CN116102640A

CN116102640A - Recombinant lactoferrin derived peptides and their use in enhancing immunity

Info

Publication number: CN116102640A
Application number: CN202211255669.6A
Authority: CN
Inventors: 赵策; 王晓娟
Original assignee: Zhejiang Double Sugar Biotechnology Co ltd
Current assignee: Guangdong Wanghe Biotechnology Co ltd
Priority date: 2022-10-13
Filing date: 2022-10-13
Publication date: 2023-05-12

Abstract

The invention discloses a recombinant lactoferrin derivative peptide, the amino acid sequence of which is shown as SEQ ID NO.1, and the coding sequence of which is shown as SEQ ID NO. 2. The recombinant lactoferrin derived peptide is obtained by constructing an expression vector, transferring the expression vector into an expression host, and culturing and expressing the expression host. The antibacterial activity of the composition for inhibiting escherichia coli, salmonella choleraesuis, salmonella typhimurium, salmonella enteritidis and staphylococcus aureus is proved by in vitro anti-pathogenic bacteria and antiviral experiments, and antiviral activity against influenza virus, measles virus and mumps virus, and in vivo experiments in mice prove that the anti-influenza virus has the effects of promoting proliferation of spleen lymphocytes of mice and comprehensively promoting secretion of IL-2, IL-4, IL-13 and TNF-alpha by the lymphocytes of the mice. Therefore, the recombinant derivative peptide Ta has broad-spectrum antibacterial and antiviral activity and also has the function of improving the immunity of mice.

Description

Recombinant lactoferrin derived peptides and their use in enhancing immunity

Technical Field

The invention relates to the technical field of lactoferrin peptides, in particular to a recombinant lactoferrin derived peptide and application thereof in improving immunity.

Background

Lactoferrin (abbreviated as lfmin) is a multi-skin tho that is released from lactoferrin in an acidic environment by pepsin action at the N-terminus, and after-research, it was found that lfmin is closely related to the functions of lactoferrin, and besides being unable to bind iron ions, lfmin has all the biological activities of lactoferrin, such as antibacterial, antiviral, cancer cell growth inhibition, anti-inflammatory and immune response participation. Lfcin does not contain rare amino acid and exogenous chemical components, is a healthy and safe product, and has the advantages of strong biological functions, high safety and the like, so that the Lfcin has great potential for replacing antibiotics.

Wherein, the LfcinB is derived from amino acid 17-41 of bovine lactoferrin and consists of 25 amino acid residues, and although the LfcinB has an immunoregulatory effect, the activation of the immune response of the LfcinB to the organism is mediated by immune chemokines, and the chemokines are combined with specific receptors on different immune cell membranes to guide the immune cells to the inflammation site so as to generate the immunoregulatory effect to the organism. However, secretion and expression of chemokines require defensin intervention, so that the activation of the immune response of the LfcinB to the body is significantly improved, and the immune response of the body cannot be directly promoted.

Disclosure of Invention

In view of the above, the present invention aims to provide a recombinant lactoferrin derived peptide, which can directly activate the immune response of the organism and improve the immunity of the organism.

In a first aspect, the embodiment of the invention discloses a recombinant lactoferrin derivative peptide, the amino acid sequence of which is shown as SEQ ID NO.1, and the coding sequence of which is shown as SEQ ID NO. 2.

In the embodiment of the invention, the recombinant lactoferrin derived peptide is obtained by constructing an expression vector, transferring the expression vector into an expression host, and culturing and expressing the expression host.

In the embodiment of the invention, the expression vector is pYC54-Ta, and the expression host is budding yeast.

In a second aspect, embodiments of the present invention disclose a method for biosynthesis of a recombinant lactoferrin derived peptide according to the first aspect, comprising the steps of:

constructing an expression vector of a target gene, wherein the expression vector is pYC54-Ta;

preparing a competent expression host, wherein the expression host is budding yeast;

transforming said expression vector into said expression host and obtaining a culture of transformants;

screening positive transformants which are budding yeast cells into which the expression vector is transferred and which can successfully express the recombinant lactoferrin derived peptide;

collecting the positive transformant, cracking thalli, purifying to obtain the recombinant lactoferrin derived peptide.

In the embodiment of the invention, the target gene is a nucleotide sequence shown as SEQ ID NO. 3.

In the embodiment of the invention, the target gene fragment is obtained by constructing an amplification plasmid p mu C19-L containing the gene shown as SEQ ID NO.2, and carrying out transformation expression to realize amplification.

In the embodiment of the invention, the construction method of the pYC54-Ta expression vector comprises the following steps:

pYC54 is transformed into competent escherichia coli DH10B, and the competent escherichia coli DH10B is coated on LB solid medium containing 100 mug/mL ampicillin, and is subjected to static culture in a constant temperature incubator at 37 ℃ for 16 hours, so that DH10B positive transformant colonies carrying the expression vector pYC54 grow out;

picking a positive transformant of a single colony, shake-culturing for 8 hours at 37 ℃ in an LB liquid medium of 100 mug/mL ampicillin, and detecting and recovering and extracting a pYC54 fragment by electrophoresis;

the pYC54 is cut by using restriction endonucleases Eco53kI and Not I, the enzyme cutting system is Eco53kI 1 muL, not I1 muL, 10 XB muffer TangoTM 2 mu L, pYC54 2 muL and dd water14 muL, and the system is evenly mixed and then subjected to water bath at 37 ℃ for overnight; after the enzyme digestion reaction is finished, performing electrophoresis detection on enzyme digestion products by using 1% agarose gel, and recovering and extracting enzyme digestion fragments;

the target gene fragment obtained by glue recovery is connected with linearization pYC54 by using T4 DNA ligase to construct a recombinant expression vector pYC54-Ta, and the reaction system is as follows: 1 mu L of T4 DNA ligase, 10 mu L of target gene Ta, 10 XB mu buffer Tango 2 mu L, pYC, 2 mu L of dd water and 5 mu L of dd water, uniformly mixing the systems, reacting for 3 hours at 16 ℃, and detecting an enzyme-linked product by electrophoresis to obtain the enzyme chain recombinant expression vector pYC54-Ta.

