CN115948537B

CN115948537B - Application of gene CHST3 composite heterozygous mutation, detection reagent and application

Info

Publication number: CN115948537B
Application number: CN202211629032.9A
Authority: CN
Inventors: 曾桥; 安灿荣; 彭谦; 刘亚宁
Original assignee: Hunan Jiahui Biotechnology Co Ltd
Current assignee: Hunan Jiahui Biotechnology Co Ltd
Priority date: 2022-12-19
Filing date: 2022-12-19
Publication date: 2024-04-09
Anticipated expiration: 2042-12-19
Also published as: CN115948537A

Abstract

The invention provides application of a gene CHST3 composite heterozygous mutation, a detection reagent and application thereof, and belongs to the technical field of medical diagnosis. The present invention discovers for the first time that chet 3: nm_004273.5: exon3: c.6755c > a: p.s225r and chet 3: nm_004273.5: exon3: c.1071075_1089 dupcagccgcctggctgcgg: p.q358_r363dup locus complex heterozygous mutations can result in congenital spinal epiphyseal hypoplasia (MIM 143095). The reagent for detecting the gene mutation site is used for genetic diagnosis and prenatal and postnatal guidance of congenital spinal epiphyseal hypoplasia, provides a new basis and path for research on pathogenesis of congenital spinal epiphyseal hypoplasia, and can provide a possible drug target for treating congenital spinal epiphyseal hypoplasia.

Description

Application of gene CHST3 composite heterozygous mutation, detection reagent and application

Technical Field

The invention belongs to the technical field of medical diagnosis, and particularly relates to application of a gene CHST3 composite heterozygous mutation, a detection reagent and application.

Background

Spinal epiphyseal hypoplasia (spondyloepiphyseal dysplasia SED) is a hereditary bone disease involving the epiphyseal and metaphyseal cartilage of the spine. The genetic mode comprises autosomal dominant inheritance, autosomal recessive inheritance and X chromosome linked recessive inheritance. The common feature of the disease is the involvement of vertebral bodies and epiphyses, and patients mainly show postnatal growth and development retardation, short trunk short stature, and walking lameness. X-ray shows thoracolumbar lateral bending, irregular vertebral bone, osteoporosis, broken and flat femoral head, high acetabulum density and the like. According to the international classification standard of hereditary bone diseases (2010 edition), nine clinical types can be classified according to the clinical characteristics, image characteristics and different manifestations of molecular genetics of SED: 1) Congenital spinal bone skeleton dysplasia (spondyloepiphyseal dysplasia congenita, SEDC); 2) Late spinal bone 16 dysplasia (spondyloepiphyseal dysplasia tarda, SEDT); 3) Late-onset spinal osteodysplasia with progressive osteoarthropathy (spondyloepiphyseal dysplasia tarda with progressivearthropathy, SEDT-PA); 4) Omani type SED (spondyloepiphyseal dysplasia Omani type, SED-OT); 5) Kimberley type SED (spondyloepiphyseal dysplasia Kimberley type, SEDK); 6) Wolcott-Rallison type SED (spondyloepiphyseal dysplasia Wolcott-Rallison type, SED-WR); 7) Mild SED with early-onset arthritis (Mild SED with premature onset arthrosis); 8) SED with bone shortening deformity (SED with metatarsal shortening); (9) Autosomal recessive Late onset SED (Late set SED, autosomal recessive type). To date, the human genome mutation database (HGMD Professional 2012.3) has a total of 8 SED-related pathogenic genes, COL2A1, TRAPPC2 (SEDL), WISP3, CHST3, ACAN (AGCl), EIF2AK3, MATN3 and PAPSS2, respectively. Among them, congenital spinal epiphyseal hypoplasia (MIM 143095) is caused by mutations in CHST3 gene, which is an autosomal recessive genetic disease.

The CHST3 gene (MIM 603799) is located on chromosome 10q22.1, comprising 3 exons and 2 introns, is 48.2kb in length, has an open reading frame 1440bp, encodes a protein carbohydrate sulfotransferase 3 of 479 amino acid sequences (CHST 3), is a key enzyme catalyzing the sulfation of chondroitin sulfate, catalyzes the sulfation of carbon atom 6 of GalNAc residue, introduces negative charges after sulfation reaction, and the water absorption property of the negative charges of chondroitin sulfate imparts the proteoglycan to retain water capacity, while the sufficient water content of the intervertebral disc is a necessary condition for maintaining normal osmotic pressure and tissue elasticity, so CHST3 is an important protective gene in the intervertebral disc, and the activity of CHST3 plays an important role in maintaining the structure and function of the intervertebral disc. Mutations in the CHST3 gene in humans cause abnormal enzymatic activity that can lead to abnormal recessive genetic diseases of the bone, such as epiphyseal dysplasia of the spine, etc.

Gene mutation is an important genetic basis for the development of congenital spinal epiphyseal hypoplasia, and gene diagnosis is a gold standard for diagnosing congenital spinal epiphyseal hypoplasia. In the prior art, the detection of the genotype of a gene mutation site can be performed by adopting other methods such as restriction enzyme fragment length polymorphism, single-chain conformation polymorphism, allele-specific oligonucleotide hybridization and the like, but the detection methods cannot simultaneously meet the purposes of qualitative, quantitative and definite mutation gene sequence.

Disclosure of Invention

In view of the above, the present invention aims to provide an application of a pathogenic gene CHST3 complex heterozygous mutation which causes congenital spinal epiphyseal hypoplasia, and develop a novel pathogenic gene complex heterozygous mutation which can be used as a biomarker for diagnosing congenital spinal epiphyseal hypoplasia to distinguish congenital spinal epiphyseal hypoplasia patients, carriers and normal people.

The invention also aims to provide a reagent for detecting the complex heterozygous mutation of the pathogenic gene CHST3 which leads to congenital spinal epiphyseal hypoplasia and application thereof, and the reagent can help screening and diagnosing the congenital spinal epiphyseal hypophyseal gene mutation.

The invention provides a reagent for detecting a complex heterozygous mutation site of a pathogenic gene CHST3 of congenital spinal epiphyseal hypoplasia, which comprises a primer for detecting the mutation site c.6755C > A of the pathogenic gene CHST3 p.S225R and a primer for detecting the mutation site c.1072_1089 dupCAGCCCGGGCTGCGG of the pathogenic gene CHST3 p.Q358_R363dup;

the primer for detecting the mutation site c.6755Cp.S225R of the pathogenic gene CHST3 comprises CHST3-1F with a nucleotide sequence shown as SEQ ID NO.1 and CHST3-1R with a nucleotide sequence shown as SEQ ID NO. 2;

the primer for detecting the pathogenic gene CHST3 mutation site c.1072_1089 dupCAGCCCGCTGGCTGCGG: p.Q358_R363dup comprises CHST3-2F with a nucleotide sequence shown as SEQ ID NO. 3 and CHST3-2R with a nucleotide sequence shown as SEQ ID NO. 4.

