CN115957187A - Lipid nanoparticle composition and drug delivery system prepared from same - Google Patents

Abstract

The invention provides a novel ionizable cationic lipid molecule, a lipid nanoparticle composed of the lipid molecule, a neutral lipid molecule, a cholesterol lipid molecule and a PEG lipid molecule, and a composition containing the lipid nanoparticle. The lipid nanoparticle serving as a delivery carrier of an active ingredient has the advantages of small and uniform particle size, high encapsulation efficiency and high cell transfection efficiency, and is particularly suitable for delivery carriers of nucleic acid molecules (such as mRNA).

Description

Lipid nanoparticle composition and drug delivery system prepared from same

Technical Field

The invention belongs to the technical field of biological medicine preparations, and particularly relates to a lipid nanoparticle containing a novel lipid compound, and a pharmaceutical composition or a drug delivery system, such as an mRNA vaccine, which is prepared from the lipid nanoparticle and carries an active ingredient.

Background

Different types of nucleic acid preparations are being developed for the treatment of a variety of important diseases such as infectious diseases, cancer, rare diseases, and the like. Such nucleic acid preparations include: DNA, antisense nucleic Acids (ASO), small interfering RNA (siRNA), microrna (miRNA), small activating RNA (saRNA), messenger RNA (mRNA), aptamers (aptamer), ribozymes (ribozymes), and the like. Among them, mRNA vaccines have subversive advantages in terms of safety, rapid preparation and immunogenicity. Based on the development of mRNA modification and delivery tools, once the viral antigen sequences are obtained, mRNA vaccines with clinical scale can be rapidly designed and manufactured within weeks, and standardized production can be achieved, making it very attractive in dealing with pandemic outbreaks. And the mRNA vaccine has no potential reversion risk of attenuated vaccine; the problem of recovery mutation of the inactivated vaccine does not exist. In terms of immunogenicity, mRNA vaccines are able to induce B-cell and T-cell immune responses, to elicit an immunological memory effect, to deliver more potent antigens, and to express multiple antigens at once. In addition, mRNA can efficiently express antigenic protein only by penetrating cell membranes and in cytoplasm; the mRNA has no risk of integration of the gene into the genome. Thirdly, mRNA is easily degraded after being translated into protein, the safety of mRNA drugs is ensured by the transient expression characteristic, the dosage of the mRNA drugs is controllable, and the antigen immune tolerance (the state of no response to specific antigen) caused by long-term exposure of vaccine drugs is avoided.

However, on one hand, nucleic acid preparations are negatively charged and are mostly large in molecular weight and difficult to directly enter cells, and on the other hand, RNA is unstable and is extremely easy to degrade by nuclease in the process of being introduced into the body, so that the biological function is lost. Therefore, the development of an efficient, safe and versatile nucleic acid delivery system is an urgent problem to be solved in the process of nucleic acid drug transformation.

Currently, methods of nucleic acid delivery include chemical modification, bioconjugation techniques, nanocarrier techniques, lipid-based formulations, exosomes, spherical nucleic acids, DNA nanostructures, stimulus-responsive polymer nanomaterials, and the like. The mature nucleic acid delivery carrier is Lipid Nanoparticles (LNP), an LNP-coated siRNA drug Onpattro (paclitaxel) is approved to be marketed in 2018, an LNP-coated mRNA vaccine has been formally approved by FDA in 2021 and applied to the control of new crown epidemic situations, and clinical results show high effectiveness and no serious adverse reaction exists at present.

The lipid preparation mainly comprises the following components: cationic/ionizable lipids, helper lipids, cholesterol, and polyethylene glycol-lipid conjugates. Of these four lipid components, the charged head of the cationic lipid can bind to negatively charged nucleic acids and also to phospholipid molecules on the cell membrane, playing a key role in both the nucleic acid encapsulation and membrane fusion processes. In view of the potential toxicity of permanent cationic lipids, lipid nanoparticles of ionizable cationic lipids have greater utility.

Ionizable cationic lipids include three important structural components: an amine group-containing hydrophilic polar head; a hydrophobic lipid chain; a linking chain responsible for linking the polar head and the non-polar tail. Currently, the commercially available ionizable cationic lipids are mainly of the MC3 series and ALC-0315, SM-102 for the new coronary mRNA vaccine. Among them, MC3 has strong liver targeting and will be limited in its application to nucleic acid preparations that may have potential hepatotoxicity, and MC3 was developed for siRNA delivery with smaller molecular weight and may have a limitation in its loading for nucleic acid preparations with larger molecular weight. The delivery efficiency of ALC-0315 and SM-102 need to be further improved. Therefore, in order to further advance the development of lipid preparations in China and the application of the lipid preparations in aspects of nucleic acid drug delivery and the like, a new ionizable cationic lipid needs to be developed, and a new nano delivery system needs to be screened and optimized to realize safe and efficient delivery of nucleic acid, for example, safe and efficient delivery of mRNA vaccine components.

Disclosure of Invention

In order to solve the problems of structural instability, susceptibility to degradation by nucleases and difficulty in cell entry of active ingredients, such as nucleic acids (e.g., mRNA molecules), in biological applications, new delivery technologies need to be developed. In addition, the problems of poor lysosome escape and low delivery efficiency exist in the prior delivery technology, and the invention is based on newly synthesized ionizable cationic lipid molecules to form various functional diversified lipid-based delivery systems.

In a first aspect of the present invention, there is provided a lipid nanoparticle composition comprising lipid nanoparticles, wherein the lipid nanoparticles comprise: ionizable cationic lipid molecules of formula I.

According to the present invention, the lipid nanoparticle composition further comprises other lipid molecules. The other lipid molecules may be lipid molecules known or conventionally used in the art for constructing lipid nanoparticles, including but not limited to neutral lipid molecules, cholesterol-based lipid molecules, pegylated lipid molecules.

According to the present invention, the lipid nanoparticle composition further comprises an active ingredient, which may be a small molecule compound, a nucleic acid, a protein, a polypeptide, or the like. The active ingredient is located in a lipid nanoparticle. Such nucleic acids include, but are not limited to, DNA, antisense nucleic Acids (ASO), small interfering RNA (siRNA), microrna (miRNA), small activating RNA (saRNA), messenger RNA (mRNA), aptamers (aptamer), and the like.

According to the invention, in the lipid nanoparticle composition, the lipid nanoparticles contain the lipid molecules of the formula I in an amount of 30-60mol%, preferably 32-55mol%, and more preferably 34-46mol% of the total lipid molecules.

According to the present invention, in the lipid nanoparticle composition, the lipid nanoparticles may contain neutral lipid molecules in an amount of 5 to 30mol%, preferably 8 to 20mol%, and more preferably 9 to 16mol%, based on the total lipid molecules.

According to the present invention, in the lipid nanoparticle composition, the cholesterol lipid molecules may be contained in the lipid nanoparticles in an amount of 30 to 50mol%, preferably 35 to 50mol%, and more preferably 37 to 49mol%, based on the total lipid molecules.

According to the present invention, in the lipid nanoparticle composition, the lipid nanoparticle may contain pegylated lipid molecules in an amount of 0.4 to 10mol%, preferably 0.5 to 5mol%, and more preferably 1.3 to 2.7mol%, based on the total lipid molecules.

According to the present invention, when the active ingredient is a nucleic acid, the ratio of the total mass of lipid molecules to the mass of nucleic acid in the lipid nanoparticle composition is 5 to 20.

According to the invention, the ionizable cationic lipid molecule of the formula I has the structural formula

Wherein:

q is a substituted or unsubstituted straight chain C2-20 alkylene group, optionally substituted with 1 or more than 1C atom of the alkylene group by a heteroatom independently selected from O, S and N; or, Q is a substituted or unsubstituted, saturated or unsaturated 4-6 membered ring, the ring atoms of the 4-6 membered ring optionally contain 1 or more than 1 independently selected from O, SA heteroatom of N; the substituted substituent group is selected from halogen, -OH, linear or branched C1-20 alkyl, linear or branched C1-20 alkoxy, linear or branched C2-20 alkenyl, linear or branched C2-20 alkynyl, -CH ₂ CH(OH)R ₅ 、

R ₁ 、R ₂ 、R ₃ 、R ₄ May be the same or different and are each independently selected from hydrogen, substituted or unsubstituted straight or branched C1-30 alkyl, substituted or unsubstituted straight or branched C2-30 alkenyl, substituted or unsubstituted straight or branched C2-30 alkynyl, 1 or more than 1C atom of said alkyl, alkenyl or alkynyl being optionally replaced by a heteroatom independently selected from O, S and N, or-CH ₂ CH(OH)R ₅ (ii) a The substituted substituent group is selected from halogen, -OH, linear or branched C1-10 alkyl, linear or branched C1-10 alkoxy;

with the proviso that R ₁ 、R ₂ 、R ₃ 、R ₄ At least one of which is

R ₅ Selected from the group consisting of hydrogen, substituted or unsubstituted straight or branched chain C1-30 alkyl, substituted or unsubstituted straight or branched chain C2-30 alkenyl, substituted or unsubstituted straight or branched chain C2-30 alkynyl, said alkyl, alkenyl or alkynyl having 1 or more than 1C atom optionally replaced by a heteroatom independently selected from O, S and N; the substituted substituent group is selected from halogen, -OH, linear or branched C1-10 alkyl, linear or branched C1-10 alkoxy;

R ₆ selected from hydrogen, C1-3 alkyl, C1-3 alkoxy, -OH;

n is an integer of 1 to 8, m is an integer of 0 to 8, and n and m are independent of each other, and may be the same or different;

when R is ₁ 、R ₂ 、R ₃ 、R ₄ At least two of which are

In the case of each of the groups, n and m are independent of each other, and may be the same or different.

In a preferred embodiment of the invention, Q is a substituted or unsubstituted straight chain C2-20 alkylene group, 1 or more than 1C atom of which is optionally replaced by a heteroatom independently selected from O, S and N;

preferably, Q is

Wherein R is ₈ 、R ₉ Independently of one another, is selected from substituted or unsubstituted, linear C1-10 alkylene groups, 1 or more than 1C atom of which is optionally replaced by a heteroatom independently selected from O, S and N; r ₇ Is hydrogen, halogen, -OH, straight or branched C1-20 alkyl, straight or branched C2-20 alkenyl, straight or branched C2-20 alkynyl, or-CH ₂ CH(OH)R ₅ Or is/are>

The substituted substituent group is halogen, -OH, straight-chain or branched C1-10 alkyl, straight-chain or branched C1-10 alkoxy;

preferably, Q is

Wherein: x and y may be the same or different and are independently selected from integers of 1 to 8; r ₇ The definitions are the same as above; preferably, x or y, which are identical or different, are chosen from integers from 1 to 3, for example 1,2 or 3; preferably, R ₇ Is a linear or branched C1-4 alkyl group, such as methyl, ethyl, n-propyl, n-butyl, and the like.

In some embodiments of the invention, the saturated or unsaturated 4-6 membered ring is piperazinyl or cyclohexyl.

In a preferred embodiment of the invention, R ₆ is-OH.

In a preferred embodiment of the present invention, n is selected from an integer of 4 to 8, and m is selected from an integer of 4 to 8.

In a preferred embodiment of the invention, the compound of formula I is of formula a, B, C or D:

wherein each n is ₁ Are all independent of one another, may be the same or different, each n ₁ An integer selected from 1 to 8, each m ₁ Are all independent of each other, can be the same or different, each m ₁ An integer selected from 0 to 8; preferably, each n ₁ An integer selected from 4 to 8, each m ₁ An integer selected from 4 to 8; preferably, each n is ₁ Are all the same as each other, each m ₁ Are all identical to each other.

Wherein each n is ₂ Are all independent of one another, may be the same or different, each n ₂ An integer selected from 1 to 8, each m ₂ Are all independent of each other, can be the same or different, each m ₂ An integer selected from 0 to 8; preferably, each n ₂ An integer selected from 4 to 8, each m ₂ An integer selected from 4 to 8; preferably, each n ₂ Are all the same as each other, each m ₂ Are all identical to each other.

Wherein each n is ₃ Are all independent of one another, may be the same or different, each n ₃ An integer selected from 1 to 8, each m ₃ Are all independent of each other, can be the same or different, each m ₃ An integer selected from 0 to 8; preferably, each n ₃ Is selected from integers of 4 to 8, each m ₃ An integer selected from 4 to 8; preferably, each n ₃ Are all the same as each other, each m ₃ Are all identical to each other.

Wherein each n is ₄ Are independent of each other and can be the sameOr different, each n ₄ Is selected from integers of 1 to 8, each m ₄ Are all independent of each other, can be the same or different, each m ₄ An integer selected from 0 to 8; preferably, each n ₄ An integer selected from 4 to 8, each m ₄ An integer selected from 4 to 8; preferably, each n is ₄ Are all the same as each other, each m ₄ Are all identical to each other.

In some embodiments of the invention, the compound of formula I is selected from the following compounds shown in table 1:

TABLE 1

/>

/>

/>

/>

/>

/>

/>

/>

/>

According to the invention, the molar percentage of the lipid molecules of formula I in the lipid of the lipid nanoparticle is 30-60mol%, such as 32-55mol%, for example 30mol%,31mol%,32mol%,33mol%,34mol%,35mol%,36mol%,37mol%,38mol%,39mol%,40mol%,41mol%,42mol%,43mol%,44mol%,45mol%,46mol%,47mol%,48 mol%,49mol%,50mol%,51mol%,52mol%,53mol%,54mol%,55mol% and the like.

According to the invention, the neutral lipid molecule is an uncharged lipid molecule or a zwitterionic lipid molecule, such as a phosphatidylcholine compound, or/and a phosphatidylethanolamine compound.

The structure of the phosphatidylcholine compound is shown as formula E:

the structure of the phosphatidylethanolamine compound is shown as a formula F: />

Wherein Ra, rb, rc, rd are independently selected from linear or branched C1-30 alkyl, linear or branched C2-30 alkenyl, preferably linear or branched C10-30 alkyl, linear or branched C10-30 alkenyl, such as CH ₃ (CH ₂ ) ₁₇ CH ₂ -、CH ₃ (CH ₂ ) ₁₅ CH ₂ -、CH ₃ (CH ₂ ) ₁₃ CH ₂ -、 CH ₃ (CH ₂ ) ₁₁ CH ₂ -、CH ₃ (CH ₂ ) ₉ CH ₂ -、CH ₃ (CH ₂ ) ₇ CH ₂ -、CH ₃ (CH ₂ ) ₇ -CH＝CH-(CH ₂ ) ₇ -、 CH ₃ (CH ₂ ) ₄ CH＝CHCH ₂ CH＝CH(CH ₂ ) ₇ -、CH ₃ (CH ₂ ) ₇ -CH＝CH-(CH ₂ ) ₉ -。

Examples of neutral lipid molecules include, but are not limited to, 5-heptadecylbenzene-1, 3-diol (resorcinol), dipalmitoylphosphatidylcholine (DPPC), distearoylphosphatidylcholine (DSPC), phosphocholine (DOPC), dimyristoylphosphatidylcholine (DMPC), phosphatidylcholine (PLPC), 1, 2-distearoyl-sn-glycero-3-phosphocholine (DAPC), phosphatidylethanolamine (PE), egg Phosphatidylcholine (EPC), dilauroyl phosphatidylcholine (DLPC), dimyristoylphosphatidylcholine (DMPC), 1-myristoyl-2-palmitoylphosphatidylcholine (MPPC) 1-palmitoyl-2-myristoylphosphatidylcholine (PMPC), 1-palmitoyl-2-stearoylphosphatidylcholine (PSPC), 1, 2-dianeoyl-sn-glycero-3-phosphocholine (DBPC), 1-stearoyl-2-palmitoylphosphatidylcholine (SPPC), 1, 2-eicosenoyl-sn-glycero-3-phosphocholine (DEPC), palmitoyl Oleoyl Phosphatidylcholine (POPC), lysophosphatidylcholine, dioleoylphosphatidylethanolamine (DOPE), distearoylphosphatidylethanolamine (DSPE), dimyristoylphosphatidylethanolamine (DMPE), dipalmitoylphosphatidylethanolamine (DPPE), palmitoyloleoylphosphatidylethanolamine (POPE), lysophosphatidylethanolamine, and combinations thereof.

