CN116457011A - Vaccine composition for treating coronavirus - Google Patents

Abstract

The present disclosure provides compositions and methods useful for preventing and/or treating coronavirus infections. As described herein, the compositions and methods are based on the development of an immunogenic composition comprising virus-like particles (VLPs) comprising one or more Moloney Murine Leukemia Virus (MMLV) core proteins and comprising one or more coronavirus epitopes, e.g., as from SARS-Cov-2 spike protein.

Description

Vaccine composition for treating coronavirus

Cross Reference to Related Applications

The present application claims the benefit of U.S. provisional application Ser. No.63/002,237, filed 3/30/2020, and U.S. provisional application Ser. No.63/070,150, filed 8/2020, both of which are incorporated herein by reference in their entirety.

Technical Field

The present invention is in the field of vaccines, in particular virus-like particle vaccines for coronaviruses.

Background

Coronaviruses are spherical enveloped viruses with a diameter of 160 to 180nm and contain a positive-stranded RNA genome. They are considered to be the largest known RNA viruses because of their genome of about 30,000 bases. Like influenza viruses, they have the ability to undergo genetic recombination with other members of the coronavirus family. Coronaviruses are divided into four major genera. Coronaviruses are recognized as causative agents of several serious diseases in many animals, for example, infectious bronchitis virus, feline infectious peritonitis virus and transmissible gastroenteritis virus. Coronaviruses also cause a range of diseases in humans from the common cold to severe respiratory infections. Four human coronaviruses HCoV-OC43, HCoV-HKU1 (beta coronavirus) and HCoV-NL63, HCoV-229E (alpha coronavirus) resulted in 15% to 30% of common cold (Fung et al (2019) Annu. Rev. Microbiol. 73:2-529-557). In recent years, the β -coronavirus has caused three major outbreaks of human disease.

In the early 21 st century, the beta coronavirus called SARS-CoV caused an outbreak of respiratory disease called severe acute respiratory syndrome (severe acute respiratory syndrome, SARS). The main symptoms include fever, dry cough, headache, shortness of breath and dyspnea. Many infected individuals develop viral pneumonia, which results in infection of the lower respiratory tract. SARS is highly contagious and is transmitted by droplets (droplets) caused by coughing or sneezing or by other methods (e.g., fecal contamination). SARS is fatal in about 9.14% of all cases. The global outbreak of SARS was controlled in month 7 of 2003 and no reported cases have been reported since 2004 (Peeri et al int.j.epi, feb 10,2020).

In 2012, another novel coronavirus, now known as the middle east respiratory syndrome coronavirus (Middle East Respiratory Syndrome coronavirus, MERS-CoV), appeared in sauter arabia. MERS-CoV is also a beta coronavirus. Subsequent MERS-CoV infection cases were reported and outbreaks were transmitted to 27 countries in the middle east, europe, asia and north america. Infection with MERS-CoV manifests as severe acute respiratory illness with symptoms of fever, cough, and shortness of breath. About 34% of reported MERS-CoV infection cases result in death. Only a few reported cases relate to subjects with mild respiratory disease.

At the end of 2019, respiratory tract infections have emerged, which were rapidly identified as being caused by a novel strain of coronavirus known as SARS-CoV-2. The infection known as covd-19 is highly infectious and causes severe pneumonia, especially in elderly patients. Mortality varies significantly from country to country, with estimates ranging from 13.7% in italy to 1.9% in japan. The mortality rate in the united states was about 1.8% by 3 months of 2021 (john hopkins coronavirus research center (Johns Hopkins Coronavirus Research Centre), updated by 30 days of 3 months of 2021). Covd-19 is rapidly spreading worldwide, which leads to significant threats to human health and massive slowing of economic activity. By day 1, 2 of 2021, more than 1 million people had infected covd-19 and more than 200 ten thousand had died.

At the end of 2020, several vaccines against covd-19 were approved for emergency use. These vaccines target proteins called spike proteins on the surface of SARS-CoV-2 and utilize a novel platform, often for the first time in human use. These vaccines have been shown to be efficient in clinical trials, but are slow to distribute in many parts of the world due to manufacturing challenges and in some cases the need to store at ultra-low temperatures. Furthermore, although several new vaccines have proven safe, some are associated with rare but fatal side effects, which limit their use in certain countries.

During the next half of 2020, SARS-CoV-2 variants have emerged that lead to COVID-19 disease. Three variants, b.1.1.7 (also known as UK variants), 501y.v2 (also known as south africa variants) and p.1 (known as brazil variants), rapidly become dominant in the countries in which they occur. These variants have been shown to be highly infectious due to the increased binding affinity of the viral receptor binding domain to a receptor known as angiotensin converting enzyme 2 (ACE 2) (angiotenin-converting enzyme 2). The rapid spread and possible emergence of new variants raise significant concerns about re-infection and the effectiveness of all recently approved vaccines developed against the original strain of SARS-CoV-2.

Thus, there is an urgent need to develop new vaccines that induce strong immunity against SARS-CoV-2 while being safe and easy to store and distribute. Furthermore, there is an urgent need to ensure that vaccines against SARS-CoV-2 provide broad immunity in order to protect patients against the mutant forms of the virus.

Thus, there is a need for a vaccine against human coronavirus that provides broad immunity against coronavirus antigens.

Disclosure of Invention

The present disclosure provides methods and compositions useful for preventing infections caused by human coronaviruses. More particularly, the present disclosure provides methods for producing and compositions comprising: virus-like particles (virus like particle, VLPs) expressing antigens from human coronaviruses, the methods and compositions are useful for preventing, treating and/or diagnosing infections caused by coronaviruses.

The present disclosure provides virus-like particles comprising one or more moloney murine leukemia virus (Moloney Murine leukemia virus, MMLV) core proteins and surrounded by a lipid bilayer membrane. VLPs comprise one or more envelope polypeptides (e.g., one or more coronavirus polypeptide epitopes) from human coronaviruses that play a role in inducing virus neutralizing antibodies.

In some embodiments, the present disclosure provides VLPs having an envelope comprising wild-type human coronavirus envelope glycoproteins. In some embodiments, the polypeptide is from SARS-CoV. In some embodiments, the polypeptide is from MERS-CoV. In some embodiments, the polypeptide is from SARS-CoV-2. In some embodiments, the VLP comprises polypeptides from more than one of SARS-CoV, MERS-CoV, and SARS-CoV-2. In some embodiments, the VLP comprises polypeptides from all three of SARS-CoV, MERS-CoV, and SARS-CoV-2.

In some embodiments, the present disclosure provides VLPs having an envelope comprising modified human coronavirus envelope glycoproteins. In one embodiment, the present disclosure encompasses the production of VLPs having an envelope comprising a coronavirus polypeptide in a premature conformation (premature conformation). In a specific embodiment, the modified envelope glycoprotein lacks a furin cleavage site. In some embodiments, the polypeptide lacking a furin cleavage site is from SARS-CoV. In some embodiments, the polypeptide lacking a furin cleavage site is from MERS-CoV. In some embodiments, the polypeptide lacking a furin cleavage site is derived from SARS-CoV-2. In some embodiments, the VLP comprises a polypeptide from more than one of SARS-CoV, MERS-CoV, and SARS-CoV-2, wherein said polypeptide lacks a furin cleavage site. In some embodiments, the VLP comprises a polypeptide from all three of SARS-CoV, MERS-CoV, and SARS-CoV-2, wherein said polypeptide lacks a furin cleavage site.

In another embodiment, the present disclosure encompasses the production of VLPs with an envelope comprising a coronavirus polypeptide having a modified amino acid sequence. In a specific embodiment, lysine residues and valine residues are replaced with proline residues in the modified envelope glycoprotein. In some embodiments, the polypeptide having a proline substitution is from SARS-CoV. In some embodiments, the polypeptide having a proline substitution is from MERS-CoV. In some embodiments, the polypeptide having a proline substitution is from SARS-CoV-2. In some embodiments, the VLP comprises a polypeptide from more than one of SARS-CoV, MERS-CoV, and SARS-CoV-2, wherein the polypeptide has a proline substitution. In some embodiments, the VLP comprises a polypeptide from all three of SARS-CoV, MERS-CoV, and SARS-CoV-2, wherein the polypeptide has a proline substitution.

In another embodiment, the present disclosure encompasses the production of VLPs having an envelope comprising a coronavirus polypeptide having a modified amino acid sequence and a premature conformation. In a specific embodiment, the modified envelope glycoprotein has lysine residues and valine residues replaced with proline residues, and the modified envelope glycoprotein lacks a furin cleavage site. In some embodiments, the polypeptide having a proline substitution and lacking a furin cleavage site is from SARS-CoV. In some embodiments, the polypeptide having a proline substitution and lacking a furin cleavage site is from MERS-CoV. In some embodiments, the polypeptide having a proline substitution and lacking a furin cleavage site is from SARS-CoV-2. In some embodiments, the VLP comprises a polypeptide from more than one of SARS-CoV, MERS-CoV, and SARS-CoV-2, wherein the polypeptide has a proline substitution and lacks a furin cleavage site. In some embodiments, the VLP comprises a polypeptide from all three of SARS-CoV, MERS-CoV, and SARS-CoV-2, wherein the polypeptide has a proline substitution and lacks a furin cleavage site.

In another embodiment, the modified envelope glycoprotein has been modified such that the transmembrane domain is replaced with the transmembrane domain of another virus. In a particularly preferred embodiment, the VLP has a modified envelope glycoprotein comprising an isolated coronavirus S protein whose transmembrane domain and cytoplasmic tail have been replaced by a transmembrane domain and cytoplasmic tail from vesicular stomatitis virus (vesicular stomatitis virus, VSV). In some embodiments, the polypeptide having a transmembrane domain and cytoplasmic tail from VSV is from SARS-CoV. In some embodiments, the polypeptide having a transmembrane domain and cytoplasmic tail from VSV is from MERS-CoV. In some embodiments, the polypeptide having a transmembrane domain and cytoplasmic tail from VSV is from SARS-CoV-2. In some embodiments, the VLP comprises a polypeptide from more than one of SARS-CoV, MERS-CoV, and SARS-CoV-2, wherein the polypeptide has a transmembrane domain and a cytoplasmic tail from VSV. In some embodiments, the VLP comprises a polypeptide from all three of SARS-CoV, MERS-CoV, and SARS-CoV-2, wherein the polypeptide has a transmembrane domain and a cytoplasmic tail from VSV. In some embodiments, the VLP comprises one or more polypeptides from SARS-CoV, MERS-CoV, and SARS-CoV-2, one or more of which have been modified as described herein and have a transmembrane domain and cytoplasmic tail from VSV.

In a preferred embodiment, the present disclosure encompasses the production of VLPs with an envelope comprising a SAR-CoV-2 spike polypeptide having a modified amino acid sequence and a premature conformation. The modified envelope glycoprotein has lysine residues and valine residues replaced with proline residues, and lacks furin cleavage sites. In addition, the modified spike glycoprotein has been further modified such that the transmembrane domain and cytoplasmic tail have been replaced with the transmembrane domain and cytoplasmic tail from Vesicular Stomatitis Virus (VSV).

The present disclosure also provides bivalent and trivalent VLPs comprising one or more modified human coronavirus envelope proteins and one or more wild-type human coronavirus proteins.

Other features, objects, and advantages of the invention will be apparent from the detailed description that follows. It is to be understood, however, that the detailed description, while indicating some embodiments of the invention, is given by way of illustration and not limitation. Various changes and modifications within the scope of the invention will become apparent to those skilled in the art from the detailed description.

Brief Description of Drawings

The drawings are for illustration purposes only and are not intended to be limiting.

FIG. 1 is a diagram illustrating the structure of SARS-CoV-2 envelope.

FIG. 2 is the S1/S2 domains from SARS-CoV, SARS CoV-2 and MERS-CoV.

FIG. 3 is a diagram illustrating an exemplary alternative COVID-S construct.

FIG. 3 discloses "RRAR" as SEQ ID NO. 43 and "GSAS" as SEQ ID NO. 44.

