CN116004808A - Marker for detecting early-onset schizophrenia and application thereof - Google Patents

Abstract

The invention belongs to the field of molecular diagnosis, and particularly relates to a molecular marker for detecting early-onset schizophrenia and application thereof. The invention provides a composition for detecting early-onset schizophrenia, which comprises a detection reagent for detecting the expression level of lncRNA shown as SEQ ID NO. 1. The composition of the present invention has 100% specificity, 90% sensitivity and 96.7% area under line (AUC) for early stage hair styling, and shows excellent diagnostic performance.

Description

Marker for detecting early-onset schizophrenia and application thereof

Technical Field

The invention belongs to the field of molecular diagnosis, and particularly relates to a molecular marker for detecting early-onset schizophrenia and application thereof.

Background

Schizophrenia is one of the most common clinical severe mental diseases, seriously harms the physical and mental health of human beings, and brings heavy burden to families and society. Early-onset schizophrenia (EOS) refers to schizophrenia that occurs before 18 years of age. Early-onset schizophrenia patients show more pronounced pre-prodromal neurodevelopmental abnormalities, a more severe familial genetic burden, and worse long-term prognosis than adult schizophrenia patients

At present, a diagnosis system which is purely symptomology is still a gold standard for diagnosing the schizophrenia, such as a manual of diagnosis and statistics of mental disorders (fifth edition) (DSM-5) and International Classification of diseases (ICD-10). However, the diagnosis method still mainly depends on clinical interviews of psychiatrists, and lacks objective physiological, biochemical and pathological indexes; the evaluation of the curative effect is mainly based on the change of symptomatology, and the subjective judgment is very easy to cause misdiagnosis and missed diagnosis.

It is difficult to obtain brain tissue of a living body of a patient suffering from schizophrenia, and even if biological changes are found in the central nervous system, it is difficult to be clinically popularized and applied. However, the molecular markers associated with the disease may fall off the tissue or cells and enter the blood as the disease progresses. The central nervous system can also influence the gene expression in peripheral blood by means of cytokines, neurotransmitters and hormones, even in the form of exosomes (exosomes) and the like.

Although there have been molecular markers for diagnosis and efficacy evaluation of early-onset schizophrenia based on genes in plasma and serum, including non-coding RNAs such as miRNA, circRNA. Studies have found that most of the mirnas in circulating plasma are present in plasma exosomes and microvesicles, but not in plasma without extracellular vesicles; in addition, the membrane of the exosome can effectively protect the internal non-coding RNA from RNase, so that the non-coding RNA derived from the exosome is more reliable than the circulating non-coding RNA in body fluids such as blood and the like, and has stronger application potential of diagnostic molecular markers. Numerous studies have reported that, under pathological conditions, the expression levels of many exosomes lncRNA are significantly different from normal control groups, indicating that exosomes can selectively package, secrete and transport lncRNA and specifically exert biological functions.

Therefore, there is a need in the art for a marker of lncRNA that can perform early diagnosis of early-onset schizophrenia, and has high sensitivity and good specificity.

Disclosure of Invention

In view of this, in a first aspect, the present invention provides a composition for detecting early-onset schizophrenia, comprising a detection reagent for detecting the expression level of lncRNA as shown in SEQ ID No. 1.

The UCSC ID of the lncRNA is ENST00000653358, and the specific sequence is as follows:

