CN115820697A

CN115820697A - Immune cell and preparation method and application thereof

Info

Publication number: CN115820697A
Application number: CN202211163685.2A
Authority: CN
Inventors: 李静; 李明风; 戚欣
Original assignee: Ocean University of China
Current assignee: Ocean University of China
Priority date: 2022-09-23
Filing date: 2022-09-23
Publication date: 2023-03-21

Abstract

The invention relates to a nucleic acid construct, an immune cell, a preparation method and application thereof, wherein the nucleic acid construct comprises the following components which are connected in sequence: the CAR molecule coding sequence consisting of an extracellular antigen binding region coding sequence, a transmembrane region coding sequence and an intracellular signal transduction region coding sequence, and the CAR molecule coding sequence consisting of a sGP coding sequence or a fusion protein coding sequence thereof; sGP130, or a fusion protein encoding sequence thereof, and a CAR molecule encoding sequence are linked by a cleavage peptide comprising: F2A, T2A, E2A or P2A. The invention combines sGP with CAR-T cells at the same time, and experiments show that the sGP-HER 2-CAR-NK92 cells obtained by the invention highly express HER2 antibody and can be used for treating HER2 related tumors. Moreover, the immune cells over-express sGP, block the combination of IL-6 and its receptor, and improve the safety in vivo, and the in vitro cytotoxicity test shows that sGP-HER 2-CAR-NK92 cells enhance the killing effect of CAR-T cells on JIMT-1 cells by about 2 times.

Description

Immune cell and preparation method and application thereof

Technical Field

The invention belongs to the technical field of cellular immunotherapy, and particularly relates to an immune cell and a preparation method and application thereof.

Background

The role of immune cells in tumor immunotherapy is increasingly gaining attention. Natural Killer (NK) cells are natural immune cells in the core of the body, and T lymphocytes are important adaptive immune response cells of the body. Both NK and T cells play a major role in tumor immune surveillance. In recent years, tumor immune cell therapy has attracted attention in tumor therapy because of its remarkable curative effect, and in particular, T/NK cell (CAR-T/NK) based on chimeric antigen receptor modification, CAR-T cell therapy exhibits good targeting, lethality and persistence in clinical treatment of hematologic malignancies, and is a typical representative of adoptive immunotherapy of tumors. However, there are still many problems associated with CAR-T cell therapy, such as the clinical therapeutic findings of CAR-T cells show that its own Cytokine Release Syndrome (CRS) is life threatening for patients. CRS takes interleukin-6 (interleukin 6, IL-6) as a detection index, and an antagonist of IL6 also becomes a means mainly used for controlling severe CRS at present so as to reduce the risk of failure of CAR-T cell treatment caused by severe CRS.

IL-6 is also one of the most distinctive cytokines that promote cancer cytokines, and among the various inflammatory factors released by immune cells, IL-6 is considered to be the most central inflammatory factor linking inflammation and tumor, and also the key inflammatory factor that initiates cytokine storm. The binding of IL-6 and IL-6R includes both membrane-bound (mIL-6R) and soluble IL-6R (sIL-6R), which are known as classical or non-classical signaling, respectively, with the biological differences arising from the two signaling pathways being large. The classical signaling pathway regenerates and has a protective effect, while the non-classical signaling pathway promotes inflammation. In the non-classical pathway, IL-6 forms a protein complex by combining with non-signaling sIL-6R alpha, then dimerizes with subunit Glycoprotein 130 (Glycoprotein 130, gp130), and initiates a signal transduction cascade through transcription factors, janus kinases (JAKs) and signal transducers, and transcriptional activators (STATs), which not only can promote the continued cell proliferation of tumors and inhibit the immune level of tumor microenvironment, but also can cause hyperpyrexia, nerve damage and even death of patients.

Although immune cells have promising prospects in tumor immunotherapy, IL-6 release creates an inflammatory microenvironment, triggers a cytokine storm in patients, promotes tumor growth or immune escape. Therefore, there is still a need in the art for further research to further improve the therapeutic effect of immune effector cells on tumor immunotherapy and reduce toxic side effects.

Disclosure of Invention

In order to solve the problems in the prior art, the invention provides a nucleic acid construct, a vector, an immune cell, a preparation method and an application thereof, wherein the tumor killing capacity of the immune cell is obviously enhanced, and the killing effect on solid tumors and the in-vivo safety of the immune cell are improved after the CAR-T cell is used in combination.