Preferably, the method further comprises a sequencing primer;

the sequencing primer comprises a sequencing primer of a pathogenic gene CHST3 mutation site c.6755C > A p.S225R and/or a sequencing primer of a pathogenic gene CHST3 mutation site c.1072_1089 dupCAGCCCGCTGGCTGCGG p.Q358_R363dup;

the sequencing primer of the pathogenic gene CHST3 mutation site c.6755C > A: p.S225R comprises CHST3-SEQ1F with a nucleotide sequence shown in SEQ ID NO. 5 and CHST3-SEQ1R with a nucleotide sequence shown in SEQ ID NO. 6;

the sequencing primer of the pathogenic gene CHST3 mutation site c.1072_1089 dupCAGCCCGCTGGCTGCGG:p.Q358_R363dup comprises CHST3-SEQ2F with a nucleotide sequence shown as SEQ ID NO. 7 and CHST3-SEQ2R with a nucleotide sequence shown as SEQ ID NO. 8.

The invention provides a congenital spinal epiphyseal hypoplasia diagnosis kit, which comprises the reagent and a PCR amplification reagent.

Preferably, the PCR amplification reagents include dNTPs, 10 XPCR buffer, magnesium ions and Tap polymerase;

the 10 XPCR buffer comprises an aqueous solution of: 500mmol/L KCl, 100mmol/L Tris-Cl pH 8.3 and 15mmol/L MgCl ₂ 。

The invention also provides a kit for detecting the mutation site of the pathogenic gene CHST3 of congenital spinal epiphyseal hypoplasia, which comprises the reagent and a PCR amplification reagent. The primer and the reaction system for detecting the mutation site of the pathogenic gene CHST3 are optimized, so that the accuracy and the reliability of a detection result are greatly improved, the screening and the diagnosis of congenital epiphyseal hypoplasia gene mutation are greatly assisted, and a new technical support is provided for drug screening, drug effect evaluation and targeted treatment.

Drawings

FIG. 1 shows a congenital spinal epiphyseal hypoplasia # 1 family genetic map; wherein,representing a male carrier, is->Representing a female carrier, diamond-solid representing a diseased fetus, ↗ representing a first passAnd then the other is a member.

FIG. 2 shows a graph of the results of detection of the genotype of the CHST3: NM-004273.5: exon3: c.6755C > A: p.S225R site using Sanger sequencing, wherein the ancestor of family 1, the male parent, is the "c.6755C > A heterozygous mutation", and the female parent of the ancestor is the wild type (the arrow in the sequencing drawing indicates the location of the mutation).

FIG. 3 shows a graph of the results of detection of CHST3: NM-004273.5: exon3: c.1072-1089 dupCAGCCCGCTGGCTGCGG: p.Q358-R363dup locus genotype using Sanger sequencing, wherein the ancestor, the ancestor mother, is "c.1072-1089 dupCAGCCCGCTGGCTGCGG heterozygous mutation", the ancestor father wild type (the position of the mutation indicated by the arrow in the sequencing).

FIG. 4 shows a congenital spinal epiphyseal hypoplasia family 2 genetic map; wherein,representing a male carrier, is->Representing female carriers, +. representing female patients, ↗ representing first-evidence.

FIG. 5 shows a graph of the results of the detection of genotypes at the loci CHST3: NM-004273.5: exon3: c.6755C > A: p.S225R using the kit, wherein the ancestor of family 2, the male parent of the ancestor, is the "c.6755C > A heterozygous mutation", and the mother of the ancestor is the wild type (the arrow in the sequencing drawing indicates the position where the mutation occurs).

FIG. 6 shows a graph of the results of the detection of genotype at the Du-line CHST3: NM-004273.5: exon3: c.1072-1089 dupCAGCCCCCGCTGGCTGCGG: p.Q358-R363dup locus using the kit, wherein the ancestor of the No. 2 family, the ancestor mother, is "c.1072-1089 dupCAGCCCGCTGGCTGCGG heterozygous mutation", and the male parent of the ancestor is wild type (the position of the mutation indicated by the arrow in the sequencing).

Detailed Description

The invention provides application of a gene CHST3 composite heterozygous mutation site in preparing a congenital spinal epiphyseal hypoplasia diagnosis reagent or preparing a medicine for preventing congenital spinal epiphyseal hypoplasia, wherein the pathogenic gene CHST3 composite heterozygous mutation site is CHST3: NM_004273.5: exon3: c.675C > A: p.S225R and CHST3: NM_004273.5: exon3: c.1072_1089 dupCAGCCCGCTGGCTGCGG: p.Q358_R363dup.

In the invention, firstly, exon sequencing is utilized to screen pathogenic gene mutation highly related to congenital spinal epiphyseal hypoplasia, in order to avoid false positive results, and then Sanger sequencing is utilized to verify, and finally, the pathogenic gene composite heterozygous mutation of congenital spinal epiphyseal hypoplasia, specifically CHST3: NM_004273.5: exon3: c.675C > A: p.S225R and exon3: c.1072_1089 dupCAGCCCCCTGGCTGCGG: p.Q358_R363dup, is obtained. The pathogenic gene composite heterozygous mutation can be used as a biomarker for diagnosing congenital spinal epiphyseal hypoplasia, and can be used for distinguishing congenital spinal epiphyseal hypoplasia patients from normal people. Wherein the CHST3: NM-004273.5: exo3: c.6755C > A: p.S225R mutation refers to a mutation of nucleotide at position 675 of exon3 of the wild-type CHST3 gene from C to A, forming a CHST3 gene mutant, the nucleotide sequence of said CHST3 gene mutant is preferably as shown in SEQ ID NO:9 (CTCCAGACGCTCC). Compared with the protein coded by the wild-type CHST3 gene, the CHST3 mutant protein provided by the invention has the advantages that the 225 th amino acid is mutated from serine (S) to arginine (R), and missense mutation occurs, namely, the CHST3 mutant protein contains p.S225R mutation, and the mutation is caused by missense mutation of c.6755C > A; the amino acid sequence of the CHST3 mutant protein is shown as SEQ ID NO:10 (RGSRRSL).