CAGGCAUGAGCCACCGCGCCCAGCCAAAAUAGUUUCUUUAACAUAACCAUGCUUAUACCAAUGCAGUACUAAAAUAUAAUUUGUAUAUAUUUUCAUGAAGGAAGGGACCCACAAAGGCAAGUGCCUAGGACCCACACAAAUCACAGUGUGGCUCUUGCUCCAACCAUGGGAGAAGCCACAGAAGAGCAUUCCAGGCAGAGGGCACGGCAAGUGCAAAGGUUCUGAGGUGGGAAUGAGCUGGACAUGUUUGAGAAACAGCAAGAAGGACCUCAAGUGAGCCCACAUUGGCAGUGACAAUCAGAAUGUCAAAAUGUCUCAGAGGAUUUCUAGGAAAUCUGUGGCACUUCACGAAGAGGCUGCCCCGGGUGAGAGACCAGCCAGAGUGAAUCGUUAAUACACUUCCCAGGAAGGGGGAUUCUUCUGAAAUGCUAAUACAAUCAACUGCAAGGCAAACUUCAAGCUUCUUUUUCAGUGAUCAGAGAGGCCCUCCCAGAGCAAGGAUGCUCUCCACUGUGCAAGCUAAAGGCCCUACUUUCUCACCCAGCCUUUUCUGGGGAGGAGAAACACAUCCUCACCACAUUGCAGCUGCCCUGCGAGGGCUGCAGGUAUUGUGUGUCCCCACCAGCCAGGGCAGUUCCCAGACAGACUCUGGCUGCCUGGACCCAGGUCUGCUCCAAGGAAGCAGCACGUUUCUGGAGGAGGCUUAGCCAAGAAACCAUUACGGAGUGAGAGAGGAGUUAUCUGGAUAAAUGCGGAACUGCCCAACUCCUAGCAUUUGUUCCUGGGACCCAGGCUGUAACAUCCUCUG GAGCCAAACUGCCUCUGUUCAAACCCUUGUCCCCGCACUCCACCUCCUAGCUGUGUGGCACUG(SEQ ID NO.1)。

the composition of the present invention has 100% specificity, 90% sensitivity and 96.7% area under line (AUC) for early stage hair styling, and shows excellent diagnostic performance.

In some specific embodiments, the expression level is measured by means of amplification-sequencing, chip, fluorescent quantitative PCR.

In some specific embodiments, detection reagents include, but are not limited to, nucleic acid primers, sequencing Tag sequences, for measuring expression levels by amplification-sequencing.

In some specific embodiments, the detection reagent includes, but is not limited to, a chip that is a gene expression profiling chip with probes that specifically bind to mRNA, lncRNA.

In some specific embodiments, detection reagents include, but are not limited to, nucleic acid primers and/or nucleic acid probes for measuring expression levels by fluorescent quantitative PCR.

Further, the detection reagent also comprises an internal standard primer and an internal standard probe.

Further, the above composition may further include the remaining reagents, specifically, for example, various reagents required for pretreatment or pretreatment of the sample. For example, nucleic acid releasing agents of sample lncRNA are extracted.

In some specific embodiments, the detection reagent is as shown in table 1:

TABLE 1

In a second aspect, the invention provides the use of a composition as described above in the manufacture of a kit for the detection of early-onset schizophrenia.

Further, the invention provides application of the composition in preparation of a kit for detecting early-onset schizophrenia by using blood nucleic acid.

In some specific embodiments, the blood nucleic acid is free nucleic acid in blood, nucleic acid in peripheral blood, nucleic acid in plasma, nucleic acid in serum, and nucleic acid in blood exosomes.

In some specific embodiments, the nucleic acid is lncRNA.

In a third aspect, the present invention provides a kit for diagnosing early-onset schizophrenia comprising 1) a composition as described above; 2) A description comprising instructions for diagnosing early-onset schizophrenia by the composition.

In some specific embodiments, the diagnosis of early onset schizophrenia is described as: according to the result of qPCR verification in independent samples, the Ct value range is 27-32, and the Ct value range of the patients with early-onset schizophrenia is 32-36, so that the Ct value 32 can be used as a diagnosis standard, and the Ct value is larger than 32 for the patients with early-onset schizophrenia.

In some specific embodiments, the diagnosis of early onset schizophrenia is described as: according to the result of qPCR verification in independent samples, the range of the detected Ct value in the peripheral blood exosome of the healthy teenagers is 27-32, and the Ct value of the early-onset schizophrenia patient is 32-36, so that the Ct value 32 can be used as a diagnosis standard, and the Ct value is more than 32 as the early-onset schizophrenia patient.

In a fourth aspect, the present invention provides a method for detecting the expression level of the molecular marker in peripheral blood plasma, comprising the following steps:

1) Collecting a peripheral blood plasma sample;

2) Extracting exosomes and extracting total RNAs;

3) The expression level of the molecular marker is detected using the above composition.