In one embodiment, the neutral lipid molecule may be selected from the group consisting of: distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylethanolamine (DOPE) and Distearoylphosphatidylethanolamine (DSPE). In another embodiment, the neutral lipid molecule can be dimyristoyl phosphatidylethanolamine (DMPE). In another embodiment, the neutral lipid molecule can be Dipalmitoylphosphatidylcholine (DPPC).

According to the invention, the molar percentage of neutral lipid molecules in the lipid of the lipid nanoparticle is 5-30mol%, such as 8-20mol%, for example 8mol%,9mol%,10mol%,11mol%,12mol%,13mol%,14mol%, 15mol%,16mol%,17mol%,18mol%,19mol%,20mol%.

According to the present invention, cholesterol lipid molecules refer to sterols as well as lipids containing sterol moieties, including but not limited to cholesterol, 5-heptadecaresorcinol, coprosterol, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, lycopin, ursolic acid, alpha-tocopherol and mixtures thereof, cholesterol hemisuccinate. In one embodiment, the cholesterol-based lipid molecule is Cholesterol (CHOL). In one embodiment, the cholesterol-based lipid molecule is cholesterol hemisuccinate.

According to the present invention, the molar percentage of the cholesterol-based lipid molecules in the lipid of the lipid nanoparticle is 30-50mol%, and may be, for example, 30mol%,31mol%,32mol%,33mol%,34mol%,35mol%,36mol%,37mol%,38mol%,39mol%,40mol%,41mol%,42mol%,43mol%,44mol%,45mol%,46mol%,47mol%,48 mol%,49mol%,50mol%, and the like.

According to the present invention, the pegylated lipid molecule comprises a lipid moiety and a PEG-based polymer moiety. In some embodiments, the lipid moiety may be derived from diacylglycerols or diacyloleamides (diacylglycylamides), including those comprising dialkylglycerols or dialkylglyceramide groups having an alkyl chain length independently comprising from about C4 to about C30 saturated or unsaturated carbon atoms, wherein the chain may comprise one or more functional groups, such as amides or esters. In some embodiments, the alkyl chain length comprises from about C10 to C20. The dialkylglycerol or dialkylglyceroamide group may further comprise one or more substituted alkyl groups. The chain length may be symmetrical or asymmetrical. As used herein, unless otherwise indicated, the term "PEG" means any polyethylene glycol or other polyalkylene ether polymer. In one embodiment, the PEG moiety is an optionally substituted linear or branched polymer of ethylene glycol or ethylene oxide. In certain embodiments, the PEG moiety may be substituted with, for example, one or more alkyl, alkoxy, acyl, hydroxyl, or aryl groups. In one embodiment, the PEG moiety comprises a PEG copolymer, such as PEG-polyUrethane or PEG-polypropylene (see, e.g., J.Milton Harris, poly (ethylene glycol) chemistry: biotechnical and biomedical applications (1992)); alternatively, the PEG moiety does not include a PEG copolymer, e.g., it can be a PEG homopolymer. In one embodiment, the molecular weight of the PEG is from about 130 to about 50,000, in sub-embodiments from about 150 to about 30,000, in sub-embodiments from about 150 to about 20,000, in sub-embodiments from about 150 to about 15,000, in sub-embodiments from about 150 to about 10,000, in sub-embodiments from about 150 to about 6,000, in sub-embodiments from about 150 to about 5,000, in sub-embodiments from about 150 to about 4,000, in sub-embodiments from about 150 to about 3,000, in sub-embodiments from about 300 to about 3,000, in sub-embodiments from about 1,000 to about 3,000, and in sub-embodiments from about 1,500 to about 2,500. In certain embodiments, the PEG is "PEG 2000" which has an average molecular weight of about 2,000 daltons. In some embodiments of the invention, the PEG is represented herein by the formula

Expressed, for PEG-2000 where n is 45, means that the number average degree of polymerization comprises about 45 subunits; other PEG embodiments known in the art may also be used, including, for example, those in which the number average degree of polymerization comprises about 23 subunits (n = 23) and/or 68 subunits (n = 68). In some embodiments, n may range from about 30 to about 60. In some embodiments, n may range from about 35 to about 55. In some embodiments, n may range from about 40 to about 50. In some embodiments, n may range from about 42 to about 48. In some embodiments, n may be 45. In some embodiments, R may be selected from H, substituted alkyl, and unsubstituted alkyl. In some embodiments, R can be an unsubstituted C1-C30 alkyl group, such as a C1-C20 alkyl group, a C1-C10 alkyl group, a C1-C6 alkyl group. In some embodiments, R may be H, methyl or ethyl.

In some embodiments, the pegylated lipid molecule may be represented as a "lipid moiety-PEG-number average molecular weight" or a "PEG-lipid moiety" or a "PEG-number average molecular weight-lipid moiety", said lipid moiety being a diacylglycerol or diacylglyceramide selected from the group consisting of dilauroyl glycerol, dimyristoyl glycerol, dipalmitoyl glycerol, distearoyl glycerol, dilauroyl glycerol amide, dimyristoyl glycerol amide, dipalmitoyl glycerol amide, distearoyl glycerol amide, 1, 2-distearoyl-sn-glycerol-3-phosphoethanolamine, 1, 2-dimyristoyl-sn-glycerol-3-phosphoethanolamine; the number average molecular weight of the PEG is from about 130 to about 50,000, such as from about 150 to about 30,000, from about 150 to about 20,000, from about 150 to about 15,000, from about 150 to about 10,000, from about 150 to about 6,000, from about 150 to about 5,000, from about 150 to about 4,000, from about 150 to about 3,000, from about 300 to about 3,000, from about 1,000 to about 3,000, from about 1,500 to about 2,500, such as about 2000.

In some embodiments, the pegylated lipid molecule may be selected from the group consisting of PEG-dilauroyl glycerol, PEG-dimyristoyl glycerol (PEG-DMG), PEG-dipalmitoyl glycerol, PEG-distearoyl glycerol (PEG-DSPE), PEG-dilauroyl glyceramide, PEG-dimyristoyl glyceramide, PEG-dipalmitoyl glyceramide and PEG-distearoyl glyceramide, PEG-cholesterol (1- [8' - (cholest-5-ene-3 [ beta ] -oxy) carboxamido-3 ',6' -dioxaoctyl ] carbamoyl- [ omega ] -methyl-poly (ethylene glycol), PEG-DMB (3, 4-ditetradecylphenylmethyl- [ omega ] -methyl-poly (ethylene glycol) ether), 1, 2-dimyristoyl-sn-glycerol-3-phosphoethanolamine-N- [ methoxy (polyethylene glycol) -2000] (DMG-PEG 2000), 1, 2-distearoyl-sn-glycerol-3-phosphoethanolamine-N- [ methoxy (polyethylene glycol) -2000] (DSPE-PEG 2000), 1, 2-distearoyl-sn-glycerol-methoxypolyethylene glycol (DSG-PEG 2000), poly (ethylene glycol) -2000-dimethacrylate (DMA-PEG 2000) and 1, 2-distearoyloxypropyl-3-amine-N- [ methoxy (polyethylene glycol) -2000] (DSA-PEG 2000). In one embodiment, the pegylated lipid molecule can be DMG-PEG2000. In some embodiments, the pegylated lipid molecule may be DSG-PEG2000. In one embodiment, the pegylated lipid molecule may be DSPE-PEG2000. In one embodiment, the pegylated lipid molecule can be DMA-PEG2000. In one embodiment, the pegylated lipid molecule may be C-DMA-PEG2000. In one embodiment, the pegylated lipid molecule may be DSA-PEG2000. In one embodiment, the pegylated lipid molecule can be PEG2000-C11. In some embodiments, the pegylated lipid molecule can be PEG2000-C14. In some embodiments, the pegylated lipid molecule can be PEG2000-C16. In some embodiments, the pegylated lipid molecule can be PEG2000-C18.

According to the invention, the mole percentage of pegylated lipid molecules in the lipid of the lipid nanoparticle is 0.4-10mol%, such as 0.5-5mol%, for example may be 0.4mol%,0.5mol%,0.6mol%,0.7mol%,0.8mol%,0.9mol%, 1.0mol%,1.1mol%,1.2mol%,1.3mol%,1.4mol%,1.5mol%,1.6mol%,1.7mol%,1.8mol%, 1.9mol%,2.0mol%,2.1mol%,2.2mol%,2.3mol%,2.4mol%,2.5mol%,2.6mol%,2.7mol%, 2.8mol%,2.9mol%,3.0mol%,3.1mol%,3.2mol%,3.3mol%,3.4mol%,3.5mol%,3.6mol%, 3.7mol%,3.8mol%,3.9mol%, 3.0mol%,3.1mol%,3.2mol%, 3.3.3 mol%,3.4mol%,3.5mol%,3.6mol%, 3.7mol%,3.8mol%, 3.4mol%, 4mol%, 4.4mol%, 4mol%,4.5mol%, 4mol%, etc.

In some embodiments of the present invention, the lipid nanoparticle comprises a lipid molecule represented by formula C, a neutral lipid molecule, a cholesterol-based lipid molecule, a pegylated lipid molecule, wherein:

formula C

Wherein each n is ₃ Are all independent of each other, may be the same or different, each n ₃ An integer selected from 1 to 8, each m ₃ Are all independent of one another, may be the same or different, each m ₃ An integer selected from 0 to 8; preferably, each n ₃ An integer selected from 4 to 8, each m ₃ An integer selected from 4 to 8; preferably, each n ₃ Are all the same as each other, each m ₃ Are all identical to each other. The ionizable cationic lipid molecule represented by formula C accounts for 32-55mol%, preferably 34-46mol%, of the lipid in the lipid nanoparticle.

The neutral lipid molecule is selected from phosphatidyl choline compounds represented by formula E

Phosphatidyl ethanolamine compound shown as a formula F>

Wherein Ra, rb, rc, rd are independently selected from linear or branched C10-30 alkyl, linear or branched C10-30 alkenyl, preferably CH ₃ (CH ₂ ) ₁₇ CH ₂ -、CH ₃ (CH ₂ ) ₁₅ CH ₂ -、 CH ₃ (CH ₂ ) ₁₃ CH ₂ -、CH ₃ (CH ₂ ) ₁₁ CH ₂ -、CH ₃ (CH ₂ ) ₉ CH ₂ -、CH ₃ (CH ₂ ) ₇ CH ₂ -、 CH ₃ (CH ₂ ) ₇ -CH＝CH-(CH ₂ ) ₇ -、CH ₃ (CH ₂ ) ₄ CH＝CHCH ₂ CH＝CH(CH ₂ ) ₇ -、 CH ₃ (CH ₂ ) ₇ -CH＝CH-(CH ₂ ) ₉ -. The mole percentage of neutral lipid molecules in the lipid nanoparticles is 8-20mol%, preferably 9-16mol%;

the cholesterol lipid molecule is selected from cholesterol and cholesterol hemisuccinate. The molar percentage of the cholesterol lipid molecules in the lipid nanoparticle is 30-50mol%, preferably 35-50mol%, more preferably 37-49mol%.

The pegylated lipid molecule is denoted as "lipid moiety-PEG-number average molecular weight", said lipid moiety being a diacylglycerol or diacylglycerol amide selected from the group consisting of dilauroyl glycerol, dimyristoyl glycerol, dipalmitoyl glycerol, distearoyl glycerol, dilauroyl glycerol amide, dimyristoyl glycerol amide, dipalmitoyl glycerol amide, distearoyl glycerol amide, 1, 2-distearoyl-sn-glycerol-3-phosphoethanolamine, 1, 2-dimyristoyl-sn-glycerol-3-phosphoethanolamine; the PEG has a number average molecular weight of 130 to 50,000, for example 150 to 30,000, 150 to 20,000, 150 to 15,000, 150 to 10,000, 150 to 6,000, 150 to 5,000, 150 to 4,000, 150 to 3,000, 300 to 3,000,1,000 to 3,000,1,500 to 2,500, about 2000. The mole percentage of the PEGylated lipid molecules to the lipid in the lipid nanoparticle is 0.5-5mol%, preferably 1.3-2.7mol%.

In one embodiment of the invention, the nucleic acid is mRNA.

According to the invention, the mRNA may comprise, from 5' to 3', a 5' cap structure, a 5' UTR, an Open Reading Frame (ORF), a 3' UTR and a poly-A tail.

According to the present invention, the Cap structure may be a Cap1 structure, a Cap2 structure or a Cap3 structure. In one embodiment of the invention, the Cap structure is a Cap1 structure.

According to the invention, the 5'UTR may comprise beta-globin or a 5' UTR of alpha-globin or homologues, fragments thereof. In some embodiments of the invention the 5'UTR comprises a nucleotide sequence that is at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or about 100% homologous to the nucleotide sequence 5' UTR of beta-globin as set forth in SEQ ID NO 6. In a particular embodiment of the invention the 5'UTR comprises the nucleotide sequence of 5' UTR of beta-globin as shown in SEQ ID NO 6.

In some embodiments of the invention, the 5' utr further comprises a Kozak sequence. In one embodiment of the invention, the Kozak sequence is GCCACC.

According to the invention, the 3'utr may comprise beta-globin or a 3' utr of alpha-globin or a homologue, fragment, or combination of fragments thereof. In some embodiments of the invention the 3'utr comprises a nucleotide sequence that is at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or about 100% homologous to a fragment of the α 2-globin 3' utr of SEQ ID NO 7. In other embodiments of the invention the 3'UTR comprises 2 head to tail nucleotide sequences at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or about 100% homologous to a fragment of the α 2-globin 3' UTR of SEQ ID NO 7. In a specific embodiment of the invention, the 3' UTR comprises 2 head to tail nucleotide sequences as shown in SEQ ID NO 7.

According to the invention, the poly-A tail may be 50-200 nucleotides, preferably 100-150 nucleotides, such as 110-120 nucleotides, e.g.about 110 nucleotides, about 120 nucleotides, about 130 nucleotides, about 140 nucleotides, about 150 nucleotides in length.

In one embodiment of the invention, the Open Reading Frame (ORF) is an Open Reading Frame (ORF) encoding an S protein mutant of 2019-nCov, the nucleic acid sequence of which is a nucleotide sequence at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or about 100% homologous to the nucleotide sequence shown in SEQ ID NO. 8. The amino acid sequence of the S protein mutant after ORF translation consists of an amino acid sequence shown by SEQ ID NO. 2 and an amino acid sequence shown by SEQ ID NO. 3 which are directly connected from the N end to the C end. In a specific embodiment of the present invention, the nucleotide sequence of the Open Reading Frame (ORF) of the S protein mutant is shown in SEQ ID NO 8.

In one embodiment of the invention, the mRNA comprises a nucleotide sequence that is at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or about 100% homologous to the nucleotide sequence set forth in SEQ ID NO. 9. In a specific embodiment of the invention, the mRNA comprises the nucleotide sequence shown in SEQ ID NO 9.

The mRNA of the present invention can be prepared by methods known in the art. In some embodiments of the invention, the nucleic acid sequence encoding the mRNA may be synthesized, cloned into a vector, and the construct inverted to a plasmid. The constructed plasmid is transformed into host bacteria for culture and amplification, and the plasmid is extracted. The extracted plasmid was digested into linear molecules using restriction enzymes immediately following the polyA tail. mRNA was prepared using the prepared linearized plasmid molecules as a template by an in vitro transcription method. Can add cap structure analog in the process of in vitro transcription to directly obtain mRNA with a cap structure; capping structures may also be added to the mRNA after in vitro transcription is complete using capping enzymes and dimethyl transferase. The resulting mRNA can be purified by methods conventional in the art, such as chemical precipitation, magnetic bead method, affinity chromatography, and the like.

According to the invention, one or more nucleotides in the mRNA may be modified. For example, one or more nucleotides (e.g., all nucleotides) in the mRNA may each independently be replaced with a naturally occurring nucleotide analog or an artificially synthesized nucleotide analog, such as selected from pseudouridine (pseudouridine), 2-thiouridine (2-thiouridine), 5-methyluridine (5-methyluridine), 5-methylcytidine (5-methylcytidine), N6-methyladenosine (N6-methyladenosine), N1-methylpseudouridine (N1-methylpseudouridine), and the like.