Sequence listing

The following is a list of the sequences mentioned herein:

SEQ ID NO. 1 is an MMLV-Gag amino acid sequence

SEQ ID NO. 2 is an MMLV-Gag nucleotide sequence

SEQ ID NO. 3 is a codon optimized MMLV-Gag nucleotide sequence

SEQ ID NO. 4 is the amino acid sequence of SARS-CoV-2 spike glycoprotein

SEQ ID NO. 5 is the nucleotide sequence of SARS-CoV-2 spike glycoprotein (Wuhan-Hu-1:Genbank Ref:MN908947)

SEQ ID NO. 6 is a nucleotide sequence of a SARS-CoV-2 spike glycoprotein that is codon optimized for expression in human cells

/>

SEQ ID NO. 7 is the amino acid sequence of SARS-CoV spike glycoprotein (HKU-39849,Genbank Ref:JN854286.1)

SEQ ID NO. 8 is the nucleotide sequence of SARS-CoV spike glycoprotein

/>

/>

SEQ ID NO. 9 is a codon optimized nucleotide sequence for SARS-CoV spike glycoprotein expressed in human cells

/>

/>

SEQ ID NO. 10 is the amino acid sequence of MERS-CoV spike glycoprotein

SEQ ID NO. 11 is the nucleotide sequence of the MERS-CoV spike glycoprotein (EMC/2012,Genbank Ref:JX869059.2)

/>

/>

SEQ ID NO. 12 is a nucleotide sequence of a MERS-CoV spike glycoprotein codon optimized for expression in human cells

/>

/>

SEQ ID NO. 13 is the amino acid sequence of SARS-CoV-2 "proline modified" spike glycoprotein

SEQ ID NO. 14 is the nucleotide sequence of SARS-CoV-2 "proline modified" spike glycoprotein

/>

/>

SEQ ID NO. 15 is a nucleotide sequence of a SARS-CoV-2 "proline modified" spike glycoprotein that is codon optimized for expression in human cells

/>

/>

SEQ ID NO. 16 is the amino acid sequence of SARS-CoV-2 'furin cleavage modified' spike glycoprotein

/>

SEQ ID NO. 17 is the nucleotide sequence of SARS-CoV-2 'furin cleavage modified' spike glycoprotein

/>

/>

SEQ ID NO. 18 is a nucleotide sequence of a modified furin cleavage "spike glycoprotein of SARS-CoV-2" that has been codon optimized for expression in human cells

/>

/>

SEQ ID NO. 19 is the amino acid sequence of SARS-CoV-2' spike glycoprotein modified by proline and furin cleavage

/>

SEQ ID NO. 20 is the nucleotide sequence of SARS-CoV-2' spike glycoprotein modified by proline and furin cleavage

/>

/>

SEQ ID NO. 21 is a nucleotide sequence of a modified "spike glycoprotein" by proline and furin cleavage of SARS-Cov-2 "that is codon optimized for expression in human cells

/>

/>

SEQ ID NO. 22 is the amino acid sequence of the "spike glycoprotein" of SARS-CoV-2 "modified by proline and furin cleavage and exchanged by VSV-G TMCyt

SEQ ID NO. 23 is the nucleotide sequence of the "spike glycoprotein" of SARS CoV-2 "modified by proline and furin cleavage and exchanged by VSV-G TMCyt

/>

/>

SEQ ID NO. 24 is a nucleotide sequence of a "spike glycoprotein" modified by proline and furin cleavage and exchanged by VSV-G TMCyt for SARS CoV-2 "codon optimized for expression in human cells

/>

/>

SEQ ID NO. 25 is the amino acid sequence of SARS-CoV-2 spike glycoprotein with VSV-GTMCyt exchange

SEQ ID NO. 26 is a nucleotide sequence of SARS-CoV-2 spike glycoprotein with VSV-G TMCyt exchange

/>

/>

SEQ ID NO. 27 is a nucleotide sequence of a SARS CoV-2 spike glycoprotein with VSV-G TMCyt exchange that is codon optimized for expression in human cells

/>

/>

Detailed Description

Coronaviruses (e.g., SARS-CoV, MERS-CoV, and SARS-CoV-2) are enveloped viruses that have an RNA genome of about 30,000 bases. They belong to the genus beta of coronaviruses. They comprise a nucleocapsid surrounded by a lipid bilayer derived from a host cell. The envelope-anchored spike protein (referred to as "S") mediates the entry of coronaviruses into host cells by binding to host receptors and then fusing the virus and host membrane. The defined receptor binding domain is a receptor for angiotensin converting enzyme 2 (ACE 2). (Wan et al, J.Vir. (2020) 94:1). The coronavirus S protein contains three copies of the S1 subunit and three copies of the S2 subunit. Coronavirus S proteins are cleaved by furin into S1 and S2 subunits during protein biosynthesis. The two subunits trimerize and fold into a metastable pre-fusion conformation. The S1 subunit is responsible for receptor binding, while the S2 subunit mediates membrane fusion.

SARS-CoV and SARS-CoV-2 spike proteins share about 76% sequence homology, indicating that both viruses share the same receptor ACE2. The sequence similarity between SARS-CoV-2 and MERS-CoV is low.

Studies of the genome of SARS-CoV-2 isolated from patients over a four month span from 12 months 2019 to 3 months 2020 showed that the overall similarity of human strains decreased over the four months, indicating that the mutation of the virus that had occurred in the population was 0.988468 corresponding to an average 348.33 nucleotide difference. Such changes mean evolutionary changes in the virus, which can result in attenuated or more virulent strains (Li et al 2020.Xidan University). Subsequently, the dominant viral variant D614 was exceeded by another variant G614 with a single amino acid change to the spike protein 3 months before 2020, even in the well established region of D614 (Korber et al, (2020) Cell, 4:812-827). Subsequently, at the end of 2020, unexpected increases in the case of COVID-19 were reported due to the appearance of new variants, namely B.1.1.7 in the United kingdom and 501Y.V2 in south Africa (Fontanet al, (2021) the Lancet, 397:952-954). Both variants have mutations in the receptor binding domain of the spike protein (N501Y), which are reported to result in increased transmission, and estimated to range from 40% to 70%.501y.v2 variants have two additional mutations in the spike protein (E484K and K417N) that confer potential immune escape against antibodies. Another variant p.1 with another set of mutations (N501Y, E484K and K417T) was found in brazil, which is worrying.

An important question is whether the currently available covd-19 vaccine is capable of preventing infection or disease from the SARS-CoV-2 variant. Preliminary studies showed that serum from individuals vaccinated with mRNA COVID-19 neutralized pseudoviruses similar to the British variant, but were less effective against pseudoviruses similar to the south Africa variant (Yang et al (2021) Nature, doi. Org/10.1038/s 41586-021-03324-6). Furthermore, preliminary results of studies using viral vector vaccines showed good efficacy against British variants, but poor efficacy against south Africa variants (Madhi et al (2021) N.E.J.M.DOI:10.1056/NEJMoa 2102214). Thus, it has been shown that there is a need for vaccines capable of inducing the production of broadly reactive antibodies to provide protection from infection by coronavirus variant strains comprising multiple mutations.

The inventors herein have prepared a VLP-containing vaccine against the beta coronavirus. VLPs are multiprotein structures typically composed of one or more viral proteins. VLPs mimic the conformation of the virus but without genetic material and are therefore not infectious. Which may be formed (or "self-assembled") upon expression of the viral structural proteins, where appropriate. VLP vaccines overcome some of the disadvantages of more traditional vaccines prepared using attenuated viruses, as they can be produced during the production process without the need for any live virus to be present. A wide variety of VLPs were prepared. For example, VLPs comprising single or multiple capsid proteins with or without envelope proteins and/or surface glycoproteins are prepared. In some cases, VLPs are non-enveloped and assembled by expression of only one major capsid protein. In other cases, VLPs are enveloped and may comprise a variety of antigenic proteins found in the corresponding native viruses. Self-assembly of coated VLPs is more complex than non-coated VLPs because of the complex reactions required to fuse with the host cell membrane (Garrone et al 2011Science Trans.Med.3:1-8) and VLP "budding" to form fully coated individual particles. Thus, self-assembly of the coated VLPs may be unsuccessful and the formation and stability of the coated VLP particles is difficult to predict. The formation of intact VLPs can be determined by imaging the particles using electron microscopy.

VLPs are generally similar to their corresponding native viruses and may be multivalent particle structures. The present disclosure encompasses the following recognition: the presentation of surface glycoproteins in the context of VLPs is advantageous in inducing neutralizing antibodies against such polypeptides compared to other forms of antigen presentation (e.g., soluble antigens not associated with VLPs). Neutralizing antibodies are most commonly classified into tertiary or quaternary structures; this typically requires presentation of the antigen protein, such as an envelope glycoprotein, in its native viral conformation. VLPs present epitopes in a highly structured repetitive array, enabling efficient cross-linking of B cell receptors, enabling activation and expansion of high affinity B cells and subsequent antibody production (Bachmann, 1993). Indeed, VLP expression of B cell antigens increased the neutralization potency by more than 10-fold relative to immunization with the same amount of recombinant protein (kirchmieier, 2014). Thus, the use of VLPs as vaccine forms can expand higher affinity B cell libraries relative to recombinant protein or DNA/mRNA based approaches (the latter approach being used in two widely used covd-19 vaccines).

The VLP of the invention comprises a retroviral vector. Retroviruses are enveloped RNA viruses belonging to the family of retroviruses (Retroviridae). After infection of host cells by retroviruses, RNA is transcribed into DNA by reverse transcriptase. The DNA is then integrated into the genome of the host cell by an integrase and is thereafter replicated as part of the host cell DNA. The retrovirus family includes the following genera: alpha retrovirus (alpha retroviruses), beta retrovirus (beta retroviruses), gamma retrovirus (gamma retroviruses), delta retrovirus (deltaretroviruses), epsilon retrovirus (epsilon retroviruses), lentivirus (lentiviruses), and foamvirus (jumavirus). The host of the retrovirus family is usually a vertebrate. Retroviruses produce infectious virions that contain a spherical nucleocapsid (viral genome complexed with viral structural proteins) surrounded by a lipid bilayer derived from the host cell membrane.

Retroviral vectors can be used to produce VLPs that are devoid of retroviral derived genomes and thus non-replicating. This is achieved by replacing most of the coding region of the retrovirus with the gene or nucleotide sequence to be transferred; thus, the vector cannot produce proteins required for additional rounds of replication. Depending on the nature of the glycoprotein present on the particle surface, VLPs have limited ability to bind to and enter host cells and cannot reproduce. Thus, VLPs can be safely administered as an immunogenic composition (e.g., vaccine).

The present invention uses VLPs comprising one or more retroviral structural proteins. In some embodiments, the structural protein used according to the invention is an alpha retrovirus (e.g., avian leukemia virus), beta retrovirus (mouse mammary tumor virus), gamma retrovirus (murine leukemia virus), delta retrovirus (bovine leukemia virus), epsilon retrovirus (Walley skin sarcoma virus (Walley Dermal Sarcoma Virus)), lentivirus (human immunodeficiency virus 1), or foamy virus (chimpanzee foamy virus (Chimpanzee Foamy Virus)) structural protein. In certain embodiments, the structural polyprotein is a murine leukemia virus (Murine Leukemia Virus, MLV) structural protein. In one embodiment of the invention, the structural protein is Moloney Murine Leukemia Virus (MMLV). The genomes of these retroviruses are readily available in databases.

In some embodiments, the retroviral structural protein used according to the present invention is a Gag polypeptide. The Gag proteins of retroviruses have overall structural similarity and are conserved at the amino acid level among the groups of retroviruses. Retroviral Gag proteins play a major role in viral assembly. Expression of Gag of some viruses (e.g., murine leukemia virus, e.g., MMLV) in some host cells can achieve self-assembly of the expression product into VLPs. The Gag gene expression product in the form of a polyprotein produces the core structural protein of the VLP. Functionally, gag polyproteins are divided into three domains: a membrane binding domain that targets Gag polyprotein to the cell membrane, an interaction domain that promotes Gag polymerization, and a late domain (late domain) that promotes release of the neonatal virion from the host cell. Generally, the form of Gag protein that mediates viral particle assembly is a polyprotein. Retroviral assembly consists of a Gag polyprotein but free of immature capsids of other viral components (such as viral proteases), with Gag as the structural protein of the immature viral particle.

Suitable Gag polypeptides for use in the invention are substantially homologous to known retroviral Gag polypeptides. The MMLV-Gag gene encodes a 65kDa polyprotein precursor that is proteolytically cleaved in the mature virion by MLV protease into 4 structural proteins (matrix (MA), p12, capsid (CA) and Nucleocapsid (NC)). In the absence of MLV protease, the polyprotein remains uncleaved and the resulting particles remain in immature form. The morphology of the immature particles is different from the morphology of the mature particles. In some embodiments of the invention, the Gag sequence does not comprise a gene encoding an MLV protease. The gene encoding MMLV nucleic acid is SEQ ID NO. 2. An exemplary codon optimized sequence for MMLV nucleic acid is provided in SEQ ID NO. 3.

Thus, in some embodiments, gag polypeptides suitable for use in the invention are substantially homologous to the MMLV-Gag polypeptide (SEQ ID NO: 1). In some embodiments, gag polypeptides suitable for use in the present invention have an amino acid sequence that has at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homology to SEQ ID NO. 1. In some embodiments, gag polypeptides suitable for use in the invention are substantially identical or identical to SEQ ID NO. 1.

In some embodiments, a suitable MMLV-Gag polypeptide is encoded by a nucleotide sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% sequence identity to SEQ ID NO. 2. In some embodiments, a suitable MMLV-Gag polypeptide is encoded by a nucleic acid sequence having a degenerate form of SEQ ID NO. 2 or a codon thereof.

As is well known to those skilled in the art, expression of a nucleic acid sequence in a host organism can be improved by replacing the nucleic acid encoding a particular amino acid (i.e., codon) with an additional codon that is better expressed in the host organism. One reason for this effect is due to the fact that different organisms show a preference for different codons. The process of altering nucleic acid sequences based on codon preference to achieve better expression is referred to as codon optimization. Various methods are known in the art to analyze codon usage bias in various organisms, and many computer algorithms have been developed to perform these analyses in the design of codon optimized gene sequences. Thus, in some embodiments, a suitable MMLV-Gag polypeptide is encoded by a codon optimized version of a nucleic acid sequence encoding MMLV-Gag and having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% sequence identity to SEQ ID NO. 3. In some embodiments, a suitable MMLV-Gag polypeptide is encoded by a nucleic acid sequence that is substantially identical or identical to SEQ ID NO. 3.

As is well known in the art, amino acid or nucleic acid sequences can be compared using any of a variety of algorithms, including those available in commercial computer programs, such as BLASTN for nucleotide sequences, and BLASTP, null BLAST, and PSI-BLAST for amino acid sequences. Some examples of such procedures are described below: altschul, et al, 1990, J.mol.biol.,215 (3): 403-410; altschul, et al, 1996,Methods in Enzymology 266:460-480; altschul, et al, 1997Nucleic Acids Res.25:3389-3402; baxevenis, et al, 1998,Bioinformatics:A Practical Guide to the Analysis of Genes and Proteins,Wiley; and Misener, et al, (editions), 1999,Bioinformatics Methods and Protocols (Methods in Molecular Biology, volume 132), humana publications. In addition to identifying homologous sequences, the above procedure generally provides an indication of the degree of homology. In some embodiments, two sequences are considered substantially homologous if at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more of the corresponding residues of the two sequences are homologous over the relevant residue segment. In some embodiments, the relevant segment is a complete sequence. In some embodiments, the relevant stretch is at least 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, or more residues.