In an embodiment of the present invention, the step of screening the positive transformant includes extracting an expression vector thereof, and performing PCR identification, the PCR identification step including:

in F-p: ccagtcacgacgttgtaaaacg and R-p: accatctaattcaacaagaattgggacaac is a primer, the expression vector is subjected to PCR amplification, and a PCR reaction system is as follows: template 2. Mu.L, F-p 0.5. Mu.L, R-p 0.5. Mu.L, 2X Taq PCR Master Mix. Mu.L and dd water 7. Mu.L, reaction procedure: carrying out electrophoresis identification on the amplified product by carrying out 5min pre-denaturation at 94 ℃, 1min denaturation at 94 ℃, 45s annealing at 55 ℃, 1min extension at 72 ℃ and 10min final extension at 72 ℃ for 30 cycles.

In the embodiment of the invention, the biosynthesis method further comprises the step of carrying out induced expression on the positive transformant, specifically comprises the steps of inoculating the positive transformant into a seed culture medium for culture, transferring into a fermentation culture medium for fermentation, collecting fermentation liquor, cracking, purifying and freeze-drying to obtain the recombinant lactoferrin derivative peptide.

In a third aspect, the embodiment of the invention also discloses application of the recombinant lactoferrin derived peptide in preparing antibacterial, antiviral and immunity improving medicines.

Compared with the prior art, the invention has at least the following beneficial effects:

the embodiment of the invention sequentially synthesizes and amplifies target genes by designing an amino acid sequence and a coding sequence of the lactoferrin derived peptide, constructs a proper expression vector and an expression host to obtain the recombinant derived peptide Ta, and has antibacterial activity for inhibiting escherichia coli, salmonella choleraesuis, salmonella typhimurium, salmonella enteritidis and staphylococcus aureus and antiviral activity for resisting influenza virus, measles virus and mumps virus by in vitro anti-pathogenic bacteria and antiviral activity for resisting the influenza virus, measles virus and mumps virus by in vitro experiments, and has the effect of promoting proliferation of mouse spleen lymphocytes, comprehensively promoting secretion of IL-2, IL-4, IL-13 and TNF-alpha by the mouse lymphocytes, activating the mouse spleen lymphocytes without mediation of chemokines and intervention of defensins and promoting secretion of related anti-inflammatory factors by in vivo experiments of mice. Therefore, the recombinant derivative peptide Ta provided by the embodiment of the invention has broad-spectrum antibacterial and antiviral activity, has the function of improving the immunity of mice, and has wide prospect of being applied to preparing related antibacterial, antiviral and immunity-improving medicaments.

Drawings

FIG. 1 is a plate diagram of a pμC19—L positive transformant provided in an example of the present invention.

FIG. 2 is an electrophoretogram of a p.mu.C19-L double cleavage product provided by the examples of the present invention; lanes M are Marker, lane 1 is the product after digestion, lane 2 is the product without digestion, and lane 3 is the recovered target gene.

FIG. 3 shows an electrophoresis chart of the cleavage product of the recombinant expression vector pYC54-Ta provided by the embodiment of the invention, wherein the M lane is a Marker, the 1 lane is a product after the pYC54 is cleaved, and the 2 lane is a pYC54-Ta cleavage product.

FIG. 4 is a plate diagram of a pYC54-Ta-ATCC30142 positive transformant provided by an example of the present invention.

FIG. 5 is a laser confocal microscope image of pYC54-Ta-ATCC30142 positive transformants provided by the example of the present invention.

FIG. 6 shows the electrophoresis patterns of the inclusion bodies of the primary product (lane 1) after the induction expression of the recombinant polypeptide Ta provided by the embodiment of the invention after washing (lane 2), lysing (lane 3), ethanol fractional precipitation (lane 4), desalting (lane 5), ultrafiltration (lane 6) and freeze-drying (lane 7); lane 8 is Marker.

Detailed Description

In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention will be described in further detail with reference to the following examples. It should be understood that the specific embodiments described herein are for purposes of illustration only and are not intended to limit the scope of the invention.

Recombinant lactoferrin derived peptides and clone expression

The inventor of the invention can obtain a lactoferrin derivative peptide with an amino acid sequence shown as SEQ ID NO.1 by improving the existing lactoferrin peptide and adjusting part of amino acids, and designs a coding gene shown as SEQ ID NO.2 for cloning and expressing, so that the obtained recombinant lactoferrin derivative peptide Ta has antibacterial activity for inhibiting escherichia coli, salmonella cholerae, salmonella typhimurium, salmonella enteritidis and staphylococcus aureus and antiviral activity for resisting influenza virus, measles virus and mumps virus, and has the effect of promoting proliferation of mouse spleen lymphocytes and comprehensively promoting secretion of IL-2, IL-4, IL-13 and TNF-alpha of the mouse lymphocytes through in vivo experiments of mice. Therefore, the recombinant protein extension peptide Ta disclosed by the invention has the functions of comprehensively resisting bacteria and viruses and improving immunity, and has excellent application prospects for preparing related medicaments.

The physical and chemical parameters of the derivative peptide are calculated by using a calculation tool in The Antimicrobial Peptide Database and a ProtParam tool, the net charge number of the derivative peptide is between +7 and +9, the proportion of hydrophobic residues is between 51 percent, the molecular weight is 3236, the theoretical isoelectric point is 11.84, the fat index is 50.8, and the GRAVY is-0.70.

In proteins of large molecular weight, hydrophobic amino acids are usually hidden inside the protein, which is particularly important in maintaining protein stability and tertiary structure formation due to their hydrophobic interactions. According to the calculation method of ProtS cale, the overall hydrophobic value distribution of the derivative peptide is continuously increased from the N-terminal to the C-terminal, so that a remarkable amphipathic trend is formed, and the derivative peptide is ensured to have similar antibacterial activity as Lfcin B.