The step 3) may be RNA whole transcriptome sequencing or chip or qPCR method.

Further, the present invention provides a method for detecting the expression level of the above molecular marker in a sample for non-diagnostic purposes, comprising the steps of:

1) Collecting a peripheral blood plasma sample;

2) Extracting exosomes and extracting total RNAs;

3) The expression level of the molecular marker is detected using the above composition.

The step 3) may be RNA whole transcriptome sequencing or chip or qPCR method.

Drawings

FIG. 1 is a graph showing the results of expression levels of ENST00000653358 revealed by transcriptome sequencing in early-onset insemination;

FIG. 2 is a graph of the results of an ENST00000653358 diagnostic efficacy assessment;

FIG. 3 is a graph showing the results of expression levels of ENST00000653358 in non-early-onset sperm separation revealed by transcriptome sequencing.

Detailed Description

The advantages and various effects of the present invention will be more clearly apparent from the following detailed description and examples. It will be understood by those skilled in the art that these specific embodiments and examples are intended to illustrate the invention, not to limit the invention.

Example 1 method for detecting early-onset schizophrenia

1. Separation of exosomes

The plasma exosomes were isolated by ultracentrifugation, as follows:

1) The samples were melted at 37 ℃.

2) The sample was transferred to a new centrifuge tube, 2000 Xg, 4℃and centrifuged for 30min.

3) The supernatant was carefully transferred to a fresh centrifuge tube, 10,000Xg, 4℃and centrifuged again for 45min to remove larger vesicles.

4) The supernatant was filtered through a 0.45 μm filter membrane, and the filtrate was collected.

5) The filtrate was transferred to a new centrifuge tube, an overspeed rotor was selected, and centrifuged at 100,000Xg for 70min at 4 ℃.

6) The supernatant was removed, and after resuspension with 10mL of pre-chilled 1 XPBS, the overspeed rotor was selected, again at 4℃and 100,000Xg, and ultracentrifuged for 70min.

7) The supernatant was removed, resuspended in 150. Mu.L of pre-chilled 1 XPBS, 20. Mu.L of electron microscopy, 10. Mu.L of particle size, 20. Mu.L of fluorescence, 10. Mu.L of protein extraction and the remaining exosomes were stored at-80 ℃.

2. Exosome identification

2.1 Transmission Electron microscopy

1) The exosomes were removed by 10 μl.

2) 10 mu L of the sample is sucked and dripped on a copper net to be precipitated for 1min, and the floating liquid is sucked by filter paper.

3) The uranyl acetate 10 mu L is dripped on a copper net to be precipitated for 1min, and the filter paper is used for sucking off the floating liquid.

4) Drying at normal temperature for several minutes.

5) And (3) performing electron microscope detection imaging at 100 kv.

6) And obtaining a transmission electron microscope imaging result.

2.2 particle size analysis

1) The exosomes were withdrawn 10 μl diluted to 30 μl.

2) The exosome sample can be loaded after the instrument performance test is qualified by using the standard substance, and the sample is required to be subjected to gradient dilution to avoid the sample blocking the sampling needle. Shanghai Decode life science institute

3) And obtaining the information of the particle size and concentration of the exosomes detected by the instrument after the sample is detected.

2.3WB protein index detection

1) The exosomes were fused at medium speed at 37 ℃ and rapidly added with 5 x RIPA lysate.

2) After mixing, cracking on ice for 30min, and mixing evenly.

3) Preparing a standard sample for measuring the protein concentration by the BCA method, and adding 5 mu L of the sample into the BCA mixed solution, and uniformly mixing.

4) Incubation was carried out at 37℃for 30min, absorbance was measured on a microplate reader at OD562 nm and recorded.

5) And calculating the protein concentration of the sample to be detected according to the standard curve.

6) Preparing SDS PAGE electrophoresis gel with concentration of 10% or 15% according to the size of the protein of the sample to be detected; after the electrophoresis device is assembled, a proper amount of Running Buffer is added.