The object of the present invention is to provide a nucleic acid construct.

The object of the present invention is to provide a vector containing the above-mentioned nucleic acid construct.

Another object of the present invention is to provide an immune cell containing the above nucleic acid construct and a method for producing the same.

It is a further object of the present invention to provide the use of the above immune cells.

According to a particular embodiment of the invention, a nucleic acid construct is provided which encodes a fusion polypeptide for modifying an immune cell, said nucleic acid construct comprising, in sequential linkage: an extracellular antigen binding region coding sequence, a transmembrane region coding sequence, an intracellular signal transduction region coding sequence, and a sGP or fusion protein coding sequence thereof.

The fusion protein of soluble GP130 includes but is not limited to: a fusion peptide of soluble sGP and Fc, or a fusion peptide of soluble sGP and CH3 domain.

In the present invention, treatment/overexpression of sGP in a nucleic acid construct or immune cell reduces the side effects of CAR-T during treatment while retaining anti-tumor effects.

Further, the coding sequence of the extracellular antigen binding region, the coding sequence of the transmembrane region and the coding sequence of the intracellular signal transduction region form the coding sequence of the CAR molecule, and the sGP or the coding sequence of the fusion protein thereof and the coding sequence of the CAR molecule are connected by a cleavage peptide, wherein the cleavage peptide comprises: F2A, T2A, E2A or P2A.

Wherein the extracellular antigen-binding region is an antibody that specifically binds to an antigen highly expressed by a tumor.

Further, the extracellular antigen-binding region recognizes any tumor specific or related antigen including HER2, ephA2, GD2, epCAM, PD-1, PD-L1, leY, CEA, EGFR, GPC3, mesothelin, CD19, CD20, ASGPR1, EGFRvIII, de4EGFR, NY-ESO-1, mage4, cd19, caix, cd123, CD33, IL13R, LMP1, PLAC1, MUC16; the transmembrane region and the intracellular signal transduction region are selected from any one of CD8, CD28 TM + ICD, 4-1BB, DAP10, DAP12, NKG2D, DNAM, CD3 zeta or the intracellular domain combination of at least two molecules.

Further, the sGP comprises amino acids 1-558aa, and the amino acid sequence is shown as SEQ ID NO: 1; preferably, the nucleotide sequence of the sGP coding gene is shown as SEQ ID NO. 2. The fragment can specifically bind to a trans-signal pathway of IL6, is the optimal fragment selected from a plurality of fragments after experimental verification in a laboratory, and is different from the known GP130 extracellular segment in length.

Furthermore, the FLAG, his or HA tag is added at the front end of the coding sequence of the extracellular antigen binding region, which is favorable for detecting the expression of the target gene.

A vector comprising said nucleic acid construct.

In the CAR recognition activation induction overexpression system, the plasmid vector comprises any one of pCDH-CMV-MCS-EF1-Puro, pCDH-CMV-MCS-EF1-EGFP-T2A-Puro and pCDH-CMV-MCS-P2A-EGFP-T2A-Puro.

Preferably, the vector used for overexpression comprises a viral vector or a PB vector.

Preferably, the viral vector comprises any one of a lentiviral vector, an adenoviral vector or a retroviral vector or a combination of at least two thereof.

Preferably, the vector is a lentiviral vector, and more preferably, the lentiviral vector is a pCDH-CMV-MCS-P2A-EGFP-T2A-Puro, the CMV is used as a promoter of a target gene to start the expression of the used target gene, the expression of the target gene comprises a screening gene and a reporter gene GFP, the effect of synchronous expression of all the target genes can be achieved, and the phenomenon of uneven expression can not occur. By adopting the slow virus package and the slow virus infection method, the method has the advantages of high transfection efficiency, large capacity of containing exogenous target gene fragments and the like, and can realize stable long-term expression of target genes.

An immune cell comprising said nucleic acid construct; the immune cell is an immune effector cell modified by a chimeric antigen receptor and can over-express sGP130.

Further, the immune cell is modified with one or more than two CAR molecules.

Further, the immune cells are selected from any one of NK cells, T cells, B cells and macrophages or the combination of at least two of the NK cells, the T cells, the B cells and the macrophages.

Preferably, the NK cells include NK cells, memory NK cells and NK cell lines induced in vitro by NK cells or stem cells removed from a human; the T cells include T cells derived from a human or stem cells induced in vitro.