1. Materials and methods

1.1 Synthesis and cloning of the Gene of interest

Amplification and extraction of recombinant plasmid pμC19_L: the amplified plasmid pμC19_L containing the gene shown in SEQ ID NO.2 obtained above was transformed into E.coli DHSa competent cells, positive transformants were picked up and cultured in large amounts to amplify the plasmid, and amplified plasmid pμC19_L was extracted using Qiagen Plasmid Midi Kit (Sigma-Aldrich) as follows:

preparation of E.coli competent cells: taking out E.coli TOP10 (Solarbio) frozen at-80 ℃, thawing on ice, inoculating to LB solid medium by using an inoculating loop streak, culturing for 12-16 h in a constant temperature incubator at 37 ℃, picking up single bacterial colony, inoculating to LB liquid medium again, collecting bacterial cells when the OD600 value of the shake culture bacterial liquid reaches above 0.4 in a constant temperature shaker at 220r/min at 37 ℃, centrifuging for 10min at 1500 Xg, and discarding the supernatant; 1mL of 0.1M sterile CaC1 pre-chilled on ice was added ₂ The solution was gently resuspended, and after 30min treatment on ice, centrifuged at 1500 Xg for 10min at 4deg.C, the supernatant was discarded and 100. Mu.L of 0.1M sterile CaC1 pre-chilled on ice was added ₂ The solution is lightly resuspended to obtain competent E.coli TOP10 cells, which can be stored in a refrigerator at 4deg.C for further use or with 15% final concentration of glycerol to-80deg.C.

pμc19—l conversion: the LB solid medium after autoclaving was cooled to 45℃and ampicillin stock solution was added to the medium to a concentration of 100. Mu.g/mL, and after mixing, the plate was immediately poured and left to solidify for use as shown in FIG. 1.

Taking out the prepared escherichia coli competent cells in a refrigerator at the temperature of 4 ℃, placing the competent cells on ice for 5-10 min, and precooling; dissolving 1 μg of recombinant plasmid pμC19-L in 10 μL of sterile deionized water, sucking plasmid solution, adding escherichia coli competent cells, sucking and beating, mixing uniformly, standing on ice for 30min, standing on water bath at 42 ℃ for 90s, immediately standing on ice for 2min, adding 900 μL of LB liquid medium, and culturing at 37 ℃ for 45min under 120r/min in an oscillating manner; competent cells transformed by pμC19_L were collected by centrifugation at 1000 Xg for 5min, the pellet was plated on LB plates containing ampicillin, and the pellet was subjected to stationary culture at 37℃for 16 to 18 hours in a constant temperature incubator, followed by selection of positive transformants harboring amplified plasmid pμC19_L.

Extraction of amplified plasmid pμC19_L

1) The positive transformants were selected and inoculated into 100mL of LB liquid medium containing 100. Mu.g/mL of ampicillin, and cultured with shaking at 37℃for 220r/min for 10hm to obtain bacterial solutions of the transformants.

2) Collecting bacterial liquid, centrifuging at 4deg.C at 6000 Xg for 15min to obtain precipitate; re-suspending with 4mL B μffer P1 (Beijing Bai Albo Co., ltd., the same applies below), adding 4mL B μffer P2, mixing, standing at room temperature for 5min; adding 4mL of B μffer P3 again, mixing again, placing in ice bath for 15min, centrifuging at 20000 Xg at 4deg.C for 30min, and collecting supernatant (repeating operation of B μffer P1-P4 for 1 time); the supernatant was carefully applied to an adsorption column equilibrated with Biffer QBT (Shanghai Hengfi Biotech Co., ltd.), the column was washed twice with 10mL of Biffer QC (Shanghai Ke Ming Biotech Co., ltd.), plasmid DNA was eluted with Biffer QF (Shanghai Hengfi Biotech Co., ltd.), and the eluate was collected using a 50mL sterile centrifuge tube.

3) The plasmid eluate was collected, and after adding about 5 to 8% v/v of room temperature isopropanol thereto, and thoroughly mixing, it was centrifuged at 15000 Xg at 4℃for 30 minutes, and the supernatant was carefully discarded.

4) The pellet was washed with 2mL of 70% ethanol at room temperature and centrifuged at 15000 Xg for 10min at 4℃and the supernatant carefully discarded.

5) Drying the precipitate at room temperature for 5-10 min, dissolving the precipitate in a proper volume of standby TE B mu buffer after the ethanol is completely volatilized, and preserving at-20 ℃ for standby, thus obtaining the obtained plasmid solution, and detecting by using 1.5% agarose gel electrophoresis.

Amplifying the target gene:

the recombinant plasmid pμC19_L was digested with restriction endonucleases EcoRI and Not I to obtain a target gene fragment. The reaction system of double enzyme digestion is as follows: ecoR I1. Mu.L, not I1. Mu.L, 10 XB. Mu.buffer Tango ^TM 2 mu L, p mu C19-Ta10 mu L and dd water 6 mu L, and after the reaction system was mixed, the mixture was subjected to water bath at 37℃overnight; after the reaction, 2.2% agarose was used for coagulationAnd (5) detecting gel electrophoresis.

And (3) recycling the target gene Ta fragment gel:

1) Cutting the strip containing the target gene fragment of the derivative peptide from agarose gel, putting the agarose gel into a 1.5mL centrifuge tube, weighing, adding Bμffer G (Beijing Hua Xinkang Biotechnology Co., ltd.) with 3 times of gel volume, and putting the agarose gel into a water bath at 50 ℃ for 10min until gel blocks are completely dissolved; and continuously adding 1-time of isopropanol with the volume of the glue, and completely mixing uniformly.