Alternatively, the Gag polypeptides used in the present invention may be modified retroviral Gag polypeptides containing one or more amino acid substitutions, deletions and/or insertions as compared to the wild type or naturally occurring Gag polypeptide while retaining substantial self-assembling activity. Typically, in nature Gag proteins contain a large C-terminal extension, which may contain retroviral protease, reverse transcriptase and integrase enzymatic activity. However, assembly of VLPs generally does not require the presence of such components. In some cases, the retroviral Gag proteins alone (e.g., lacking C-terminal extension, lacking one or more of genomic RNA, reverse transcriptase, viral protease, or envelope protein) can self-assemble to form VLPs both in vitro and in vivo (Sharma S et al, 1997, proc. Natl. Acad. Sci. USA 94:10803-8).

The inventors of the present application prepared VLPs expressing β -coronavirus envelope glycoproteins on the surface that could elicit an immune response in a subject. Humoral immune responses are immune responses mediated by antibody molecules. Certain antibodies, known as neutralizing antibodies, protect cells from viral infection and related biological effects by recognizing and binding to specific proteins or antigens expressed by the virus. The envelope proteins of coronaviruses are important targets for the generation of neutralizing antibodies. It is well known to those skilled in the art that retroviral Gag based envelope VLPs can be used to express a variety of envelope glycoproteins for the purpose of eliciting a neutralizing antibody response. More particularly, there is evidence of expression of class I viral fusion proteins (e.g., HIV-1gp120, metapneumovirus (metapneumovirus) and influenza HA) as well as class III fusion proteins (e.g., VSV G protein and CMV gB protein) (Mammano et al, 1997, J. Virol.71:3341-3345; levy et al, 2013,Vaccine 31:2778-2785;Lemaitre et al,2011, clin. Microbiol. Infect.1:732-737;Garrone et al,2011;Kirchmeier et al, 2014, CVI 21:174-180). However, little is known about the expression of coronavirus spike proteins, particularly MLV-derived Gag. In us patent 8,920,812, example 1 describes the inability to express class II virus fusion protein RSV F glycoprotein on the surface of VLPs produced using MLV Gag. The inventors hypothesize that the presence of RSV F glycoprotein interferes with the budding of Gag virus particles through the cell membrane (see column 41, line 50). Thus, retroviral Gag-based enveloped virus-like particles cannot be predicted to be useful for successful expression of coronavirus spike proteins. However, the present inventors have completed several different embodiments of a β coronavirus vaccine comprising one or more spike polypeptide antigens on the surface of VLPs (e.g., from SARS CoV-2, SARS CoV, and MERS-CoV). In some embodiments, the spike polypeptide antigen comprises a modified polypeptide. In some embodiments, the spike polypeptide antigen has more than one genetic modification.

In some embodiments, the VLP of the invention comprises a fusion protein of a spike polypeptide from a beta coronavirus (e.g., all or part of an extracellular portion of a beta coronavirus spike polypeptide) with a transmembrane domain and/or a cytoplasmic domain not found in a beta coronavirus protein in nature (e.g., from another virus). In some embodiments, the fusion protein comprises a spike polypeptide from a beta coronavirus (e.g., all or part of the extracellular portion of the spike polypeptide) and a transmembrane domain and/or cytoplasmic domain found in glycoprotein G from VSV, referred to as VSV-G in nature. The nucleotide and amino acid sequences of VSV-G proteins are known in the art.

The transmembrane domain of VSV-G can function to target viral glycoproteins to the cell membrane (Compton Tet al.,1989,Proc Natl Acad Sci USA86:4112-4116). Exchange of the transmembrane and cytoplasmic domains of VSV-G for those of another protein has been used to increase the yield of the protein of interest in VLP production and to increase immunogenicity in neutralizing antibody responses (Garrone et al 2011). Such modification successfully improved the yield and activity of VLPs expressing HCV-E1 protein (Garrone et al 2011) and CMV-gB protein (Kircheier et al 2014). However, when used with certain viral antigens, this modification is also associated with a significant loss of immunogenicity. In addition, after replacing the transmembrane/cytoplasmic domains of the antigenic glycoproteins with the transmembrane/cytoplasmic domains from VSV, the expression of some glycoproteins is reduced. For example, loss of glycoprotein in SARS virus is reported (Broer et al, 2006, J.Vir.80, 1302-1310). In RSV, a significant loss of immunogenicity is observed when the antigenic surface protein is modified to replace the transmembrane component with a sequence from VSV (see example 6).

In some embodiments, the immunogenic compositions of the invention comprise VLPs containing wild-type spike polypeptides from SARS-CoV-2, the sequences of which are SEQ ID NO. 4 or a degenerate form of the codons of SEQ ID NO. 4. The nucleic acid encoding the polypeptide is shown in SEQ ID NO. 5. The codon-optimized version of SEQ ID No. 5 is shown in SEQ ID No. 6. In some embodiments, the invention includes an immunogenic composition comprising a VLP comprising a polypeptide having an amino acid sequence with at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homology to SEQ ID No. 4. In some embodiments, the invention includes an immunogenic composition comprising a VLP comprising a polypeptide having an amino acid sequence that is SEQ ID NO. 4 or a degenerate form of the codon of SEQ ID NO. 4. In some embodiments, the polypeptide is encoded by a nucleic acid sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homology to SEQ ID NO. 5. In some embodiments, the polypeptide is encoded by a codon-optimized version of the nucleic acid sequence of SEQ ID NO. 5 that has at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homology to SEQ ID NO. 6. In some embodiments, the polypeptide is encoded by a nucleic acid sequence having SEQ ID NO. 6.

In some embodiments, the immunogenic compositions of the invention comprise VLPs containing modified spike polypeptides from SARS-CoV-2 that have been modified to have transmembrane and cytoplasmic segments replaced by corresponding segments from VSV, the sequence of the modified spike polypeptide being SEQ ID NO:26 or a codon degenerate version of SEQ ID NO: 26. The nucleic acid encoding the polypeptide is shown in SEQ ID NO. 25. In some embodiments, the invention includes an immunogenic composition comprising a VLP comprising a polypeptide having an amino acid sequence with at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homology to SEQ ID No. 25. In some embodiments, the invention includes an immunogenic composition comprising a VLP comprising a polypeptide having an amino acid sequence that is SEQ ID NO. 25 or a degenerate form of the codon of SEQ ID NO. 25. In some embodiments, the polypeptide is encoded by a nucleic acid sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homology to SEQ ID NO. 26. In some embodiments, the mutated polypeptide is encoded by a nucleic acid sequence having SEQ ID NO. 26. In some embodiments, the polypeptide is encoded by a codon-optimized version of the nucleic acid sequence of SEQ ID NO. 26 that has at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homology to SEQ ID NO. 27.

In some embodiments, the immunogenic compositions of the invention comprise VLPs containing wild-type spike polypeptides from SARS-CoV, the sequences of which are SEQ ID NO. 7 or a degenerate form of the codons of SEQ ID NO. 7. The nucleic acid encoding the polypeptide is shown in SEQ ID NO. 8. The codon-optimized version of SEQ ID NO. 8 is shown as SEQ ID NO. 9. In some embodiments, the invention includes an immunogenic composition comprising a VLP comprising a polypeptide having an amino acid sequence with at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homology to SEQ ID No. 7. In some embodiments, the invention includes an immunogenic composition comprising a VLP comprising a polypeptide having an amino acid sequence that is SEQ ID NO. 7 or a degenerate form of the codon of SEQ ID NO. 7. In some embodiments, the polypeptide is encoded by a nucleic acid sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homology to SEQ ID NO. 8. In some embodiments, the polypeptide is encoded by a codon-optimized version of the nucleic acid sequence of SEQ ID NO. 8 that has at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homology to SEQ ID NO. 9. In some embodiments, the polypeptide is encoded by a nucleic acid sequence having SEQ ID NO. 9.

In some embodiments, the immunogenic compositions of the invention comprise VLPs containing wild-type spike polypeptides from MERS-CoV, the sequences of which are SEQ ID NO. 10 or a degenerate form of the codons of SEQ ID NO. 10. The nucleic acid encoding the polypeptide is shown in SEQ ID NO. 11. The codon-optimized version of SEQ ID NO. 11 is shown as SEQ ID NO. 12. In some embodiments, the invention includes an immunogenic composition comprising a VLP comprising a polypeptide having an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homologous to SEQ ID No. 10. In some embodiments, the invention includes an immunogenic composition comprising a VLP comprising a polypeptide having an amino acid sequence that is SEQ ID NO. 10 or a degenerate form of the codon of SEQ ID NO. 10. In some embodiments, the polypeptide is encoded by a nucleic acid sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homology to SEQ ID NO. 11. In some embodiments, the polypeptide is encoded by a codon-optimized version of the nucleic acid sequence of SEQ ID NO. 11 that has at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homology to SEQ ID NO. 12. In some embodiments, the polypeptide is encoded by a nucleic acid sequence having SEQ ID NO. 12.

In some embodiments, the immunogenic compositions of the invention comprise VLPs comprising variants of β coronavirus spike glycoprotein. In some embodiments, the variant spike glycoprotein has been modified to delete a furin cleavage site from the spike polypeptide. In some embodiments, the spike glycoprotein has been modified to have a lysine residue (986) and a valine (987) residue replaced with a proline residue. In some embodiments, the spike glycoprotein has been modified to lack a furin cleavage site and has a lysine (986) residue and a valine (987) residue replaced with a proline residue. Each such modification is described further below.

Coronavirus spike proteins are known to contain sites at which protease (furin) cleaves the S polypeptide into the S1 and S2 subunits during the virion maturation process. A modified spike protein construct is produced in which the amino acid sequence is modified to remove the furin cleavage site, thereby retaining the spike polypeptide in its immature form. A mutant form of the furin cleavage site that does not undergo normal cleavage and maturation of the spike protein would likely exhibit enhanced cellular receptor binding and cellular entry, suggesting that immunization against this structure may achieve humoral immunity with greater neutralizing activity.

In some embodiments, the immunogenic composition of the invention comprises a VLP comprising a modified SARS-CoV-2 spike polypeptide having a mutated furin cleavage site compared to a wild-type or naturally-occurring SARS-CoV-2 spike polypeptide. The sequence of an exemplary modified SARS-CoV-2 polypeptide is depicted by SEQ ID NO. 16. In some embodiments, the invention includes an immunogenic composition comprising a VLP comprising a polypeptide having an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homologous to SEQ ID No. 16. In some embodiments, the invention includes an immunogenic composition comprising a VLP comprising a polypeptide having an amino acid sequence that is SEQ ID NO. 16 or a degenerate form of the codon of SEQ ID NO. 16. In some embodiments, the modified polypeptide is encoded by a nucleic acid sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homology to SEQ ID NO. 17. In some embodiments, the modified polypeptide is encoded by a codon-optimized version of the nucleic acid sequence of SEQ ID NO. 17 that has at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homology to SEQ ID NO. 18. In some embodiments, the mutated polypeptide is encoded by a nucleic acid sequence having SEQ ID NO. 18.

From previous studies of SARS-CoV and MERS-CoV, it is known that substitution of two amino acid residues with a proline residue stabilizes the S2 subunit in its pre-fusion conformation (Pallesen et al, 2017PNAS.114:35;Wrapp et al (2020) Science: 367:1260-1263). Thus, such mutations may be able to enhance the immune response to coronaviruses. Thus, SARS-CoV-2 polypeptide constructs have been prepared that have been modified to have a lysine (986) residue and a valine (987) residue replaced with a proline residue. In some embodiments, the immunogenic composition of the invention comprises a VLP comprising a SARS-CoV-2 polypeptide that has been modified to have a lysine (986) residue and a valine (987) residue replaced with a proline residue as compared to a wild-type or naturally occurring SARS-CoV-2 polypeptide. The sequence of an exemplary modified polypeptide is shown in SEQ ID NO. 13. In some embodiments, the invention includes an immunogenic composition comprising a VLP comprising a polypeptide having an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homologous to SEQ ID No. 13. In some embodiments, the invention includes an immunogenic composition comprising a VLP comprising a polypeptide having an amino acid sequence that is SEQ ID NO. 13 or a degenerate form of the codons of SEQ ID NO. 13. In some embodiments, the modified polypeptide is encoded by a nucleic acid sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homology to SEQ ID NO. 14. In some embodiments, the modified polypeptide is encoded by a codon-optimized version of the nucleic acid sequence of SEQ ID NO. 14 that has at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homology to SEQ ID NO. 15. In some embodiments, the modified polypeptide is encoded by a nucleic acid sequence having SEQ ID NO. 15.

In another variant, a SARS-CoV-2 polypeptide construct was prepared that had been modified to have a lysine (986) residue and a valine (987) residue replaced with a proline residue, and that had been further modified to remove the furin cleavage site. In some embodiments, the immunogenic composition of the invention comprises a VLP comprising a SARS-CoV-2 polypeptide that has been modified to have a lysine (986) residue and a valine (987) residue replaced with a proline residue and a furin cleavage site removed as compared to a wild-type or naturally occurring SARS-CoV-2 polypeptide. The sequence of an exemplary modified polypeptide is shown in SEQ ID NO. 19. In some embodiments, the invention includes an immunogenic composition comprising a VLP comprising a polypeptide having an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homologous to SEQ ID No. 19. In some embodiments, the invention includes an immunogenic composition comprising a VLP comprising a polypeptide having an amino acid sequence that is SEQ ID NO. 19 or a degenerate form of the codon of SEQ ID NO. 19. In some embodiments, the modified polypeptide is encoded by a nucleic acid sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homology to SEQ ID NO. 20. In some embodiments, the modified polypeptide is encoded by a codon-optimized version of the nucleic acid sequence of SEQ ID NO. 20 that has at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homology to SEQ ID NO. 21. In some embodiments, the modified polypeptide is encoded by a nucleic acid sequence having SEQ ID NO. 21.