7) Taking out a protein sample, boiling in a constant-temperature metal bath for 3-5 min, and centrifuging to throw off; protein samples and protein Maker were added to the wells of the electrophoresis gel in the desired order with a pipette or loading needle.

8) The tank cover is covered, a power supply is turned on, 80V glue is run until the sample runs out of concentrated glue, and 100V glue is run until bromophenol blue is run to the bottom of the glue.

9) Taking out the electrophoresis gel after electrophoresis, trimming the size of the gel, cutting off the edges and redundant parts, and marking the left lower corner cut angle; and cutting PVDF film of corresponding size according to the size of the trimmed glue, marking at the lower left corner cutting angle, activating for 20s in a proper amount of methanol, and then soaking in precooled film transfer buffer solution.

10 Cutting 8 pieces of filter paper into 8cm×10cm size, and soaking in pre-cooled transfer membrane buffer solution; the transfer membrane "sandwich" was made in the order of sponge-filter-electrophoresis gel-membrane-filter-sponge.

11 Adding a film transfer buffer solution into a tank, assembling a film transfer device, adding floating ice, burying the device in an ice bath or placing in a refrigerator, turning on a power supply, transferring films at 300mA, and determining film transfer time according to the size of the protein to be detected, wherein the general rule is 1 kd=1 min.

12 After finishing the film transfer, taking out the PVDF film, soaking the film in 5% skimmed milk TBST with the protein surface upwards, and sealing for 1h.

13 Primary anti-blocking: the membrane after milk sealing is cut according to the requirement, the membrane is soaked in the prepared primary antibody solution (the dilution ratio of the antibody is 1:1000), and the membrane is incubated overnight at 4 ℃.

14 Primary antibody was recovered, and the membrane was washed with 20mL TBST at room temperature for 10min, and repeated three times.

15 Selecting a secondary antibody according to the primary antibody, preparing the secondary antibody into a 5% skimmed milk TBST solution according to a ratio of 1:5000, soaking the membrane in the secondary antibody solution, and incubating at room temperature for about 1h.

16 Secondary antibody was recovered, and the membrane was washed with 20mL TBST at room temperature for 10min, and repeated three times.

17 Taking out the PVDF film, draining off water, spreading the protein surface on the preservative film, dripping the ECL A/B liquid mixture with equal volume on the film, and reacting for 5min in a dark place; the film is clamped and transferred into the plastic packaging film, and the protein surface is always upward.

18 Placing the film in an imager, setting parameters, and starting exposure; and adjusting brightness and contrast, and storing the picture.

2.4 fluorescent labeling and nanoflow detection

1) mu.L of the exosomes were diluted to 60. Mu.L, and 30. Mu.L of the diluted exosomes were added to 20. Mu.L of the fluorescent-labeled antibodies (IgG, CD9, CD 63), mixed well and incubated at 37℃for 30min in the absence of light.

2) 1mL of precooled PBS was added, an overspeed rotor was selected, and ultracentrifuged at 4℃for 70min at 110,000Xg.

3) The supernatant was carefully removed, 1mL of pre-chilled PBS was added, the overspeed rotor was selected, and the system was ultracentrifuged at 4℃again, 110,000Xg, for 70min.

4) The supernatant was carefully removed and resuspended with 50. Mu.L of pre-chilled 1 XPBS.

5) The exosome sample can be loaded after the instrument performance test is qualified by using the standard substance, and the sample is required to be subjected to gradient dilution to avoid the sample blocking the sampling needle.

6) And (5) obtaining the protein index detection result of the NanoFCM instrument after the sample is detected.

2.5RNA extraction and concentration determination

2.5.1RNA extraction

1) After thawing the RNA lysate, the RNA lysate was left at room temperature for 5min. .

2) 140 μl of chloroform was added and vortexed for 15s.

3) Incubate for 3min at room temperature, 4 ℃,12000g, centrifuge for 15min (pre-chill centrifuge, immediately return to room temperature after this step).

4) The upper aqueous phase was transferred to a new EP tube (avoiding aspiration into the middle layer), 1.5 volumes of absolute ethanol (typically 525. Mu.L) were added and mixed by gun aspiration.