2) Adding the above mixed solution into an equilibrated adsorption column, standing at room temperature for 2min, centrifuging at 12000 Xg for 1min, and pouring out waste liquid; adding 500 mu L B mu buffer G into an adsorption column, centrifuging at 12000 Xg for 1min, and pouring out waste liquid; adding 650 mu L B mu buffer W into the adsorption column, centrifuging at 12000 Xg for 1min, pouring out waste liquid, and centrifuging at 12000 Xg for 2min; placing the adsorption column into a clean 1.5mL centrifuge tube, adding 15 mu L B mu fferB in the center of the adsorption film, standing at room temperature for 1-2 min, centrifuging at 12000 Xg for 1min, collecting DNA solution in the centrifuge tube, and storing at-20 ℃ for later use; and (3) detecting the recovered derivative peptide target gene fragment by agarose gel electrophoresis.

1.2 construction of the vector for expressing the desired Gene pYC54-Ta

Transformation of competent E.coli cells with expression vector pYC 54:

taking out the preserved competent E.coli cells from-80℃and placing on ice for 10min, transforming competent E.coli DH10B cells (purchased from Shanghai Ji Biotechnology Co., ltd.) with pYC54 (ZYb science) according to the above method, and coating the cells on LB solid medium containing 100. Mu.g/mL ampicillin, and standing and culturing the cells in a 37℃incubator for 16h, wherein DH10B positive transformant colonies carrying the expression vector pYC54 are grown; the positive transformants of the single colony are picked up and cultured for 8 hours in LB liquid medium of 100 mug/mL ampicillin at 37 ℃ in a shaking way, pYC54 is extracted, and the detection is carried out by electrophoresis.

The pYC54 extracted from the upper section was subjected to double cleavage using restriction endonucleases Eco53kI and Not I, cleavage system: eco53kI 1. Mu.L, not I1. Mu.L, 10 XB. Mu.buffer Tango ^TM 2 mu L, pYC mu L,2 mu L of dd water, 14 mu L of the mixture was mixed and then the mixture was subjected to a water bath at 37℃overnight. Enzyme digestion reaction junctionAfter ligation, the digested products were electrophoretically detected using 1% agarose gel.

The derivative peptide gene fragment is enzymatically linked to pYC 54: the T4 DNA ligase is used for connecting the derivative peptide gene fragment obtained by glue recovery with linearization pYC54 to construct a recombinant expression vector pYC54-Ta, and the reaction system is as follows: t4 DNA ligase (Simer Feishul China) 1. Mu.L, target gene Ta 10. Mu.L, 10 XB. Mu.ffer Tango ^TM 2 mu L, pYC mu L,2 mu L dd water and 5 mu L, mixing the systems uniformly, reacting for 3 hours at 16 ℃, and detecting the enzyme linked product by electrophoresis to obtain the enzyme chain recombinant expression vector pYC54-Ta.

The recombinant expression vector pYC54-Ta is transformed into competent escherichia coli DH10B cells to obtain positive transformants, the positive transformants are inoculated into LB liquid medium containing 100 mug/mL ampicillin, shake culture is carried out for 8 hours at 37 ℃, and the recombinant expression vector pYC54-Ta is extracted according to the method, and PCR amplification and identification are carried out.

In F-p: ccagtcacgacgttgtaaaacg, SEQ ID NO.3 and R-p: accatctaattcaacaagaattgggacaac the primer shown in SEQ ID No.4 is used for PCR amplification of recombinant expression vectors pYC54-Ta and pYC54 respectively, and the recombinant expression vectors are inserted with target gene fragments at multiple cloning sites, so that the pYC54-Ta should have 75bp more gene fragments than the pYC54 through calculation, and the PCR reaction system is as follows: template 2. Mu.L, F-p 0.5. Mu.L, R-p 0.5. Mu.L, 2X Taq PCR Master Mix. Mu.L and dd water 7. Mu.L, reaction procedure: pre-denaturation at 94℃for 5min, denaturation at 94℃for 1min, annealing at 55℃for 45s, extension at 72℃for 1min, final extension at 72℃for 10min,30 cycles.

The extracted recombinant expression vector pYC54-Ta is sent to a biological company for sequencing identification, and is analyzed by comparing with the pYC54 sequence.

In addition, the invention also constructs pEsc-HIS and pLac-EGFP respectively as expression vectors of comparative examples by adopting the similar method.

1.3 transformation and expression of the recombinant expression vector pYC54-Ta

Preparation of competent budding yeast:

aureobasidium pullulans (black yeast) (purchased from Shanghai research and development industries, inc. ATCC 30142) are inoculated on a YPD plate, and subjected to stationary culture in a constant temperature incubator at 30 ℃ for 48-72 hours until single colonies grow; single colonies are selected and inoculated into YPD liquid culture medium, bacterial cells are collected when the temperature of 220r/min is 30 ℃ and the OD600 is 0.8, the single colonies are inoculated into 100mL of YPD liquid culture medium as seed liquid, the single colonies are cultured for 22-24 hours at the temperature of 220r/min and the OD600 is 0.8, the bacterial cells are collected after centrifugation for 5min at 1500 Xg at the temperature of 4 ℃, and 100mL of sterile deionized water precooled on ice is used for resuspension of the bacterial cells. Resuspension of the cells with sterile water, 0.68wt% sterile physiological saline and 1M glycol solution, packaging, and temporary storage at 4deg.C.

Electrotransformation of recombinant expression vector pYC 54-Ta:

the linearized recombinant expression vector pYC54-Ta was transformed into the genome of the budding yeast ATCC30142 using the electric shock method, in particular: 80 mu L of competent ATCC30142 cells and 10 mu L of linearization expression vector pYC54-Ta are sucked, uniformly mixed and transferred into a 0.2cm electric rotating cup precooled on ice; the electric rotating cup is subjected to ice bath for 5min, and a Bio-Rad electric converter is used for electric shock, and the electric rotating parameters are set as follows: voltage, 1500V; capacitance, 25 μF; resistance, 200Ω; taking out the electric rotating cup, immediately adding 1mL of 1M sterile glycol solution precooled on ice, and transferring the bacterial liquid into a sterile 1.5mL centrifuge tube; the bacterial liquid was spread on the prepared 1MD plate, and the bacterial liquid was allowed to stand and cultured in a constant temperature incubator at 30℃for 72 hours, and the transformant pYC54-Ta-ATCC30142 was allowed to grow as shown in FIG. 4.