In some embodiments, the VLPs described herein comprise a fusion protein comprising an extracellular domain of a coronavirus spike polypeptide (or a portion thereof), and a transmembrane domain and cytoplasmic tail of an envelope protein from a VSV. In some embodiments, the immunogenic composition of the invention comprises a VLP comprising a coronavirus spike polypeptide modified to have the transmembrane domain and cytoplasmic tail replaced by a transmembrane domain and cytoplasmic tail from a VSV. Any of the coronavirus spike proteins described herein may be modified such that the transmembrane domain and cytoplasmic tail are replaced with the transmembrane domain and cytoplasmic tail from VSV.

In a specific embodiment, the present inventors constructed a SARS-CoV-2 spike protein in which the protein has been modified such that the transmembrane domain and cytoplasmic tail are replaced by a transmembrane domain and cytoplasmic tail from VSV, lysine (986) residues and valine (987) residues are replaced with proline residues, and the furin cleavage site is removed. Such triple-modified SARS-CoV-2 proteins comprise a biproline mutation intended to enhance stability and a mutated furin cleavage site associated with enhanced receptor binding. Furthermore, the triple-modified SARS-CoV-2 protein comprises a transmembrane domain and cytoplasmic tail from VSV, which is associated with improved expression on VLP envelopes. The sequence of such a triple modified coronavirus spike polypeptide is shown in SEQ ID NO. 22 (wherein the portion from the VSV is shown above in bold text at the end of the sequence). In some embodiments, the invention includes an immunogenic composition comprising a VLP comprising a polypeptide having an amino acid sequence with at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homology to SEQ ID No. 22. In some embodiments, the modified polypeptide is encoded by a nucleic acid sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homology to SEQ ID NO. 23. In some embodiments, the modified polypeptide is encoded by a codon-optimized version of the nucleic acid sequence of SEQ ID NO. 23 that has at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homology to SEQ ID NO. 23. In some embodiments, the modified polypeptide is encoded by a nucleic acid sequence having SEQ ID NO. 24.

The antigen mixture can induce a broad range of reactive immunity, and thus, a combination of coronavirus antigens can be used to enhance the breadth of the immune response. VLPs can be used to express two (bivalent) or three (trivalent) viral antigens in their native conformation, thereby inducing an effective B cell response. Previous studies using the zika virus epitope showed that the immune response generated by the combination of two antigens on bivalent VLPs alone was significantly more effective than two monovalent VLPs expressing the same antigen (us patent 8920812).

Thus, the VLPs of the disclosure include bivalent VLPs comprising two wild-type coronavirus spike proteins, two modified coronavirus spike proteins described herein, or any combination of wild-type coronavirus spike proteins and modified coronavirus spike proteins described herein. The VLPs of the disclosure also include trivalent VLPs comprising three wild-type coronavirus spike proteins, three modified coronavirus spike proteins described herein, or any combination of wild-type coronavirus spike proteins and modified coronavirus spike proteins described herein. One or more of any wild-type or modified spike proteins expressed on the bivalent or trivalent VLP may also be modified such that the transmembrane domain and cytoplasmic tail are replaced by the transmembrane domain and cytoplasmic tail from the VSV.

In a preferred embodiment, the VLP of the present disclosure is a trivalent VLP comprising spike protein from SARS-CoV-2, spike protein from SARS-CoV and spike protein from MERS-CoV. One or more of the spike proteins may be modified such that the transmembrane domain and cytoplasmic tail are replaced with the transmembrane domain and cytoplasmic tail from VSV.

In some embodiments, the immunogenic composition of the invention comprises a trivalent VLP comprising: wild-type spike polypeptide from SARS-CoV-2, whose sequence is SEQ ID NO. 4 or a degenerate form of the codon of SEQ ID NO. 4; spike polypeptide from SARS-CoV, whose sequence is SEQ ID NO. 7 or a degenerate form of the codon of SEQ ID NO. 7; and spike polypeptide from MERS whose sequence is SEQ ID No. 10 or a degenerate form of the codon of SEQ ID No. 10. The nucleic acid encoding the SARS-CoV-2 polypeptide is shown as SEQ ID NO. 5. The codon-optimized version of SEQ ID No. 5 is shown in SEQ ID No. 6. The nucleic acid encoding the SARS-CoV polypeptide is shown as SEQ ID NO. 8. The codon-optimized version of SEQ ID NO. 8 is shown as SEQ ID NO. 9. The nucleic acid encoding the MERS polypeptide is shown in SEQ ID NO. 11. The codon-optimized version of SEQ ID NO. 11 is shown as SEQ ID NO. 12. In some embodiments, the invention includes an immunogenic composition comprising a VLP comprising a polypeptide having the amino acid sequence: at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homology to SEQ ID NO. 4, at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homology to SEQ ID NO. 7, and at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homology to SEQ ID NO. 10. In some embodiments, the SARS-CoV-2 polypeptide is encoded by a nucleic acid sequence that has at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homology to SEQ ID NO. 5. In some embodiments, the polypeptide is encoded by a codon-optimized version of the nucleic acid sequence of SEQ ID NO. 5 that has at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homology to SEQ ID NO. 6. In some embodiments, the polypeptide is encoded by a nucleic acid sequence having SEQ ID NO. 6. In some embodiments, the SAR-CoV polypeptide is encoded by a nucleic acid sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homology to SEQ ID NO. 8. In some embodiments, the polypeptide is encoded by a codon-optimized version of the nucleic acid sequence of SEQ ID NO. 8 that has at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homology to SEQ ID NO. 9. In some embodiments, the polypeptide is encoded by a nucleic acid sequence having SEQ ID NO. 9. In some embodiments, MERS polypeptides are encoded by nucleic acid sequences having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homology to SEQ ID No. 11. In some embodiments, the polypeptide is encoded by a codon-optimized version of the nucleic acid sequence of SEQ ID NO. 11 that has at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homology to SEQ ID NO. 12. In some embodiments, the polypeptide is encoded by a nucleic acid sequence having SEQ ID NO. 12.

In some embodiments, the immunogenic composition of the invention comprises a trivalent VLP comprising: a modified spike polypeptide from SARS-CoV-2, the sequence of which is SEQ ID NO. 22 or a degenerate form of the codon of SEQ ID NO. 22; spike polypeptide from SARS-CoV, whose sequence is SEQ ID NO. 7 or a degenerate form of the codon of SEQ ID NO. 7; and spike polypeptide from MERS whose sequence is SEQ ID No. 10 or a degenerate form of the codon of SEQ ID No. 10. The nucleic acid encoding the SARS-CoV-2 polypeptide is shown as SEQ ID NO. 5. The codon-optimized version of SEQ ID No. 5 is shown in SEQ ID No. 6. The nucleic acid encoding the SARS-CoV polypeptide is shown as SEQ ID NO. 8. The codon-optimized version of SEQ ID NO. 8 is shown as SEQ ID NO. 9. The nucleic acid encoding the MERS polypeptide is shown in SEQ ID NO. 11. The codon-optimized version of SEQ ID NO. 11 is shown as SEQ ID NO. 12. In some embodiments, the invention includes an immunogenic composition comprising a VLP comprising a polypeptide having the amino acid sequence: at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homology to SEQ ID NO. 22, at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homology to SEQ ID NO. 7, and at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homology to SEQ ID NO. 10. In some embodiments, the SARS-CoV-2 polypeptide is encoded by a nucleic acid sequence that has at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homology to SEQ ID NO. 23. In some embodiments, the polypeptide is encoded by a codon-optimized version of the nucleic acid sequence of SEQ ID NO. 23 that has at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homology to SEQ ID NO. 24. In some embodiments, the polypeptide is encoded by a nucleic acid sequence having SEQ ID NO. 24. In some embodiments, the SAR-CoV polypeptide is encoded by a nucleic acid sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homology to SEQ ID NO. 8. In some embodiments, the polypeptide is encoded by a codon-optimized version of the nucleic acid sequence of SEQ ID NO. 8 that has at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homology to SEQ ID NO. 9. In some embodiments, the polypeptide is encoded by a nucleic acid sequence having SEQ ID NO. 9. In some embodiments, MERS polypeptides are encoded by nucleic acid sequences having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homology to SEQ ID No. 11. In some embodiments, the polypeptide is encoded by a codon-optimized version of the nucleic acid sequence of SEQ ID NO. 11 that has at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homology to SEQ ID NO. 12. In some embodiments, the polypeptide is encoded by a nucleic acid sequence having SEQ ID NO. 12.

As can be seen in the examples, the VLPs of the invention are capable of eliciting a strong immune response against SARS-CoV-2. In particular, each of the modified thorn mutants described herein is effective in inducing a strong immune response (see example 5). The trivalent VLPs of the invention (see example 6) induce antibody responses against SARS-Cov-2, SARS-Cov and MERS. Furthermore, immunization with the trivalent VLPs of the invention induced antibodies recognizing the relevant seasonal human coronavirus OC43 not contained in the vaccine, indicating that the trivalent VLPs have the ability to amplify immunity against coronaviruses. Unexpectedly, trivalent VLPs are enriched for induction of antibodies with functional neutralizing activity relative to immunization with monovalent VLPs. This enrichment of neutralizing antibodies is shown in table 8, table 8 showing the ratio of endpoint neutralizing antibody titers to endpoint antibody binding titers using serum obtained from vaccinated mice.

Monovalent VLPs expressing triple modified SARS-CoV-2 spike proteins provided significant protection against SARS-CoV-2 infection as demonstrated by the challenge study in golden hamsters (golden hamster) (example 7). As shown in example 7, hamsters vaccinated with VLPs have significantly lower viral RNA levels and improved clinical performance as shown by body weight. Furthermore, immunized hamsters were able to generate a stronger cytokine response than non-vaccinated hamsters.

The VLPs of the invention demonstrate that a broad immune response is effective against variants of SARS-CoV-2. As described in example 9, trivalent VLPs expressing triple modified SARS-CoV-2 spike protein, natural MERS spike protein and natural SARS-CoV protein, and monovalent VLPs expressing triple modified SARS-CoV-2 spike protein were evaluated for their ability to induce antibodies to 501y.v2 (south africa) variants of SARS-CoV-2 in mice. Unexpectedly, both trivalent and monovalent constructs raised antibodies against the 501y.v2 variant. Even more surprising is the fact that: antibody titers against the 501Y.V2 strain of SARS-CoV-2 and the original L strain were similar. Thus, both trivalent and monovalent VLPs expressing triple modified SARS-CoV-2 spike proteins were unexpectedly effective in inducing an effective antibody response to SARS-CoV-2 variants that have been shown to escape significantly from other covd-19 vaccines.

The VLPs of the invention also have an effect on the nature of the antibody response. As shown in example 10, mice vaccinated with monovalent VLPs of the invention expressing wild-type SARS-CoV-2 spike protein produced higher amounts of IgG2b than mice vaccinated with recombinant spike protein. Higher IgG2b correlates with TH1 immune responses and can achieve higher cell-mediated immune levels. Thus, presentation of spike proteins on VLPs achieves a response associated with cell-mediated immunity.

It will be appreciated that a composition comprising VLPs will typically comprise a mixture of VLPs having a range of sizes. It should be understood that the diameter values listed below correspond to the most common diameters in the mixture. In some embodiments, >90% of the vesicles in the composition will have diameters within 50% of the most common value (e.g., 1000±500 nm). In some embodiments, the distribution may be narrower, e.g., >90% of the vesicles in the composition may be within 40%, 30%, 20%, 10% or 5% of the most common value. In some embodiments, sonication or ultrasound treatment may be used to promote VLP formation and/or alter VLP size. In some embodiments, filtration, dialysis, and/or centrifugation can be used to modulate VLP size distribution.

In general, VLPs produced according to the methods of the present disclosure may be of any size. In certain embodiments, the composition may comprise VLPs having a diameter of about 20nm to about 300 nm. In some embodiments, the VLP is characterized by a diameter that is within a range bounded by a lower limit of 20, 30, 40, 50, 60, 70, 80, 90, or 100nm and bounded by an upper limit of 300, 290, 280, 270, 260, 250, 240, 230, 220, 210, 200, 190, 180, or 170 nm. In some embodiments, VLPs within a population exhibit an average diameter within a range bounded by a lower limit of 20, 30, 40, 50, 60, 70, 80, 90, or 100nm and bounded by an upper limit of 300, 290, 280, 270, 260, 250, 240, 230, 220, 210, 200, 190, 180, or 170 nm. In some embodiments, the polydispersity index of VLPs in a population is less than 0.5 (e.g., less than 0.45, less than 0.4, or less than 0.3). In some embodiments, VLP diameter is determined by nanosize. In some embodiments, the VLP diameter is determined by electron microscopy.

VLPs according to the invention may be prepared according to general methods known to the skilled person. For example, nucleic acid molecules, recombinant vectors or plasmids may be prepared using sequences known in the art. Such sequences can be obtained from libraries, and the material can be obtained from various collections (collections), published plasmids, and the like. These components may be isolated and manipulated using techniques known to the skilled artisan or available in the art. Various synthetic or artificial sequences can also be generated by computer analysis or by (high throughput) screening of libraries. Recombinant expression of polypeptides of VLPs requires construction of an expression vector comprising a polynucleotide encoding one or more polypeptides. Once a polynucleotide encoding one or more polypeptides is obtained, vectors for producing the polypeptides can be generated by recombinant DNA techniques using techniques known in the art. Expression vectors that may be used in accordance with the present invention include, but are not limited to, mammalian and avian expression vectors, baculovirus expression vectors, plant expression vectors (e.g., cauliflower mosaic virus (Cauliflower Mosaic Virus, caMV), tobacco mosaic virus (Tobacco Mosaic Virus, TMV)), plasmid expression vectors (e.g., ti plasmid), and the like.

