ ID NO. 3 or SEQ ID NO. 4. The junction sequences (5 'junction region SEQ ID NO:1, and 3' junction region SEQ ID NO: 2) are useful as DNA probes or as DNA primer molecules in DNA detection methods. The junction sequences SEQ ID NO. 6 and SEQ ID NO. 7 are also novel DNA sequences in transgenic maize event LP016-1, which can also be used as DNA probes or as DNA primer molecules to detect the presence of transgenic maize event LP016-1 DNA. The sequence of SEQ ID NO. 6 (nucleotides 839-1330 of SEQ ID NO. 3) spans the LP016 construct DNA sequence and the tNos transcription termination sequence, and the sequence of SEQ ID NO. 7 (nucleotides 1-381 of SEQ ID NO. 4) spans the tNos transcription termination sequence and the LP016 construct DNA sequence.

Furthermore, the amplicon is generated by using primers from at least one of SEQ ID NO. 3 or SEQ ID NO. 4, which primers when used in a PCR method generate a diagnostic amplicon for transgenic maize event LP 016-1.

Specifically, a PCR product is generated from the 5 'end of the transgenic insert that is a portion of genomic DNA flanking the 5' end of the T-DNA insert in the genome comprising plant material derived from transgenic maize event LP 016-1. This PCR product contains SEQ ID NO 3. For PCR amplification, primers 9 (SEQ ID NO: 8) hybridizing to the genomic DNA sequence flanking the 5' -end of the transgene insert and primers 10 (SEQ ID NO: 9) located in the transcription termination sequence of the transgene tNos were designed to pair with them.

A PCR product is generated from the 3 'end of the transgenic insert comprising a portion of genomic DNA flanking the 3' end of the T-DNA insert in the genome of the plant material derived from transgenic maize event LP 016-1. This PCR product contains SEQ ID NO. 4. For PCR amplification, primers 12 (SEQ ID NO: 11) hybridizing to the genomic DNA sequences flanking the 3 '-end of the transgene insert and primers 11 (SEQ ID NO: 10) of the tNos transcription termination sequence at the 3' -end of the insert were designed to pair with.

The DNA amplification conditions described in tables 3 and 4 can be used in the PCR zygosity assay described above to generate a diagnostic amplicon of transgenic maize event LP 016-1. Detection of the amplicon may be performed by using conditions as shown in Table 3 in a Stratagene Robotcycle, MJ Engine, perkin-Elmer 9700 or Eppendorf MastercyclerGradien thermocycler, or the like, or by methods and apparatus known to those skilled in the art.

TABLE 3 PCR procedure and reaction mixture conditions for identification of 5' transgenic insert/genomic combination region of transgenic maize event LP016-1

Step (a)	Reagent(s)	Quantity of	Remarks
				1	Water without nucleotidase	Added to the final volume 20 [ mu ] L
2	Reaction buffer (with MgCl ₂ ）	2.0µL	1.5mM final buffer concentration MgCl ₂ Final concentration
				3	dATP, dCTP, dGTP and dTTP in 10mM	0.4µL	200 mu M final concentration of each dNTP
4	Event primer 9 (SEQ ID NO:8 suspended in 1X TE buffer or Concentration of no nucleotidase in water to 10 mu M	0.2µL	Final concentration of 0.1 [ mu ] M
				5	Event primer 10 (SEQ ID NO:9 suspended in 1X TE buffer Or a concentration of 10 [ mu ] M in water without nucleotidase	0.2µL	Final concentration of 0.1 [ mu ] M
6	RNase, DNase-free (500 ng/mL)	0.1µL	50 ng/reaction
				7	REDTaq DNA polymerase (1 unit/. Mu.l)	1.0 [ mu ] L (suggesting switching of pipette before next step)	1 unit/reaction
8	Extracted DNA (template): blade for sample to be analyzed	200ng of genomic DNA
					Negative control	50ng of non-transgenic maize genomic DNA
	Negative control	Template-free DNA (solution in which DNA is resuspended) Liquid
					Positive control	50ng of maize genomic DNA comprising LP016-1

Table 4, perkin-Elmer9700 thermal cycler conditions

Cycle number	Setting up
		1	94 ℃ for 3 minutes
34	94 ℃ for 30 seconds
			64 ℃ for 30 seconds
	72 ℃ for 1 minute
		1	72 ℃ for 10 minutes