Screening of pYC54-Ta-ATCC30142 positive transformants: since pYC54-Ta has a Yellow Fluorescent Protein (YFP) tag, only the growing transformant needs to be photographed by a laser confocal microscope and whether the bacterial cells generate yellow fluorescence or not is observed, and the positive transformant is generated when the bacterial cells generate the yellow fluorescence, as shown in FIG. 5.

Inducible expression of positive transformants:

and (3) carrying out induced expression on the positive transformant subjected to yellow fluorescence screening to obtain the positive transformant capable of efficiently expressing the Ta derivative peptide. The specific method comprises the following steps:

1) Selecting single colony of the preliminary positive transformant, inoculating the single colony to 25mL of seed culture, and carrying out breathable vibration culture for 16-18 h to OD600 = 1.0 based on 30 ℃ and 260r/min in a 100mL shaking flask; the seed culture medium comprises the following components: glucose 20g/L, yeast powder 2.5g/L, (NH) ₄ ) ₂ SO ₄ 0.6g/L、K ₂ HPO ₄ 5g/L、NaCL 1g/L、MgSO ₄ ·7H ₂ O 0.2g/L，pH 6.5。

2) Collecting seed solution, centrifuging at 1500 Xg at room temperature for 5min, re-suspending with seed culture medium to 10mL, mixing and collecting to 300mL, inoculating into fermentation tank containing 3mL fermentation medium, and shaking fermenting at 30deg.C under 400r/min and 3L/min ventilation (sterile air), wherein the fermentation medium is yeast powder 3g/L, (NH) ₄ ) ₂ SO ₄ 0.6g/L,K ₂ HPO ₄ 2g/L、NaCL 1g/L、MgSO ₄ ·7H ₂ O 0.2g/L、CaSO ₄ 0.05～0.1g/L、FeSO ₄ ·7H ₂ O5 mg/L, 0.03mg/L sodium molybdate dihydrate, biotin 0.02mg/L, biotin B9.02 mg/L, biotin B6 0.1mg/L, biotin B1.05 mg/L, biotin B2.05 mg/L, vitamin B3.05 mg/L, biotin B5.05 mg/L, biotin B12.001 mg/L, biotin K31mg/L, p-aminobenzoic acid 0.05mg/L and lipoic acid 0.05mg/L, and pH 3.8.

3) The fermentation time was 120h, and the cells were collected by centrifugation at 5000 Xg, and the expression level of the recombinant extension peptide Ta was detected by SDS-PAGE.

Purification of recombinant Ta:

1) 100ml lysis buffer (50 mmol/L Tris-HCl, pH8.0,0.5g/L lysozyme, 1% Triton X-100) was added per 25g of cells to suspend, and freeze-thawed 1 time at-20 ℃;

2) 10 mu/mL DNase was added and stirred at room temperature until no more viscous, the pellet was taken by centrifugation at 10000 Xg for 15min, washed 2 times with inclusion body wash (50 mmol/L Tris-HCl, pH8.0,0.5% Triton X-100, 50mL added per 10g pellet) and centrifuged at 10000 Xg for 15min.

3) Suspending the obtained inclusion body with inclusion body lysate (50 mmo/L Tris-HCl, pH8.0,8 mmole/L urea, 50mL for each 10g inclusion body), stirring overnight at 4deg.C, centrifuging 10000 Xg for 15min, discarding precipitate, slowly adding 2 times volume of glacial ethanol into the supernatant under stirring, standing at 4deg.C for 2h, centrifuging 10000 Xg for 15min, and retaining precipitate; 100mL 100mmol/L HCl was added per 6g protein, and the mixture was subjected to a water bath at 48℃for 72h.

4) The hydrolyzed solution was pH adjusted to 4.2 with 0.1mol/L NaOH and centrifuged at 10000 Xg for 15min.

5) Dialyzing and desalting the supernatant containing the target polypeptide at 4 ℃, performing ultrafiltration concentration by using a hollow fiber column with a molecular weight cut-off of 3000 (Millipore company of America), and centrifuging 5000g of concentrate to concentrate; the concentrated sample was lyophilized, the polypeptide powder was collected and weighed and stored at-20 ℃.

Mass spectrometry identification of recombinant polypeptide Ta: the recombinant polypeptide was sent to the Baitai park company for mass spectrometry. In vitro bacteriostasis experiment of recombinant polypeptide Ta:

1) In vitro anti-pathogenic bacteria

The recombinant polypeptide Ta was diluted in sequence to a plurality of concentration gradients of 2000. Mu.g/mL, 1000. Mu.g/mL, 200. Mu.g/mL, 100. Mu.g/mL, 50. Mu.g/mL, 10. Mu.g/mL, 5. Mu.g/mL and 1. Mu.g/mL in sterile 96-well plates, each gradient was taken at 10. Mu.L, mixed with 90. Mu.L of the previously prepared bacterial suspension, and 100. Mu.L of the bacterial suspension was taken as a positive control. Specifically, the bacterial suspension comprises: bacterial suspensions of escherichia coli ATCC25922, salmonella choleraesuis CMCC50020, salmonella typhimurium CMCC50013, salmonella enteritidis CMCC50041 and staphylococcus aureus ATCC25923, and the test strains were from the China general microbiological culture collection center. Sealing the 96-well plate in a constant temperature incubator at 37 ℃ for culturing for 18-24 h; the bottom of the 96-well plate was observed for bacterial precipitation, and the OD of each well was measured by MTT colorimetry using a Bio-Rad standard instrument ₅₇₀ The value is the bacterial concentration of each hole, and the minimum inhibitory concentration of the recombinant protein peptide Ta is calculated.