VLPs of the invention may be produced in any available protein expression system. Typically, the expression vector is transferred to a host cell by conventional techniques and the transfected cells are then cultured by conventional techniques to produce VLPs. In some embodiments, transiently transfected cells are used to produce VLPs. In some embodiments, VLPs are produced using stably transfected cells. Typical cell lines that may be used for VLP production include, but are not limited to, mammalian cell lines such as human embryonic kidney (human embryonic kidney, HEK) 293, WI 38, chinese hamster ovary (Chinese hamster ovary, CHO), monkey kidney (COS), HT1080, C10, heLa, baby hamster kidney (baby hamster kidney, BHK), 3T3, C127, CV-1, haK, NS/O, and L-929 cells. Some specific non-limiting examples include, but are not limited to, the BALB/c mouse myeloma line (NSO/l, ECACC No: 8510503), human retinoblastoma (per.c6 (CruCell, leiden, the Netherlands)), monkey kidney CV1 line transformed by SV40 (COS-7, ATCC CRL 1651), human embryonic kidney line (293 cells for subcloning grown in suspension culture, graham et al, j.gen virol, 36:59 (1977)), baby hamster kidney cells (BHK, ATCC CCL 10), chinese hamster ovary cells +/-DHFR (CHO, urlaub and Chasin, proc.Natl.Acad.sci.usa,77:4216 (1980)), mouse sertoli cells (mouse sertoli cell) (TM 4, mather, biol.reprod.,23:243-251 (1980)), monkey kidney cells (CV 1 ATCC CCL 70), african green monkey kidney cells (VERO-76, ATCC CRL-1 587), human cervical cancer cells (HeLa, ATCC CCL 2), canine kidney cells (MDCK, ATCC CCL 34), buffalo rat liver cells (buffalo rat liver cell) (BRL 3A, ATCC CRL 1442), human lung cells (W138, ATCC CCL 75), human liver cells (HepG 2, HB 8065), mouse mammary tumors (MMT 060562,ATCC CCL51), TRI cells (Mather et al, annals NY Acad. Sci.,383, 1982)), MRC 5 cells, FS4 cells, and human liver cancer cell lines (Hep G2). In some embodiments, cell lines useful for VLP production include insect cells (e.g., sf-9, sf-21, tn-368, hi 5) or plant (e.g., leguminosae (leguminosae), cereal, or tobacco) cells. It will be appreciated that in some embodiments, particularly when glycosylation is important for protein function, mammalian cells are preferred for protein expression and/or VLP production (see, e.g., roldao a et al, 2010Expt Rev Vaccines 9:1149-76).

It will be appreciated that cell lines may be selected that either regulate expression of the inserted sequences or modify and process the gene product in a specific manner. Such modification (e.g., glycosylation) and processing (e.g., cleavage or transport to a membrane) of the protein product may be important for the production of VLPs or the function of VLP polypeptides or additional polypeptides (e.g., adjuvants or additional antigens). Different cells have unique and specific mechanisms for post-translational processing and modification of proteins and gene products. An appropriate cell line or host system may be selected to ensure proper modification and processing of the expressed foreign protein. In general, eukaryotic host cells (also known as packaging cells (e.g., 293T human embryonic kidney cells)) having appropriate cellular mechanisms for proper processing of primary transcripts, glycosylation and phosphorylation of gene products can be used in accordance with the present invention.

VLPs can be purified according to known techniques, such as centrifugation, gradient, sucrose gradient ultracentrifugation, tangential flow filtration and chromatography (e.g., ion exchange (anion and cation) chromatography, affinity chromatography and size column chromatography), or differential solubility, among others. Alternatively or additionally, the cell supernatant may be used directly without a purification step. Additional entities (e.g., additional antigens or adjuvants) may be added to the purified VLPs.

According to the invention, cells may be transfected with a single expression vector. In some embodiments, a single expression vector encodes more than one component of a VLP (e.g., more than one structural polyprotein, coronavirus spike protein, etc.). For example, in some embodiments, a single expression vector encodes two or more components of a VLP. In some embodiments, a single expression vector encodes three or more components of a VLP. In one embodiment of the invention, a single expression vector encodes both the Gag polypeptide and the coronavirus spike glycoprotein.

In some embodiments, the cells are transfected with two or more expression vectors. For example, in some embodiments, cells are transfected with a first vector encoding a Gag polypeptide and a second vector encoding a coronavirus spike glycoprotein, and "monovalent" VLPs comprising coronavirus spike glycoproteins are produced. In some embodiments, the cell is transfected with a first vector encoding a Gag polypeptide, a second vector encoding a coronavirus spike glycoprotein, and a third vector encoding another coronavirus spike glycoprotein. In some such embodiments, a "bivalent" VLP is produced comprising two coronavirus spike glycoproteins. In some embodiments, the cell is transfected with a first vector encoding a Gag polypeptide, a second vector encoding a coronavirus spike glycoprotein, and a third vector encoding both coronavirus spike glycoproteins. In some such embodiments, a "trivalent" VLP comprising three coronavirus spike glycoproteins is produced.

As further demonstrated in the examples, modification of SARS-CoV-2 spike protein has a significant impact on VLP yield. Referring to table 1 in example 3, VLPs expressing triple modified SARS-CoV-2 spike protein (group 3) showed significantly higher spike protein yields than other monovalent VLPs expressing SARS-CoV-2 spike protein. Thus, this embodiment of VLP can be prepared in higher volumes, which is important to address the need in a pandemic situation.

In some embodiments, monovalent VLPs, divalent VLPs, or trivalent VLPs are mixed. For example, in some embodiments, monovalent VLPs and divalent VLPs are mixed to form a trivalent VLP mixture. In some embodiments, two monovalent VLPs are mixed to form a bivalent VLP mixture.

The present invention provides pharmaceutical compositions comprising VLPs described herein and optionally further comprising glycoproteins and glycoprotein variants described herein. In some embodiments, the invention provides VLPs and at least one pharmaceutically acceptable excipient, adjuvant and/or carrier. Such pharmaceutical compositions may optionally comprise and/or be administered in combination with one or more additional therapeutically active substances. The provided pharmaceutical compositions are useful as prophylactic agents (i.e., vaccines) in the prevention of SARS, MERS, or covd-19 infection or the prevention of adverse effects (ramifications) associated with or associated with SARS, MERS, or covd-19 infection. The provided pharmaceutical compositions may also be used as prophylactic agents against certain SARS-CoV-2 variants. In some embodiments, the pharmaceutical composition is formulated for administration to a human.

The pharmaceutical compositions provided herein may be provided in a sterile injectable form (e.g., a form suitable for subcutaneous or intravenous infusion). For example, in some embodiments, the pharmaceutical composition is provided in a liquid dosage form suitable for injection. In some embodiments, the pharmaceutical composition is provided as a powder (e.g., lyophilized and/or sterilized), optionally under vacuum, that is reconstituted with an aqueous diluent (e.g., water, buffer, saline solution, etc.) prior to injection. In some embodiments, the pharmaceutical composition is diluted and/or reconstituted in water, sodium chloride solution, sodium acetate solution, benzyl alcohol solution, phosphate buffered saline, and the like. In some embodiments, the powder should be gently mixed with the aqueous diluent (e.g., without shaking).

In some embodiments, provided pharmaceutical compositions comprise one or more pharmaceutically acceptable excipients (e.g., preservatives, inert diluents, dispersants, surfactants and/or emulsifiers, buffers, etc.). Suitable excipients include, for example, water, saline, dextrose, sucrose, trehalose, glycerol, ethanol, or the like, and combinations thereof. Remington's The Science and Practice of Pharmacy, 21 st edition, a.r. gennaro, (Lippincott, williams & Wilkins, baltimore, MD, 2006) discloses a variety of excipients for formulating pharmaceutical compositions and known techniques for preparing the same. Unless any conventional excipient medium is incompatible with the substance or derivative thereof, e.g., by producing any undesirable biological effect or otherwise interacting in a deleterious manner with any of the other components of the pharmaceutical composition, its use is contemplated as falling within the scope of the present invention. In some embodiments, the pharmaceutical composition comprises one or more preservatives. In some embodiments, the pharmaceutical composition does not comprise a preservative.

In some embodiments, the pharmaceutical composition is sufficiently immunogenic as a vaccine (e.g., in the absence of an adjuvant). In some embodiments, the immunogenicity of the pharmaceutical composition is enhanced by the inclusion of an adjuvant. Any adjuvant may be used according to the present invention. A large number of adjuvants are known; the available schema for many of these compounds is compiled by the national institutes of health (National Institutes of Health) and can be found (www.niaid.nih.gov/dates/vaccine/pdf/comp. See also Allison,1998, dev. Biol. Stand.,92:3-11; unkeless et al, 1998, annu. Rev. Immunol.,6:251-281; and Phillips et al, 1992, vaccine,10:151-158. Hundreds of different adjuvants are known in the art and can be used in the practice of the present invention. Some exemplary adjuvants that may be used according to the present invention include, but are not limited to: cytokines, gel-type adjuvants (e.g., aluminum hydroxide, aluminum phosphate, calcium phosphate, etc.), microbial adjuvants (e.g., immunomodulatory DNA sequences comprising CpG motifs), endotoxins (e.g., monophosphoryl lipid a), exotoxins (e.g., cholera toxin, escherichia coli (e.coli) thermolabile toxin and pertussis toxin), muramyl dipeptide, etc.), oil emulsion and emulsifier-based adjuvants (e.g., freund's Adjuvant), MF59[ Novartis ], SAF, etc.), particulate adjuvants (e.g., liposomes, biodegradable microspheres, saponins, etc.), synthetic adjuvants (e.g., nonionic block copolymers, muramyl peptide analogues, polyphosphazenes, synthetic polynucleotides, etc.), and/or combinations thereof. Other exemplary adjuvants include some polymers (e.g., polyphosphazenes; described in U.S. patent 5,500,161, Q57, QS21, squalene, tetrachlorodecaoxide, etc.).

In some embodiments, the pharmaceutical composition is provided in a form that can be refrigerated and/or frozen. In some embodiments, the pharmaceutical composition is provided in a form that is not refrigerated and/or frozen. In some embodiments, the reconstituted solution and/or liquid dosage form may be stored for a period of time (e.g., 2 hours, 12 hours, 24 hours, 2 days, 5 days, 7 days, 10 days, 2 weeks, one month, two months, or more) after reconstitution. In some embodiments, the storage time of the VLP formulation is longer than the specified time resulting in degradation of the VLP.

Pharmaceutical compositions according to the present invention may be prepared, packaged and/or sold as single unit doses and/or as a plurality of single unit doses. As used herein, a "unit dose" is a discrete amount of a pharmaceutical composition comprising a predetermined amount of an active ingredient. The amount of active ingredient is typically equal to the dose to be administered to the subject and/or a convenient fraction of such dose, e.g., half or one third of such dose.

The relative amounts of the active ingredient, pharmaceutically acceptable excipients and/or any additional ingredients in the pharmaceutical composition according to the invention may vary depending on the identity, size and/or condition of the subject and/or depending on the route of administration of the composition to be administered. For example, the composition may comprise from 0.1% to 100% (w/w) of the active ingredient.

The compositions and methods provided by the present disclosure are useful for preventing and/or treating SARS, MERS, or covd-19 infection in subjects, including adults and children. However, in general, they can be used with any animal. The methods herein may also be used with farm animals, such as sheep, birds, cattle, pigs and equine breeds, if desired. For the purposes of the present disclosure, vaccination may be administered before, during, and/or after exposure to a pathogenic agent, and in certain embodiments before, during, and/or shortly after exposure to the agent. In some embodiments, vaccination comprises multiple administrations of the vaccination composition at appropriate intervals in time.

The compositions described herein are generally administered in such amounts and for such times as are required or sufficient to induce an immune response. The dosing regimen may consist of a single dose or multiple doses over a period of time. The exact amount of the immunogenic composition (e.g., VLP) to be administered may vary from subject to subject and may depend on several factors. It will thus be appreciated that the precise dosage typically employed will depend not only on the weight of the subject and the route of administration, but also on the age of the subject. In certain embodiments, a particular amount of the VLP composition is administered in a single dose. In certain embodiments, a particular amount of VLP composition is administered in more than one dose (e.g., 1 to 3 doses separated by 1 to 12 months).

In some embodiments, the provided compositions are administered in an initial dose and at least one booster dose. In some embodiments, the provided compositions are administered in an initial dose and two, three, or four booster doses. In some embodiments, the provided compositions are administered in an initial dose and at least one booster dose about one month, about two months, about three months, about four months, about five months, or about six months after the initial dose. In some embodiments, the provided compositions are administered at the second booster dose about six months, about seven months, about eight months, about nine months, about ten months, about eleven months, or about one year after the initial dose. In some embodiments, the provided compositions are administered at booster doses every 1 year, 2 years, 3 years, 4 years, 5 years, 6 years, 7 years, 8 years, 9 years, or 10 years.

In certain embodiments, the provided compositions may be formulated for parenteral delivery, such as by injection. In some such embodiments, administration may be, for example, intravenous, intramuscular, intradermal, or subcutaneous, or by infusion or needleless injection techniques. In certain embodiments, the compositions may be formulated for oral (peroral), oral, intranasal, buccal, sublingual, transdermal, intraperitoneal, intravaginal, rectal, or intracranial delivery.

In some embodiments, the provided VLPs induce a humoral immune response in a subject after administration to the subject. In some embodiments, the humoral immune response in the subject lasts for at least about 1 month, at least about 2 months, at least about 3 months, at least about 4 months, at least about 5 months, at least about 6 months, at least about 7 months, at least about 8 months, at least about 9 months, at least about 10 months, at least about 11 months, at least about 12 months, at least about 13 months, at least about 14 months, at least about 15 months, at least about 16 months, at least about 17 months, at least about 18 months, at least about 19 months, at least about 20 months, at least about 21 months, at least about 22 months, at least about 23 months, at least about 24 months, at least about 28 months, at least about 32 months, at least about 36 months, at least about 40 months, at least about 44 months, at least about 48 months, or longer.