The invention also provides an mRNA vaccine, which contains lipid nanoparticles, wherein the lipid nanoparticles contain lipid molecules shown as a formula C, neutral lipid molecules, cholesterol lipid molecules, PEGylated lipid molecules and mRNA encoding 2019-nCoV S protein mutant, and the mRNA comprises a nucleotide sequence which is at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or about 100% homologous to the nucleotide sequence shown as SEQ ID NO. 9; the mass ratio of the total mass of the lipid molecules to the mRNA is 5-20; wherein:

formula C

Wherein each n is ₃ Are all independent of each other, may be the same or different, each n ₃ Is selected from integers of 1 to 8, each m ₃ Are all independent of each other, can be the same or different, each m ₃ An integer selected from 0 to 8; preferably, each n ₃ Is selected from integers of 4 to 8Each m of ₃ An integer selected from 4 to 8; preferably, each n ₃ Are all the same as each other, each m ₃ Are all identical to each other. The lipid molecule represented by the formula C accounts for 34-46mol% of the lipid in the lipid nanoparticle;

the neutral lipid molecule is selected from phosphatidyl choline compounds represented by formula E

Phosphatidylethanolamine compound represented by formula F>

Wherein Ra, rb, rc, rd are independently selected from linear or branched C10-30 alkyl, linear or branched C10-30 alkenyl, preferably CH ₃ (CH ₂ ) ₁₇ CH ₂ -、CH ₃ (CH ₂ ) ₁₅ CH ₂ -、 CH ₃ (CH ₂ ) ₁₃ CH ₂ -、CH ₃ (CH ₂ ) ₁₁ CH ₂ -、CH ₃ (CH ₂ ) ₉ CH ₂ -、CH ₃ (CH ₂ ) ₇ CH ₂ -、 CH ₃ (CH ₂ ) ₇ -CH＝CH-(CH ₂ ) ₇ -、CH ₃ (CH ₂ ) ₄ CH＝CHCH ₂ CH＝CH(CH ₂ ) ₇ -、 CH ₃ (CH ₂ ) ₇ -CH＝CH-(CH ₂ ) ₉ -. The neutral lipid molecules account for 9-16mol% of the lipid in the lipid nanoparticles;

the cholesterol lipid molecule is selected from cholesterol and cholesterol hemisuccinate. The cholesterol lipid molecule accounts for 37-49mol% of lipid in the lipid nanoparticle;

the pegylated lipid molecule is represented by "lipid moiety-PEG-number average molecular weight", said lipid moiety being a diacylglycerol or diacyloleamide selected from the group consisting of dilauroyl glycerol, dimyristoyl glycerol, dipalmitoyl glycerol, distearoyl glycerol, dilauroyl oleamide, dimyristoyl oleamide, dipalmitoyl oleamide, distearoyl oleamide, 1, 2-distearoyl-sn-glycerol-3-phosphoethanolamine, 1, 2-dimyristoyl-sn-glycerol-3-phosphoethanolamine; PEG has a number average molecular weight of about 130 to about 50,000, e.g., about 150 to about 30,000, about 150 to about 20,000, about 150 to about 15,000, about 150 to about 10,000, about 150 to about 6,000, about 150 to about 5,000, about 150 to about 4,000, about 150 to about 3,000, about 300 to about 3,000, about 1,000 to about 3,000, about 1,500 to about 2,500, e.g., about 2000. The pegylated lipid molecule comprises 1.3-2.7mol% of the lipid in the lipid nanoparticle.

In some embodiments of the invention, the molar ratio of the lipid molecule represented by formula C, the neutral lipid molecule, the cholesterol, and the pegylated lipid molecule is 35.

In some embodiments of the invention, the molar ratio of the lipid molecule represented by formula C, the neutral lipid molecule, the cholesterol, and the pegylated lipid molecule is 40.

In some embodiments of the invention, the molar ratio of lipid molecules represented by formula C, neutral lipid molecules, cholesterol, and pegylated lipid molecules is 45.

In one embodiment of the invention, the lipid molecule of formula C is compound II-37.

In one embodiment of the invention, the neutral lipid molecule is DOPE and/or DSPC.

In one embodiment of the invention, the pegylated lipid molecule is DMG-PEG2000 and/or DSPE-PEG2000.

The invention also provides a method for preparing the ionizable cationic lipid molecule shown in the formula I.

The ionizable lipid compounds of the present invention can be synthesized using methods known in the art, for example, by reacting one or more equivalents of amine with one or more equivalents of epoxy-capping compound under suitable conditions. The synthesis of ionizable lipid compounds is performed with or without solvent and can be performed at higher temperatures in the range of 25-100 ℃. The produced ionizable lipid compound may optionally be purified. For example, a mixture of ionizable lipid compounds can be purified to yield a particular ionizable lipid compound. Or the mixture may be purified to give specific stereoisomers or regioisomers. The epoxides can be purchased commercially, or prepared synthetically.

In some embodiments of the invention, the ionizable lipid compounds of the invention can be prepared using the following general preparation methods.

Formula A, B, C or D

Step 1: reduction of

In the presence of a reducing agent, the carboxyl group of compound A1 is reduced to a hydroxyl group to obtain compound A2. Examples of reducing agents include, but are not limited to, lithium aluminum hydride, diisobutyl aluminum hydride, and the like. Examples of the solvent used for the reaction include, but are not limited to, ethers (e.g., diethyl ether, tetrahydrofuran, dioxane, etc.), halogenated hydrocarbons (e.g., chloroform, methylene chloride, dichloroethane, etc.), hydrocarbons (e.g., n-pentane, n-hexane, benzene, toluene, etc.), and mixed solvents of two or more of these solvents.

And 2, step: oxidation by oxygen

In the presence of an oxidizing agent, a hydroxyl group of the compound A2 is oxidized into an aldehyde group to obtain a compound A3. Examples of oxidizing agents include, but are not limited to, 2-iodoxybenzoic acid (IBX), pyridinium chlorochromate (PCC), pyridinium Dichlorochromate (PDC), dess-martin oxidizing agent, manganese dioxide, and the like. Examples of the solvent used for the reaction include, but are not limited to, halogenated hydrocarbons (e.g., chloroform, dichloromethane, dichloroethane, etc.), hydrocarbons (e.g., n-pentane, n-hexane, benzene, toluene, etc.), nitriles (e.g., acetonitrile, etc.), and mixed solvents of two or more of these solvents.

And 3, step 3: halo-reduction of

Firstly, aldehyde alpha-hydrogen of the compound A3 and a halogenating reagent are subjected to halogenation reaction under acidic conditions to obtain an alpha-halogenated aldehyde intermediate, and then an aldehyde group of the alpha-halogenated aldehyde is reduced to a hydroxyl group in the presence of a reducing agent to obtain a compound A4. Examples of providing acidic conditions include, but are not limited to, DL-proline. Examples of halogenated agents include, but are not limited to, N-chlorosuccinimide (NCS) and N-bromosuccinimide (NBS). Examples of reducing agents include, but are not limited to, sodium borohydride, sodium cyanoborohydride, and sodium triacetoxyborohydride.

And 4, step 4: epoxidation

Compound A4 is subjected to an intramolecular nucleophilic substitution reaction in the presence of a base to obtain epoxy compound A5. Examples of bases include, but are not limited to, hydroxides or hydrides of alkali metals, such as sodium hydroxide, potassium hydroxide, and sodium hydride. Examples of solvents used for the reaction include, but are not limited to, a mixture of dioxane and water.

And 5: ring opening reaction

Compound A5 is subjected to a ring-opening reaction with an amine, such as N, N-bis (2-aminoethyl) methylamine, to obtain the final compound. Examples of solvents for the reaction include, but are not limited to, ethanol, methanol, isopropanol, tetrahydrofuran, chloroform, hexane, toluene, ethyl ether, and the like.

The raw material A1 in the preparation method can be purchased commercially or synthesized by adopting a conventional method.

The present invention also provides a method of preparing the lipid nanoparticle composition.

According to the invention, the preparation method comprises the following steps: lipid nanoparticles are prepared by dissolving each lipid molecule in an organic solvent in a molar ratio to prepare a solution of mixed lipids, using the solution of mixed lipids as an organic phase, using an aqueous solution of a substance to be delivered (e.g., nucleic acid) as an aqueous phase, and mixing the organic phase and the aqueous phase. Lipid nanoparticles can be prepared using methods including, but not limited to, spray drying, single and double emulsion solvent evaporation, solvent extraction, phase separation, nanoprecipitation, microfluidics, simple and complex coacervation, and others well known to those of ordinary skill in the art.

In some embodiments, the organic solvent is an alcohol, such as ethanol.

In some embodiments, the volume ratio of the organic phase to the aqueous phase is (2-4): 1.

In some embodiments, the nanoparticles are prepared using a microfluidic platform.

According to the present invention, the preparation method further comprises the step of isolating and purifying the lipid nanoparticle.

According to the present invention, the preparation method further comprises a step of lyophilizing the lipid nanoparticle.

The ionizable lipid of the formula I contains two adjacent cis double bonds in the molecular structure, so that the ionizable lipid has high encapsulation efficiency and high cell transfection efficiency when being subsequently applied to a delivery system to wrap active substances (such as nucleic acids such as mRNA); in addition, when lipid nanoparticles are prepared, the particle size of the obtained lipid nanoparticles is more uniform. The ionizable lipid compound of the present invention is particularly suitable for the preparation of solid structured nanoparticles.

In addition, for the mRNA vaccine of the invention, because the mRNA of the invention has high translation efficiency and stability, the S protein mutant coded by the mRNA has high stability, and in addition, the lipid nanoparticle of the invention has high encapsulation efficiency, more uniform particle size and better cell transfection efficiency, and the mRNA vaccine of the invention has high mRNA encapsulation efficiency, drug loading capacity, cell transfection efficiency, high-efficiency and stable in vivo translation, antigen stability and good immune effect.

The particle size of the lipid nanoparticles of the present invention is in the range of 1nm to 1000nm, for example, 10 to 500nm,10 to 200nm, etc.

The lipid nanoparticles of the present invention may also be modified with targeting molecules that make them targeting agents that target specific cells, tissues or organs. The targeting molecule may be located on the surface of the particle. The targeting molecule can be a protein, peptide, glycoprotein, lipid, small molecule, nucleic acid, and the like, examples of which include, but are not limited to, antibodies, antibody fragments, low Density Lipoproteins (LDL), transferrin (transferrin), asialoglycoprotein (asialycoprotein), receptor ligands, sialic acid, aptamers, and the like. The targeting molecule may be linked to a cholesterol-based lipid molecule or a pegylated lipid molecule of the lipid nanoparticle.

The lipid nanoparticle composition and vaccine of the present invention may further comprise one or more pharmaceutical excipients. The term "pharmaceutical excipient" means any type of non-toxic, inert solid, semi-solid or liquid filler, diluent, or the like, including, but not limited to, sugars such as lactose, trehalose, glucose, and sucrose; starches, such as corn starch and potato starch; cellulose and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; gelatin; talc; oils such as peanut oil, cottonseed oil, safflower oil, olive oil, corn oil and soybean oil; glycols, such as propylene glycol; esters such as ethyl oleate and ethyl laurate; surfactants such as Tween 80 (Tween 80); buffers such as phosphate buffer solution, acetate buffer solution, and citrate buffer solution; coloring agents, sweetening, flavoring and perfuming agents, preserving and antioxidant agents and the like.

In one embodiment of the present invention, the lipid nanoparticle composition and the vaccine are liquid formulations, further comprising sucrose in a concentration of 5-20% by mass, preferably 8-10%.

The lipid nanoparticle compositions and vaccines of the present invention can be administered to humans and/or animals orally, rectally, intravenously, intramuscularly, intravaginally, intranasally, intraperitoneally, buccally, or as an oral or nasal spray.

The S protein mutant of the invention is generated by amino acid mutation of parent S protein. In one embodiment of the invention, the parent S protein is the S protein of the 2019-nCoV B1.351 mutant strain, the S protein of the 2019-nCoV B1.351 mutant strain has the following mutations compared to the S protein of the 2019-nCoV wild strain: L18F, D80A, D215G, L242-244L del, R246I, K417N, E484K, N501Y, D614G, A701V (the positions are described as positions of the amino acid sequence shown in SEQ ID NO: 1).

In the present invention, the amino acid positions of the S protein mutant and the parent S protein are based on the amino acid sequence of the wild-type S protein, and the amino acid sequence of the wild-type S protein can be obtained at NCBI GeneID:43740568, and has a total of 1273 amino acids, and the sequence is shown as SEQ ID NO:1.

The S protein mutants of the present invention comprise at least an extracellular domain comprising amino acid mutations at the following positions relative to the extracellular domain of a parent S protein: F817P, A892P, A899P, A942P, and KV986_987PP and mutation of amino acid RRAR at position 682-685 to GSAS; and a transmembrane domain and cytoplasmic tail that does not contain the S protein; the domain T4 Fibritin Foldon Trimerization Motif which assists in trimer formation is fused directly to the C-terminus of the extracellular region. The S protein mutant comprises an amino acid sequence of SEQ ID NO. 2 and an amino acid sequence of SEQ ID NO. 3 which are directly connected from the N end to the C end.

List of the above sequences of the invention:

/>

/>

/>

/>

/>

/>

/>

description of terms:

the term "alkyl" refers to a saturated hydrocarbon radical derived from a hydrocarbon moiety containing from 1 to 30 carbon atoms by removal of a single hydrogen atom. Examples of alkyl groups include, but are not limited to, methyl, ethyl, propyl, isopropyl, n-butyl, sec-butyl, tert-butyl, n-pentyl, isopentyl, neopentyl, n-hexyl, n-heptyl, n-octyl, n-decyl, n-undecyl, and n-dodecyl.

The term "alkenyl" denotes a monovalent group derived from a hydrocarbon moiety having at least one carbon-carbon double bond by the removal of a single hydrogen atom. Alkenyl groups include, for example, ethenyl, propenyl, butenyl, 1-methyl-2-buten-1-yl, and the like.

The term "alkynyl" refers to a monovalent group derived from a hydrocarbon having at least one carbon-carbon triple bond by the removal of a single hydrogen atom. Representative alkynyl groups include ethynyl, 2-propynyl (propargyl), 1-propynyl, and the like.

The term "alkoxy" means an alkyl group, as defined above, appended to the parent molecule through an oxygen atom. Examples of alkoxy groups include, but are not limited to, methoxy, ethoxy, propoxy, isopropoxy, n-butoxy, tert-butoxy, neopentyloxy, and n-hexyloxy.

The terms "halo" and "halogen" refer to an atom selected from fluorine, chlorine, bromine, and iodine.

The term "saturated or unsaturated 4-to 6-membered ring" refers to a ring having 4 to 6 ring atoms which may be C, N, S, O, examples of which include, but are not limited to, 4 to 6-membered saturated cycloalkyl groups such as cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl; 4-6 membered aryl, such as phenyl; 4-6 membered heterocyclic groups such as pyrrolidinyl, piperidinyl, piperazinyl, morpholinyl and the like; 4-6 membered heteroaryl groups such as triazolyl, oxazolyl, isoxazolyl, thiazolyl, and the like. In some embodiments of the invention, the saturated or unsaturated 4-6 membered ring is preferably piperazinyl, cyclohexyl.

The terms "substituted" (whether or not the term "optionally" is present above) and "substituent" refer to the ability to change one functional group to another, provided that the valences of all atoms are maintained. When more than one position in any particular structure may be substituted with more than one substituent selected from a specified group, the substituents may be the same or different at each position.

"and/or" is to be taken as a specific disclosure of each of the two specified features or components with or without the other. Thus, use of the term "and/or" in phrases such as "a and/or B" is intended to include "a and B," "a or B," "a" (alone), and "B" (alone). Likewise, the term "and/or" as used in phrases such as "a, B, and/or C" is intended to encompass each of the following: A. b and C; A. b or C; a or C; a or B; b or C; a and C; a and B; b and C; a (alone); b (alone); and C (alone).

"comprising" and "comprises" have the same meaning, are intended to be open-ended and allow, but do not require, the inclusion of additional elements or steps. When the term "comprising" or "including" is used herein, the term "consisting of and/or" consisting essentially of 8230, is thus also included and disclosed.

In the present specification and claims, nucleotides are referred to by their commonly accepted single letter codes. Unless otherwise indicated, nucleotide sequences are written from left to right in the 5 'to 3' direction. Nucleobases are herein represented by the commonly known single-letter symbols recommended by the IUPAC-IUB Biochemical nomenclature Commission. The skilled person will understand that the T base in the codons disclosed herein is present in DNA, whereas the T base will be substituted by a U base in the corresponding RNA. For example, codon-nucleotide sequences in the form of DNA disclosed herein, such as vectors or In Vitro Translation (IVT) templates, have T bases transcribed as U bases in their corresponding transcribed mRNA. In this regard, both codon-optimized DNA sequences (comprising T) and their corresponding mRNA sequences (comprising U) are considered to be codon-optimized nucleotide sequences of the present disclosure. One skilled in the art will also appreciate that equivalent codon patterns can be generated by replacing one or more bases with non-natural bases.