Mix gently, if there is no thermal cap on the thermocycler, 1-2 drops of mineral oil can be added above each reaction solution. PCR was performed on a Stratagene Robotcycler (Stratagene, la Jolla, calif.), MJ Engine (MJ R-Biorad, hercules, calif.), perkin-Elmer9700 (Perkin Elmer, boston, mass.) or Eppendorf Mastercycler Gradient (Eppendorf, hamburg, germany) thermocycler using the cycling parameters of Table 4. The MJ Engine or Eppendorf Mastercycler Gradient thermocycler should operate in a calculated mode. The Perkin-Elmer9700 thermocycler is operated with a ramp rate (ramp speed) set to a maximum value.

The experimental results show that: primers 9 and 10 (SEQ ID NOS: 8 and 9), which when used in a PCR reaction of transgenic maize event LP016-1 genomic DNA, produce an amplification product of 1330bp fragment, NO fragment being amplified when used in a PCR reaction of untransformed maize genomic DNA and non-LP 016-1 maize genomic DNA; primers 11 and 12 (SEQ ID NOS: 10 and 11), when used in the PCR reaction of transgenic maize event LP016-1 genomic DNA, produced an amplification product of 1228bp fragment, when used in the PCR reaction of untransformed maize genomic DNA and non-LP 016-1 maize genomic DNA, NO fragment was amplified.

The PCR zygosity assay can also be used to identify whether the material derived from transgenic maize event LP016-1 is homozygous or heterozygous. Primer 13 (SEQ ID NO: 12), primer 14 (SEQ ID NO: 13) and primer 15 (SEQ ID NO: 14), or primer 14 (SEQ ID NO: 13), primer 15 (SEQ ID NO: 14) and primer 16 (SEQ ID NO: 15) are used in an amplification reaction to generate a diagnostic amplicon of transgenic maize event LP 016-1. The DNA amplification conditions illustrated in tables 5 and 6 can be used in the zygosity assay described above to generate a diagnostic amplicon of transgenic corn event LP 016-1.

TABLE 5 reaction solution for measuring the bondability

Step (a)	Reagent(s)	Quantity of	Remarks
				1	Nuclease-free water	Added to the final volume 5 [ mu ] L
2	2*Universal Master Mix(Applied Biosystems catalog number 4304437)	5µL	Final concentration of 1
				3	Primer 13 (SEQ ID NO: 12) and primer 14 (SEQ ID NO NO: 13) and primer 15 (SEQ ID NO: 14) (resuspended) Concentration to 10. Mu.M in non-nucleic acid water	0.3µL	Final concentration of 0.1 [ mu ] M
4	REDTaq DNA polymerase (1 unit/. Mu.L)	1.0 [ mu ] L (suggesting switching of pipette before next step)	1 unit/reaction
				5	Extracted DNA (template): blade for sample to be analyzed	200ng of genomic DNA
	Negative control	50ng of non-transgenic maize genomic DNA
					Negative control	Template-free DNA (solution in which DNA is resuspended)
	Positive control	50ng of maize genomic DNA comprising LP016-1

TABLE 6 determination of the bondability Perkin-Elmer9700 thermal cycler conditions

Cycle number	Setting up
		1	95 ℃ for 10 minutes
10	95 ℃ for 15 seconds
			64 ℃ for 1 minute (-1 ℃/cycle)
25	95 ℃ for 15 seconds
			54 ℃ for 1 minute
1	Immersion at 10 ℃

PCR was performed on a Stratagene Robotcycler (Stratagene, la Jolla, calif.), MJ Engine (MJ R-Biorad, hercules, calif.), perkin-Elmer9700 (Perkin Elmer, boston, mass.) or Eppendorf MastercyclerGradient (Eppendorf, hamburg, germany) thermocycler using the cycling parameters of Table 6. The MJ Engine or Eppendorf Mastercycler Gradient thermocycler should operate in a calculated mode. The Perkin-Elmer9700 thermocycler is operated with a ramp rate (ramp speed) set to a maximum value.