In some embodiments, the provided VLPs induce a cellular immune response in a subject after administration to the subject. In some embodiments, the cellular immune response in the subject lasts for at least about 1 month, at least about 2 months, at least about 3 months, at least about 4 months, at least about 5 months, at least about 6 months, at least about 7 months, at least about 8 months, at least about 9 months, at least about 10 months, at least about 11 months, or at least 12 months.

All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described herein.

Examples

The following examples describe some exemplary modes of making and practicing certain compositions described herein. It is to be understood that these examples are for illustrative purposes only and are not meant to limit the scope of the compositions and methods described herein.

Example 1: construction of DNA expression plasmid

This example describes the development of expression plasmids and constructs for expressing recombinant coronavirus spike gene sequences. Standard expression plasmids generally consist of: mammalian-derived promoter sequences, intron sequences, polyadenylation signal sequences (PolyA), pUC origin of replication sequences (pUC-pBR 322 is the colE1 origin/origin of replication and is used to replicate plasmids in bacteria such as E.coli (DH 5. Alpha.), and antibiotic resistance genes as selectable markers for plasmid plaque selection. Within the plasmid, there are a number of restriction sites available for splicing the gene of interest or part of the gene sequence following the intron.

The Propol II expression plasmid contains pHCMV (early promoter of HCMV), beta-globin intron (BGL intron), rabbit globin polyadenylation signal sequence (PolyA), pUC origin of replication sequence (pUC-pBR 322 is colE1 origin/origin of replication site and is used to replicate the plasmid in bacteria such as E.coli (DH 5. Alpha.), and ampicillin resistance gene beta-lactamase (selectable marker of Amp R-plasmid) conferring resistance to ampicillin (100. Mu.g/ml).

To develop a Gag MMLV expression construct ("MLV-Gag"), a complementary DNA (cDNA) sequence (SEQ ID NO: 3) encoding the Gag polyprotein of MMLV (Gag without its C-terminal Pol sequence) was cloned into a Propol II expression vector. To develop all coronavirus expression constructs, each of the following sequences was cloned into a Propol II expression vector:

i)SARS-CoV-2(SEQ ID NO:6)；

ii)SARS-CoV(SEQ ID NO:9)；

iii)MERS(SEQ ID NO:12)；

iv) a proline modified spike glycoprotein of SARS-CoV-2 (SEQ ID NO: 15);

v) SARS-CoV-2 is modified by furin cleavage (SEQ ID NO: 18);

vi) SARS-CoV-2 is modified by proline and furin cleavage (SEQ ID NO: 21);

vii) SARS-CoV-2 is cleaved by proline and furin and TM/Cyt modification from VSV (SEQ ID NO: 24); and

viii) SARS-CoV-2 was modified with TM/Cyt from VSV (SEQ ID NO: 26). SARS-CoV-2 sequence is from the L strain of virus identified in Wuhan in China.

The DNA plasmid was amplified in competent escherichia coli (dh5α) and purified with endotoxin-free preparation kit according to standard protocols.

Example 2: production of virus-like particles

This example describes a method for producing virus-like particles comprising a plurality of recombinant coronavirus spike antigens described in example 1.

The 293SF-3F6 cell line derived from HEK293 cells is a proprietary suspension cell culture grown in serum-free chemically defined medium (CA 2,252,972 and US 6,210,922). HEK293SF-3F6 cells at 37℃with 5% CO ₂ Amplification in shake flasks at 80rpm and subsequent use of HyQSF 4T supplemented with L-glutamine (GE Bioscience)The ransfx293 culture medium is inoculated into a bioreactor to obtain the target cell density of 90 to 120 ten thousand cells/ml and high viability>90%). Cells were co-transfected with plasmids encoding coronavirus envelope polypeptides, gag encoding plasmids in varying proportions at a cell density of about 100 tens of thousands of cells/ml, and high quality polyethylenimine (PEIpro) ^TM ) As transfection agents. DNA plasmids and transfection reagents were prepared in OptiPRO SFM medium (GE Biosciences). The bioreactor (about 24 hours and 48 hours after transfection) was monitored daily and cell density, viability and cell diameter were recorded. The resulting liquid medium was harvested 48 hours after transfection.

Total protein was determined on aliquots by the Bradford assay quantification kit (BioRad). Bradford protein assay is based on the following observations: the maximum absorbance of the coomassie brilliant blue G-250 acidic solution was shifted from 465nm to 595nm when binding to the protein occurred. Both hydrophobic and ionic interactions stabilize the anionic form of the dye, causing a visible color change. Absorbance at 595nm was measured for the sample and Bradford protein reagent dye using a spectrophotometer.

Example 3: monovalent vaccine candidate generation

Four different monovalent virus-like particles were produced using the method described in example 2. The virus-like particles were transfected with one of the following four SARS-CoV-2 nucleotide sequences:

the natural form of SARS-CoV-2 (SEQ ID NO: 6);

SARS-CoV-2 was modified by proline and furin cleavage (SEQ ID NO: 21);

SARS-CoV-2 is cleaved by proline and furin and TM/Cyt modification from VSV (SEQ ID NO: 24); or alternatively

SARS-CoV-2 was modified with TM/Cyt from VSV (SEQ ID NO: 26).

The total antigen content of the resulting product was measured and the results are shown in table 1.

TABLE 1 yield of monovalent SARS-CoV-2 Virus-like particles

As can be seen from the data in table 1, significantly higher yields were obtained using the SARS-CoV-2 sequences of group 3 that had been modified by replacing cytoplasmic and transmembrane segments with the corresponding segments from VSV.

Example 4: production of trivalent vaccine candidates

Four different trivalent virus-like particles were produced using the method described in example 2. Each particle was transfected with a plasmid encoding Gag, the antigen sequence from MERS (SEQ ID NO: 12), the antigen sequence from SARS-CoV (SEQ ID NO: 9) and one of the following two SARS-CoV-2 sequences:

a natural form of SARS-CoV-2 envelope polypeptide (SEQ ID NO: 6); or alternatively

SARS-CoV-2 was cleaved by proline and furin and modified by TM/Cyt from VSV (SEQ ID NO: 24).

The antigen content of the resulting product was measured and the results are shown in table 2.

TABLE 2 yield of trivalent coronavirus virus-like particles

As can be seen from the data in Table 2, significantly higher trivalent VLP yields were obtained using the SARS-CoV-2 sequence (SEQ ID NO: 24) of group 2 with a stable pre-fusion form of spike protein further modified by TM/Cyt from the VSV G protein.

Example 5: evaluation of efficacy of monovalent SARS-CoV-2VLP vaccine constructs

Two immunizations were performed with the primary 6 to 8 week old C57/BL6 mice (n=10) with approximately 1/20 to 1/50 of the human dose of the SARS-CoV-2VLP vaccine formulation shown in table 3 below. Immunization was performed on day 0 and day 21. Animals were sacrificed 14 days after immunization and their serum was collected for subsequent analysis of anti-spike protein antibody titers and neutralizing antibodies.

Using aluminium phosphate adjuvant) SARS-CoV-2 VLPs were formulated as shown in table 3.

TABLE 3 monovalent SARS-CoV-2VLP vaccine formulations

Anti-spike SARS-CoV-2 antibody titers were measured as follows: the 96-well plates were coated overnight with SARS-COV-2 spike protein (S1+S2) (Sinobiological, cat#40589-V08B1 (0.1 μg/ml in DPBS) at 4 ℃ the next day the plates were blocked with 5% milk in ELISA wash buffer for 1 hour at 37 ℃, the plates were washed with wash buffer followed by addition of individual mouse serum diluted 2 times starting from 1:10,000 to 1:1,200,000, the plates were incubated at 37 ℃ for 1.5 hours followed by washing the plates and adding secondary antibodies goat anti-mouse IgG1 (Bethy, cat#A90-131P) diluted 1% milk in ELISA wash buffer at 1:5,000.

The anti-spike total IgG binding titers reported in table 4 represent the highest dilutions of serum still having an optical density of 0.1 or higher as measured by ELISA against recombinant SARS-CoV-2 spike protein. Unexpectedly, immunization of mice with only a single dose of VLP (group 4) expressing a stable pre-fusion form of SARS-CoV-2 spike protein further modified with TM/Cyt from VSV-G protein induced a significantly stronger antibody response than immunization of mice with VLPs (groups 2, 7) expressing similar doses of SARS-CoV-2 spike protein but exhibiting a different expression.

Antibody titers from mice 14 days after each vaccination are shown in table 4. P1 and P2 refer to the first and second vaccinations. The results were pooled between individual animals.

TABLE 4 monovalent SARS-CoV-2 VLP vaccine antibody titers

As shown in table 4, each monovalent VLP vaccine formulation induced a strong antibody response in mice. In almost all formulations, the response was strongly enhanced by the second vaccination. One group consisting of vaccine formulations based on SARS-CoV-2 cleavage by proline and furin and TM/Cyt modification from VSV (SEQ ID NO: 24), group 5, showed a reduced response after the second vaccination. However, the response after the first vaccination is very high, which increases the likelihood that the second vaccination depletes the immune response in the mice. Such a response may not be visible in large mammals (e.g., humans).

Neutralizing antibodies were tested as follows. A constant amount of virus consisting of 100 plaque forming units (plaque forming unit, pfu) of a canadian isolate of SARS-CoV-2 virus was mixed with a 2-fold diluted mouse serum sample tested at a dilution of 40 to 5120 fold, and the mixture was plated onto cells of a suitable cell line for the individual virus. The concentration of plaque forming units is determined by the number of plaques formed after a few days. A vital dye (e.g., crystal violet or neutral red) was then added for visualization of plaques and the number of plaques in a single plate with test serum divided by the number of plaques present in negative control serum to calculate the percent neutralization. Plaque forming units are measured by microscopic observation or by observing specific dyes that react with infected cells. The explanation is generally based on 50% neutralization, which is the final dilution of serum capable of inhibiting 50% of total plaques (virions). Plaque reduction neutralization test (plaque reduction neutralization test, PRNT) thresholds of 80 and 90, respectively, represent serum dilutions capable of reducing plaque by 80% or 90%. The results are shown in table 5.

TABLE 5 monovalent SARS-CoV-2 VLP vaccine neutralizing antibodies

* Lower than the minimum dilution limit of PRNT (titer 40); * Higher than the highest dilution range of PRNT (titer 5120)

As shown in table 5, all monovalent vaccine constructs induced neutralizing antibody responses. This response is very effective as indicated by the data from the stringent PRNT 90 threshold.

Example 6: evaluation of efficacy of trivalent SARS-CoV-2 VLP vaccine constructs

Trivalent VLPs were prepared using the method in example 2 with an antigenic plasmid comprising all of the following sequences:

i)SARS-CoV-2(SEQ ID NO:6)；

ii) SARS-CoV (SEQ ID NO: 9); and

iii)MERS(SEQ ID NO:12)。

vaccine formulations comprising trivalent VLPs, monovalent VLPs expressing native SARS-CoV-2 (SEQ ID NO. 6), recombinant SARS-CoV-2 (SEQ ID NO: 25) and Gag protein alone (SEQ ID NO: 1) were tested in mice. Recombinant SARS-CoV-2 (SEQ ID NO: 25) is provided by the national research Committee of Canada (National Research Council of Canada). Using aluminium phosphate adjuvant) Vaccines were formulated as shown in table 6.

Three immunizations were performed on 40 naive 6 to 8 week old C57/BL6 mice (4 groups of 10) with human doses of about 1/20 to 1/50 of the vaccine formulations shown in Table 6 below. Immunization was performed on day 0, day 21 and day 42. Animals were sacrificed 14 days after final immunization and their serum was collected for subsequent analysis of anti-spike protein antibody titers and neutralizing antibodies.

Table 6 vaccine formulations

Using the techniques described in example 5, the anti-spike SARS-CoV-2, anti-SARS and anti-MERS antibody titers were measured with the following capture antigens (SARS-COV-2 spike protein (S1+S2), sino Biological, cat#40589-V08B1; SARS-COV spike protein (S1+S2), myBioSource, cat#MBS434077; and MERS-CoV spike protein (S1+S2), sino Biological, cat#40069-V08B). The results are shown in table 7.

TABLE 7 coronavirus antibody titers

As shown in table 7, trivalent VLP (group 2) induced antibody responses against all three coronaviruses: SARS-CoV-2, SARS and MERS. This suggests that trivalent vaccine candidates have the potential to provide immune protection against all three major coronaviruses.

The anti-SARS-CoV-2 binding and PRNT 80 neutralization titers of individual animals after the third vaccination are shown in Table 8 below. The neutralizing antibodies were measured using the method described in example 5.

TABLE 8 anti-SARS-CoV-2 binding and neutralization titers in individual mice

As can be seen from the data shown in table 8, trivalent VLPs induced a higher neutralizing antibody response, albeit at a lower binding potency, than monovalent SARS-CoV-2 VLPs. This is especially evident when the ratio of neutralizing to binding antibody titers in the last column of table 8 is observed. This suggests that trivalent vaccine candidates have the potential to provide greater immune protection against covd-19.

Serum obtained from mice fourteen (14) days after each vaccination was cross-reactive tested using a different coronavirus (HCoV-OC 43) known to infect humans and cause common cold. Antibody titers were measured using ELISA as described above using human coronavirus (HCoV-OC 43) spike protein (S1+S2ECD, his Tag), sino, cat#40607-V08B, stock 0.25mg/mL as capture antigen. The results are shown in table 9 below.