The terms "nucleic acid sequence", "nucleotide sequence" or "polynucleotide sequence" are used interchangeably and refer to a contiguous nucleic acid sequence. The sequence may be a single-or double-stranded DNA or RNA, such as an mRNA.

"nucleotide sequence encoding" \\ 8230; "refers to a nucleic acid (e.g., an mRNA or DNA molecule) coding sequence encoding a polypeptide. The coding sequence may further comprise initiation and termination signals operably linked to regulatory elements including a promoter and polyadenylation signals capable of directing expression in the cells of the individual or mammal to which the nucleic acid is administered.

In the present description and claims, the conventional one-letter or three-letter code for amino acid residues is used. Unless otherwise indicated, amino acid sequences are written left to right in amino to carboxyl orientation.

"about": the term "about" used in connection with numerical values throughout the specification and claims denotes an interval of accuracy familiar and acceptable to a person skilled in the art. Typically, this accuracy is in the range of ± 10%.

For ease of reference, the S protein mutants of the invention are described using the following nomenclature: original amino acid position substituted amino acid. According to this nomenclature, for example, the substitution of asparagine at position 30 with alanine is represented by: asn30Ala or N30A; the deletion of asparagine at the same position is represented as: asn30 or N30; insertion of another amino acid residue, such as lysine, is represented as: asn30AsnLys or N30NK; deletion of a contiguous stretch of amino acid residues, such as deletion of amino acid residues 242-244, denoted (242-244)' or Δ (242-244) or 242\ u 244del; if the S protein mutant contains a "deletion" and an insertion at that position, as compared to the other S protein parent, it is expressed as: *36Asp or 36D, representing a deletion at position 36 with the insertion of aspartic acid. When one or more alternative amino acid residues may be inserted at a given position, this is expressed as: N30A, E, or N30A or N30E.

Homology: as used herein, the term "homology" refers to the overall relatedness between polymer molecules, e.g., between nucleic acid molecules (e.g., DNA molecules and/or RNA molecules) and/or between polypeptide molecules. In general, the term "homology" means an evolutionary relationship between two molecules. Thus, two homologous molecules will have a common evolutionary ancestor. In the context of the present disclosure, the term homology includes identity and similarity.

In some embodiments, polymer molecules are considered "homologous" to each other if at least 25%,30%,35%,40%,45%,50%,55%, 60%, 65%,70%,75%,80%,85%,90%,95%,96%,97%,98%,99% or 100% of the monomers in the molecule are identical (identical monomers) or similar (conservative substitutions). The term "homologous" necessarily refers to a comparison between at least two sequences (polynucleotide or polypeptide sequences).

Identity: as used herein, the term "identity" refers to the overall monomer conservation between polymer molecules, for example, between polynucleotide molecules (e.g., DNA molecules and/or RNA molecules) and/or between polypeptide molecules. For example, calculation of percent identity of two polynucleotide sequences can be performed by aligning the two sequences for optimal comparison purposes (e.g., gaps can be introduced in one or both of the first and second nucleic acid sequences for optimal alignment and non-identical sequences can be discarded for comparison purposes.

Suitable software programs are available from a variety of sources and are used in the alignment of both protein and nucleotide sequences. For example, bl2seq, needle, stretcher, water or Matcher, etc.

The terms "coding region" and "coding region" refer to the Open Reading Frame (ORF) in a polynucleotide that, when expressed, produces a polypeptide or protein.

"operably linked" refers to a functional linkage between two or more molecules, constructs, transcripts, entities, moieties, etc.

Domain (b): as used herein, when referring to a polypeptide, the term "domain" refers to a motif of a polypeptide having one or more identifiable structural or functional features or properties (e.g., binding capacity, serving as a site of protein-protein interaction).

Expressing: as used herein, "expression" of a nucleic acid sequence refers to one or more of the following events: (1) Generating an mRNA template from the DNA sequence (e.g., by transcription); (2) Processing of mRNA transcripts (e.g., by splicing, editing, 5 'cap formation and/or 3' end processing); (3) translating the mRNA into a polypeptide or protein; and (4) post-translational modification of the polypeptide or protein.

The term "protein mutant" or "polypeptide mutant" refers to a molecule whose amino acid sequence differs from a native or reference sequence. Amino acid sequence mutants may have substitutions, deletions, and/or insertions, etc., at certain positions within the amino acid sequence, as compared to the native or reference sequence. Typically, a mutant will have at least about 50% identity, at least about 60% identity, at least about 70% identity, at least about 80% identity, at least about 90% identity, at least about 95% identity, at least about 99% identity with the native or reference sequence.

Drawings

FIG. 1: the b1.351mrna integrity results were analyzed on a 2100 bioanalyzer using an RNA 6000nano chip.

FIG. 2: and (3) detecting the expression level of the S protein in the supernatant after the nucleic acid is transfected into the CHO-K1 cell by an ELISA method.

FIG. 3: 3D structural map of S protein mutant.

FIG. 4: ELISA method was used to determine the level of S protein expression in the supernatant after the cells transfected with mRNA of the present invention were encapsulated with nanoparticles prepared from II-37.

FIG. 5 is a schematic view of: II-37 and MC3 LNPs prepared encapsulate the mRNA of the invention and the expression level of S protein in the supernatant after transfection of the cells.

FIG. 6: and (3) taking Firefly Luc as a report protein, and obtaining a statistical graph of protein expression quantity of mRNA in cells, which is prepared by different in vitro transcription vectors.

FIG. 7 is a schematic view of: statistical graph of in vivo antibody production after immunization of BALB/c mice with the S protein mutant of the present invention. In the figure, a is the result of wild type S protein trimer, B is the result of S protein trimer translated from B1.351mRNA, and c is blank control.

FIG. 8: statistical figures of the production of in vivo binding and neutralizing antibodies after immunization of BALB/c mice with lipid nanoparticles encoding the mRNA of the S protein mutants. D, e and f in the figure are respectively the detection results of the bound antibody after the immunization of the Lipid Nanoparticle (LNP) of mRNA of 5 mug, 1 mug and 0.2 mug, and the ordinate in the figure is the concentration (mug/ml); in the figure, g, h and i are respectively the detection results of neutralizing antibodies after the immunization of Lipid Nanoparticles (LNP) of mRNA of 5 mug, 1 mug and 0.2 mug, the abscissa of the figure is the log conversion value of serum dilution times, and the ordinate of the figure is the inhibition percentage%.

Detailed Description

The technical solution of the present invention will be further described in detail with reference to specific embodiments. It is to be understood that the following examples are illustrative only and are not to be construed as limiting the scope of the invention. All the techniques realized based on the above-mentioned contents of the present invention are covered in the protection scope of the present invention.

Unless otherwise indicated, the raw materials and reagents used in the following examples are all commercially available products or can be prepared by known methods. The experimental method is a molecular biological method which is conventional in the field, and can be operated according to the guidance of molecular biological experimental manuals or kit product instructions in the field.

Example 1 Synthesis of lipid II-37

Synthesis of linolenol (a 2): liAlH was added to 950mL of tetrahydrofuran at 0 deg.C ₄ (7.20 g), linoleic acid (50 g, a 1), after which the mixture was stirred at 25 ℃ for 2h. After completion of the reaction as shown by Thin Layer Chromatography (TLC), the reaction mixture was quenched by adding water (7.2 mL), aqueous NaOH (7.2 mL, 15% by mass) and water (21.6 mL) in this order, and adding an appropriate amount of Na ₂ SO ₄ Stirring for 15 minutes, filtering by a Buchner funnel, washing a filter cake by ethyl acetate, collecting filtrate, evaporating and concentrating to obtain a target productLinolenol (a 2) 47.4g.

¹ H NMR(400MHz,CDCl ₃ ):δ5.27-5.44(m,4H),3.63(t,J＝6.63Hz,2H),2.77(t,J＝6.44 Hz,2H),1.97-2.12(m,4H),1.57-1.63(m,1H),1.20-1.46(m,18H),0.83-0.95(m,3H)

Synthesis of (9Z, 12Z) -octadeca-9, 12-dienal (a 3): linseed alcohol (25.0 g, a 2) and 2-iodoxybenzoic acid (39.4 g) were added to 170mL of acetonitrile at room temperature, after which the mixture was stirred at 85 ℃ for 4h. The reaction solution was filtered through a Buchner funnel and the filter cake was washed with methylene chloride, and the filtrate was collected and concentrated by evaporation to obtain 24.0g of the target product (9Z, 12Z) -octadeca-9, 12-dienal (a 3).

¹ H NMR(400MHz,CDCl ₃ ):δ9.76(t,J＝1.76Hz,1H),5.25-5.43(m,4H),2.76(t,J＝6.17 Hz,2H),2.41(td,J＝7.33,1.87Hz,2H),2.04(q,J＝6.84Hz,4H),1.56-1.68(m,2H),1.22-1.36 (m,14H),0.88(t,J＝6.73Hz,3H)

Synthesis of (9Z, 12Z) -2-chloro-octadeca-9, 12-dien-1-ol (a 4): (9Z, 12Z) -octadeca-9, 12-dienal (43.0 g, a 3), DL-proline (5.62 g) and N-chlorosuccinimide were added to 246mL of acetonitrile at 0 ℃ and then stirred at 0 ℃ for 2h. After completion of the reaction, the reaction solution was diluted with anhydrous ethanol (246 mL), and sodium borohydride (8.8 g) was added, followed by stirring at 0 ℃ for 4h. The reaction mixture was quenched with water (120 mL) and extracted with methyl tert-butyl ether, and the combined organic phases were washed with saturated brine, dried over sodium sulfate, filtered, and concentrated by evaporation to give the desired product (9Z, 12Z) -2-chloro-octadeca-9, 12-dien-1-ol (a 4,46 g) which was used directly in the next step.

¹ H NMR(400MHz,CDCl ₃ ):δ5.25-5.51(m,4H),3.97-4.07(m,1H),3.79(dd,J＝12.01, 3.63Hz,1H),3.59-3.70(m,1H),2.67-2.90(m,2H),1.96-2.15(m,5H),1.64-1.82(m,1H), 1.20-1.49(m,15H),0.89(br t,J＝6.75Hz,3H)

Synthesis of 2- [ (7Z, 10Z) -hexadecane-7, 10-diene ] oxirane (a 5): to 450mL1, 4-dioxane, (9Z, 12Z) -2-chloro-octadeca-9, 12-dien-1-ol (45g, a4) and aqueous sodium hydroxide (120 g sodium hydroxide in 585mL water) were added at room temperature, and the mixture was stirred at 35 ℃ for 2h after the addition. After TLC showed that the reaction was completed, the reaction solution was separated by a separatory funnel and washed with saturated brine, dried over sodium sulfate, filtered and concentrated by evaporation, and then the residue was purified by flash column chromatography eluting with petroleum ether/ethyl acetate to obtain 29.11g of the desired product, 2- [ (7z, 10z) -hexadecane-7, 10-diene ] oxirane (a 5).

¹ H NMR(400MHz,CDCl ₃ ):δ5.27-5.46(m,4H),2.87-2.98(m,1H),2.70-2.85(m,3H), 2.46(dd,J＝5.00,2.75Hz,1H),1.94-2.21(m,4H),1.24-1.58(m,17H),0.78-1.00(m,3H)

Synthesis of II-37: to 10mL of ethanol were added 2- [ (7Z, 10Z) -hexadeca-7, 10-diene ] ethylene oxide (5 g) and N, N-bis (2-aminoethyl) methylamine (739 mg) at room temperature, and the mixture was stirred at 90 ℃ for 36h. The reaction was concentrated by evaporation and the residue was purified by flash column chromatography eluting with dichloromethane/methanol to give crude II-37 (4 g). The desired product was again purified by flash column chromatography with dichloromethane/methanol to give II-37 (2.2 g).

¹ H NMR(400MHz,CDCl ₃ ):δ5.27-5.44(m,12H),3.48-3.79(m,3H),2.63-3.00(m,12H), 2.16-2.61(m,12H),2.05(q,J＝6.80Hz,12H),1.18-1.57(m,51H),0.89(t,J＝6.88Hz,9H)

ESI-MS：m/z 910.8[M+H] ⁺ ,911.8[M+2H] ⁺ ,912.8[M+3H] ⁺

Example 2B1.351 mRNA preparation and translation thereof

1. A nucleic acid sequence capable of coding the mRNA shown in the SEQ ID No.8 is artificially synthesized, and the sequence is cloned behind a T7 promoter of a pUC57-kana vector, wherein the vector is modified before and already contains sequences capable of coding SEQ ID No. 6, a Kozak sequence, 2 head-to-tail SEQ ID No. 7 and a polyA tail. The nucleic acid sequence encoding the mRNA shown in SEQ ID NO.8 was cloned into a multiple cloning site between Kozak sequence and 2 head-to-tail SEQ ID NO. 7 to construct a plasmid for in vitro transcription.

2. The constructed plasmid is transformed into Escherichia coli Dh5a, cultured and amplified, and the plasmid is extracted.

3. The extracted plasmid was digested into linear molecules using the restriction enzyme SpeI immediately after the polyA tail.

4. The prepared linearized plasmid molecules are used as a template to prepare mRNA (shown as SEQ ID NO: 9) by using an in vitro transcription method (an in vitro transcription kit A45975 of Thermo company), the mRNA is abbreviated as B1.351mRNA hereinafter, and the mRNA is translated to obtain the S protein mutant of the invention, the amino acid sequence of which is directly connected with the amino acid sequence of SEQ ID NO:2 and the amino acid sequence of SEQ ID NO:3 from the N end to the C end. After the in vitro transcription is complete, CAP structures of CAP1 are added to the mRNA using capping enzyme and dimethyl transferase.

Purification of mRNA: the resulting mRNA stock solution was purified by affinity chromatography.

Quality control of mRNA: the prepared mRNA was analyzed for mRNA integrity on a 2100 bioanalyzer using an RNA 6000nano chip, and the result is shown in FIG. 1, wherein the transcribed mRNA has a single band and is not significantly degraded.

In addition, a Spike fragment was excised from the commercial plasmid pCMV3-Spike by restriction enzymes HindIII and EcoRI and inserted between HindIII and EcoRI sites of the IVT1 vector of example 5 to obtain an IVT1-Spike plasmid. And carrying out point mutation on the plasmid to obtain IVT1-spike-D614G plasmid, carrying out in vitro transcription by taking the plasmid as a template to obtain spike-D614G mRNA, and expressing the full-length S protein containing the D614G mutation.

Detection of cellular level expression of B1.351 mRNA: a CHO-K1 cell line is taken as an expression system, mRNA is transfected by using Lipofectamine Messenger MAX Reagent (Invitrogen, cat # 1168-027), after 48 hours of culture, cell culture supernatant is collected, and an enzyme-linked immunosorbent assay kit for detecting S protein is adopted to detect the expression level of the S protein so as to judge whether the mRNA can be translated into protein or not. The results are shown in FIG. 2. In FIG. 2, "spike DNA" is a commercial plasmid pCMV3-spike (purchased from Chinesian corporation), expressing the full-length wild-type S protein; the "spike-D614G mRNA" is the mRNA expressing the full-length S protein containing the D614G mutation, and the "spike B1.351 mRNA" is the B1.351mRNA, and the expressed S protein mutant is the S protein mutant of the invention, and the result shows that the mRNA of the invention can highly express the S protein mutant in the cell.

After the obtained S protein mutant was purified, structural analysis was performed using a cryo-electron microscope, the 3D structure of the S protein was as shown in fig. 3, and the S protein mutant was a stable structure of prefusion spike structure. The B1.351 mutant strain has a sequence which is different from that of a wild strain in 9 mutation sites, wherein 3 mutation sites are in an RBD region. The RBD domain status of the prefusion S protein of wild strains has been reported to be mainly 1 OPEN, 2 CLOSE structures. The structure of the S protein mutant of the invention is mainly the flexible state of 2 OPENs and 1 CLOSE. This structural difference, which is the structural basis for the enhanced binding and infectivity of the virus to the receptor ACE2, also leads to a significant difference in the immunogenic epitopes of the S protein, and thus to a significant difference in the antibodies, especially neutralizing antibodies, induced on the basis of different structures.