The c.1072-1089 dupCAGCCCGCTGGCTGCGG mutation refers to that the 1072 th to 1089 th nucleotides of the 3 rd exon of a wild CHST3 gene are repeated to form a CHST3 gene mutant by 18 bases (CAGCCCGCCTGGCTGCGG, SEQ ID NO: 11), and the nucleotide sequence of the CHST3 gene mutant is preferably shown as SEQ ID NO:12 (CAGCCCGCCTGGCTGCGGCAGCCCGCCTGGCTGCGG). The CHST3 mutant protein of the invention is repeated by 6 amino acids (QPADLR, SEQ ID NO: 13) from 358 th to 363 th compared with the protein encoded by the wild-type CHST3 gene, namely the CHST3 mutant protein contains a mutation of p.QP358_R363 dup, wherein the mutation is caused by repeated mutation of c.1072_1089 dupCAGCCCGCGCTGGCTGCGG; the amino acid sequence of the CHST3 mutant protein is shown in SEQ ID NO.14 (QPAWLRQPAWLR).

In the present invention, a diagnostic reagent is prepared by designing a specific amplification primer or a specific detection probe according to the sequences upstream and downstream of two mutation sites of CHST 3.

The invention provides a reagent for detecting a complex heterozygous mutation site of a pathogenic gene CHST3 of congenital spinal epiphyseal hypoplasia, which comprises a primer for detecting the mutation site c.6755C > A of the pathogenic gene CHST3 p.S225R and a primer for detecting the mutation site c.1072_1089 dupCAGCCCGGGCTGCGG of the pathogenic gene CHST3 p.Q358_R363dup; the primer for detecting the mutation site c.6755C > A p.S225R of the pathogenic gene CHST3 comprises CHST3-1F with a nucleotide sequence shown as SEQ ID NO.1 (GATTCAGCCTTCTCCCA) and CHST3-1R with a nucleotide sequence shown as SEQ ID NO. 2 (CCAGCCACTTCTTCCAG); the primer for detecting the pathogenic gene CHST3 mutation site c.1072_1089 dupCAGCCCGCTGGCTGCGG: p.Q358_R363dup comprises CHST3-2F with a nucleotide sequence shown as SEQ ID NO. 3 (GGCAACATCTTCTACCTCT) and CHST3-2R with a nucleotide sequence shown as SEQ ID NO. 4 (CCAGTTTGTAGCCGAAG).

In the present invention, the reagent preferably further comprises a sequencing primer. The sequencing primer comprises a sequencing primer of a pathogenic gene CHST3 mutation site c.6755C > A p.S225R and/or a sequencing primer of a pathogenic gene CHST3 mutation site c.1072_1089 dupCAGCCCGCTGGCTGCGG p.Q358_R363dup. The sequencing primer of the pathogenic gene CHST3 mutation site c.6755C > A: p.S225R comprises CHST3-SEQ1F with a nucleotide sequence shown as SEQ ID NO. 5 (GCAGGGCAACATCTTCTA) and CHST3-SEQ1R with a nucleotide sequence shown as SEQ ID NO. 6 (CCACTTCTTCCAGGTCTTAT); the sequencing primer of the pathogenic gene CHST3 mutation site c.1072_1089 dupCAGCCCGCTGGCTGCGG:p.Q358_R363dup comprises CHST3-SEQ2F with a nucleotide sequence shown as SEQ ID NO. 7 (TGAGGGAAGAGGAGGTG) and CHST3-SEQ2R with a nucleotide sequence shown as SEQ ID NO. 8 (CTGCGTGTTCTTTTGGA). The source of the primer is not particularly limited in the present invention, and primer synthesis methods well known in the art may be employed.

In the present invention, the PCR amplification reagent preferably includes dNTPs, 10 XPCR buffer, magnesium ions and Tap polymerase. The 10 XPCR buffer comprises an aqueous solution of: 500mmol/L KCl, 100mmol/L Tris-Cl pH 8.3 and 15mmol/L MgCl ₂ 。

The invention provides application of the reagent in preparing a kit for detecting a pathogenic gene CHST3 mutation site of congenital spinal epiphyseal hypoplasia.

In the present invention, the method for detecting a mutation site of chet 3, a causative gene of congenital spinal epiphyseal hypoplasia, preferably comprises the steps of:

extracting genome DNA of a sample to be detected;

amplifying the CHST3 gene sequence using the genomic DNA as a template and the reagents described in the above schemes;

DNA sequencing the amplified product of CHST3 gene;

comparing the DNA sequencing result of the sample to be detected with the genome DNA sequence of a normal person, when the result is completely consistent, the CHST3 gene in the sample to be detected is not mutated into a wild type, when one allele in the chromosome of the comparison result is mutated from C to A at the position 675 of the CHST3 gene (NM_ 004273.5), the genotype of the mutation site is 'c.6755C > A: p.S225R heterozygous mutation', and when one allele on the chromosome is duplicated at the position 1072 to 1089 of 18 bases (CAGCCCGCCTGGCTGCGG) in total, the other allele is not mutated, and the genotype of the mutation site is 'c.1072_1089 dupCAGCCCGCTGGCTGCGG p.Q358_R363dup heterozygous mutation'.

In the present invention, the reaction system for amplifying CHST3 gene sequence is preferably 10 XPCR buffer 2.0. Mu.L, 10mmol/L dNTPs 0.4. Mu.L, 100 ng/. Mu.L CHST3-1F (or CHST 3-2F) 0.5. Mu.L, 100 ng/. Mu.L CHST3-1R (or CHST 3-2R) 0.5. Mu.L, 100 ng/. Mu.L extracted DNA 1.0. Mu.L, 5U/. Mu.L Taq enzyme 0.2. Mu. L, ddH ₂ O15.4. Mu.L. For CHST3: NM-004273.5: exon3: c.675C>The PCR amplification reaction procedure for the p.S225R mutation site is preferably as follows: the first step: 95 ℃ for 5 minutes; and a second step of: 30 cycles (95 ℃,30 seconds- > 50 ℃,30 seconds- > 72 ℃,60 seconds); and a third step of: 72 ℃,7Minutes; fourth step: preserving heat at 4 ℃. For CHST3: NM_004273.5: exon3: c.1072_1089 dupCAGCCCGCTGGCTGCGG: p.Q358_R363dup mutation site reaction procedure was as follows: the first step: 95 ℃ for 5 minutes; and a second step of: 30 cycles (95 ℃,30 seconds- > 48 ℃,30 seconds- > 72 ℃,60 seconds); and a third step of: 72 ℃,7 minutes; fourth step: preserving heat at 4 ℃.