TABLE 9 Cross-reactivity of mouse serum against HCoV-OC43 spike protein

As can be seen from table 9 above, the trivalent VLP vaccine candidate (group 2) exhibited higher cross-reactivity against human coronaviruses that caused the common cold. Thus, trivalent candidates demonstrated the potential for broader protection against coronaviruses compared to monovalent VLPs or recombinant SARS-CoV-2 spike protein alone.

To evaluate the efficacy of vaccine formulations, neutralizing antibodies were also measured in Human Serum (HS) collected from four recovered covd-19 patients and compared to neutralizing antibodies induced by four different test groups shown in table 6. PRNT 50 and PRNT 90 were determined after the first and second vaccinations using the methods described in example 5. The combined results for each group are shown in table 10 below.

TABLE 10 neutralizing antibodies against SARS-CoV-2

Sample of	PRNT50	PRNT90
			HS1	80	**
HS2	160	40
			HS3	1280	320
HS4	160	80
			POV (before vaccination)	**	**
P1VD14 GR1	**	**
			P1VD14 GR2	**	**
P1VD14 GR3	40	**
			P1VD14 GR4	**	**
P2VD14 GR1	640	160
			P2VD14 GR2	320	**
P2VD14 GR3	640	80
			P2VD14 GR4	**	**

* Lower than the minimum dilution limit of PRNT (titer 40);

as can be seen in table 10, the monovalent VLP vaccine induced more neutralizing antibodies than covd-19 infection in three-quarters of human patients, as measured by PRNT 50 and PRNT 90. As measured by PRNT 50, trivalent VLP vaccines induced more neutralizing antibodies than covd-19 infection in three-quarters of human patients. Thus, the vaccine construct is at least as effective as, and may be more effective than, exposure to SARS-CoV-2 in inducing immune protection.

Example 7: evaluation of the protective Effect of monovalent SARS-CoV-2VLP vaccine constructs

Syrian golden hamsters (male, about 5 to 6 weeks old) were divided into two groups and dosed with two doses of the formulation shown in table 11 below, in particular with aluminium phosphate adjuvantThe formulated test samples (group B) containing triple modified SARS-CoV 2VLP (SEQ ID: 24) and saline control (group A) were immunized. Immunization was performed by intramuscular injection on day 0 and day 21. On day 42, 50 μl SARS-CoV-2 was passed through both nostrils at 1×10 ⁵ TCID ₅₀ Challenge virus dose in animalsAll animals were challenged intranasally. SST (serum separation tubes) blood samples (about 0.5ml each) were collected before the initial immunization on day 0, on day 14 and on day 35, respectively. The final blood sample was collected at necropsy. Nasal washes were collected on days 35, 43, 44, 45, 47, 49, 51, 53 and 56. Half of the animals in each group were euthanized 3 days after challenge, and the remaining animals were euthanized 14 days after challenge.

TABLE 11 monovalent SARS-CoV-2 VLP vaccine formulations

At necropsy, the general lung pathology was assessed and the proportion of lung lobes containing lesions was estimated. Lung tissue was analyzed for viral load by qRT-PCR and viral cell culture. Similarly, the viral load of turbinates was collected by qRT-PCR and viral cell culture.

RNA extraction from nasal washes was performed using Qiagen reagent (QIAamp Viral RNA Mini Kit Cat No./ID: 52906). Briefly, 140. Mu.l of nasal wash was added to 560. Mu.l of viral lysis Buffer (Buffer AVL). The mixture was incubated at room temperature for 10 minutes. After a short centrifugation, the solution was transferred to a new tube containing 560 μl of 100% ethanol and the tube was incubated for 10 minutes at room temperature. The RNA was then purified and eluted with 60. Mu.l of RNase-free water (elution buffer AVE) containing 0.04% sodium azide.

Extraction of RNA from lung lobes and turbinates was accomplished using approximately 100 μg of tissue. Tissues were homogenized in 600 μl lysis buffer (RLT Qiagen) with sterile stainless steel balls in TissueLyserII (Qiagen) at 30Hz for 6 min. The solution was centrifuged at 5000 Xg for 5 minutes. The supernatant was transferred to a new tube containing 600 μl of 70% ethanol and the tube was incubated for 10 minutes at room temperature. The viral RNA was then purified using Qiagen RNeasy Mini Kit (Cat No/ID: 74106) and eluted with 50. Mu.L of elution buffer.

qRT-PCR assays were performed on RNA from samples of nasal washes, lung tissue and turbinates using SARS-CoV-2 specific primers (Table 12). The annealing temperature of the primer was about 60 ℃. Qiagen Quantifast RT-PCR Probe kit was used for qRT-PCR, and the qRT-PCR reaction was performed using an OneStep Plus (Applied Biosystems) machine. qRT-PCR results are expressed in copy number/reaction by generating a standard curve with linearized plasmid DNA samples containing the env gene of SARS-CoV-2. The Ct values for the individual samples are used together with the standard curve to determine the copy number in each sample.

Table 12 sequences of primers used

Primer(s)	Sequence(s)	SEQ ID NO：
			Forward primer (Fwd)	ACAGGTACGTTAATAGTTAATAGCGT	28
Reverse primer (Rev)	ATATTGCAGCAGTACGCACACA	29
			Labeling probes	ACACTAGCCATCCTTACTGCGCTTCG	30

Virus titration assays were performed to assess infectious virus. Assays were performed in 96-well plates using Vero'76 cells (ATCC CRL-1587). Median tissue culture was determined by microscopic observation of cytopathic effects (cytopathic effect, CPE) of cellsDose of infection-keeping agent (TCID) ₅₀ ). Quantification of virus and use of TCID ₅₀ /ml or TCID ₅₀ Per gram. Use of Spearman in Excel&Calculation of TCID by Karber algorithm ₅₀ Values.

Anti-spike SARS-CoV-2 antibody titers were measured by ELISA on serum samples. Plates were coated with spike s1+s2ag (cat# 40589-V08B1, sino Biological inc.). The coating concentration was 0.1ug/mL. Plates were blocked with 5% skim milk powder in PBS containing 0.05% tween 20. Quadruple diluted serum was used. Goat anti-hamster IgG HRP (PA 1-29626) from ThermoFisher was used as secondary antibody at 1:7000. The plate was developed with OPD peroxidase substrate (0.5 mg/ml) (Thermo Scientific Pierce 34006). The reaction was quenched with 2.5M sulfuric acid and absorbance was measured at 490 nm. Throughout the assay, plates were washed with PBS containing 0.05% tween 20. Assays were performed in duplicate. Titers are reported as endpoints of dilution.

Antibodies to the spike receptor binding domain (receptor binding domain, "RBD") were measured as follows. anti-SARS-CoV-2 spike S1RBD IgG antibody binding titers were determined from serum samples using an indirect ELISA. Recombinant SARS-CoV-2 spike S1RBD protein was adsorbed onto microtiter plates overnight, and the plates were blocked with a 5% solution of skim milk in wash buffer for 1 hour. After blocking and washing, samples were added to the microwell plates and incubated for 1.5 hours. HRP conjugated goat anti-syrian hamster IgG-Fc was used as detection antibody and incubated on microwell plates for 1 hour. The signal was developed with Tetramethylbenzidine (TMB) substrate solution and the reaction was stopped by adding 450. Mu.L of liquid stop solution for TMB microwell substrate. Absorbance was read at 450nm using an ELISA microplate reader.

Serum samples were subjected to virus neutralization assays against the aggressive SARS-CoV-2 virus using the cell line Vero' 76. Serum samples were heat inactivated at 56 ℃ for 30 minutes. Serum samples were serially diluted (2-fold serial dilution). This experiment was performed in duplicate technically. The virus was diluted at 50. Mu.l/well in medium to a concentration of 25TCID ₅₀ (inoculum size=25 TCID ₅₀ ). Mu.l of the virus solution was then mixed with 60. Mu.l of serial diluted serum samples. Will be mixedThe compound was reacted at 37℃in 5% CO ₂ Incubate for 1 hour. Preincubated virus-serum mixtures (100 μl) were transferred to wells of 96-well flat bottom plates containing 90% confluent preinoculated Vero'76 cells. The plates were incubated at 37℃with 5% CO ₂ Incubate for five days. Plates were observed using a microscope for contamination on day 1 (dpi) after infection and for cytopathic effects on days 3 and 5 after infection. At 5dpi, serum dilution factors for CPE-free wells were defined as serum neutralization titers. The initial serum dilution was 1:20.

Neutralizing antibodies were tested as follows. Vero cells were grown at 8X 10 at 48 hours prior to infection ⁵ Individual cells/well were seeded in 6-well plates. The serum was heat-inactivated at 56 ℃ for 30 min and then transferred to ice. Serum was diluted 1:10 with virus infection medium and then 1/2X-fold serial dilutions were made using each diluted serum to give 1:20 to 1:40960 (8 subsequent dilutions). Equal volumes of diluted serum and virus (100 pfu/serum dilution) were mixed and incubated for 1 hour at 37 ℃. Serum-free and virus-free controls were included. Cells were washed with PBS and each virus/serum was transferred and mixed into each cell-containing well and incubated for 1 hour at 37 ℃ and plates were intermittently shaken. After 1 hour of adsorption, the excess inoculum was removed and 2ml of virus infection medium/agarose mixture was overlaid on the cells. The cover layer was allowed to cure and the plates were incubated at 37 ℃ for 72 hours. Cells were stained with crystal violet 72 hours after infection. Plaques of all dilutions were quantified and PRNT titers were calculated. The% plaque reduction was calculated for all dilutions based on serum-free control using the Reed-Muench formula to determine PRNT titers 50, 80 and 90.

Cytokine gene expression was also quantified in lung tissue collected at necropsy. Gene expression of IL-4, IL-10, IL-13, TNF- α and IFN- γ was determined in the right cranium and right lung lobe by qRT-PCR using the primers shown in Table 13. Beta-actin gene expression was used for reference.

TABLE 13 primer sequences

Lung tissue was collected in RNAlater and RNA was isolated using an RLT lysis buffer (Qiagen RNeasy Mini Kit, cat No/ID: 74106) using Qiagen RNeasy Mini extraction kit. RNA concentration and 260/280 ratio as an index of purity were determined by nanodrop spectrophotometry. Use of iScript ^TM Reverse Transcription Supermix cDNA was synthesized using 500ng of RNA as a template. cDNA was synthesized according to the following procedure: at 25℃for 5 minutes, at 46℃for 20 minutes, and at 95℃for 1 minute. Master mix was prepared at 10% overage for each gene of interest and housekeeping gene: 1.84 μl nuclease-free H ₂ O, forward primer 0.08. Mu.L, reverse primer 0.08. Mu.L and SYBR 10. Mu.L [Green PCR Master Mix(SsoAdvanced ^TM Universal/>Green Supermix#1725275)]. For each PCR reaction, 12. Mu.l of the master mix was combined with 8. Mu.l RNA. After loading, the plate was centrifuged at 1500RPM for 1 minute to bring all liquid back to the bottom of the well. qPCR was performed using a Bio-Rad Thermocycler (Bio-Rad CX 1000). Data were analyzed using Bio-Rad CFX Maestro software. The data were exported in the form of Ct values into an Excel spreadsheet for use in calculating fold change by the ΔΔct formula in Excel. / >

Results based on animal clinical observations indicate that all animals are healthy throughout the immunization phase. All animals had normal activity levels and no clinical signs. Weight gain was normal in the group vaccinated with the test sample (group B) when compared to the saline control group (group a).

Fourteen days after the first vaccination and fourteen days after the second vaccination (P1 and P2 refer to the first and second vaccination), as shown in table 14 by the immune response to vaccination as measured by antibody titers against SARS-CoV-2 spike protein. The results shown are the geometric mean of the animals in each group.

TABLE 14 SARS-CoV-2VLP vaccine antibody titers

Group B animals (vaccinated with the triple modified monovalent SARS-CoV-2VLP vaccine) produced high levels of anti-spike antibodies two weeks after the second vaccination. Two weeks after the first vaccination, 10 of the 12 animals in group B produced anti-spike antibodies (data not shown). Group a animals (saline control) did not have anti-spike antibodies raised. Triple modified monovalent SARS-CoV-2VLP vaccine also induced detectable levels of anti-SARS-CoV-2-S1 RBD IgG antibodies 14 days after the first immunization. A significant increase in antibody titers was observed at day 14 after the 2 nd immunization. No anti-SARS-CoV-2-S1 RBD IgG was detected in control group A.

The neutralizing antibodies for each group as determined by PRNT fourteen days after the first vaccination are shown in table 15 (mean shown). The values represent the reciprocal of the highest dilution, which shows inhibition of 50% (PRNT 50), 80% (PRNT 80) or 90% (PRNT 90), respectively, of the input virus.

TABLE 15 neutralizing antibodies to SARS-CoV-2 VLP vaccine

* Below the minimum dilution limit of PRNT (potency 40)

All animals in group B developed virus neutralizing antibodies two weeks after immunization, as shown in table 15. Group a animals did not develop any neutralizing antibodies as shown in table 15.

Three days after challenge (dpc), all animals in group B and only one animal in group a produced neutralizing antibodies (data not shown). At 14dpc, neutralizing antibodies were generated by all animals in groups a and B. (data not shown).

During the challenge phase, all animals except the two animals were active and had normal activity levels and no abnormal nasal signs.

Animals were weighed daily after challenge. After challenge, group a animals lost about 15% of their initial body weight, peaking at 6 to 8 dpc. Group B animals had an average% change in body weight of only about 1 to 2% and reached a peak at 2 dpc. Body weight data on day 0 and on days 3 and 6 after challenge are shown in table 16 below.

Table 16 body weight of hamsters after virus challenge

Euthanasia or humane euthanasia on day 3 as planned (416 and 421)

As can be seen in table 16, animals given saline solution lost considerable weight 3 and 6 days after challenge, while animals receiving vaccine lost considerably less weight on day 3 and increased body weight by day 6.