Example 3 preparation of lipid nanoparticle composition comprising nucleic acid

Accurately weighing compound II-37, DOPE, CHOL, DSPE-PEG2000, DSPC, DMG-PEG2000, etc., placing each lipid in a suitable container, and dissolving with anhydrous ethanol completely for use.

The lipids were mixed uniformly in the molar ratios shown in the following table, and the nucleic acid (mRNA or DNA) was prepared as an aqueous solution (using pure water as a solvent) as an organic phase, with pH =4.

Mixing the organic phase and the aqueous phase according to the volume ratio of 3. And (3) carrying out centrifugal filtration on the obtained lipid nanoparticle suspension liquid through a 100KDa ultrafiltration centrifugal tube, purifying and concentrating, and subpackaging the concentrated liquid.

The lipid nanoparticles obtained by preparation were measured for particle size, PDI, and potential using a laser nanoparticle sizer, and encapsulation efficiency (%) using an ultraviolet spectrophotometer in combination with a RiboGreen RNA kit, with the following exemplary results.

After the preparation process is optimized, lipid nanoparticles with better physical and chemical quality control data can be obtained, and the formula results of II-37 DSPC: CHOL: DMG-PEG2000 are shown in the following table, wherein the molar ratio of the lipid of tri-009-BJ-LNP-21040601 is 40; the molar ratio of the lipid of the tri-009-BJ-LNP-21040602 is 35; the molar ratio of the lipid of the tri-009-BJ-LNP-21040603 is 45. One of the samples was transfected into CHO cells in the same manner as in example 2, and the protein expression was measured by Elisa to evaluate the transfection efficiency of the cells.

Sample numbering	PDI	Diameter (nm)	EE％	Zeta potential (mV)
					tri-009-BJ-LNP-21040601	0.1429	140.36±27.54	100.00	24.91
tri-009-BJ-LNP-21040602	0.2335	120.48±21.39	100.00	27.58
					tri-009-BJ-LNP-21040603	0.1885	134.20±22.20	100.00	28.04

The results of cell transfection are shown in FIG. 4, "tri-009-BJ-LNP-21040601", "tri-009-BJ-LNP-21040602", "tri-009-BJ-LNP-21040603" are the above-mentioned corresponding formulations for loading the B1.351mRNA of example 2, and "lipoMax-spike mRNA" is the one obtained by lipoMax ^TM The B1.351mRNA of example 2 was entrapped, and the "negative control" was an empty lipid nanoparticle containing no mRNA. From FIG. 4, it can be seen that 48 hours after transfection of cells with the nucleic acid-loaded lipid nanoparticles obtained from II-37, the expression of antigen protein was detected by ELISA, and the transfection efficiency of cells was comparable to that of commercial lipoMax ^TM Quite even better.

Example 4 comparison of the Effect of II-37 and commercially available ionizable cationic lipid molecule MC3

MC3 is: 4- (N, N-dimethylamino) butanoic acid (6Z, 9Z,28Z, 31Z) -heptatriaconta-6, 9,28, 31-tetralin-19-yl ester.

Lipid nanoparticles were prepared according to the method described in example 3 using II37 and MC3, respectively, at the following specific molar ratios: II-37; MC3: DSPC: CHOL: DMG-PEG2000= 45; the B1.351mRNA of example 2 was entrapped.

The physical, chemical and quality control data of the prepared lipid nanoparticles are shown in the following table:

sample information	Particle size (nm)	PDI	Zeta potential	Encapsulation efficiency
					mRNA-LNP(II-37)	154.58±27.75	0.1068	22.07	90.5
mRNA-LNP(MC3)	234.08±40.11	0.1259	2.44	40.7

As can be seen from the above table, the encapsulation rate of the lipid nanoparticles prepared in II-37 is as high as 90.5% and is much higher than that of the lipid nanoparticles prepared in MC3 under the same preparation process, and the lipid nanoparticles have smaller and more uniform particle size and higher potential.

The cells were transfected with the prepared lipocalin nanoparticles in the same manner as in example 2, and the expression of proteins was understood, and as a result, as shown in FIG. 5, after the lipocalin nanoparticles prepared from II-37 (indicated by C2 in the figure) carried mRNA and transfected into the cells, the protein expression level in the cells was much higher than that of MC3, indicating that the lipocalin nanoparticles prepared from II-37 had high cell transfection efficiency.

EXAMPLE 5 comparative experiments on the efficiency of IVT vectors of the invention

In the embodiment, firefly Luc is used as a reporter protein, different IVT vectors are constructed for in vitro transcription synthesis of mRNA capable of translating Firefly Luc, and the translation efficiency of the synthesized mRNA with different sequence characteristics is compared.

The encoding sequence of Firefly Luc is cloned to the multiple cloning sites of the corresponding vector by adopting the conventional plasmid vector construction technology in the field to obtain vectors with numbers of IVT1, IVT2, IVT3 and IVT4 respectively, and then the corresponding Firefly Luc mRNA sample is prepared by using an AM1344 kit according to the in vitro transcription of the vectors.

The vectors IVT1 to IVT4 are all transformed on the basis of a commercial vector psp73, the following sequences are inserted at the restriction site XhoI/NdeI of the vector psp73, wherein no UTR sequence is added in IVT1, and the length of a polyA tail is 64A; IVT2 uses 5' UTR shown in SEQ ID NO:6 and 3' UTR sequence (3 ' UTR sequence of beta globin) of GCTCGCTTTCTTGCTGTCCAATTTCTATTAAAGGTTCCTTTGTTCCCTCAAGTCCAACTAC TAAACTGGGGGATATTATGAAGGGCCTTGAGCATCTGGATCTGCCTAATAAAAAACA TTTATTTTTTCATTGC, and polyA has a length of 120A; IVT3 uses 5'UTR shown in SEQ ID NO:6 and 3' UTR sequence shown in SEQ ID NO:7, and polyA is 120A in length; IVT4 uses 5'UTR shown in SEQ ID NO. 6 and 2 3' UTR sequences shown in SEQ ID NO. 7 repeated in tandem, and has a polyA length of 120A. A multiple cloning site containing common enzyme cutting sites HindIII and EcoRI was inserted into the sequence of the 5'UTR and 3' UTR, and the coding sequence of Firefly Luc was cloned into the multiple cloning site of HindIII and EcoRI. All vectors were constructed by Kinseri using a gene synthesis method.

Each Firefly Luc mRNA sample was transfected into CHO cells using Dual-Lumi using Lipofectamine2000 (cat #11668030, from Seimerle Feishell Co.) as a transfection reagent ^TM A dual-luciferase reporter assay kit (at # RG088S, available from Shanghai Bin Yuntian Biotechnology Ltd.) detects luciferase. DNA from Firefly Luc was transferred into a psicheck2 plasmid as a positive control (psicheck 2 plasmid, cat #60908-6151, available from Genet technologies Limited in Beijing Tianenza). The method comprises the following specific steps: the first day, CHO cells were seeded into 96-well plates at 1.5X 10 per well ⁴ (ii) individual cells, cultured overnight using F12K +10% fbs; the following day, the medium was changed toSerum-free F12K medium, using Lipofectamine2000, to transfect mRNA or DNA into CHO cells; the amount of nucleic acid used per well was 100ng, the amount of liposomes was 0.3. Mu.l, the total volume per well was 100. Mu.l, and overnight culture was carried out; on the third day, the serum-free medium was changed to complete medium (F12K +10% FBS), and cultivation was continued for 24 hours; on the fourth day (48 hours after transfection), firefly Luc fluorescence values were measured.

The results are shown in FIG. 6. In the figure, "DNA" is a positive control (psichelk 2 plasmid carrying DNA of Firefly Luc), "IVT1-Luc", "IVT2-Luc", "IVT3-Luc", "IVT4-Luc" represent the corresponding Firefly Luc mRNA transcribed in vitro from vectors of IVT1, IVT2, IVT3 and IVT4, respectively, and "negative control". As can be seen from FIG. 6, the protein expression level of IVT4-Luc is much higher than that of the other three mRNAs by 2-3 times under the same mRNA transfection level, which indicates that IVT4-Luc has good stability and high translation efficiency.

EXAMPLE 6 determination of immunogenicity of S protein mutants

The S protein mutants were evaluated using BALB/c mice for the induction of production of binding and neutralizing antibodies: 6 weeks old female BALB/c mouse, the primary immunity and the secondary immunity are separated by 2 weeks; blood was collected 14 days after immunization. ELISA measures the expression of binding antibodies against S protein mutants and chemiluminescence measures the neutralizing antibody titer against S protein mutants.

Detection of bound antibody by ELISA: binding antibodies against S protein mutants in immunized mouse plasma were captured by coating commercial S protein on an enzyme label plate, and absorbance detection was performed with biotin-labeled detection antibodies. Chemiluminescence assay neutralizing antibody titers against S protein mutants: after immunization, the plasma of mice was neutralized with a luciferase reporter-carrying SPIKE lentivirus (Zhongjingkang; trade name: SRAS-CoV-2 pseudovirus (B.1.351) -LUC; trade name: DZPSC-L-0; batch: K05202102) to infect 293T cells highly expressing ACE-2 (Zhongjingkang; trade name: YJ1B09 "hACE 2-293T cells lines; trade name: YJ293T-01; batch: A02023201), and the plasma neutralization antibody titer was assessed using chemiluminescence (Bright-Lumi II firefly luciferase reporter assay kit, brand: biyun day; trade name: RG 052M).

The control group consisted of 9 mice, each of which was injected subcutaneously with 2ug of protein. Of these, 3 injected proteins were trimer purifications of the S protein translated from B1.351mRNA of example 2, 3 injected proteins were trimers of the wild-type S protein, 3 injected were blank lipid nanoparticles, and the lipid formulation of the lipid nanoparticles was tri-009-BJ-LNP-21040602 in example 3.

A total of 18 mice in the experimental group were injected subcutaneously with lipid nanoparticles of mRNA; lipid Nanoparticles (LNPs) injected with 0.2 μ g of mRNA No. 1-6, 1 μ g of mRNA No. 7-12, and 5 μ g of mRNA No. 13-18 in example 2, wherein the mRNA is B1.351mRNA and the formulation of the lipid nanoparticles is tri-009-BJ-LNP-21040602 in example 3.

The levels of mouse bound antibody expression and neutralizing antibody after primary and secondary immunizations are shown in FIGS. 7-8.

As can be seen from a, B and c in FIG. 7, the trimer S protein translated from B1.351mRNA in example 2 and the trimer S protein in wild type both induced anti-S protein binding antibodies in mice: higher concentrations of bound antibody were already produced in the experimental mice at the second immunization, which remained high 8 weeks after the second immunization, and were calculated to be around 2.2. Mu.g/ml and around 1.6. Mu.g/ml at 8 weeks after the second immunization.

As can be seen in FIGS. 8 d, e, and f, mice post-immunisation with LNP-encapsulated mRNA formulations induced anti-S protein binding antibody in the mice even in the low dose (0.2. Mu.g) injection group, which was calculated to be at a level of about 0.1-0.3. Mu.g/ml. As can be seen in fig. 8, g, h, i, the mice post-immunisation with LNP-encapsulated mRNA preparations induced better neutralising antibodies with GMT values of 78.69, 21.9 and 72.19 respectively.

The embodiments of the present invention have been described above. However, the present invention is not limited to the above embodiment. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

SEQUENCE LISTING

<110> Beijing Qichen Biotechnology Limited

<120> a lipid nanoparticle composition and drug delivery system prepared therefrom