The invention provides application of a primer for detecting a pathogenic gene CHST3 composite heterozygous mutation site in preparation of a kit for auxiliary diagnosis of congenital spinal epiphyseal hypoplasia, wherein the pathogenic gene CHST3 composite heterozygous mutation site is CHST3: NM_004273.5: exo3: c.6755C > A: p.S225R and CHST3: NM_004273.5: exo3: c.1072_1089 dupCAGCCCGCTGGCTGCGG: p.Q358_R363dup.

In the invention, a specific primer is designed based on the sequence at the upstream and downstream of the mutation site of the pathogenic gene CHST3, the primer is adopted to amplify the DNA fragment containing the mutation site, and whether the risk of congenital spinal epiphyseal hypoplasia exists is judged through the genotype of the DNA fragment. In an embodiment of the present invention, the primer is preferably a reagent according to the above scheme.

In the present invention, the method for aiding in the diagnosis of congenital spinal epiphyseal hypoplasia preferably comprises the steps of: detecting the genotype of the mutation site of the gene in the sample with the kit to diagnose whether the individual is at risk of congenital spinal epiphyseal hypoplasia: when the detected genotype is "c.6755C > A p.S225R heterozygote +c.1072_1089 dupCAGCCCGCTGGCTGCGG p.Q358_R363dup heterozygote", the CHST3 gene is judged to have compound heterozygote mutation, and the individual is a patient; if the detected genotype is a single heterozygous mutation, "c.6755C > A: p.S225R heterozygous mutation" or "c.1072_1089 dupCAGCCCGCTGGCTGCGG: p.Q358_R363dup heterozygous mutation", the individual is a carrier; if mutation is not generated at the mutation site, then the CHST3 gene is judged to be wild type, and the individual is normal.

In the present invention, the sample is preferably at least one of blood, amniotic fluid and biopsy tissue.

In the present invention, unless otherwise indicated, scientific and technical terms used herein have the meanings commonly understood by one of ordinary skill in the art. Also, the terms related to molecular genetics, nucleic acid chemistry and molecular biology and laboratory procedures used herein are all widely used terms and conventional procedures in the corresponding field. Meanwhile, in order to better understand the present invention, definitions and explanations of related terms are provided below.

The term "diagnosis" herein includes prediction of disease risk, diagnosis of the onset or absence of a disease, and also the assessment of disease prognosis.

The term "mutation" as used herein refers to the alteration of a wild-type polynucleotide sequence into a variant, which may be naturally occurring or non-naturally occurring.

In the present invention, the term "heterozygous mutation" means that the mutation exists in only one gene of a pair of alleles.

In the present invention, the term "complex heterozygous mutation" means a heterozygous mutation in which 1 or more parts of alleles occur, that is, a double allelic mutation, each chromosome being mutated.

The term "prenatal diagnosis" herein refers to definitive diagnosis of a high-risk fetus based on genetic counseling, mainly through genetic detection and imaging examination, and achieves the purpose of fetal selection through selective abortion of a diseased fetus, thereby reducing birth defect rate and improving prenatal quality and population quality.

In the present invention, a "primer" refers to a polynucleotide fragment, typically an oligonucleotide, containing at least 5 bases, such as 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more bases, for amplifying a target nucleic acid in a PCR reaction. The primer need not be completely complementary to the target gene to be amplified or its complementary strand, as long as it can specifically amplify the target gene. As used herein,

the term "specifically amplify" refers to a primer that is capable of amplifying a gene of interest by a PCR reaction, but not other genes. For example, specifically amplifying the CHST3 gene means that the primer amplifies only the CHST3 gene and not the other genes in the PCR reaction.

The application of the present invention for the complex heterozygous mutation of pathogenic gene CHST3, which causes congenital spinal epiphyseal hypoplasia, and the detection reagent and application thereof will be described in detail with reference to examples, but they should not be construed as limiting the scope of the present invention.

The experimental procedures, which do not address the specific conditions in the examples below, are generally followed by conventional conditions such as those described in Sambrook et al, molecular cloning, A laboratory Manual (Molecular Cloning A LABORATORY MANUAL 1SECOND EDITION;New York:Cold Spring Harbor LaboratoryPress,2014), or by the manufacturer's recommendations.

Example 1

Sample acquisition

The inventors found 1 congenital spinal epiphyseal hypoplastic family (family 1 for short), and the clinical information of part members of the family is shown in table 1. FIG. 1 is a family chart, wherein a male carrier is shown,representing female carriers, diamond-back representing a diseased fetus, ↗ representing a pre-patient.

1. Diagnostic criteria:

reference may be made to the 2010 version of the human monogenic genetic disease.

CHST3 gene mutations can lead to autosomal recessive vertebral epiphyseal dysplasia with congenital joint dislocation. Clinically, it is mainly manifested by short trunk, thousand forms, short stature, chest deformity and joint degeneration. The imaging features include flattened vertebral body, epiphyseal dysplasia and articular cartilage destruction.

The method specifically comprises the following steps: skeletal dysplasia, limb shortness, aortic valve stenosis, tibial curvature, hearing impairment, delayed tooth eruption, short stature, flexion contracture, finger curvature, dislocation of joints, ulnar curvature, short metacarpal bones, flat epiphysis, tricuspid valve stenosis, shield-like chest, narrowing of pedicle gap, immobilization of elbow joint, lumbar lordosis, excessive eye distance, gonum valgus, pulmonary artery stenosis, flat feet, mental disability, spinal epiphysis dysplasia, high arch eyebrows, scoliosis, delayed bone maturation, small tooth deformity, dislocation of elbow joints, arthropathy, coarse movement developmental retardation, tricuspid valve regurgitation, joint pain, small finger deviation, decalcification of whole body bone, multiple carpal ossification center, bilateral single palm transverse crease aortic valve regurgitation, narrowing of the intervertebral space, mitral regurgitation, dislocation of the shoulder, widening of the intervertebral space, in long people, barreled chest, short finger deformity syndrome, limited hip extension, epiphysis, low proximal epiphysis development of the femur, short neck of the femur, ventricular septal defect, small ear deformity, short phalanges of the fingers, wide forehead, sparse eyebrows, toddler gait, high palate, wide nipple spacing, dislocation of the knee joints, short phalanges of the fingers, irregular vertebral endplates, scoliosis, horseshoe varus, low ulna development, short neck, reduced hip abduction, pulmonary arterial hypertension, kyphosis deformity (humpback), mitral stenosis, coronary spinal fissures, ventricular hypertrophy, and elbow valgus.