2) In vitro antiviral assay

Virus culture and TCID ₅₀ Is determined by: different concentrations of strain IV-A3 (influenza A3, purchased from the institute of viruses, department of medical science, china) were inoculated into monolayer cultures of MDCK cells (purchased from ATCC MDCK Cell Lines); the measles vaccine strain Shanghai 191 (Shanghai Biotechnology institute of health) was inoculated with a monolayer culture of VeroE6 cells (Shangen organism) at various concentrations; different concentrations of SP-a strain (mumps virus, purchased from institute of medical biology, academy of sciences of china) were inoculated into human diploid cell KMB17 cell strain; thereby forming different titers of IV-A3, 191 and SP-A virus solutions respectively.

By rounding, fusing and shedding cellsMeasuring TCID (tumor cell infection) of tissue cells with 50% cytopathy caused by each virus liquid by using pathological change effect (CPE) as index ₅₀ . Wherein, both cells are cultured in DMEM culture solution (Sieimer's fly) containing 10% calf serum (FCS) at 37 ℃ for 2-3 days for passage, and the second generation cells are used for virus planting.

Will be 1X 10 ⁴ MDCK, veroE6 and KMB17 cell suspensions at a volume of each mL were inoculated into 96-well cell culture plates at a concentration of 0.1 mL/well and 5% CO ₂ Culturing at 37deg.C for 24 hr, preparing each Ta,200 μg/mL reference substance morpholinoamidine hydrochloride (Mo, beijing Baoling Wired scientific Co., ltd.) with different concentrations by using 2.5% FCS-DMEM, and 4 times TCID ₅₀ IV-A3, 191 and SP-A virus solution. Mixing 0.25mL of each virus solution with equivalent recombinant derivative peptide Ta, chemically synthesized polypeptide Ta or morpholino guandine hydrochloride solution with different concentrations (25, 50 and 100 mu g/mL), respectively, acting at 37 ℃ for 1h, inoculating 3 holes in a 96-hole cell culture plate, and inoculating 0.2mL of 5% CO in each hole ₂ CPE fractionation was observed daily after 5 days of incubation at 37 ℃. Experiments set up 2 times TCID at the same time ₅₀ Concentration of infection control with each viral action. Simultaneously, the OD of each well is measured by a Bio-Rad standard instrument by using an MTT colorimetric method ₅₇₀ It is worth.

The embodiment of the invention also adopts pichia pastoris for transformation and expression, and carries out induction expression, and the method refers to the implementation process.

2. Results

The amplified plasmid pμC-SP-L3 and the double digestion products thereof are subjected to 2.2% agarose gel electrophoresis detection, the result is shown in FIG. 3, lane 1 is the double digestion products, and 89bp target gene fragment bands appear below the 100by band, which indicates that the target gene is successfully obtained. Lane 2 is the non-double digested recombinant plasmid pμC19-L, and an amplified plasmid band appears near the 2.7kb band, indicating successful plasmid extraction and double digestion. In FIG. 3, the products obtained by gel recovery were also subjected to 2.2% agarose gel electrophoresis, which demonstrates successful recovery of the gene fragment of interest.

And respectively taking pYC54 and a recombinant expression vector pYC54-Ta as templates to carry out PCR reaction, wherein the length of a PCR product of the pYC54 is 365bp, the length of a target gene of the inserted derivative peptide Ta is 75bp, and the length of a PCR product of the recombinant expression vector pYC54-Ta is 440bp. The result of 1.5% agarose gel electrophoresis after the PCR is finished is shown in FIG. 3, which shows that the target gene of the derivative peptide Ta is correctly inserted into pYC54.

As shown in FIG. 6, after induced expression, inclusion bodies are washed, cracked, ethanol fractional precipitation, desalting, ultrafiltration and freeze-drying, a fusion protein crude product with higher purity is obtained, and the target polypeptide obtained after purification is subjected to SDS-PAGE electrophoresis and coomassie brilliant blue G250 staining, so that the obtained polypeptide has higher purity. The examples and comparative examples all have been conducted to obtain recombinant polypeptide Ta. As shown in the figure, the molecular weight of the recombinant polypeptide obtained by purification is similar to the theoretical molecular weight 3236.

TABLE 1

Description of the embodiments	Target gene	Expression vector	Expression host
				Example 1	Ta	pYC54	Budding yeast
Comparative example 1	Ta	pEsc-HIS	Pichia pastoris
				Comparative example 2	Ta	pLac-EGFP	Coli bacterium
Comparative example 3	Ta	pYC54	Pichia pastoris
				Comparative example 4	Ta	pYC54	Coli bacterium

TABLE 2 MIC (μg/mL), "-" indicates undetected

Description of the embodiments	ATCC25922	CMCC50020	CMCC50013	CMCC50041	ATCC25923
						Example 1	1.5	1.3	2.7	1.3	1.6
Comparative example 1	92	106	79	86	95
						Comparative example 2	73	76	87	79	72
Comparative example 3	61	45	29	24	31
						Comparative example 4	49	36	36	33	29
Comparative example 5	162	172	－	－	－
						Amoxicillin	0.001	0.001	－	－	0.016

In order to study the different biological functions of the recombinant polypeptide Ta and the chemically synthesized polypeptide Ta provided by the embodiment of the invention, the invention also provides the chemically synthesized polypeptide Ta, the amino acid sequence of which is the same as that of the recombinant polypeptide Ta, provided by Shanghai Botai as a comparative example 5.