5) mu.L of the mixture (including all precipitates) was aspirated, transferred to an RNeasy column, centrifuged at 8000g for 15s at room temperature, the filtrate was discarded (collection tube was reused, the same applies below), and the remaining mixture was repeated.

6) The column was washed with 700. Mu.L Buffer RWT, centrifuged at 8000g for 15s at room temperature and the filtrate was discarded.

7) The column was washed with 500. Mu.L Buffer RPE, centrifuged at 8000g for 15s at room temperature and the filtrate was discarded.

8) The adsorption column was washed with 500 μLBuffer RPE, centrifuged at 8000g for 2min at room temperature, and the filtrate and collection tube were discarded (carefully remove the column, avoid touching the filtrate, residual alcohol).

9) The column was transferred to a fresh 2mL fresh centrifuge tube (self-contained), 12000g was centrifuged for 1min for drying, and the filtrate and collection tube were discarded.

10 Transfer the column to a 1.5mL fresh centrifuge tube, add 30. Mu.L RNase-free water to the middle of the adsorption membrane, centrifuge 8000g for 1min, and elute RNA.

11 Immediately transferred to-80 ℃ refrigerator for cryopreservation and sample information is registered.

2.5.2RNA concentration determination

The extracted RNA was stained by taking 1. Mu.L each, and the RNA concentration was measured on Quantus Fluorometer.

2.6RNA Qsep100 detection

According to the concentration of RNA, a proper amount of RNA stock solution is diluted by an NR1 clamp matched diluent, and after dilution, the machine is used for detection, and the RNA with qualified quality inspection can be used for subsequent lncRNA detection

The subsequent detection of lncRNA with UCSC ID ENST00000653358 can be divided into three methods, respectively:

1. transcriptome sequencing method detection

a) The Total RNA obtained by extraction was subjected to library construction using a microsampled strand-specific kit, and the concentration of the constructed library was measured using a Qubit 2.0Fluorometer and the library fragment size was measured by Agilent 2100.

b) Sequencing on a machine. And after the library is qualified, carrying out Illumina sequencing on different libraries according to the effective concentration and the requirement of target off-machine data volume. The basic principle of sequencing is sequencing-by-synthesis (Sequencing by Synthesis). Four fluorescence-labeled dNTPs, DNA polymerase and a linker primer are added into a sequenced flow cell for amplification, when each sequencing cluster extends a complementary strand, each fluorescence-labeled dNTP is added to release corresponding fluorescence, and a sequencer captures a fluorescence signal and converts the optical signal into a sequencing peak through computer software, so that sequence information of a fragment to be detected is obtained.

c) And (5) controlling the quality of the data of the machine. Raw data obtained by sequencing contains a small amount of reads including linker information, low-quality bases or undetected bases, and in order to ensure the quality of information analysis, fine filtration is required for raw reads to obtain clean reads, and subsequent analysis is performed based on the clean reads. Data processing uses Fastp software.

The data processing steps are as follows:

(1) Removing a read pair with a adapter (adapter);

(2) When the proportion of N (N represents undetermined base information) in the single-ended sequencing read is greater than 10%, the pair of reads needs to be removed;

(3) When the low quality (less than 5) base number contained in a single-ended sequencing read exceeds 50% of the length proportion of the strip, the pair of reads needs to be removed.

d) Reference genome alignment

Reads were aligned using HISAT2 software based on Ensembl release 102GRCh38 version of the reference genome.

e) lncRNA identification and quantification

Transcript construction is carried out by using Stringtie software by using comparison files, annotated and candidate lncRNA transcripts are obtained by comparing gffcompare with human genome annotation files, transcripts with the length of more than 200nt are selected as candidate lncRNA transcripts, coding capacity prediction is carried out on lncRNA by using 4 kinds of software including CPC2, CNCI, pfam and FEElnc, at least 3 kinds of software are filtered to predict encodable transcripts, and new lncRNA is obtained. lncRNA (known + unknown) was quantified and annotated by featureCounts.

f) lncRNA differential expression analysis

Differential lncRNA analysis between samples was performed using DESeq 2.