Table 1 clinical information of congenital spinal epiphyseal hypoplasia family members No.1 and No. 2

As shown in FIG. 1, the numbers I (first generation) and II (second generation) are adopted.

Family 1 personnel I1 (male parent, current male) I2 and II 1 (male) peripheral blood DNA were used for sequencing.

Example 2

Exon sequencing

1. The instrument is shown in table 2.

Table 2 list of instruments and devices

2. Reagent consumable

Human whole exon sequencing kit (Agilent), DNA 1000 kit (Agilent), 96 well plate (Axygen), different types of tips (Axygen), 200 μl centrifuge tube (Eppendorf), 1.5mL centrifuge tube (Eppendorf), capillary electrophoresis buffer (Thermo), sequencing standard (Thermo), absolute ethanol (Thermo), bigDye Terminator V3.1.3.1 (Thermo), peripheral blood gDNA extraction kit (TIANGEN), agarose (TIANGEN), EB dye (amerco).

3. Reagent formulation

A5 XTBE stock solution of electrophoresis liquid was prepared in accordance with Table 3.

Table 35 XTBE electrophoresis liquid formula

Reagent(s)	Tris	Boric acid	EDTA(pH 8.0，0.5mol/L)	ddH ₂ O
					Volume/weight	5.4g	750mg	2mL	90mL

With ddH ₂ O adjusts the final volume to 100mL.

0.5 XTBE working solution was run on ddH ₂ O is diluted by 10 times.

10 Xerythrocyte lysate was prepared according to Table 4.

TABLE 4 10 Xerythrocyte lysate formula

Reagent(s)	NH ₄ Cl	KHCO ₃	EDTA	Adding ddH ₂ O
					Volume/weight	82.9g	10g	0.37g	To 1000mL

Autoclaving and storing at 4deg.C.

1 Xnuclear lysate was prepared according to Table 5.

Table 5 1 XNuclear lysate formula

Reagent(s)	2M Tris-HCl，pH 8.2	4M NaCl	2mM EDTA
				Volume/weight	0.5mL	10mL	0.4mL

4. Experimental procedure

After signing the informed consent, 3-5mL of peripheral blood of I1 (male parent of the forerunner), I2 (mother of the forerunner) and 5-10 mL of amniotic fluid of II 1 (male parent) in family 1 are collected.

4.1 sample DNA extraction

1) 3-5mL of sample is put into a 15mL centrifuge tube, and 1 Xerythrocyte lysate with the volume of 2-3 times is added, and the mixture is uniformly mixed, and the mixture is kept stand on ice for 30 minutes until the solution becomes transparent.

2) Centrifuge at 4℃for 10 min at 3000 rpm, carefully remove the supernatant. 1mL of 1 Xcell nucleus lysate was added to the pellet, mixed well, and 2mL of 1 Xcell nucleus lysate and 150. Mu.L of 20% SDS were added thereto, and shaken well until a viscous transparent state appeared. Add 10. Mu.L of 20mg/mL proteinase K and shake well. Digestion is performed at 37℃for more than 6 hours or overnight.

3) Adding saturated phenol with equal volume, mixing by shaking, and centrifuging at room temperature of 3000 rpm for 10 min.

4) The supernatant was carefully transferred to another centrifuge tube, mixed with an equal volume of phenol/chloroform (1:1 v/v) and centrifuged at 3000 rpm for 10 minutes at room temperature.

5) The supernatant was carefully removed and if not clear, extracted once more with an equal volume of chloroform.

6) Transferring the supernatant into another centrifuge tube, adding diploid absolute ethanol, shaking, and obtaining white flocculent DNA. The DNA was hooked with a flame sterilized glass crochet, washed twice with 70% ethanol, dried at room temperature for 5 minutes, and then dissolved in 200. Mu.L of 1 XTE and drum-dissolved overnight. OD was measured by uv.

7) The TE-dissolved DNA can be preserved for one year at 4deg.C, and if long-term preservation is required, 2 times volume of absolute ethanol is added for preservation at-70deg.C.

4.2 exon sequencing

Reference is made to the manual of the human whole exon sequencing kit (Agilent) and the manual of the molecular cloning laboratory (third edition; molecular Cloning A LABORATORY MANUAL 1SECOND EDITION;New York:Cold Spring Harbor LaboratoryPress,2014) for instructions.

1) Taking 2 mug DNA, mechanically breaking to ensure that the fragment size is about 200bp, cutting gel, and recovering 150-250bp fragments;

2) DNA fragment is used for terminal repair and A is added to the 3' -terminal;

3) Connecting sequencing joints, purifying the connection products, performing PCR amplification, and purifying the amplified products;

4) Adding the purified amplification product into an Agilent kit probe for hybridization capture, eluting and recovering the hybridization product, performing PCR amplification, recovering the final product, and performing quality control analysis by agarose gel electrophoresis on a small sample;

5) NextSeq500 sequencer sequencing and data analysis.

4.3 results

Finally, 1 gene composite heterozygous mutation CHST 3:NM_004273.5:exon3:c.6755C > A:p.S225R and exon 3:c.1072_1089dupCAGCCCGCTGGCTGCGG:p.Q358_R363dup with pathogenic significance are obtained; wherein c.6755C > A is mutated to a base C at position 675 to A, resulting in a missense mutation, resulting in the mutation of amino acid 225 from serine (S) to arginine (R); the 1072_1089 dupcagccccgctggctgcgg mutation is a CAGCCCGCCTGGCTGCGG repeat of bases 1072 to 1089, resulting in a repeat mutation, and a repeat mutation of amino acids 6 (QPAWLR) 358 to 363. Genotype at the family 1 patient (precursor) CHST3: nm_004273.5: exon3: c.6755c > a: p.s225r and exon3: c.1072_1089dupCAGCCCGCCTGGCTGCGG: p.q358_r363dup site is the "c.6755c > a+c.1072_1089 dupcagcctggctgcgg" composite heterozygous mutation; the genotype of this site in line 1 carrier was either the "c.6755C > A" heterozygous mutation or the "c.1072_1089 dupCAGCCCGCTGGCTGCGG" heterozygous mutation.