<130> CPCN21411053

<160> 9

<170> PatentIn version 3.5

<210> 1

<211> 1273

<212> PRT

<213> Unknown

<220>

<223> 2019-nCoV wild-type S protein

<400> 1

Met Phe Val Phe Leu Val Leu Leu Pro Leu Val Ser Ser Gln Cys Val

1 5 10 15

Asn Leu Thr Thr Arg Thr Gln Leu Pro Pro Ala Tyr Thr Asn Ser Phe

20 25 30

Thr Arg Gly Val Tyr Tyr Pro Asp Lys Val Phe Arg Ser Ser Val Leu

35 40 45

His Ser Thr Gln Asp Leu Phe Leu Pro Phe Phe Ser Asn Val Thr Trp

50 55 60

Phe His Ala Ile His Val Ser Gly Thr Asn Gly Thr Lys Arg Phe Asp

65 70 75 80

Asn Pro Val Leu Pro Phe Asn Asp Gly Val Tyr Phe Ala Ser Thr Glu

85 90 95

Lys Ser Asn Ile Ile Arg Gly Trp Ile Phe Gly Thr Thr Leu Asp Ser

100 105 110

Lys Thr Gln Ser Leu Leu Ile Val Asn Asn Ala Thr Asn Val Val Ile

115 120 125

Lys Val Cys Glu Phe Gln Phe Cys Asn Asp Pro Phe Leu Gly Val Tyr

130 135 140

Tyr His Lys Asn Asn Lys Ser Trp Met Glu Ser Glu Phe Arg Val Tyr

145 150 155 160

Ser Ser Ala Asn Asn Cys Thr Phe Glu Tyr Val Ser Gln Pro Phe Leu

165 170 175

Met Asp Leu Glu Gly Lys Gln Gly Asn Phe Lys Asn Leu Arg Glu Phe

180 185 190

Val Phe Lys Asn Ile Asp Gly Tyr Phe Lys Ile Tyr Ser Lys His Thr

195 200 205

Pro Ile Asn Leu Val Arg Asp Leu Pro Gln Gly Phe Ser Ala Leu Glu

210 215 220

Pro Leu Val Asp Leu Pro Ile Gly Ile Asn Ile Thr Arg Phe Gln Thr

225 230 235 240

Leu Leu Ala Leu His Arg Ser Tyr Leu Thr Pro Gly Asp Ser Ser Ser

245 250 255

Gly Trp Thr Ala Gly Ala Ala Ala Tyr Tyr Val Gly Tyr Leu Gln Pro

260 265 270

Arg Thr Phe Leu Leu Lys Tyr Asn Glu Asn Gly Thr Ile Thr Asp Ala

275 280 285

Val Asp Cys Ala Leu Asp Pro Leu Ser Glu Thr Lys Cys Thr Leu Lys

290 295 300

Ser Phe Thr Val Glu Lys Gly Ile Tyr Gln Thr Ser Asn Phe Arg Val

305 310 315 320

Gln Pro Thr Glu Ser Ile Val Arg Phe Pro Asn Ile Thr Asn Leu Cys

325 330 335

Pro Phe Gly Glu Val Phe Asn Ala Thr Arg Phe Ala Ser Val Tyr Ala

340 345 350

Trp Asn Arg Lys Arg Ile Ser Asn Cys Val Ala Asp Tyr Ser Val Leu

355 360 365

Tyr Asn Ser Ala Ser Phe Ser Thr Phe Lys Cys Tyr Gly Val Ser Pro

370 375 380

Thr Lys Leu Asn Asp Leu Cys Phe Thr Asn Val Tyr Ala Asp Ser Phe

385 390 395 400

Val Ile Arg Gly Asp Glu Val Arg Gln Ile Ala Pro Gly Gln Thr Gly

405 410 415

Lys Ile Ala Asp Tyr Asn Tyr Lys Leu Pro Asp Asp Phe Thr Gly Cys

420 425 430

Val Ile Ala Trp Asn Ser Asn Asn Leu Asp Ser Lys Val Gly Gly Asn

435 440 445

Tyr Asn Tyr Leu Tyr Arg Leu Phe Arg Lys Ser Asn Leu Lys Pro Phe

450 455 460

Glu Arg Asp Ile Ser Thr Glu Ile Tyr Gln Ala Gly Ser Thr Pro Cys

465 470 475 480

Asn Gly Val Glu Gly Phe Asn Cys Tyr Phe Pro Leu Gln Ser Tyr Gly

485 490 495

Phe Gln Pro Thr Asn Gly Val Gly Tyr Gln Pro Tyr Arg Val Val Val

500 505 510

Leu Ser Phe Glu Leu Leu His Ala Pro Ala Thr Val Cys Gly Pro Lys

515 520 525

Lys Ser Thr Asn Leu Val Lys Asn Lys Cys Val Asn Phe Asn Phe Asn

530 535 540

Gly Leu Thr Gly Thr Gly Val Leu Thr Glu Ser Asn Lys Lys Phe Leu

545 550 555 560

Pro Phe Gln Gln Phe Gly Arg Asp Ile Ala Asp Thr Thr Asp Ala Val

565 570 575

Arg Asp Pro Gln Thr Leu Glu Ile Leu Asp Ile Thr Pro Cys Ser Phe

580 585 590

Gly Gly Val Ser Val Ile Thr Pro Gly Thr Asn Thr Ser Asn Gln Val

595 600 605

Ala Val Leu Tyr Gln Asp Val Asn Cys Thr Glu Val Pro Val Ala Ile

610 615 620

His Ala Asp Gln Leu Thr Pro Thr Trp Arg Val Tyr Ser Thr Gly Ser

625 630 635 640

Asn Val Phe Gln Thr Arg Ala Gly Cys Leu Ile Gly Ala Glu His Val

645 650 655

Asn Asn Ser Tyr Glu Cys Asp Ile Pro Ile Gly Ala Gly Ile Cys Ala

660 665 670

Ser Tyr Gln Thr Gln Thr Asn Ser Pro Arg Arg Ala Arg Ser Val Ala

675 680 685

Ser Gln Ser Ile Ile Ala Tyr Thr Met Ser Leu Gly Ala Glu Asn Ser

690 695 700

Val Ala Tyr Ser Asn Asn Ser Ile Ala Ile Pro Thr Asn Phe Thr Ile

705 710 715 720

Ser Val Thr Thr Glu Ile Leu Pro Val Ser Met Thr Lys Thr Ser Val

725 730 735

Asp Cys Thr Met Tyr Ile Cys Gly Asp Ser Thr Glu Cys Ser Asn Leu

740 745 750

Leu Leu Gln Tyr Gly Ser Phe Cys Thr Gln Leu Asn Arg Ala Leu Thr

755 760 765

Gly Ile Ala Val Glu Gln Asp Lys Asn Thr Gln Glu Val Phe Ala Gln

770 775 780

Val Lys Gln Ile Tyr Lys Thr Pro Pro Ile Lys Asp Phe Gly Gly Phe

785 790 795 800

Asn Phe Ser Gln Ile Leu Pro Asp Pro Ser Lys Pro Ser Lys Arg Ser

805 810 815

Phe Ile Glu Asp Leu Leu Phe Asn Lys Val Thr Leu Ala Asp Ala Gly

820 825 830

Phe Ile Lys Gln Tyr Gly Asp Cys Leu Gly Asp Ile Ala Ala Arg Asp

835 840 845

Leu Ile Cys Ala Gln Lys Phe Asn Gly Leu Thr Val Leu Pro Pro Leu

850 855 860

Leu Thr Asp Glu Met Ile Ala Gln Tyr Thr Ser Ala Leu Leu Ala Gly

865 870 875 880

Thr Ile Thr Ser Gly Trp Thr Phe Gly Ala Gly Ala Ala Leu Gln Ile

885 890 895

Pro Phe Ala Met Gln Met Ala Tyr Arg Phe Asn Gly Ile Gly Val Thr

900 905 910

Gln Asn Val Leu Tyr Glu Asn Gln Lys Leu Ile Ala Asn Gln Phe Asn

915 920 925

Ser Ala Ile Gly Lys Ile Gln Asp Ser Leu Ser Ser Thr Ala Ser Ala

930 935 940

Leu Gly Lys Leu Gln Asp Val Val Asn Gln Asn Ala Gln Ala Leu Asn

945 950 955 960

Thr Leu Val Lys Gln Leu Ser Ser Asn Phe Gly Ala Ile Ser Ser Val

965 970 975

Leu Asn Asp Ile Leu Ser Arg Leu Asp Lys Val Glu Ala Glu Val Gln

980 985 990

Ile Asp Arg Leu Ile Thr Gly Arg Leu Gln Ser Leu Gln Thr Tyr Val

995 1000 1005

Thr Gln Gln Leu Ile Arg Ala Ala Glu Ile Arg Ala Ser Ala Asn

1010 1015 1020

Leu Ala Ala Thr Lys Met Ser Glu Cys Val Leu Gly Gln Ser Lys

1025 1030 1035

Arg Val Asp Phe Cys Gly Lys Gly Tyr His Leu Met Ser Phe Pro

1040 1045 1050

Gln Ser Ala Pro His Gly Val Val Phe Leu His Val Thr Tyr Val

1055 1060 1065

Pro Ala Gln Glu Lys Asn Phe Thr Thr Ala Pro Ala Ile Cys His

1070 1075 1080

Asp Gly Lys Ala His Phe Pro Arg Glu Gly Val Phe Val Ser Asn

1085 1090 1095

Gly Thr His Trp Phe Val Thr Gln Arg Asn Phe Tyr Glu Pro Gln

1100 1105 1110

Ile Ile Thr Thr Asp Asn Thr Phe Val Ser Gly Asn Cys Asp Val

1115 1120 1125

Val Ile Gly Ile Val Asn Asn Thr Val Tyr Asp Pro Leu Gln Pro

1130 1135 1140

Glu Leu Asp Ser Phe Lys Glu Glu Leu Asp Lys Tyr Phe Lys Asn

1145 1150 1155

His Thr Ser Pro Asp Val Asp Leu Gly Asp Ile Ser Gly Ile Asn

1160 1165 1170

Ala Ser Val Val Asn Ile Gln Lys Glu Ile Asp Arg Leu Asn Glu

1175 1180 1185

Val Ala Lys Asn Leu Asn Glu Ser Leu Ile Asp Leu Gln Glu Leu

1190 1195 1200

Gly Lys Tyr Glu Gln Tyr Ile Lys Trp Pro Trp Tyr Ile Trp Leu

1205 1210 1215

Gly Phe Ile Ala Gly Leu Ile Ala Ile Val Met Val Thr Ile Met

1220 1225 1230

Leu Cys Cys Met Thr Ser Cys Cys Ser Cys Leu Lys Gly Cys Cys

1235 1240 1245

Ser Cys Gly Ser Cys Cys Lys Phe Asp Glu Asp Asp Ser Glu Pro

1250 1255 1260

Val Leu Lys Gly Val Lys Leu His Tyr Thr

1265 1270

<210> 2

<211> 1205

<212> PRT

<213> Artificial Sequence

<220>

<223> 2019-nCoV S protein mutant

<400> 2

Met Phe Val Phe Leu Val Leu Leu Pro Leu Val Ser Ser Gln Cys Val

1 5 10 15

Asn Phe Thr Thr Arg Thr Gln Leu Pro Pro Ala Tyr Thr Asn Ser Phe

20 25 30

Thr Arg Gly Val Tyr Tyr Pro Asp Lys Val Phe Arg Ser Ser Val Leu

35 40 45

His Ser Thr Gln Asp Leu Phe Leu Pro Phe Phe Ser Asn Val Thr Trp

50 55 60

Phe His Ala Ile His Val Ser Gly Thr Asn Gly Thr Lys Arg Phe Ala

65 70 75 80

Asn Pro Val Leu Pro Phe Asn Asp Gly Val Tyr Phe Ala Ser Thr Glu

85 90 95

Lys Ser Asn Ile Ile Arg Gly Trp Ile Phe Gly Thr Thr Leu Asp Ser

100 105 110

Lys Thr Gln Ser Leu Leu Ile Val Asn Asn Ala Thr Asn Val Val Ile

115 120 125

Lys Val Cys Glu Phe Gln Phe Cys Asn Asp Pro Phe Leu Gly Val Tyr

130 135 140

Tyr His Lys Asn Asn Lys Ser Trp Met Glu Ser Glu Phe Arg Val Tyr

145 150 155 160

Ser Ser Ala Asn Asn Cys Thr Phe Glu Tyr Val Ser Gln Pro Phe Leu

165 170 175

Met Asp Leu Glu Gly Lys Gln Gly Asn Phe Lys Asn Leu Arg Glu Phe

180 185 190

Val Phe Lys Asn Ile Asp Gly Tyr Phe Lys Ile Tyr Ser Lys His Thr

195 200 205

Pro Ile Asn Leu Val Arg Gly Leu Pro Gln Gly Phe Ser Ala Leu Glu

210 215 220

Pro Leu Val Asp Leu Pro Ile Gly Ile Asn Ile Thr Arg Phe Gln Thr

225 230 235 240

Leu His Ile Ser Tyr Leu Thr Pro Gly Asp Ser Ser Ser Gly Trp Thr

245 250 255

Ala Gly Ala Ala Ala Tyr Tyr Val Gly Tyr Leu Gln Pro Arg Thr Phe

260 265 270

Leu Leu Lys Tyr Asn Glu Asn Gly Thr Ile Thr Asp Ala Val Asp Cys

275 280 285

Ala Leu Asp Pro Leu Ser Glu Thr Lys Cys Thr Leu Lys Ser Phe Thr

290 295 300

Val Glu Lys Gly Ile Tyr Gln Thr Ser Asn Phe Arg Val Gln Pro Thr

305 310 315 320

Glu Ser Ile Val Arg Phe Pro Asn Ile Thr Asn Leu Cys Pro Phe Gly

325 330 335

Glu Val Phe Asn Ala Thr Arg Phe Ala Ser Val Tyr Ala Trp Asn Arg

340 345 350

Lys Arg Ile Ser Asn Cys Val Ala Asp Tyr Ser Val Leu Tyr Asn Ser

355 360 365

Ala Ser Phe Ser Thr Phe Lys Cys Tyr Gly Val Ser Pro Thr Lys Leu

370 375 380

Asn Asp Leu Cys Phe Thr Asn Val Tyr Ala Asp Ser Phe Val Ile Arg

385 390 395 400

Gly Asp Glu Val Arg Gln Ile Ala Pro Gly Gln Thr Gly Asn Ile Ala

405 410 415

Asp Tyr Asn Tyr Lys Leu Pro Asp Asp Phe Thr Gly Cys Val Ile Ala

420 425 430

Trp Asn Ser Asn Asn Leu Asp Ser Lys Val Gly Gly Asn Tyr Asn Tyr

435 440 445

Leu Tyr Arg Leu Phe Arg Lys Ser Asn Leu Lys Pro Phe Glu Arg Asp

450 455 460

Ile Ser Thr Glu Ile Tyr Gln Ala Gly Ser Thr Pro Cys Asn Gly Val

465 470 475 480

Lys Gly Phe Asn Cys Tyr Phe Pro Leu Gln Ser Tyr Gly Phe Gln Pro

485 490 495

Thr Tyr Gly Val Gly Tyr Gln Pro Tyr Arg Val Val Val Leu Ser Phe

500 505 510

Glu Leu Leu His Ala Pro Ala Thr Val Cys Gly Pro Lys Lys Ser Thr

515 520 525

Asn Leu Val Lys Asn Lys Cys Val Asn Phe Asn Phe Asn Gly Leu Thr

530 535 540

Gly Thr Gly Val Leu Thr Glu Ser Asn Lys Lys Phe Leu Pro Phe Gln

545 550 555 560

Gln Phe Gly Arg Asp Ile Ala Asp Thr Thr Asp Ala Val Arg Asp Pro

565 570 575

Gln Thr Leu Glu Ile Leu Asp Ile Thr Pro Cys Ser Phe Gly Gly Val

580 585 590

Ser Val Ile Thr Pro Gly Thr Asn Thr Ser Asn Gln Val Ala Val Leu

595 600 605

Tyr Gln Gly Val Asn Cys Thr Glu Val Pro Val Ala Ile His Ala Asp

610 615 620

Gln Leu Thr Pro Thr Trp Arg Val Tyr Ser Thr Gly Ser Asn Val Phe

625 630 635 640

Gln Thr Arg Ala Gly Cys Leu Ile Gly Ala Glu His Val Asn Asn Ser

645 650 655

Tyr Glu Cys Asp Ile Pro Ile Gly Ala Gly Ile Cys Ala Ser Tyr Gln

660 665 670

Thr Gln Thr Asn Ser Pro Gly Ser Ala Ser Ser Val Ala Ser Gln Ser

675 680 685

Ile Ile Ala Tyr Thr Met Ser Leu Gly Val Glu Asn Ser Val Ala Tyr

690 695 700

Ser Asn Asn Ser Ile Ala Ile Pro Thr Asn Phe Thr Ile Ser Val Thr

705 710 715 720

Thr Glu Ile Leu Pro Val Ser Met Thr Lys Thr Ser Val Asp Cys Thr

725 730 735

Met Tyr Ile Cys Gly Asp Ser Thr Glu Cys Ser Asn Leu Leu Leu Gln

740 745 750

Tyr Gly Ser Phe Cys Thr Gln Leu Asn Arg Ala Leu Thr Gly Ile Ala

755 760 765

Val Glu Gln Asp Lys Asn Thr Gln Glu Val Phe Ala Gln Val Lys Gln

770 775 780

Ile Tyr Lys Thr Pro Pro Ile Lys Asp Phe Gly Gly Phe Asn Phe Ser

785 790 795 800

Gln Ile Leu Pro Asp Pro Ser Lys Pro Ser Lys Arg Ser Pro Ile Glu

805 810 815

Asp Leu Leu Phe Asn Lys Val Thr Leu Ala Asp Ala Gly Phe Ile Lys

820 825 830

Gln Tyr Gly Asp Cys Leu Gly Asp Ile Ala Ala Arg Asp Leu Ile Cys

835 840 845

Ala Gln Lys Phe Asn Gly Leu Thr Val Leu Pro Pro Leu Leu Thr Asp

850 855 860

Glu Met Ile Ala Gln Tyr Thr Ser Ala Leu Leu Ala Gly Thr Ile Thr

865 870 875 880

Ser Gly Trp Thr Phe Gly Ala Gly Pro Ala Leu Gln Ile Pro Phe Pro

885 890 895

Met Gln Met Ala Tyr Arg Phe Asn Gly Ile Gly Val Thr Gln Asn Val

900 905 910

Leu Tyr Glu Asn Gln Lys Leu Ile Ala Asn Gln Phe Asn Ser Ala Ile

915 920 925

Gly Lys Ile Gln Asp Ser Leu Ser Ser Thr Pro Ser Ala Leu Gly Lys

930 935 940

Leu Gln Asp Val Val Asn Gln Asn Ala Gln Ala Leu Asn Thr Leu Val

945 950 955 960

Lys Gln Leu Ser Ser Asn Phe Gly Ala Ile Ser Ser Val Leu Asn Asp

965 970 975

Ile Leu Ser Arg Leu Asp Pro Pro Glu Ala Glu Val Gln Ile Asp Arg

980 985 990

Leu Ile Thr Gly Arg Leu Gln Ser Leu Gln Thr Tyr Val Thr Gln Gln

995 1000 1005

Leu Ile Arg Ala Ala Glu Ile Arg Ala Ser Ala Asn Leu Ala Ala

1010 1015 1020

Thr Lys Met Ser Glu Cys Val Leu Gly Gln Ser Lys Arg Val Asp

1025 1030 1035

Phe Cys Gly Lys Gly Tyr His Leu Met Ser Phe Pro Gln Ser Ala

1040 1045 1050

Pro His Gly Val Val Phe Leu His Val Thr Tyr Val Pro Ala Gln

1055 1060 1065

Glu Lys Asn Phe Thr Thr Ala Pro Ala Ile Cys His Asp Gly Lys

1070 1075 1080

Ala His Phe Pro Arg Glu Gly Val Phe Val Ser Asn Gly Thr His

1085 1090 1095

Trp Phe Val Thr Gln Arg Asn Phe Tyr Glu Pro Gln Ile Ile Thr

1100 1105 1110

Thr Asp Asn Thr Phe Val Ser Gly Asn Cys Asp Val Val Ile Gly

1115 1120 1125

Ile Val Asn Asn Thr Val Tyr Asp Pro Leu Gln Pro Glu Leu Asp

1130 1135 1140

Ser Phe Lys Glu Glu Leu Asp Lys Tyr Phe Lys Asn His Thr Ser

1145 1150 1155

Pro Asp Val Asp Leu Gly Asp Ile Ser Gly Ile Asn Ala Ser Val

1160 1165 1170

Val Asn Ile Gln Lys Glu Ile Asp Arg Leu Asn Glu Val Ala Lys

1175 1180 1185

Asn Leu Asn Glu Ser Leu Ile Asp Leu Gln Glu Leu Gly Lys Tyr

1190 1195 1200

Glu Gln

1205

<210> 3