In the amplification reaction, the biological sample containing the template DNA contains DNA diagnostic for the presence of transgenic maize event LP016-1 in the sample. Or the reaction will produce two different DNA amplicons from a biological sample containing DNA derived from the corn genome that is heterozygous for the allele corresponding to the insert DNA present in transgenic corn event LP 016-1. These two different amplicons would correspond to the first amplicon derived from the wild-type maize genomic locus and the second amplicon diagnostic for the presence of transgenic maize event LP016-1 DNA. Only a corn DNA sample corresponding to a single amplicon of the second amplicon described for the heterozygous genome is generated, the presence of transgenic corn event LP016-1 can be diagnostically determined in the sample, and the sample is generated from a corn seed homozygous for the allele corresponding to the inserted DNA present in transgenic corn plant LP 016-1.

It should be noted that the primer pair of transgenic maize event LP016-1 was used to generate amplicons diagnostic for the transgenic maize event LP016-1 genomic DNA. These primer pairs include, but are not limited to, primers 9 and 10 (SEQ ID NOS: 8 and 9), and primers 11 and 12 (SEQ ID NOS: 10 and 11) for use in the DNA amplification method described. In addition, a control primer 7 and 8 (SEQ ID NO:25 and SEQ ID NO: 26) for amplifying the maize endogenous gene was included as an intrinsic criterion for the reaction conditions. Analysis of the DNA extract sample of transgenic corn event LP016-1 should include a positive tissue DNA extract control of transgenic corn event LP016-1, a negative DNA extract control derived from non-transgenic corn event LP016-1 and a negative control without template corn DNA extract. In addition to these primer pairs, any primer pair from SEQ ID NO. 3 or SEQ ID NO. 4, or the complement thereof, which when used in a DNA amplification reaction, produces an amplicon comprising SEQ ID NO. 1 or SEQ ID NO. 2, respectively, that is diagnostic for tissue derived from transgenic event maize plant LP016-1, may be used. The DNA amplification conditions set forth in tables 3-6 can be used to generate diagnostic amplicons of transgenic maize event LP016-1 using appropriate primer pairs. Extracts that are presumed to contain corn plant or seed DNA comprising transgenic corn event LP016-1, or products derived from transgenic corn event LP016-1, that when tested in a DNA amplification method produce an amplicon diagnostic for transgenic corn event LP016-1, can be used as templates for amplification to determine the presence or absence of transgenic corn event LP016-1.

Example 4 detection of transgenic maize event LP016-1 by Southern blot hybridization

4.1 DNA extraction for Southern blot hybridization

Southern blot analysis was performed using transformation events homozygous for the T3, T4 generation. Approximately 5 to 10g of plant tissue was ground in liquid nitrogen using a mortar and pestle. Plant tissue was resuspended in 12.5mL extraction buffer a (0.2M Tris ph=8.0, 50mM EDTA,0.25M NaCl,0.1%v/v β -mercaptoethanol, 2.5% w/v polyvinylpyrrolidone) and centrifuged at 4000rpm for 10 min (2755 g). After discarding the supernatant, the pellet was resuspended in 2.5mL of extraction buffer B (0.2M Tris ph=8.0, 50mM EDTA,0.5M NaCl,1%v/v β -mercaptoethanol, 2.5% w/v polyvinylpyrrolidone, 3% myo-aminoacyl, 20% ethanol) and incubated for 30 min at 37 ℃. During the incubation period, the samples were mixed once with a sterile loop. After incubation, an equal volume of chloroform/isoamyl alcohol (24:1) was added, gently mixed by inversion and centrifuged at 4000rpm for 20 minutes. The aqueous layer was collected and centrifuged at 4000rpm for 5 minutes after the addition of 0.54 volume of isopropanol to precipitate the DNA. The supernatant was discarded and the DNA pellet was resuspended in 500. Mu.L TE. To degrade any RNA present, the DNA was incubated with 1. Mu.L of 30mg/mL RNAaseA for 30 min at 37℃and centrifuged at 4000rpm for 5 min, and the DNA was precipitated by centrifugation at 14000rpm for 10 min in the presence of 0.5 volumes of 7.5M ammonium acetate and 0.54 volumes of isopropanol. After discarding the supernatant, the pellet was washed with 500. Mu.L of 70% ethanol and dried and resuspended in 100. Mu.L TE.