Example 3

Sanger sequencing validation

For exome sequencing results, CHST3: NM-004273.5: exo3: c.6755C > A: p.S225R and exo3: c.1072-1089 dupCAGCCCGCTGGCTGCGG: p.Q358_R363dup sites were further verified using Sanger sequencing. CHST3: NM-004273.5: exo3: c.6755C > A: p.S225R and exon3: c.1072-1089 dupCAGCCCGCTGGCTGCGG: p.Q358-R363dup site genotype detection was performed on3 persons (forerunner, forerunner parent, forerunner mother), 4 persons (forerunner, forerunner mother, forerunner parent, fetus) of family 1, and 100 normal persons outside the family, respectively.

The specific method comprises the following steps:

1. DNA extraction

Genomic DNA was extracted according to the method of example 1.

2. Candidate primer design, verification and preference

2.1 candidate primer design references the human genome sequence database hg19/build36.3 (https:// www.ncbi.nlm.nih.gov/genome, or http:// genome. Ucsc. Edu/cgi-bin/hgGateway.

2.2 16 pairs and 15 pairs of candidate primers were designed for mutation sites c.675C > A and c.1072_1089 dupCAGCCCGCTGGCTGCGG, respectively (see Table 6), and the merits of each pair of candidate primers were verified and evaluated by PCR experiments.

TABLE 6 list of candidate primer base conditions and validation experiment results for each pair

/>

Note that: after electrophoresis, the normal PCR amplification result has only one specific band, and if the primer dimer band and the non-specific product band are all the results of abnormal reaction of the primer; the target primer avoids such a situation as much as possible. The optimal primer pairs were also comprehensively evaluated and selected with reference to the following principles:

(1) the length of the primer is 15-30nt, and is usually about 20 nt;

(2) the content of G+C is preferably 40-60%, too little G+C has poor amplification effect, and excessive G+C is easy to generate nonspecific bands. ATGC is preferably randomly distributed;

(3) avoiding a serial alignment of more than 5 purine or pyrimidine nucleotides;

(4) complementary sequences should not occur inside the primer;

(5) no complementary sequences should exist between the two primers, in particular to avoid complementary overlapping of the 3' ends;

(6) the homology of the primer and the sequence of the non-specific amplification region is not more than 70 percent, the continuous 8 bases at the 3' -end of the primer cannot have a complete complementary sequence outside the region to be amplified, otherwise, the non-specific amplification is easy to cause;

2.3 candidate primer PCR verification reaction

PCR was performed according to the reaction system in Table 7 and the reaction system was kept on ice; each pair of primers was provided with 8 reaction test tubes (SEQ ID NOS 1 to 8 in Table 7).

TABLE 7 primer detection PCR reaction System

/>

Reaction conditions: the test reaction tube was placed in a PCR instrument and the following reaction procedure was performed:

the first step: 95 ℃ for 5 minutes;

and a second step of: 30 cycles (95 ℃,30 seconds→tm,30 seconds→72 ℃,60 seconds); (the Tm value is calculated for each primer in Table 6 by setting PCR amplification parameters based on the Tm value of each primer).

And a third step of: 72 ℃,7 minutes;

fourth step: 4℃until sampling.

2.4 candidate primer PCR results agarose gel electrophoresis detection was performed to evaluate the effectiveness, specificity of the primer reactions:

1) Sealing the two ends of the gel sampler with adhesive tape, placing on a horizontal table, and placing a comb at about 1cm position at one end of the sampler.

2) Weighing 2g of agar powder in a conical flask, adding 100mL of 0.5 XTBE electrophoresis buffer, shaking uniformly, heating on a microwave oven or an electric furnace (adding asbestos gauze), taking out after boiling, shaking uniformly, reheating until the gel is completely melted, taking out and cooling at room temperature.

3) After the gel is cooled to about 50 ℃, pouring the gel into a sealed gel sampler to enable the thickness to be about 5 mm.

4) Gel is solidified and the adhesive tape is removed, and the gel and the sampler are put into an electrophoresis tank together.

5) Adding electrophoresis buffer solution to make the liquid level 1-2mm higher than the rubber surface, and pulling out the comb upwards; and (3) uniformly mixing the sample and the DNA size standard substance with the sample loading liquid by using a micropipette, and adding the mixture into each sample loading hole, wherein the DNA is sunk into the hole bottom due to the fact that the sucrose in the sample loading liquid has a larger specific gravity.

6) And (5) covering an electrophoresis tank, switching on a power supply, adjusting to a proper voltage, and starting electrophoresis. And judging the approximate position of the sample according to the indication of bromophenol blue in the sample carrying liquid, and determining whether to terminate electrophoresis.

7) The power supply is cut off, the gel is taken out, and the gel is put into an EB water solution with the concentration of 0.5g/mL for dyeing for 10-15 minutes.

8) The gel was observed under a transmissive ultraviolet irradiator at 254nm and the electrophoresis results were recorded either with a camera with a red filter or with a gel scanning system.

2.5 evaluation of results:

1) If only one bright and clear target strip appears in the tube No. 7 and no other strip exists, judging that the pair of primers and a reaction system are good in effectiveness and strong in specificity;

2) If no target band appears in the tube 7, judging that the pair of primers and the reaction system are invalid;

3) If the No. 7 tube has a primer dimer band outside the target band and also has a primer dimer band in the No. 2, 3, 4, 5 and 6 partial tubes, judging that the effectiveness of the pair of primers and the reaction system is poor;

4) If the No. 7 tube has a nonspecific band outside the target band and also has a nonspecific band in the No. 5 and 6 partial tubes, judging that the specificity of the pair of primers and the reaction system is poor;

5) If primer dimer and non-specific band outside the target band appear in the tube No. 7, and primer dimer and non-specific band also appear in the tube No. 2, 3, 4, 5, 6, the effectiveness and specificity of the pair of primers and the reaction system are judged to be poor.

2.6 according to the results of statistics after the verification test of Table 6, the optimal pair (two site No.1 pair candidate primers in Table 6) was selected as the primers for mutation family detection:

the PCR amplification primer sequences for the CHST3: NM-004273.5: exon3: c.675C > A: p.S225R sites were as follows:

5’-GATTCAGCCTTCTCCCA-3’(SEQ ID NO:1)

5’-CCAGCCACTTCTTCCAG-3’(SEQ ID NO:2)

the PCR amplification primer sequences for the CHST3: NM-004273.5: exon3: c.1072-1089 dupCAGCCCGCTGGCTGCGG: p.Q358_R363dup sites were as follows:

5’-GGCAACATCTTCTACCTCT-3’(SEQ ID NO:3)

5’-CCAGTTTGTAGCCGAAG-3’(SEQ ID NO:4)

PCR was performed according to the reaction system in Table 8 and the reaction system was kept on ice.