<211> 28

<212> PRT

<213> Artificial Sequence

<220>

<223> trimer-aiding Domain

<400> 3

Gly Tyr Ile Pro Glu Ala Pro Arg Asp Gly Gln Ala Tyr Val Arg Lys

1 5 10 15

Asp Gly Glu Trp Val Leu Leu Ser Thr Phe Leu Gly

20 25

<210> 4

<211> 3615

<212> DNA

<213> Artificial Sequence

<220>

<223> Artificial sequence

<400> 4

atgttcgtgt tcctggtgct gcttcccctg gtctctagcc agtgcgtgaa cttcacgacc 60

cggacccaac tgccccccgc gtacacaaac tccttcacca gaggcgtgta ctaccctgac 120

aaggtgttcc gcagcagcgt gctgcacagc acccaggacc tgttcctccc attcttcagc 180

aacgtgacct ggttccacgc catccacgtg tccggcacca atggaacaaa gagatttgcg 240

aaccccgtgc tacctttcaa cgacggcgtg tacttcgcct ccaccgagaa gagcaacatc 300

atccggggct ggatcttcgg caccaccctg gactctaaaa cccagagcct gctgatcgtg 360

aataatgcca ccaacgtggt gatcaaggtg tgcgagttcc agttctgcaa cgaccctttc 420

ctgggcgtct actaccacaa gaacaacaag agttggatgg aaagcgagtt cagagtgtac 480

tcttctgcta acaactgcac cttcgagtac gtgtcccagc ctttcctgat ggacctggaa 540

ggcaagcagg ggaacttcaa gaacctgcgg gagttcgtgt tcaagaacat cgacgggtat 600

ttcaagatct actccaagca cacacctatc aatctggtga gaggcctgcc ccagggcttc 660

agcgccctgg aacctctggt cgacctgcca atcggcatca acatcacccg gttccaaaca 720

ctgcatatca gctacctgac acctggcgat agctcctccg gctggaccgc cggcgctgcc 780

gcttattacg tcggctacct gcagcctaga acgttcctgc tgaagtacaa cgagaacggc 840

accatcaccg acgccgtcga ctgcgccctg gaccccctct ccgagacaaa atgcaccctg 900

aagagcttca ctgttgaaaa gggcatctac cagaccagca actttagagt gcagcctaca 960

gagtctatcg tgagattccc taacattacc aacctgtgtc cttttggaga agtgttcaac 1020

gccacaagat tcgcttctgt gtatgcctgg aaccggaaga gaatctcgaa ctgcgtggct 1080

gattacagcg tgctgtacaa cagcgctagc tttagcacat ttaagtgcta cggcgtgagc 1140

cccaccaagc tgaatgattt gtgcttcaca aatgtgtacg ccgactcttt cgtgataaga 1200

ggggacgagg tgcggcagat agctccaggc cagaccggca acatcgccga ttacaattac 1260

aagctgcctg acgactttac cggatgtgtg atcgcctgga acagcaacaa cctggatagc 1320

aaggtgggcg gaaactacaa ctacctgtac agactgttcc ggaaatctaa ccttaagcct 1380

tttgagcggg atatcagcac cgagatctac caagctggct ctacaccctg caacggcgtg 1440

aaggggttta attgttactt ccccctgcag agctacggct tccaaccgac ctacggagtg 1500

ggctaccagc cctaccgggt cgtggtgctg agctttgagc tgctgcacgc ccctgctaca 1560

gtgtgcggcc ccaagaagtc tacgaacctg gtgaagaaca agtgtgtgaa ttttaatttc 1620

aacggactga ccggcacagg cgtcctgacc gaatctaaca agaaattcct ccctttccag 1680

cagttcggga gagatatcgc cgacaccacc gacgccgtgc gggaccctca aacactggaa 1740

atcctggata tcaccccttg ttctttcgga ggcgtgtccg tgatcacccc aggtacgaac 1800

acatctaacc aggtggctgt gctgtaccag ggcgtgaact gcaccgaggt gcctgtggcc 1860

attcacgccg accagctgac tcctacctgg cgggtgtaca gcacgggctc caacgtgttt 1920

cagaccagag ctggctgtct gatcggagcc gagcacgtga acaactctta tgagtgcgat 1980

atccccatcg gcgctggaat ctgtgcctcc taccagactc aaaccaacag ccctggcagc 2040

gctagcagcg tggccagcca gagcatcatc gcctacacca tgagcctggg agtcgaaaac 2100

agcgtggcct actcaaacaa ctccatcgct atccctacca acttcaccat cagcgtaacg 2160

accgaaatcc tgcccgtgag catgaccaag accagcgtgg actgcacaat gtacatctgc 2220

ggcgatagca cagaatgcag caatctgcta ctgcagtacg gtagcttttg cacccaactg 2280

aatagagccc tgaccggcat cgccgtggaa caggataaaa acacccaaga ggtcttcgct 2340

caggtgaagc agatctacaa gacacctccc atcaaggact tcggaggatt caactttagc 2400

cagatcctgc ctgatccaag caaacctagc aagcggagtc ctatcgagga cctgctgttt 2460

aacaaggtga cactggccga cgccggcttc atcaagcagt atggcgactg tctgggcgac 2520

atcgccgcca gggatctgat ctgtgcccaa aaattcaacg gcctgacagt gctgccacct 2580

ctgctgaccg acgagatgat cgctcaatac accagcgccc tcctcgccgg cacgatcacc 2640

agcggctgga cattcggcgc cggccctgcc ctccagatcc ctttccctat gcagatggcc 2700

tacagattca acggcatcgg cgtgacacaa aacgtgctgt acgaaaacca gaagctgatc 2760

gccaatcagt ttaatagcgc catcgggaag atccaggata gcctgtcatc taccccttct 2820

gccctgggaa agctgcagga cgtggtgaac cagaacgccc aggccctgaa caccctggtg 2880

aaacagctgt ctagcaactt cggcgctatc agcagcgtgc tgaatgatat cctgagcaga 2940

ctggatcctc ctgaggccga ggtgcagatc gacagattga tcaccggccg gctgcagagc 3000

ctgcaaacct acgttacaca gcagctgatc agagccgctg aaatcagagc ctctgccaac 3060

ctggccgcca ccaaaatgag cgagtgcgtg ctgggacaga gcaaaagggt ggacttctgc 3120

gggaagggct accacctcat gagttttccc cagagcgccc cccacggcgt ggtgttcctg 3180

cacgtgacat atgtcccggc ccaggagaaa aactttacaa cagcccctgc catttgccat 3240

gacggaaagg cccacttccc tcgggaaggt gtgttcgtga gcaacggcac acactggttc 3300

gtgacccaga gaaacttcta cgagcctcaa atcatcacca cagacaacac cttcgttagt 3360

ggaaattgcg acgtggttat cggcatcgtg aacaacaccg tctacgaccc actgcagcct 3420

gaactggata gcttcaagga ggaactggat aagtatttca agaaccacac ctcccccgac 3480

gtggatctgg gcgacattag cggcatcaac gccagcgtgg tgaacatcca gaaagagatc 3540

gatagactta atgaggtggc caagaacctg aacgagagcc tgatcgacct gcaggagctc 3600

ggcaaatacg agcag 3615

<210> 5

<211> 84

<212> DNA

<213> Artificial Sequence

<220>

<223> Artificial sequence

<400> 5

ggctatatcc cagaggcccc tagagatggc caggcctacg ttagaaagga cggcgagtgg 60

gtcctgctga gcacattcct gggc 84

<210> 6

<211> 50

<212> RNA

<213> Artificial Sequence

<220>

<223> Artificial sequence

<400> 6

acauuugcuu cugacacaac uguguucacu agcaaccuca aacagacacc 50

<210> 7

<211> 88

<212> RNA

<213> Artificial Sequence

<220>

<223> Artificial sequence

<400> 7

gcuggagccu cgguagccgu uccuccugcc cgcugggccu cccaacgggc ccuccucccc 60

uccuugcacc ggcccuuccu ggucuuug 88

<210> 8

<211> 3702

<212> RNA

<213> Artificial Sequence

<220>

<223> Artificial sequence

<400> 8

auguucgugu uccuggugcu gcuuccccug gucucuagcc agugcgugaa cuucacgacc 60

cggacccaac ugccccccgc guacacaaac uccuucacca gaggcgugua cuacccugac 120

aagguguucc gcagcagcgu gcugcacagc acccaggacc uguuccuccc auucuucagc 180

aacgugaccu gguuccacgc cauccacgug uccggcacca auggaacaaa gagauuugcg 240

aaccccgugc uaccuuucaa cgacggcgug uacuucgccu ccaccgagaa gagcaacauc 300

auccggggcu ggaucuucgg caccacccug gacucuaaaa cccagagccu gcugaucgug 360

aauaaugcca ccaacguggu gaucaaggug ugcgaguucc aguucugcaa cgacccuuuc 420

cugggcgucu acuaccacaa gaacaacaag aguuggaugg aaagcgaguu cagaguguac 480

ucuucugcua acaacugcac cuucgaguac gugucccagc cuuuccugau ggaccuggaa 540

ggcaagcagg ggaacuucaa gaaccugcgg gaguucgugu ucaagaacau cgacggguau 600

uucaagaucu acuccaagca cacaccuauc aaucugguga gaggccugcc ccagggcuuc 660

agcgcccugg aaccucuggu cgaccugcca aucggcauca acaucacccg guuccaaaca 720

cugcauauca gcuaccugac accuggcgau agcuccuccg gcuggaccgc cggcgcugcc 780

gcuuauuacg ucggcuaccu gcagccuaga acguuccugc ugaaguacaa cgagaacggc 840

accaucaccg acgccgucga cugcgcccug gacccccucu ccgagacaaa augcacccug 900

aagagcuuca cuguugaaaa gggcaucuac cagaccagca acuuuagagu gcagccuaca 960

gagucuaucg ugagauuccc uaacauuacc aaccuguguc cuuuuggaga aguguucaac 1020

gccacaagau ucgcuucugu guaugccugg aaccggaaga gaaucucgaa cugcguggcu 1080

gauuacagcg ugcuguacaa cagcgcuagc uuuagcacau uuaagugcua cggcgugagc 1140

cccaccaagc ugaaugauuu gugcuucaca aauguguacg ccgacucuuu cgugauaaga 1200

ggggacgagg ugcggcagau agcuccaggc cagaccggca acaucgccga uuacaauuac 1260

aagcugccug acgacuuuac cggaugugug aucgccugga acagcaacaa ccuggauagc 1320

aaggugggcg gaaacuacaa cuaccuguac agacuguucc ggaaaucuaa ccuuaagccu 1380

uuugagcggg auaucagcac cgagaucuac caagcuggcu cuacacccug caacggcgug 1440

aagggguuua auuguuacuu cccccugcag agcuacggcu uccaaccgac cuacggagug 1500

ggcuaccagc ccuaccgggu cguggugcug agcuuugagc ugcugcacgc cccugcuaca 1560

gugugcggcc ccaagaaguc uacgaaccug gugaagaaca agugugugaa uuuuaauuuc 1620

aacggacuga ccggcacagg cguccugacc gaaucuaaca agaaauuccu cccuuuccag 1680

caguucggga gagauaucgc cgacaccacc gacgccgugc gggacccuca aacacuggaa 1740

auccuggaua ucaccccuug uucuuucgga ggcguguccg ugaucacccc agguacgaac 1800

acaucuaacc agguggcugu gcuguaccag ggcgugaacu gcaccgaggu gccuguggcc 1860

auucacgccg accagcugac uccuaccugg cggguguaca gcacgggcuc caacguguuu 1920

cagaccagag cuggcugucu gaucggagcc gagcacguga acaacucuua ugagugcgau 1980

auccccaucg gcgcuggaau cugugccucc uaccagacuc aaaccaacag cccuggcagc 2040

gcuagcagcg uggccagcca gagcaucauc gccuacacca ugagccuggg agucgaaaac 2100

agcguggccu acucaaacaa cuccaucgcu aucccuacca acuucaccau cagcguaacg 2160

accgaaaucc ugcccgugag caugaccaag accagcgugg acugcacaau guacaucugc 2220

ggcgauagca cagaaugcag caaucugcua cugcaguacg guagcuuuug cacccaacug 2280

aauagagccc ugaccggcau cgccguggaa caggauaaaa acacccaaga ggucuucgcu 2340

caggugaagc agaucuacaa gacaccuccc aucaaggacu ucggaggauu caacuuuagc 2400

cagauccugc cugauccaag caaaccuagc aagcggaguc cuaucgagga ccugcuguuu 2460

aacaagguga cacuggccga cgccggcuuc aucaagcagu auggcgacug ucugggcgac 2520

aucgccgcca gggaucugau cugugcccaa aaauucaacg gccugacagu gcugccaccu 2580

cugcugaccg acgagaugau cgcucaauac accagcgccc uccucgccgg cacgaucacc 2640

agcggcugga cauucggcgc cggcccugcc cuccagaucc cuuucccuau gcagauggcc 2700

uacagauuca acggcaucgg cgugacacaa aacgugcugu acgaaaacca gaagcugauc 2760

gccaaucagu uuaauagcgc caucgggaag auccaggaua gccugucauc uaccccuucu 2820

gcccugggaa agcugcagga cguggugaac cagaacgccc aggcccugaa cacccuggug 2880

aaacagcugu cuagcaacuu cggcgcuauc agcagcgugc ugaaugauau ccugagcaga 2940

cuggauccuc cugaggccga ggugcagauc gacagauuga ucaccggccg gcugcagagc 3000

cugcaaaccu acguuacaca gcagcugauc agagccgcug aaaucagagc cucugccaac 3060

cuggccgcca ccaaaaugag cgagugcgug cugggacaga gcaaaagggu ggacuucugc 3120

gggaagggcu accaccucau gaguuuuccc cagagcgccc cccacggcgu gguguuccug 3180

cacgugacau augucccggc ccaggagaaa aacuuuacaa cagccccugc cauuugccau 3240

gacggaaagg cccacuuccc ucgggaaggu guguucguga gcaacggcac acacugguuc 3300

gugacccaga gaaacuucua cgagccucaa aucaucacca cagacaacac cuucguuagu 3360

ggaaauugcg acgugguuau cggcaucgug aacaacaccg ucuacgaccc acugcagccu 3420

gaacuggaua gcuucaagga ggaacuggau aaguauuuca agaaccacac cucccccgac 3480

guggaucugg gcgacauuag cggcaucaac gccagcgugg ugaacaucca gaaagagauc 3540

gauagacuua augagguggc caagaaccug aacgagagcc ugaucgaccu gcaggagcuc 3600

ggcaaauacg agcagggcua uaucccagag gccccuagag auggccaggc cuacguuaga 3660

aaggacggcg aguggguccu gcugagcaca uuccugggcu ga 3702

<210> 9

<211> 4093

<212> RNA

<213> Artificial Sequence

<220>

<223> Artificial sequence

<400> 9

gggagaccgg ccucgagaca uuugcuucug acacaacugu guucacuagc aaccucaaac 60

agacaccaag cuugccacca uguucguguu ccuggugcug cuuccccugg ucucuagcca 120

gugcgugaac uucacgaccc ggacccaacu gccccccgcg uacacaaacu ccuucaccag 180

aggcguguac uacccugaca agguguuccg cagcagcgug cugcacagca cccaggaccu 240

guuccuccca uucuucagca acgugaccug guuccacgcc auccacgugu ccggcaccaa 300

uggaacaaag agauuugcga accccgugcu accuuucaac gacggcgugu acuucgccuc 360

caccgagaag agcaacauca uccggggcug gaucuucggc accacccugg acucuaaaac 420

ccagagccug cugaucguga auaaugccac caacguggug aucaaggugu gcgaguucca 480

guucugcaac gacccuuucc ugggcgucua cuaccacaag aacaacaaga guuggaugga 540

aagcgaguuc agaguguacu cuucugcuaa caacugcacc uucgaguacg ugucccagcc 600

uuuccugaug gaccuggaag gcaagcaggg gaacuucaag aaccugcggg aguucguguu 660

caagaacauc gacggguauu ucaagaucua cuccaagcac acaccuauca aucuggugag 720

aggccugccc cagggcuuca gcgcccugga accucugguc gaccugccaa ucggcaucaa 780

caucacccgg uuccaaacac ugcauaucag cuaccugaca ccuggcgaua gcuccuccgg 840

cuggaccgcc ggcgcugccg cuuauuacgu cggcuaccug cagccuagaa cguuccugcu 900

gaaguacaac gagaacggca ccaucaccga cgccgucgac ugcgcccugg acccccucuc 960

cgagacaaaa ugcacccuga agagcuucac uguugaaaag ggcaucuacc agaccagcaa 1020

cuuuagagug cagccuacag agucuaucgu gagauucccu aacauuacca accugugucc 1080

uuuuggagaa guguucaacg ccacaagauu cgcuucugug uaugccugga accggaagag 1140

aaucucgaac ugcguggcug auuacagcgu gcuguacaac agcgcuagcu uuagcacauu 1200

uaagugcuac ggcgugagcc ccaccaagcu gaaugauuug ugcuucacaa auguguacgc 1260

cgacucuuuc gugauaagag gggacgaggu gcggcagaua gcuccaggcc agaccggcaa 1320

caucgccgau uacaauuaca agcugccuga cgacuuuacc ggauguguga ucgccuggaa 1380

cagcaacaac cuggauagca aggugggcgg aaacuacaac uaccuguaca gacuguuccg 1440

gaaaucuaac cuuaagccuu uugagcggga uaucagcacc gagaucuacc aagcuggcuc 1500

uacacccugc aacggcguga agggguuuaa uuguuacuuc ccccugcaga gcuacggcuu 1560

ccaaccgacc uacggagugg gcuaccagcc cuaccggguc guggugcuga gcuuugagcu 1620

gcugcacgcc ccugcuacag ugugcggccc caagaagucu acgaaccugg ugaagaacaa 1680

gugugugaau uuuaauuuca acggacugac cggcacaggc guccugaccg aaucuaacaa 1740

gaaauuccuc ccuuuccagc aguucgggag agauaucgcc gacaccaccg acgccgugcg 1800

ggacccucaa acacuggaaa uccuggauau caccccuugu ucuuucggag gcguguccgu 1860

gaucacccca gguacgaaca caucuaacca gguggcugug cuguaccagg gcgugaacug 1920

caccgaggug ccuguggcca uucacgccga ccagcugacu ccuaccuggc ggguguacag 1980

cacgggcucc aacguguuuc agaccagagc uggcugucug aucggagccg agcacgugaa 2040

caacucuuau gagugcgaua uccccaucgg cgcuggaauc ugugccuccu accagacuca 2100

aaccaacagc ccuggcagcg cuagcagcgu ggccagccag agcaucaucg ccuacaccau 2160

gagccuggga gucgaaaaca gcguggccua cucaaacaac uccaucgcua ucccuaccaa 2220

cuucaccauc agcguaacga ccgaaauccu gcccgugagc augaccaaga ccagcgugga 2280