4.2 restriction enzyme digestion

DNA concentrations were quantitatively detected using a spectrophotometer or fluorometer (using 1 xTAE and GelRED dyes). In a 100. Mu.L reaction system, 5. Mu.g of DNA was digested each time. Genomic DNA was digested with restriction enzymes SpeI and HindIII, respectively, and partial sequences of cry3Aa, cry3Bb and pat on T-DNA were used as probes. For each enzyme, the digestate was incubated at the appropriate temperature overnight. The samples were spun down to a volume of 30 μl using a vacuum centrifugal evaporative concentrator (speed vacuum).

4.3 gel electrophoresis

Bromophenol blue loading dye was added to each sample from this example 4.2, and each sample was loaded onto a 0.7% agarose gel containing ethidium bromide, electrophoretically separated in TBE electrophoresis buffer, and the gel was electrophoresed overnight at 20 volts.

The gel was washed in 0.25M HCl for 15 minutes to depurinate the DNA, then washed with water. Southern blot hybridization was set as follows: in the tray 20 thick dry blotting papers were placed, and 4 thin dry blotting papers were placed thereon. In 0.4M NaOH, 1 sheet of Bao Yinji paper was pre-moistened and placed on the paper stack, followed by 1 sheet of Hybond-N+ transfer film pre-moistened in 0.4M NaOH (Amersham Pharmacia Biotech, # RPN 303B). The gel is placed on top, ensuring that there are no bubbles between the gel and the membrane. 3 additional pre-soaked blotters were placed on top of the gel and the buffer tray was filled with 0.4M NaOH. The gel stack and the buffer disc were connected with a wick pre-immersed in 0.4M NaOH, and the DNA was transferred to the membrane. DNA transfer was performed at room temperature for about 4 hours. After transfer, the Hybond membranes were rinsed in 2 XSSC for 10 seconds and the DNA was bound to the membrane by UV cross-linking.

4.4 hybridization

PCR was used to amplify the appropriate DNA sequences for probe preparation. The DNA probes are SEQ ID NO. 27, SEQ ID NO. 28 and SEQ ID NO. 29, or are homologous or complementary with the sequence parts. 25ng of probe DNA was boiled in 45. Mu.L TE for 5 minutes, placed on ice for 7 minutes, and then transferred to a Rediprime II (Amersham Pharmacia Biotech, #RPN1633) tube. After adding 5. Mu.l of 32P-labeled dCTP to the Rediprime tube, the probe was incubated at 37℃for 15 minutes. The probe was purified by centrifugation through a microcentrifuge G-50 column (Amersham Pharmacia Biotech, # 27-5330-01) according to the manufacturer's instructions to remove unincorporated dNTPs. Probe activity was measured using a scintillation counter. By prehybridization with Church prehybridization solution (500 mM Na ₃ P0 ₄ 1mM EDTA,7%SDS,1%BSA) wet the Hybond membrane for 30 minutes, prehybridized the Hybond membrane. The labeled probe was boiled for 5 minutes and placed on ice for 10 minutes. To the pre-hybridization buffer, an appropriate amount of probe (1 million counts per 1mL of pre-hybridization buffer) was added and hybridization was performed overnight at 65 ℃. The next day, hybridization buffer was discarded and 20mL Church rinse solution 1 (40 mM Na ₃ P0 ₄ 1mM EDTA,5% SDS,0.5% BSA) was washed in 150mL Church rinse solution 1 at 65℃for 20 minutes. Washing with Church rinse solution 2 (40 mM Na ₃ P0 ₄ 1mM EDTA,1% SDS) was repeated 2 times. The membrane is exposed to a phosphor screen or X-ray film to detect the location of probe binding.

Two control samples were included on each Southern: (1) DNA from negative (untransformed) isolates that are used to identify any endogenous maize sequences that can hybridize to the element-specific probe; (2) DNA from positive segregants, into which HindIII digested pLP016 was introduced in an amount equivalent to one copy number based on probe length, to demonstrate the sensitivity of the experiment when detecting single gene copies within the maize genome.