TABLE 8 mutation site PCR reaction system

Reaction conditions: the reaction system was put into a PCR instrument, and the following reaction procedure was performed:

PCR amplification procedure for CHST3: NM-004273.5: exo3: c.675C > A: p.S225R sites was as follows:

the first step: 95 ℃ for 5 minutes;

and a second step of: 30 cycles (95 ℃,30 seconds- > 50 ℃,30 seconds- > 72 ℃,60 seconds);

and a third step of: 72 ℃,7 minutes;

fourth step: 4℃until sampling.

The PCR amplification procedure for CHST3: NM-004273.5: exon3: c.1072_1089 dupCAGCCCGCTGGCTGCGG: p.Q358_R363dup site was as follows:

the first step: 95 ℃ for 5 minutes;

and a second step of: 30 cycles (95 ℃,30 seconds- > 48 ℃,30 seconds- > 72 ℃,60 seconds);

and a third step of: 72 ℃,7 minutes;

fourth step: 4℃until sampling.

4. Agarose gel electrophoresis detection

Refer to step 2.4 above.

5. Purifying a PCR product by an enzymolysis method: to the 5. Mu.LPCR product, 0.5. Mu.L of exonuclease I (Exo I), 1. Mu.L of alkaline phosphatase (AIP) was added, and the mixture was digested at 37℃for 15 minutes and inactivated at 85℃for 15 minutes.

6. BigDye reaction

The BigDye reaction system is shown in Table 9.

TABLE 9 BigDye reaction System

Reagent(s)	DNA after purification of PCR product	3.2 pmol/. Mu.L sequencing primer	BigDye	5 XBigDye sequencing buffer	ddH ₂ O
						Volume of	2.0μL	1.0μL	0.5μL	2.0μL	4.5μL

Sequencing PCR cycling conditions:

the first step: 96℃for 1 minute;

and a second step of: 33 cycles (96 ℃,30 seconds- > 55 ℃,15 seconds- > 60 ℃,4 minutes);

and a third step of: 4℃until sampling.

7. And (3) purifying a BigDye reaction product:

1) mu.L of 125mM EDTA (pH 8.0) was added to each tube, and 1. Mu.L of 3mol/L NaAc (pH 5.2) was added to the bottom of the tube;

2) Adding 70 mu L of 70% alcohol, shaking and mixing for 4 times, and standing at room temperature for 15 minutes;

3) 3000g, centrifugation at 4℃for 30 minutes; immediately inverting the 96-well plate and centrifuging 185g for 1 minute;

4) After 5 minutes at room temperature, the residual alcohol was allowed to evaporate at room temperature, 10. Mu.LHi-Di formamide was added to dissolve DNA, denatured at 96℃for 4 minutes, quickly placed on ice for 4 minutes, and sequenced on the machine.

8. Sequencing

The purified BigDye reaction product was subjected to DNA sequencing.

Sequencing primers nested primers (the second set of primers is designed within the range of the product sequence amplified from the first set of primers) were designed as sequencing primers based on the preferred primers for PCR described above:

the sequencing primer sequences for the CHST3: NM-004273.5: exon3: c.675C > A: p.S225R sites were as follows:

5’-GCAGGGCAACATCTTCTA-3’(SEQ ID NO:5)；

5’-CCACTTCTTCCAGGTCTTAT-3’(SEQ ID NO:6)。

the sequencing primer sequences for the CHST3: NM-004273.5: exon3: c.1072_1089 dupCAGCCCGCTGGCTGCGG: p.Q358_R363dup sites are as follows:

5’-TGAGGGAAGAGGAGGTG-3’(SEQ ID NO:7)；

5’-CTGCGTGTTCTTTTGGA-3’(SEQ ID NO:8)。

9. analysis of results

The Sanger sequencing results of FIG. 2 show that the genotype of the 2 persons of family 1 CHST3: NM-004273.5: exo3: c.6755C > A: p.S225R locus is "c.6755C > A heterozygote". The position indicated by the arrow in the sequencing diagram of FIG. 2 shows that the B and C layers CHST3: NM-004273.5: exo3: c.675C > A: p.S225R site genotypes are "c.675C > A heterozygote" mutations; the position indicated by the arrow in the sequencing diagram of FIG. 2 shows that the A-layer individual genotype is wild type.

The Sanger sequencing results of FIG. 3 show that the genotype of the 2 members CHST3: NM-004273.5: exon3: c.1072-1089 dupCAGCCCGCTGGCTGCGG: p.Q358_R363dup locus is the "c.6755C > A heterozygote". The position indicated by the arrow in the sequencing diagram of FIG. 3 shows that the individuals CHST3: NM-004273.5: exon3: c.1072-1089 dupCAGCCCGCTGGCTGCGG: p.Q358_R363dup locus genotype is the "c.1072-1089 dupCAGCCCGCTGGCTGCGG heterozygous" mutation in the individuals CHST3: NM-004273.5: exon 3; the position indicated by the arrow in the sequencing diagram of FIG. 3 shows that the B-layer individual genotype is wild type.

From the above results, the chet 3 genotype of the precursor was c.6755c > a, c.1072_1089dupCAGCCCGCCTGGCTGCGG complex heterozygous mutation.

Example 5

Congenital spinal epiphyseal hypoplasia diagnostic kit and application

1. The kit comprises the following components:

1) Amplification primers: as shown in example 3

2) Buffer solution

3) Taq enzyme

4)dNTPs

5) CHST3: c.6755c > a and c.1072_1089 dupcaggcccgctggctgcgg positive mutant reference DNA, c.6755c > a positive reference is a double-stranded DNA, the specific sequence is as follows:

1072-1089 dupCAGCCCGCTGGCTGCGG positive reference is a double-stranded DNA, and the specific sequence is as follows:

wherein, single underlined base is the position of the primer at the upstream and downstream of PCR amplification, the base in the square frame is the point mutation site, and double underlined base is the position of the primer at the upstream and downstream of sequencing.

6) Sequencing primer: as shown in example 3.

2. The using method comprises the following steps:

210 individuals out of 56 skeletal system dysplasia families were screened and tested altogether, and the following families were found again, and the kit was applied to family 2 patient testing (see table 10).

Table 10 clinical information of congenital spinal epiphyseal hypoplasia family 2 members

As shown in FIG. 4, the numbers I (first generation) and II (second generation) are used.