As can be seen from Table 2, the recombinant polypeptide Ta prepared in example 1 has lower MIC values for the five pathogenic bacteria, while the MIC values of comparative examples 1-4 for the five pathogenic bacteria are larger, which indicates that the recombinant polypeptide Ta provided in example 1 of the invention has better antibacterial effect for the five pathogenic bacteria. The comparison examples 1 and 2 both adopt different expression vectors and expression host cells, so that the obtained recombinant polypeptide Ta has a significantly higher bacteriostatic MIC value for five pathogenic bacteria than that of the example 1, while the comparison examples 3 and 4 adopt different expression vectors, and the obtained recombinant polypeptide Ta has a significantly higher bacteriostatic MIC value for five pathogenic bacteria than that of the example 1; thus, it is demonstrated that the use of the expression vector and expression host cells according to example 1 of the present invention is more advantageous for obtaining recombinant polypeptide Ta which produces more effective bacteriostatic effects. In addition, the polypeptide Ta chemically synthesized in comparative example 5, although having the same amino acid sequence as the recombinant polypeptide Ta, did not undergo a biosynthetic process, did not exert an influence on the three-dimensional structure of the polypeptide Ta, and thus did not have a remarkable bacteriostatic effect on CMCC50013, CMCC50041 and ATCC 25923.

In order to further explore the in vitro antiviral effect of the recombinant derived peptide Ta provided by the embodiment of the invention, the IV-A3, 191 and SP-A viruses are selected as test strains.

TABLE 3 OD detected by MTT method ₅₇₀ "-" means not detected

The results of the in vitro antiviral assay are shown in table 3. Table 3 shows that, except comparative example 5, examples 1 and comparative examples 1 to 4 each had a rescue effect on three virus-infected cells, and thus it was found that the recombinant polypeptides Ta provided in examples 1 and comparative examples 1 to 4 each had an antiviral effect, whereas the chemically synthesized polypeptide Ta provided in comparative example 5 had a significant effect on its three-dimensional structure due to the absence of folding effects by biological processes, thereby affecting its living activity. While comparative examples 1 and 2 both use different expression vectors and expression host cells, resulting in a recombinant polypeptide Ta having a lower antiviral effect than that of example 1, comparative examples 3 and 4 use different expression vectors, which also results in a lower antiviral effect than that of example 1. Thus, it is demonstrated that the use of the expression vector and expression host cells according to example 1 of the present invention is more advantageous for obtaining recombinant polypeptide Ta which produces more potent antiviral effects.

In vivo experiments

1. Materials and methods

1.1, laboratory animals

The SPF-class Kunming mice are 6 female, the average body mass (20+/-2) g, and the new medical word SCXK (New) 2011-00031 is provided by the laboratory animal center of Xinjiang medical university.

1.2 test

50 Kunming mice were randomly assigned to distilled water control, dosing group and dosing control group.

The distilled water control group was fed with 0.5mL distilled water per kg body weight per day, and was fed normally.

The administration group administered 50mg per day of the polypeptide Ta was provided in each of the above-described example 1 and comparative examples 1 to 5 per kg of body weight of the administration group.

The administration control group administered 300mg of compound Yizhu granule (national drug standard 220026711, xinjiang western medicine Co., ltd.) per kg body weight per day.

1.3 phagocytic Effect on mouse peritoneal macrophages

Experiments were performed for a total of 7 days, 3h after the last jar administration, 2% chicken erythrocyte suspension lmL was injected intraperitoneally into each mouse, and after 50min, the mice were sacrificed by taking off the neck, continuously injecting 0.9% sodium chloride solution 2m L intraperitoneally, gently kneading the abdomen about lmin, then sucking the abdominal cavity liquid l mL with a syringe, smear, 0.2 mL/piece, staining with reji dye solution, counting the number of macrophages phagocytizing chicken erythrocytes in 100 macrophages and the number of phagocytized chicken erythrocytes in each macrophage under an oil microscope.

The percent phagocytosis and phagocytosis index were calculated as follows:

percent phagocytosis%o = number of macrophages phagocytosed chicken erythrocytes per 100 macrophages x 100%; phagocytic index = total number of phagocytosed chicken erythrocytes per 100 macrophages

1.3 effects on IgG and IgM antibody levels in mouse serum

Serum was collected 2h after the last administration of each group of mice, and the content of IgG and IgM in the serum was measured by ELISA kit (shanghai constant distance organism).

1.4 Effect on mouse lymphocyte proliferation potency

Preparation of mouse spleen cell suspension: sterilizing cervical vertebrae removed mice, taking out spleen under aseptic condition, cleaning in sterile Hank's solution, shearing, filtering with 100 mesh stainless steel mesh sieve, washing filtrate with medium Hank's solution to obtain spleen cell suspension, centrifuging at 1000rpm for 10min, collecting precipitate, and concentrating with 0.83% NH ₄ CL resuspension, standing for hypotonic treatment for 2-3 min, removing erythrocyte, centrifuging at 1000rpm for 5min, collecting precipitate, washing with RPMI1610 nutrient solution (Haowei biotechnology Co., ltd.) for 3 times, centrifuging at 1000rpm for 5min, collecting precipitate, counting living cell number by trypan blue elimination method to above 95%, and regulating spleen cell concentration to 10 with RPMI1610 culture solution ⁶ And each mL.

Lymphocyte proliferation response: the spleen cell suspension prepared above was added to a 96-well culture plate at 1.50. Mu.L per well, and a control group, an experimental group and an LPS group were set. Except for a control group, 50 mu L of 40 mu g/mL LPS (Beijing Soy Bao technology Co., ltd.) and 50 mu L of 50 mu g/mL recombinant polypeptide Ta or 50 mu L of 300 mu g/mL compound one-branch Artemisia particle medicine liquid are respectively added into the pore plate, 50 mu L of RPM1610 culture solution is added into a cell control group, and 100 mu L of 40 mu g/mL LPS is added into the LPS group;

5 multiple wells were made in each group, and then 96-well plates were placed in 5% CO at 37deg.C ₂ Culturing in a saturated humidity incubator for 48h, fixing with 50 μl of 80% trichloroacetic acid (TCA), standing at room temperature for 5min, transferring to 96-well plate, fixing at 4deg.C for 1 hr, pouring out the fixing solution, cleaning with deionized water, spin-drying, and air-drying; mu.L of SRB solution was added to each well, and the mixture was left at room temperature for 10 minutes, and the SRB not bound to protein was washed with 1% acetic acid for 5 times and air-dried. mu.L of 10mmol/L of unbuffered Tris-lye (pH 10.5) was added to each well and the mixture was shaken for 5 minutes. The absorbance of each well was measured at 490nm by an ELISA reader, and the inhibition of lymphocyte proliferation by each concentration of the drug solution was calculated. Lymphocyte proliferation inhibition (%) = mean absorbance per control group x 100%.