Hybridization data provided corroborated evidence to support TaqMan ^TM PCR analysis, i.e. maize plant LP016-1 contains crySingle copies of the 3Bb, cry3Aa and pat genes. Using the cry3Bb probe, speI and HindIII enzymatic hydrolysis produced single bands of about 11.0kb and 12.1kb, respectively; speI and HindIII digestion with cry3Aa probe produced single bands of about 11.0kb and 12.1kb, respectively; using the pat probe, speI and HindIII enzymatic hydrolysis produced single bands of about 8.3kb and 12.1kb, respectively. This indicates that one copy of cry3Bb, cry3Aa, and pat each is present in maize transformation event LP 016-1.

Example 5 insect resistance detection

5.1 determination of field pest control Effect of transgenic corn event LP016-1

(1) Leaf beetle of double-spot fluorescent

The living body insect-grafting method is adopted to carry out the resistance identification of the main target pest double-spotted fluorescent leaf beetles in the field on the transgenic corn event LP 016-1. The insects are grafted in the 4-6 leaf period and the silk-laying period (female silk-laying 3-5 cm), the insects are grafted for 2 times in each period, 50 heads are grafted each time, and the interval between the two times is one week. After the cardiotrophin 14 and d, feeding of upper leaves of corn plants by the diabrotica virgifera was investigated on a plant-by-plant basis. After the silk-laying period is inoculated, the damage degree of female ears and the damage condition of plants are investigated before harvest. The statistical results of the cut-off investigation damage rate (%) = (number of insect units/total number of investigation units x 100%) of the ears at the silking period are shown in table 7. The results show that the leaf feeding degree of transgenic corn event LP016-1 is significantly lower than that of a transformation receptor Control (CK), and the transgenic corn event has good resistance to diabrotica.

TABLE 7 results of resistance of transgenic maize event LP016-1 to Aphanizomenon bifidus under artificial insect-grafting conditions

Project/plant	LP016-1	CK
			Rate of damage (%)	3	65

(2) Corn rootworm

Through the identification of American cooperative units, western corn rootworm eggs are placed in an evaluation test plot in the V2 period of corn, the transgenic corn rootworm and a transformation receptor control are treated in the same way, roots of plants in the evaluation region are dug out and washed when corn grows to the V10 period, the condition that corn rootworm damages the roots of the plants is investigated plant by plant, the damage rate (%) = (number of insect units/total number of investigation units multiplied by 100%) of the transgenic corn event LP016-1 to the corn rootworm is shown in a table 8, and the result shows that compared with the Control (CK), the damage rate of the corn rootworm to the transgenic corn event LP016-1 is obviously reduced, thereby indicating that the transgenic corn event LP016-1 has higher resistance to the corn rootworm.

Table 8 results of resistance of transgenic corn event LP016-1 to Spodoptera frugiperda under artificial insect-receiving conditions

Project/plant	LP016-1	CK
			Rate of damage (%)	3	60

Example 6 herbicide tolerance detection of maize transformation event

The test selects the herbicide (glufosinate) for spraying. A random block design was used, 3 replicates. The cell area is 20m ² (5 m is multiplied by 4 m), the seedlings are planted 340, the conventional cultivation and management are carried out, and 1m wide isolation zones are arranged between the communities. Transgenic maize event LP016-1 and the transformation receptor Control (CK) were subjected to 2 treatments, respectively: 1) Spraying clear water; 2) The pesticide was sprayed at a dose of 160 g a.i./ha during the V3 leaf stage and then again at the same dose during the V8 stage. It should be noted that the conversion of the glufosinate herbicide of different content and dosage form into the equivalent glufosinate form is applicable to the following conclusion. The phytotoxicity symptoms were investigated at 1 and 2 weeks after dosing, respectively, and the yield of the cells was determined at harvest. The phytotoxicity symptoms were ranked as shown in table 9. The herbicide damage rate is used as an evaluation index to evaluate an index of herbicide tolerance of a transformation event, specifically, the herbicide damage rate (%) Σ (peer damage number×number of ranks)/(total number×highest rank); the herbicide damage rate refers to the glufosinate damage rate, and the glufosinate damage rate is determined according to the phytotoxicity investigation result of 2 weeks after glufosinate treatment. The corn yield per cell is measured as the total yield (weight) of corn kernels in the middle 3 rows of each cell, and the yield difference between the different treatments is measured as a yield percentage (% yield = glufosinate yield sprayed/clear water yield sprayed). The results of the tolerance of transgenic maize event LP016-1 to herbicide and the maize yield results are shown in FIG. 3 and Table 10.