Viral RNAs in nasal washes as measured after challenge are shown in table 17. Throughout the days examined, vaccinated (group B) animals had lower viral RNA levels in nasal washes than group a animals (control group), as shown in table 17 (showing daily copies/Rxn after challenge). Only during the second day after challenge, viral RNA levels were significantly lower in group B compared to group a (p=0.0206).

TABLE 17 viral RNA in nasal washes

Viral RNAs in various tissues of control (group a) and vaccinated (group B) animals 3 days after challenge are shown in table 18 (values of copies/gram are shown). Viral RNA was detectable in the right cranial (RCra) and caudal (RCau) lobes of the lungs as well as in the turbinates in all animals three days after challenge. The viral RNA levels in RCra of group B were significantly lower when compared to group a. Similarly, the RNA level in RCau in group B was significantly lower compared to group a. In the turbinates, viral RNA levels in group B were significantly lower than those in group a.

TABLE 18 viral RNA in tissues 3 days after challenge

Viral RNAs in various tissues of control (group a) and vaccinated (group B) animals 14 days after challenge are shown in table 19 (values of copies/gram are shown). Viral RNA was detectable in RCra, RCau or turbinates in all animals of group a and some animals of group B14 days after challenge. The RNA levels in RCra and RCau in group B were significantly different from those in group a.

TABLE 19 viral RNA in tissues 14 days after challenge

Infectious viruses in various tissues of control (group a) and vaccinated (group B) animals 3 days after challenge are shown in table 20 (TCID shown ₅₀ Value per gram). Three days after challenge, infectious virus was detectable in both the right cranial and caudal lobes of the lungs and in the turbinates of all animals in group a. Group BThe titer of infectious viruses in (a) was significantly lower than those in group a. No infectious virus was detected in any of the animals 14 days after challenge (data not shown).

TABLE 20 infectious virus in tissue 3 days after challenge (TCID 50/g)

Heavier lungs are associated with more advanced disease. Thus, the ratio of lung weight to body weight is associated with a more severe disease state. Table 21 shows the lung weight to body weight ratio of animals in control (group a) and vaccinated (group B) animals three days after challenge. Animals in group B animals had significantly lower lung weight to body weight ratios.

TABLE 21 Lung weight to body weight ratio (%)

/>

After necropsy, lung tissue was fixed in formalin, embedded, sectioned and stained with hematoxylin and eosin (H & E). Slides were examined by a committee certified pathologist and scored on a scale of 0 to 4 as shown in table 22.

Table 22-Lung histology score (median)

/>

/>

As can be seen in table 22, animals in the control group (group a) exhibited significant disease pathology at days 3 and 14 after challenge. In contrast, vaccinated animals (group B) exhibited some mild pathology on day 3, but recovered mostly by day 14. Thus, the vaccine provides significant protection against diseases that cause lung pathology.

Immunohistochemical staining was performed to observe lung tissue, particularly SARS-CoV-2 virus in the parenchyma and bronchioles/bronchi. Staining was observed and scores for the two groups of animals are shown in table 23.

Table 23 lung immunohistochemical score (median) for SARS-CoV-2

/>

The vaccinated animals were significantly less virus-stained in both the parenchyma and bronchioles/bronchi than those in the saline control animals (group a). The viral staining was similar in the parenchyma or bronchioles/bronchi between groups, but still slightly lower in the vaccinated group, 14 days after challenge.

The levels of transcription of cytokines IL-4, IL-10, IL-13, TNF- α and IFN- γ in the right craniofacial, right caudal and turbinates were determined by qRT-PCR. IL-10, IL-13 and IFN-gamma showed differential expression in the right cranial and caudal lobes of group B3 days after challenge (shown in tables 24 and 25). In the turbinates, IL-10 and IFN-gamma showed differential expression (shown in Table 26). The transcript levels of IL-4, IL-10, IL-13, TNF-. Alpha.and IFN-. Gamma.in the right craniofacial, right caudal and turbinates of each group were similar 14 days after challenge (shown in tables 27 to 29).

Table 24 transcription profile (fold change) of cytokines in right cranial lobes 3 days after challenge

Group ID	IL-4	IL-10	IL-13	TNF-α	IFN-γ
						Group A	1.04	1.09	1.3	1.07	1.14
Group B	1.8	0.37	7.1	0.61	0.27

Table 25 transcription profile of cytokines in right tail leaves 3 days after challenge (fold change)

Table 26 transcript of cytokines in turbinates 3 days after challenge (fold change)

Group ID	IL-4	IL-10	IL-13	TNF-α	IFN-γ
						Group A	1.22	1.05	1.26	1.16	1.09
Group B	1.44	0.84	2.87	0.45	0.82

Table 27 transcription profile (fold change) of cytokines in right cranial lobes 14 days after challenge

Group ID	IL-4	IL-10	IL-13	TNF-α	IFN-γ
						Group A	1.07	1.25	1.57	1.34	1.24
Group B	1.37	0.92	2.22	0.77	0.61

Table 28 transcription profile of cytokines in right tail leaf 14 days after challenge (fold change)

Group ID	IL-4	IL-10	IL-13	TNF-α	IFN-γ
						Group A	1.09	1.51	1.13	1.11	1.31
Group B	1.38	0.78	0.63	0.94	0.65

Table 29 transcript of cytokines in turbinates 14 days after challenge (fold change)

Group ID	IL-4	IL-10	IL-13	TNF-α	IFN-γ
						Group A	1.46	1.45	1.43	1.41	1.46
Group B	0.73	0.72	1.40	0.65	0.57

Example 8: evaluation of efficacy and protective effects of single dose monovalent SARS-CoV-2VLP vaccine constructs

Syrian golden hamsters (male, about 6 to 7 weeks old) were vaccinated with monovalent triple modified SARS-CoV-2VLP vaccine formulations shown in table 30 below. Immunization was performed by intramuscular injection only on day 21. Serum was collected on day 0 and day 35 for subsequent neutralizing antibody analysis.

TABLE 30 monovalent SARS-CoV-2VLP vaccine formulations

Neutralizing antibodies were tested using the Plaque Reduction Neutralization Test (PRNT) as described in example 7 for animals in group B. The results are shown in table 31 (average values are shown).

TABLE 31 monovalent SARS-CoV-2VLP vaccine neutralizing antibodies

* Below the minimum dilution limit of PRNT (potency 40)

Animals in group B of this example 8 (wherein animals received a single immunization of 1.4 μg SARS-CoV-2 spike/dose on day 21) exhibited a higher serum neutralizing antibody response than group B of example 7 (wherein animals received 1 μg SARS-CoV-2 spike/dose of immunization on day 0 and day 21). These data support effective immunization with only a single dose of monovalent SARS-CoV-2VLP vaccine.

Challenge studies were performed on day 42 as described in example 7. Table 32 shows the average body weight (grams) of the animals prior to challenge.

Table 32 average body weight of animals prior to challenge

Table 33 shows the average body weight (grams) of the animals after challenge. As can be seen in table 33, animals receiving a single dose of vaccine lost less weight than animals receiving saline.

Table 33 mean body weight of animals after challenge

Days (days)	Group A	Group B
			1	172.1	174.6
2	168.3	172.6
			3	165.3	173.4
4	163.7	168.5
			5	159.1	168.5
6	155.7	168.5
			7	154.7	170.1
8	157.5	171.7
			9	162.9	173.8
10	164.4	174.0
			11	166.6	175.3
12	169.4	177.1

13	172.0	177.8
			14	173.5	178.9

Table 34 shows the average% change in animal body weight after challenge.

Table 34 mean% weight change of animals after challenge

Days (days)	Group A	Group B
			1	-1.09	-2.24
2	-3.29	-3.30
			3	-5.08	-2.90
4	-6.51	-2.10
			5	-9.14	-2.15
6	-11.11	-2.11
			7	-11.64	-1.22
8	-10.05	-0.31
			9	-7.03	0.87
10	-6.22	0.93
			11	-4.94	1.63
12	-3.35	2.69
			13	-1.89	3.09

14

-1.00

3.74

These data indicate that a single immunization at a dose of 1.4 μg SARS-CoV-2 spike/dose on day 21 relative to the control is effective to prevent weight loss following viral challenge.

Example 9: evaluation of antibody titers of monovalent and trivalent SARS-CoV-2VLP vaccine constructs against NanfAfrican SARS-CoV-2 variants

Antibody production was assessed for monovalent and trivalent SARS-CoV-2VLP vaccine constructs with triple modified SARS-CoV-2 spike proteins against south african SARS-CoV-2 variants. Mice were IP immunized with the SARS-CoV-2VLP vaccine formulations shown in table 35 below (as described in example 6 on days 0 and 21). Animals were sacrificed 14 days after immunization and their serum was collected for subsequent anti-spike protein antibody titer analysis.

Using aluminium phosphate adjuvant) SARS-CoV-2 VLPs were formulated as shown in table 35.

TABLE 35 SARS-CoV-2VLP vaccine formulations

Antibody titers were assessed by ELISA, except that the well plates were coated with SARS-COV-2 spike protein from south africa variants, as described in example 7. Antibody titers 14 days after the second immunization are shown in table 36. The results shown are the geometric mean of the animals in each group.

TABLE 36 antibody titers of SARS-CoV-2VLP vaccine

These data indicate that mice injected with monovalent and trivalent vaccines produce antibodies that bind to south africa variants of the spike protein of SARS-CoV.

Example 10: evaluation of isotype antibody titers for monovalent SARS-CoV-2VLP vaccine constructs

In another study, isotype antibody titers were assessed after immunization of mice with the vaccine constructs shown in table 37.

TABLE 37 antibody titers of SARS-CoV-2VLP vaccine

Mice were vaccinated with IP twice (on days 0 and 21, as described in example 6). Animals were sacrificed 14 days after immunization and their serum was collected for subsequent anti-spike protein antibody titer analysis.

As shown in table 38, unexpectedly, an balanced antibody response (IgG 1/IgG2 b) was observed when VLPs were formulated with the same amount/concentration of alum as recombinant spike protein. Increased production of IgG2b is associated with a TH1 immune response, which is indicative of cell-mediated immunity. This suggests that VLP constructs cause an increase in IgG2b expression levels, which correlates with a more potent TH1 immune response.

TABLE 38 SARS-CoV-2VLP vaccine antibody titers

/>

Claims (20)

1. An immunogenic composition comprising a virus-like particle (VLP), comprising:

a first polypeptide which is the gag protein present in Murine Leukemia Virus (MLV) and which hybridizes to SEQ ID NO:1 has at least 95% identity to the amino acid sequence of 1;

at least one additional polypeptide that is a spike glycoprotein from a beta-coronavirus; and

a pharmaceutically acceptable carrier.

2. The immunogenic composition of claim 1, wherein the at least one additional polypeptide is a spike glycoprotein from SARS-CoV-2, SARS-CoV, or MERS-CoV.

3. The immunogenic composition of claim 2, wherein the spike glycoprotein is a wild-type protein.

4. The immunogenic composition of claim 2, wherein the spike glycoprotein is a modified protein.

5. The immunogenic composition of claim 2, comprising two spike glycoproteins.

6. The immunogenic composition of claim 2, comprising three spike glycoproteins.

7. The immunogenic composition of claim 4, wherein the modified protein has a deletion at a furin cleavage site.

8. The immunogenic composition of claim 7, wherein the modified protein has a transmembrane domain from VSV.

9. The immunogenic composition of claim 4, wherein lysine residues and valine residues are replaced with proline residues in the modified protein.

10. The immunogenic composition of claim 9, wherein the modified protein has a transmembrane domain from VSV.

11. The immunogenic composition of claim 4, wherein the modified protein has lysine residues and valine residues replaced with proline residues and the modified protein has a deletion at the furin cleavage site.

12. The immunogenic composition of claim 4, wherein the modified protein has lysine residues and valine residues replaced with proline residues, and the modified protein has a deletion at the furin cleavage site, and has a transmembrane domain from VSV.

13. The immunogenic composition of claim 1, wherein the additional polypeptide has the amino acid sequence of SEQ ID NO: 22.

14. The immunogenic composition of claim 1, further comprising an adjuvant.

15. The immunogenic composition of claim 14, wherein the adjuvant is selected from the group consisting of cytokines, gel-type adjuvants, microbial adjuvants, adjuvants based on oil emulsions and emulsifiers, particulate adjuvants, synthetic adjuvants, polymeric adjuvants, and/or combinations thereof.

16. The immunogenic composition of claim 15, wherein the particulate adjuvant is an aluminum salt.

17. The immunogenic composition of claim 1, wherein the VLP is produced by: with a polypeptide comprising SEQ ID NO:3 and a first vector comprising the nucleotide sequence of SEQ ID NO: 6. 9, 12, 15, 18, 21, 24 or 27; and

culturing the host cell in a suitable medium under conditions that allow expression of the protein encoded by the vector.

18. The immunogenic composition of claim 1, wherein the VLP is produced by: with a polypeptide comprising SEQ ID NO:3, a first vector comprising the nucleotide sequence of SEQ ID NO:6, a second vector comprising the nucleotide sequence of SEQ ID NO:9 and a third vector comprising the nucleotide sequence of SEQ ID NO:12, and co-transfecting the host cell with a fourth vector of the nucleotide sequence of 12; and

culturing the host cell in a suitable medium under conditions that allow expression of the protein encoded by the vector.

19. The immunogenic composition of claim 1, wherein the VLP is produced by: with a polypeptide comprising SEQ ID NO:3 and a first vector comprising the nucleotide sequence of SEQ ID NO:25, and co-transfecting the host cell with a second vector of nucleotide sequence; and

Culturing the host cell in a suitable medium under conditions that allow expression of the protein encoded by the vector.

20. A method of treating a subject suffering from or at risk of developing a coronavirus infection comprising administering to the subject the pharmaceutical composition of claim 1.