g) ROC curve

ROC curves were plotted in R software using the pROC package. The results are shown in fig. 2, auc=0.967, 100% specificity, 90% sensitivity, lncRNA with UCSC ID ENST00000653358, were able to distinguish between early onset schizophrenic patients and typical developing adolescents.

lncRNA chip method detection

a) lncRNA detection was performed according to Arraystar Human LncRNA Expression Array V5.0.0 or custom chip instructions, with the following steps outlined below: cDNA synthesis; cy 3-labelling; chip hybridization, washing and scanning; and (5) data extraction.

b) And calculating the expression quantity of lncRNA with UCSC ID of ENST00000653358 in different samples, and carrying out statistical analysis.

qPCR method detection

(a) Reverse transcribing the extracted Total RNA into cDNA by using a random primer;

(b) The qPCR reaction system was configured as follows:

(c) qPCR reactions were performed as follows:

95℃30s

melting curve

(d) The Ct value of lncRNA with UCSC ID of ENST00000653358 was calculated and the relative expression amount was calculated.

Example 2 detection results of test samples of the inventive composition

Following the procedure described in example 1, exosome ENST00000653358 expression levels were found to be significantly lower in EOS patients than in the control group by transcriptome sequencing. As particularly shown in fig. 1.

Further, the inventors verified the results of their detection of the sample. Efficacy of ENST00000653358 in distinguishing control and EOS patients was assessed by subject work profile analysis. According to the analysis result, the specificity of the ENST00000653358 diagnosis is 100%, the sensitivity is 90%, the area under line (AUC) is 96.7%, and good diagnosis efficiency is shown, and the specific result is shown in FIG. 2.

In addition, we detected the expression level of ENST00000653358 in peripheral blood exosomes of 6 adolescents (less than 18 years old) using qPCR method based on SYBR Green I, where the Ct value of ENST00000653358 of one adolescent was greater than 32, and initially judged as an early onset schizophrenic patient, after which the adolescent was determined to suffer from early onset schizophrenic by clinician evaluation.

Comparative example 1 detection results of the composition of the present invention in non-early-onset semen

We collected samples of normal schizophrenic patients (SCZ) and examined the expression level of lncRNA with UCSC ID ENST00000653358, and the results show that there is no difference (P > 0.05) in the expression level of ENST00000653358 of SCZ patients compared with the control samples. Further, the inventors have validated the sample, indicating that the composition of the present invention cannot be used to identify non-early onset semen.

Claims (10)

1. A composition for detecting early-onset schizophrenia, comprising a detection reagent for detecting the expression level of lncRNA as shown in SEQ ID No. 1.

2. The composition of claim 1, wherein the expression level is measured by means of amplification-sequencing, chip, fluorescent quantitative PCR.

3. The composition of claim 1, wherein the detection reagent is a primer pair as shown in SEQ ID nos. 2 to 3.

4. The composition of claim 1, further comprising reagents required for pre-treating or pre-treating the sample.

5. Use of a composition according to any one of claims 1 to 4 in the manufacture of a kit for the detection of early-onset schizophrenia.

6. Use of the composition according to any one of claims 1 to 4 for the preparation of a kit for detecting early-onset schizophrenia using blood nucleic acids.

7. The use according to claim 6, wherein the nucleic acid is lncRNA.

8. A kit for diagnosing early-onset schizophrenia, which comprises

1) The composition of any one of claims 1 to 4; and

2) A description comprising instructions for diagnosing early-onset schizophrenia by the composition.

9. The kit of claim 8, wherein the diagnosis of early onset schizophrenia is described as: according to the result of qPCR verification in independent samples, the Ct value range is 27-32, and the Ct value range of the early-onset schizophrenia patient is 32-36, so that the Ct value 32 can be used as a diagnosis standard, and the Ct value is larger than 32 for the early-onset schizophrenia patient.

10. A method for detecting the expression level of a molecular marker with non-diagnostic purpose in a sample comprises the following steps:

1) Collecting a peripheral blood plasma sample;

2) Extracting exosomes and extracting total RNAs;

3) And detecting the expression quantity of the lncRNA shown in SEQ ID NO. 1.

Images