TABLE 9 grading Standard for the extent of phytotoxicity of glufosinate-ammonium to corn

Grade of phytotoxicity	Description of symptoms
		Level 0	No phytotoxicity, and the growth is consistent with that of clear water contrast;
level 1	Slight burns occur at the leaf base, with burn areas less than or equal to 10%;
		level 2	The basal part of the leaf is obviously burned, and the burned area is more than 10 percent. Possibly accompanied by slight curling of the leaves or tilting of the plants, recoverable within 14 days;
3 grade	Plant leaf deformity, or plant oblique growth, still unrecoverable for 14 days; breaking the leaves from the phytotoxicity part;
		grade 4	Serious plant deformity; wilting leaves and dying;

table 10, results of transgenic corn event LP016-1 on glufosinate herbicide tolerance and corn yield results

Project/plant	LP016-1	CK
			Rate of damage (%) (spraying clear water)	0	0
Glufosinate-ammonium failure (%) (guard reach 160 g a.i./ha)	0	100
			Yield percentage (guard reached 160 g a.i./ha)	103	0

The results show that in terms of herbicide (glufosinate) damage rate: 1) The rate of damage of transgenic maize event LP016-1 under treatment with glufosinate herbicide (160 g a.i./ha) was essentially 0, thus it was seen that transgenic maize event LP016-1 had good glufosinate herbicide tolerance.

In terms of yield: the yield of the transgenic corn event LP016-1 is not obviously different under the 2 treatments of spraying clear water and spraying 4000 g of a.i./ha glufosinate, and after the glufosinate herbicide is sprayed, the yield of the transgenic corn event LP016-1 is slightly improved compared with that of the transgenic corn event LP Shi Qingshui, thereby further indicating that the transgenic corn event LP016-1 has good glufosinate herbicide tolerance.

In conclusion, through TaqMan ^TM Analysis (see example 2) the regenerated transgenic maize plants were tested for the presence of cry3Bb, cry3Aa and pat genes and characterized for insect resistance and copy number of glufosinate herbicide resistant lines. Based on the copy number of the gene of interest, good insect resistance, glufosinate herbicide tolerance and agronomic trait performance (see example 5 and example 6), event LP016-1 was selected to be excellent by screening, with single copy transgenes, good insect resistance, glufosinate herbicide tolerance and agronomic trait performance.

Claims

1. A nucleic acid sequence comprising one or more of the sequences SEQ ID NOs 1 to 7 or the complement thereof; the nucleic acid sequence is derived from transgenic corn event LP016-1, and a representative sample of seeds comprising the transgenic corn event LP016-1 has been deposited with China center for type culture collection with the accession number CCTCC NO: P202310.

2. A DNA primer pair comprising a first primer and a second primer, wherein each of said first primer and said second primer comprises a partial sequence of SEQ ID No. 5 or a complement thereof and when used in an amplification reaction with DNA comprising transgenic maize event LP016-1, produces an amplicon that detects transgenic maize event LP016-1 in a sample.

3. The primer pair of claim 2, wherein the first primer is selected from the group consisting of SEQ ID No. 1 or its complement, SEQ ID No. 8, and SEQ ID No. 12; the second primer is selected from SEQ ID NO. 2 or a complementary sequence thereof, SEQ ID NO. 11 or SEQ ID NO. 14.

4. The primer pair of claim 2, wherein the first primer is selected from the group consisting of SEQ ID No. 1 or its complement, SEQ ID No. 8 or SEQ ID No. 12, and the second primer is selected from the group consisting of SEQ ID No. 9 or SEQ ID No. 13; or the first primer is selected from SEQ ID NO. 2 or a complementary sequence thereof, SEQ ID NO. 10 or SEQ ID NO. 15, and the second primer is selected from SEQ ID NO. 11 or SEQ ID NO. 14.