The peripheral blood DNA of family 2 personnel I1 (father), I2 (mother) and II 1 (forerunner) were used for the detection of the kit.

1) Genomic DNA extraction: and extracting the genomic DNA of the sample.

2) Firstly, carrying out PCR amplification reaction by using the PCR amplification primer, taq enzyme, buffer solution, dNTPs, sample genome DNA and the like, as in the example 3;

3) Purifying the PCR amplification product;

4) Performing BigDye reaction on the purified PCR product by using the sequencing primer;

5) Purifying the BiyDye reaction product;

6) The biydiye reaction products were sequenced and the sequenced sequences were compared to the normal sequences.

The detection result of the kit in FIG. 5 shows that the genotype of the loci CHST3: NM_004273.5: exo3: c.6755C > A: p.S225R is "c.6755C > A heterozygote" of the family 2 father and forensics. The position indicated by the arrow in the sequencing diagram of FIG. 5 shows that the genotypes of the loci of the A and C layers CHST3: NM-004273.5: exo3: c.6755C > A: p.S225R are "c.6755C > A heterozygote" mutations; the position indicated by the arrow in the sequencing diagram of FIG. 5 shows that the B-layer individual genotype is wild-type. The kit test results of FIG. 6 show that the genotype of the No. 2 family mother and forerunner CHST3: NM-004273.5: exon3: c.1072-1089 dupCAGCCCGCTGGCTGCGG: p.Q358_R363dup locus is the "c.1072-1089 dupCAGCCCGCTGGCTGCGG heterozygote". The position indicated by the arrow in the sequencing diagram of FIG. 6 shows that the B and C layers CHST3: NM-004273.5: exon3: c.1072-1089 dupCAGCCCGCTGGCTGCGG: p.Q358_R363dup locus genotype is the "c.1072-1089 dupCAGCCCGCTGGCTGCGG heterozygote" mutation; the position indicated by the arrow in the sequencing diagram of FIG. 6 shows that the A-layer individual genotype is wild type. The detection result confirms that the first person is a congenital spine epiphyseal hypoplasia patient, and the mother and father of the patient are mutant gene carriers; genetic counseling opinion is that the probability of the couple to re-produce congenital spine epiphyseal hypoplasia is 1/4, the probability of producing the offspring of the carrier is 1/2, the probability of producing normal individuals is 1/4, and genetic diagnosis before embryo implantation and prenatal diagnosis in hospital after pregnancy are suggested when the couple is scheduled to re-produce.

From the results of the above examples, it can be seen that the present invention has found a novel CHST3 gene mutant, and confirmed that the novel mutant is closely related to the onset of congenital spinal epiphyseal hypoplasia, which can be used for molecular diagnosis of congenital spinal epiphyseal hypoplasia and differential diagnosis of related diseases.

The foregoing is merely a preferred embodiment of the present invention and it should be noted that modifications and adaptations to those skilled in the art may be made without departing from the principles of the present invention, which are intended to be comprehended within the scope of the present invention.

Claims

1. Comprises a gene CHST3 mutation site CHST3: NM_004273.5: exon3: c.675C >

A p.S225R DNA fragment and a gene CHST3 mutation site CHST3 NM-004273.

Use of a DNA fragment comprising the gene CHST3 mutation site CHST 3:nm_004273.5:exo3:c.6755c > a:p.s225r having the nucleotide sequence as set forth in SEQ ID NO: 79; the nucleotide sequence of the DNA fragment containing the gene CHST3 mutation site CHST3: NM_004273.5: exon3: c.1072_1089 dupCAGCCCCCGCTGGCTGCGG: p.Q358_R363dup is shown as SEQ ID NO: 80.

2. A reagent for detecting a complex heterozygous mutation site of a pathogenic gene CHST3 of congenital spinal epiphyseal hypoplasia is characterized by comprising a primer for detecting the pathogenic gene CHST3 mutation site c.6755C > A p.S225R, a primer for detecting the pathogenic gene CHST3 mutation site c.1072_1089 dupCAGCCCGGGCTGCGG p.Q358_R363dup and a sequencing primer;

the detection of the mutation site c.1072_1089 dupCAGCCCGCTGG of the pathogenic gene CHST3

The primer of CTGCGG p.Q358_R363dup comprises CHST3-2F with the nucleotide sequence shown in SEQ ID NO. 3 and CHST3-2R with the nucleotide sequence shown in SEQ ID NO. 4;

the sequencing primer comprises a sequencing primer of a pathogenic gene CHST3 mutation site c.6755C > A p.S225R and a sequencing primer of a pathogenic gene CHST3 mutation site c.1072_1089 dupCAGCCCGCTGGCTGCGG p.Q358_R363dup;

the mutation site c.1072-1089 dupCAGCCCGCCCTGGCTG of the pathogenic gene CHST3

The sequencing primer of the CGG p.Q358_R363dup comprises CHST3-SEQ2F with the nucleotide sequence shown in SEQ ID NO. 7 and CHST3-SEQ2R with the nucleotide sequence shown in SEQ ID NO. 8.

3. A congenital spinal epiphyseal hypoplasia diagnosis kit comprising the reagent of claim 2 and a PCR amplification reagent.

4. The kit of claim 3, wherein the PCR amplification reagents comprise dNTPs, 10 XPCR buffer, magnesium ions, andTap a DNA polymerase;

the 10 XPCR buffer comprises an aqueous solution of: 500mmol/L KCl, 100mmol/L Tris-HCl pH 8.3 and 15mmol/L MgCl ₂ 。

5. Use of the reagent of claim 2 for the preparation of a kit for detecting a pathogenic gene CHST3 mutation site of congenital spinal epiphyseal hypoplasia, said pathogenic gene CHST3 mutation site being CHST3: nm_004273.5: exon3: c.6755 c > a: p.s225r and CHST3: nm_004273.5: exon3: c.1072_1089 dupcagcctggctgcgg: p.q358_r363dup.

6. Application of a primer for detecting a pathogenic gene CHST3 composite heterozygous mutation site in preparation of a kit for assisting in diagnosing congenital spinal epiphyseal hypoplasia, wherein the pathogenic gene CHST3 composite heterozygous mutation site is CHST3: NM_004273.5: exo3: c.675C > A: p.S225R and CHST3: NM_004273.5: exo3: c.1072_1089 dupCAGCCCGGCCTGGCTGCGG: p.Q358_R363dup.

7. The use according to claim 6, wherein the primer is the reagent according to claim 2 or 3.