cugcacaaug uacaucugcg gcgauagcac agaaugcagc aaucugcuac ugcaguacgg 2340

uagcuuuugc acccaacuga auagagcccu gaccggcauc gccguggaac aggauaaaaa 2400

cacccaagag gucuucgcuc aggugaagca gaucuacaag acaccuccca ucaaggacuu 2460

cggaggauuc aacuuuagcc agauccugcc ugauccaagc aaaccuagca agcggagucc 2520

uaucgaggac cugcuguuua acaaggugac acuggccgac gccggcuuca ucaagcagua 2580

uggcgacugu cugggcgaca ucgccgccag ggaucugauc ugugcccaaa aauucaacgg 2640

ccugacagug cugccaccuc ugcugaccga cgagaugauc gcucaauaca ccagcgcccu 2700

ccucgccggc acgaucacca gcggcuggac auucggcgcc ggcccugccc uccagauccc 2760

uuucccuaug cagauggccu acagauucaa cggcaucggc gugacacaaa acgugcugua 2820

cgaaaaccag aagcugaucg ccaaucaguu uaauagcgcc aucgggaaga uccaggauag 2880

ccugucaucu accccuucug cccugggaaa gcugcaggac guggugaacc agaacgccca 2940

ggcccugaac acccugguga aacagcuguc uagcaacuuc ggcgcuauca gcagcgugcu 3000

gaaugauauc cugagcagac uggauccucc ugaggccgag gugcagaucg acagauugau 3060

caccggccgg cugcagagcc ugcaaaccua cguuacacag cagcugauca gagccgcuga 3120

aaucagagcc ucugccaacc uggccgccac caaaaugagc gagugcgugc ugggacagag 3180

caaaagggug gacuucugcg ggaagggcua ccaccucaug aguuuucccc agagcgcccc 3240

ccacggcgug guguuccugc acgugacaua ugucccggcc caggagaaaa acuuuacaac 3300

agccccugcc auuugccaug acggaaaggc ccacuucccu cgggaaggug uguucgugag 3360

caacggcaca cacugguucg ugacccagag aaacuucuac gagccucaaa ucaucaccac 3420

agacaacacc uucguuagug gaaauugcga cgugguuauc ggcaucguga acaacaccgu 3480

cuacgaccca cugcagccug aacuggauag cuucaaggag gaacuggaua aguauuucaa 3540

gaaccacacc ucccccgacg uggaucuggg cgacauuagc ggcaucaacg ccagcguggu 3600

gaacauccag aaagagaucg auagacuuaa ugagguggcc aagaaccuga acgagagccu 3660

gaucgaccug caggagcucg gcaaauacga gcagggcuau aucccagagg ccccuagaga 3720

uggccaggcc uacguuagaa aggacggcga guggguccug cugagcacau uccugggcug 3780

agaauucgcu ggagccucgg uagccguucc uccugcccgc ugggccuccc aacgggcccu 3840

ccuccccucc uugcaccggc ccuuccuggu cuuuggcugg agccucggua gccguuccuc 3900

cugcccgcug ggccucccaa cgggcccucc uccccuccuu gcaccggccc uuccuggucu 3960

uuguuaauua aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 4020

aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 4080

aaaaaaaaac uag 4093

Claims (9)

1. A lipid nanoparticle composition comprising a lipid nanoparticle comprising a lipid molecule of formula I,

wherein:

q is a substituted or unsubstituted straight chain C2-20 alkylene group, optionally substituted with 1 or more than 1C atom of the alkylene group by a heteroatom independently selected from O, S and N; or, Q is a substituted or unsubstituted, saturated or unsaturated 4-6 membered ring, the ring atoms of said 4-6 membered ring optionally containing 1 or more than 1 heteroatom independently selected from O, S, N; the substituted substituent group is selected from halogen, -OH, linear or branched C1-20 alkyl, linear or branched C1-20 alkoxy, linear or branched C2-20 alkenyl, linear or branched C2-20 alkynyl, -CH ₂ CH(OH)R ₅ 、

R ₁ 、R ₂ 、R ₃ 、R ₄ May be the same or different and are each independently selected from hydrogen, substituted or unsubstituted straight or branched C1-30 alkyl, substituted or unsubstituted straight or branched C2-30 alkenyl, substituted or unsubstituted straight or branched C2-30 alkynyl, 1 or more than 1C atom of said alkyl, alkenyl or alkynyl being optionally replaced by a heteroatom independently selected from O, S and N, or-CH ₂ CH(OH)R ₅ (ii) a The substituted substituent group is selected from halogen, -OH, linear or branched C1-10 alkyl, linear or branched C1-10 alkoxy;

provided that R is ₁ 、R ₂ 、R ₃ 、R ₄ At least one of which is

R ₅ Selected from the group consisting of hydrogen, substituted or unsubstituted straight or branched C1-30 alkyl, substituted or unsubstituted straight or branched C2-30 alkenyl, substituted or unsubstituted straight or branched C2-30 alkynyl, 1 or more C atoms of said alkyl, alkenyl or alkynyl being optionally replaced by heteroatoms independently selected from O, S and N; the substituted substituent group is selected from halogen, -OH, linear or branched C1-10 alkyl, linear or branched C1-10 alkoxy;

R ₆ selected from hydrogen, C1-3 alkyl, C1-3 alkoxy, -OH;

n is an integer of 1 to 8, m is an integer of 0 to 8, and n and m are independent of each other, and may be the same or different;

when R is ₁ 、R ₂ 、R ₃ 、R ₄ At least two of which are

In the case of each of the groups, n and m are independent of each other, and may be the same or different.

2. The lipid nanoparticle composition of claim 1, wherein Q in formula I is a substituted or unsubstituted linear C2-20 alkylene group, wherein 1 or more than 1C atom of the alkylene group is optionally replaced with a heteroatom independently selected from O, S and N;

preferably, Q is

Wherein R is ₈ 、R ₉ Independently of each other, is selected from substituted or unsubstituted straight chain C1-10 alkylene, optionally substituted with 1 or more than 1C atom of the alkylene by heteroatoms independently selected from O, S and N; r is ₇ Is hydrogen, halogen, -OH, straight or branched C1-20 alkyl, straight or branched C2-20 alkenyl, straight or branched C2-20 alkynyl, or-CH ₂ CH(OH)R ₅ Or/or>

The substituted substituent group is halogen, -OH, straight-chain or branched C1-10 alkyl, straight-chain or branched C1-10 alkoxy;

more preferably, Q is

Wherein: x and y may be the same or different and are independently selected from integers of 1 to 8; r ₇ The definitions are the same as above; preferably, x or y are the same or different and are selected from integers of 1 to 3, for example 1,2 or 3; preferably, R ₇ Is a linear or branched C1-4 alkyl group, such as methyl, ethyl, n-propyl, n-butyl, and the like.

3. The lipid nanoparticle composition of claim 1 or 2, wherein the saturated or unsaturated 4-6 membered ring in formula I is piperazinyl or cyclohexyl;

preferably, R ₆ is-OH;

preferably, n is an integer from 4 to 8 and m is an integer from 4 to 8.

4. The lipid nanoparticle composition of any one of claims 1-3, wherein the compound of formula I is of formula A, B, C, or D:

wherein each n is ₁ Are all independent of one another, may be the same or different, each n ₁ An integer selected from 1 to 8, each m ₁ Are all independent of each other, can be the same or different, each m ₁ An integer selected from 0 to 8; preferably, each n ₁ An integer selected from 4 to 8, each m ₁ An integer selected from 4 to 8; preferably, each n is ₁ Are all the same as each other, each m ₁ Are all identical to each other;

wherein each n is ₂ Are all independent of one another, may be the same or different, each n ₂ An integer selected from 1 to 8, each m ₂ Are all independent of each other, can be the same or different, each m ₂ An integer selected from 0 to 8; preferably, each n is ₂ An integer selected from 4 to 8, each m ₂ An integer selected from 4 to 8; preferably, each n ₂ Are all the same as each other, each m ₂ Are all identical to each other;

wherein each n is ₃ Are all independent of one another, may be the same or different, each n ₃ An integer selected from 1 to 8, each m ₃ Are all independent of one another, may be the same or different, each m ₃ An integer selected from 0 to 8; preferably, each n ₃ An integer selected from 4 to 8, each m ₃ An integer selected from 4 to 8; preferably, each n ₃ Are all the same as each other, each m ₃ Are all identical to each other;

wherein each n is ₄ Are all independent of one another, may be the same or different, each n ₄ An integer selected from 1 to 8, each m ₄ Are all independent of each other, can be the same or different, each m ₄ An integer selected from 0 to 8; preferably, each n ₄ Selected from 4EAn integer of 8, each m ₄ An integer selected from 4 to 8; preferably, each n ₄ Are all the same as each other, each m ₄ Are all identical to each other.

5. Lipid nanoparticle composition according to any one of claims 1 to 4, wherein the lipid nanoparticles comprise lipid molecules of formula I in an amount of 30 to 60mol%, preferably 32 to 55mol%, further preferably 34 to 46mol%, based on the total lipid molecules of the lipid nanoparticles;

preferably, the lipid nanoparticles contain neutral lipid molecules accounting for 5-30mol% of the total lipid molecules of the lipid nanoparticles, preferably 8-20mol%, and further preferably 9-16mol%;

preferably, the cholesterol lipid molecules can be contained in the lipid nanoparticles by 30-50mol% of the total lipid molecules, preferably 35-50mol%, and further preferably 37-49mol%;

preferably, the lipid nanoparticle may contain pegylated lipid molecules in an amount of 0.4 to 10mol%, preferably 0.5 to 5mol%, and more preferably 1.3 to 2.7mol%, based on the total lipid molecules;

preferably, the lipid nanoparticle composition further comprises an active ingredient, the active ingredient being located in the lipid nanoparticle; preferably, the active ingredient is a nucleic acid; preferably, the active ingredient is mRNA.

6. The lipid nanoparticle composition of claim 5, wherein the neutral lipid molecule is selected from the group consisting of phosphatidylcholine compounds represented by formula E

Phosphatidylethanolamine compound shown as formula F

Wherein Ra, rb, rc, rd are independently selected from linear or branched C1-30 alkyl, linear or branched C2-30 alkenyl, preferably linear or branched C10-30 alkyl, linear or branched C10-30 alkenyl, more preferably CH ₃ (CH ₂ ) ₁₇ CH ₂ -、CH ₃ (CH ₂ ) ₁₅ CH ₂ -、CH ₃ (CH ₂ ) ₁₃ CH ₂ -、CH ₃ (CH ₂ ) ₁₁ CH ₂ -、CH ₃ (CH ₂ ) ₉ CH ₂ -、CH ₃ (CH ₂ ) ₇ CH ₂ -、CH ₃ (CH ₂ ) ₇ -CH＝CH-(CH ₂ ) ₇ -、CH ₃ (CH ₂ ) ₄ CH＝CHCH ₂ CH＝CH(CH ₂ ) ₇ -、CH ₃ (CH ₂ ) ₇ -CH＝CH-(CH ₂ ) ₉ -; such as DOPE and/or DSPC;

the cholesterol lipid molecule is selected from cholesterol, coprosterol, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, solasonine, tomatine, ursolic acid, alpha-tocopherol and mixtures thereof, 5-heptadecyl resorcinol, and cholesterol hemisuccinate;

the pegylated lipid molecule comprises a lipid moiety and a PEG-based polymer moiety, denoted "lipid moiety-PEG-number average molecular weight", said lipid moiety being a diacylglycerol or a diacylglycinamide selected from the group consisting of dilauroyl glycerol, dimyristoyl glycerol, dipalmitoyl glycerol, distearoyl glycerol, dilauroyl glycinamide, dimyristoyl glycinamide, dipalmitoyl glycinamide, distearoyl glycinamide, 1, 2-distearoyl-sn-glycerol-3-phosphoethanolamine, 1, 2-dimyristoyl-sn-glycerol-3-phosphoethanolamine; the number average molecular weight of PEG is 130 to 50,000, preferably 150 to 10,000, more preferably 300 to 3,000, and most preferably 1,500 to 2,500; such as DMG-PEG2000 and/or DSPE-PEG2000.

7. The lipid nanoparticle composition of claim 5, wherein the ratio of the total mass of lipid molecules to the mass of nucleic acids in the lipid nanoparticle composition is 5-20.

8. The lipid nanoparticle composition of claim 5, wherein the mRNA comprises, from 5 'to 3' end, 5'UTR, open reading frame, 3' UTR and poly-A tail;

preferably, the 5'UTR comprises a nucleotide sequence that is at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or about 100% homologous to the nucleotide sequence 5' UTR of beta-globin as set forth in SEQ ID NO 6;

preferably, the 3' UTR comprises a nucleotide sequence which is at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or about 100% homologous to a fragment of the α 2-globin 3 UTR of SEQ ID NO: 7;

preferably, the 3'UTR comprises 2 nucleotide sequences with at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or about 100% homology to a fragment of the alpha 2-globin 3' UTR of SEQ ID NO 7 in end-to-end relationship

Preferably, the poly-A tail is 50-200 nucleotides in length, preferably 100-150 nucleotides in length;

preferably, the open reading frame is an open reading frame encoding an S protein mutant of 2019-nCov, which nucleic acid sequence is a nucleotide sequence at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or about 100% homologous to the nucleotide sequence shown in SEQ ID No. 8;

preferably, the mRNA comprises a nucleotide sequence that is at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or about 100% homologous to the nucleotide sequence set forth in SEQ ID NO. 9;

preferably, the mRNA also has a 5' cap structure.

9. The lipid nanoparticle composition of any one of claims 1-8, further comprising a pharmaceutical excipient; preferably, the lipid nanoparticle composition is a liquid preparation containing sucrose at a concentration of 5-20% by mass.

Images