5. A DNA probe comprising a partial sequence of SEQ ID No. 5 or a complement thereof, said DNA probe hybridizing under stringent hybridization conditions to a DNA molecule comprising a nucleic acid sequence selected from the group consisting of SEQ ID nos. 1 to 7 or a complement thereof and not hybridizing under stringent hybridization conditions to a DNA molecule not comprising a nucleic acid sequence selected from the group consisting of SEQ ID nos. 1 to 7 or a complement thereof.

6. The probe of claim 5, wherein the DNA probe comprises a sequence selected from the group consisting of SEQ ID NO. 3 or a sequence complementary thereto, and SEQ ID NO. 4 or a sequence complementary thereto.

7. The probe of claim 5, wherein the DNA probe comprises a sequence selected from the group consisting of SEQ ID NO. 1 or a complement thereof, SEQ ID NO. 2 or a complement thereof, SEQ ID NO. 6 or a complement thereof, and SEQ ID NO. 7 or a complement thereof.

8. A marker nucleic acid molecule comprising a partial sequence of SEQ ID No. 5 or a complement thereof, said marker nucleic acid molecule hybridizing under stringent hybridization conditions with a DNA molecule comprising a nucleic acid sequence selected from the group consisting of SEQ ID nos. 1 to 7 or a complement thereof and not hybridizing under stringent hybridization conditions with a DNA molecule not comprising a nucleic acid sequence selected from the group consisting of SEQ ID nos. 1 to 7 or a complement thereof.

9. The marker nucleic acid molecule of claim 8, wherein the marker nucleic acid molecule comprises a sequence selected from the group consisting of SEQ ID No. 3 or its complement, SEQ ID No. 4 or its complement.

10. The marker nucleic acid molecule of claim 8, wherein the marker nucleic acid molecule comprises a sequence selected from the group consisting of SEQ ID No. 1 or its complement, SEQ ID No. 2 or its complement, SEQ ID No. 6 or its complement, and SEQ ID No. 7 or its complement.

11. A method of detecting the presence of DNA comprising transgenic maize event LP016-1 in a sample, comprising:

(1) Contacting a sample to be detected with the DNA primer pair of any one of claims 2 to 4 in a nucleic acid amplification reaction;

(2) Performing a nucleic acid amplification reaction;

(3) Detecting the presence of an amplification product;

the amplification product comprises a nucleic acid sequence selected from the group consisting of the sequences SEQ ID NOs 1-7 or the complement thereof, i.e., is indicative of the presence of DNA comprising the transgenic maize event LP016-1 in the test sample.

12. A method of detecting the presence of DNA comprising transgenic maize event LP016-1 in a sample, comprising:

(1) Contacting a sample to be detected with the DNA probe of any one of claims 5-7, and/or the marker nucleic acid molecule of any one of claims 8-10;

13. A DNA detection kit comprising: the DNA primer pair of any one of claims 2-4, the DNA probe of any one of claims 5-7, and/or the marker nucleic acid molecule of any one of claims 8-10.

14. A method of protecting a maize plant from insect infestation comprising providing at least one transgenic maize plant cell in the diet of a target insect, said transgenic maize plant genome comprising in sequence SEQ ID No. 1, the nucleic acid sequence of SEQ ID No. 5 from position 850 to 11076, and SEQ ID No. 2; or the genome of the transgenic corn plant comprises a sequence shown in SEQ ID NO. 5; target insects that ingest the transgenic corn plant cells are inhibited from further ingest the corn plant.

15. A method of protecting a maize plant from injury caused by a herbicide, characterized in that at least one transgenic maize plant is grown comprising in sequence SEQ ID No. 1, the nucleic acid sequence of SEQ ID No. 5 from position 850 to 11076 and SEQ ID No. 2 in the genome of said transgenic maize plant; or the genome of the transgenic corn plant comprises a sequence shown in SEQ ID NO. 5.

16. A method of controlling weeds in a field in which corn plants are grown, comprising applying an effective dose of glufosinate herbicide to the field in which at least one transgenic corn plant is grown, said transgenic corn plant comprising in its genome the nucleic acid sequence of SEQ ID No. 1, SEQ ID No. 5 from position 850 to 11076 and SEQ ID No. 2; or the genome of the transgenic corn plant comprises a sequence shown in SEQ ID NO. 5.

17. A processed product resulting from transgenic corn event LP016-1, wherein the processed product is corn flour, corn oil, corn starch.