1.5 Effect on IL-2, IL-4, IL-13 and TNF- α secretion by mouse spleen cells

The prepared mouse spleen cell suspension is subjected to experiments according to the experimental groups, wherein the temperature is 37 ℃ and the concentration of CO is 5% ₂ After 48 hours of incubation, the culture supernatants were collected and assayed for the levels of each cytokine using the methods described in IL-2, IL-4, IL-13 and TNF- α assay kit (Jiang Lai organism).

2. Results

TABLE 4 Table 4

As can be seen from Table 4, the experimental groups (except comparative examples 1, 2 and 5) and the administration control groups provided the polypeptide Ta which has different promotion effects on phagocytosis of macrophages in the abdominal cavity of mice and on secretion of IgG and IgM antibodies in the serum of mice. In contrast, the recombinant polypeptides Ta or chemically synthesized Ta provided in comparative examples 1, 2 and 5 each had no significant effect on the normal control group. In combination with the results of the above examples, the use of suitable expression vectors and expression host cells in the examples of the present invention has a significant impact on the three-dimensional structure and biological activity of the recombinant polypeptide Ta.

TABLE 5

In Table 5, the experimental group, the administration control group and the LPS group were each compared with the cell control group, and example 1 in the experimental group had a remarkable promoting effect on lymphocyte proliferation. In Table 5, the results of IL-2, IL-4, IL-13 and TNF- α secretion by mouse spleen lymphocytes. The implementation group, the administration control group and the LPS group are respectively opposite to the cell control group, have different promotion effects on the secretion of the four cell anti-inflammatory factors, but the administration control group and the LPS group can promote only one or two of the spleen lymphocytes of the mice, and the recombinant polypeptide Ta provided in the embodiment 1 can completely promote the secretion of the four anti-inflammatory factors of the spleen lymphocytes of the mice, so that the promotion effect on the immunity of the mice is comprehensive. Likewise, the secretion promoting effect of comparative examples 1 to 4 was not significant enough, and comparative example 5 had little promotion effect, which was associated with the use of different expression vectors and expression host cells during biosynthesis of these comparative examples 1 to 4, or it was merely chemically synthesized substance, and was not biologically active.

In summary, the embodiment of the invention sequentially synthesizes and amplifies target genes by designing an amino acid sequence and a coding sequence of the lactoferrin derived peptide, and constructs a proper expression vector and an expression host to obtain the recombinant derived peptide Ta, and the in vitro anti-pathogenic bacteria and antiviral experiments prove that the recombinant derived peptide Ta has antibacterial activity for inhibiting escherichia coli, salmonella cholerae, salmonella typhimurium, salmonella enteritidis and staphylococcus aureus and antiviral activity for resisting influenza virus, measles virus and mumps virus, and the in vivo experiments of mice prove that the recombinant peptide Ta has the effects of promoting proliferation of spleen lymphocytes of mice, comprehensively promoting secretion of IL-2, IL-4, IL-13 and TNF-alpha by the lymphocytes of the mice, activating spleen lymphocytes of the mice without mediation of chemokines and intervention of defensins, and promoting secretion of related anti-inflammatory factors.

Therefore, the recombinant derivative peptide Ta provided by the embodiment of the invention has broad-spectrum antibacterial and antiviral activity, has the effect of improving the immunity of mice, and has a broad prospect of being applied to preparing related antibacterial, antiviral and immunity-improving medicaments.

The present invention is not limited to the above-mentioned embodiments, and any changes or substitutions that can be easily understood by those skilled in the art within the technical scope of the present invention are intended to be included in the scope of the present invention.

Claims

1. A recombinant lactoferrin derivative peptide is characterized in that the amino acid sequence is shown as SEQ ID NO.1, and the coding sequence is shown as SEQ ID NO. 2.

2. The recombinant lactoferrin derived peptide of claim 1, wherein said recombinant lactoferrin derived peptide is obtained by constructing an expression vector, transferring said expression vector into an expression host, and culturing and expressing said expression host.

3. The recombinant lactoferrin derived peptide of claim 2, wherein the expression vector is pYC54-Ta and the expression host is budding yeast.

4. A method of biosynthesis of a recombinant lactoferrin derived peptide as claimed in any one of claims 1 to 3, comprising the steps of:

5. The method according to claim 4, wherein the target gene is a nucleotide sequence shown as SEQ ID NO. 3.

6. The biosynthesis method according to claim 5, wherein the target gene fragment is obtained by constructing an amplification plasmid pμC19_L containing the gene shown in SEQ ID NO.2, and performing transformation expression to amplify the same.

7. The method according to claim 6, wherein the construction method of the pYC54-Ta expression vector comprises:

8. The biosynthesis method of claim 7 wherein the step of screening the positive transformant comprises extracting its expression vector and performing PCR identification, the PCR identification step comprising:

9. The biosynthesis method of claim 7, further comprising the step of inducing the positive transformant to express, specifically comprising inoculating the positive transformant into a seed culture medium for culturing, transferring to a fermentation culture medium for fermentation, collecting fermentation broth, performing cleavage, purification and freeze-drying to obtain the recombinant lactoferrin derivative peptide.

10. Use of a recombinant lactoferrin derived peptide according to any one of claims 1-3 or a recombinant lactoferrin derived peptide synthesized by the biosynthetic method of any one of claims 4-7 in the preparation of a medicament for inhibiting bacteria, inhibiting viruses, and enhancing immunity.