Preferably, the T cells are CD4+ T cells, CD8+ T cells, NKT cells, and memory T cells.

A method of preparing said immune cell, said method comprising: transferring said nucleic acid construct into an immune effector cell.

The nucleic acid construct, the vector, the use of the immune cell, and the use of the nucleic acid construct, the vector, and the immune cell in preparing a medicament for inhibiting tumor cells or in tumor cell immunotherapy to reduce CRS caused by CAR-T cell treatment process.

Preferably, the extracellular antigen-binding region in the CAR molecule recognizes and binds to a single chain antibody extracellular variable region of HER2 protein, forming a HER2-CAR fragment.

Preferably, the amino acid sequence of the extracellular signal peptide CD8a Leader of the CAR molecule is shown as SEQ ID NO. 5; the nucleotide sequence of the coding gene is shown as SEQ ID NO. 6.

Preferably, the amino acid sequences of the CD8 alpha Linker in the extracellular and intracellular Linker regions of the CAR molecule are shown as SEQ ID NO. 7; the nucleotide sequence of the coding gene is shown as SEQ ID NO. 8.

The intracellular co-stimulatory signaling domain of the CAR molecule comprises any one of CD8, CD28 TM + ICD, 4-1BB, DAP10, DAP12, NKG2D, DNAM1, CD3 ζ or a combination of at least two of the intracellular domains of the molecules.

The intracellular signal transduction region is formed by connecting the intracellular region of CD28 TM + ICD and the intracellular region of CD3 zeta in series.

Preferably, the amino acid sequence of the transmembrane and intracellular costimulatory region of the CD28 TM + ICD is shown as SEQ ID NO. 9; the nucleotide sequence of the coding gene is shown as SEQ ID NO. 10.

Preferably, the amino acid sequence of CD3 zeta of the CAR molecule is as shown in SEQ ID NO 11. The nucleic acid sequence is shown as SEQ ID NO. 12.

Preferably, the amino acid sequence of the F2A peptide fragment is shown in SEQ ID NO 13; the nucleotide sequence of the coding gene is shown as SEQ ID NO. 14.

Preferably, the amino acid sequence of the FLAG fragment is shown as SEQ ID NO. 15; the nucleotide sequence of the coding gene is shown as SEQ ID NO. 16.

The nucleic acid construct, the vector and the immune cell can inhibit various tumors, including blood tumors and/or solid tumors.

The traditional Chinese medicine composition has a good inhibiting effect on solid tumors including lung cancer, liver cancer, breast cancer, wilms tumor, glioma, neuroblastoma, melanoma, nasopharyngeal carcinoma, mesothelioma, islet cell tumor, retinoblastoma, pancreatic cancer, uterine myoma, cervical cancer or thyroid cancer, and particularly has a good curative effect on liver cancer and lung cancer.

sGP130 is soluble GP130, containing only the extracellular domain of GP130. It is produced primarily by splicing of mRNA, rather than by hydrolysis of a restriction protein. The research shows that sGP can capture IL-6/sIL-6R complex, prevent the complex from being combined with gp130 on the membrane, and can specifically inhibit non-classical signal transduction pathway, thereby playing a role in inhibiting IL-6 biological activity.

The invention adds the extracellular segment (sGP: 1-558 aa) of GP130, can strongly capture an IL-6/sIL-6R complex (compared with sGP130:1-618 aa), prevents the complex from being combined with GP130 on a membrane, can specifically inhibit a non-classical signal path, and thus plays a role in inhibiting the biological activity of IL-6 for promoting inflammation. In the research and development process, the initial lentiviral expression vector pCDH-CMV-MCS-EF1-EGFP-T2A-Puro is found to respectively express a target gene and GFP by using double promoters, but the phenomenon that the fluorescence expression is possibly more than 90% but the target gene HER2 is less than 10% often occurs, so that the expression vector is optimized and modified, namely the second promoter EF1 is replaced by self-breaking peptide P2A, and the expression level between the target gene and GFP is coupled. In the process of packaging the target plasmid lentivirus, the virus packaging efficiency containing the target gene can be visually observed through the reporter gene GFP, and the NK92 cells after the late lentivirus transfection can be rapidly obtained through continuous screening of puromycin.

In the invention, F2A-sGP130 is placed behind HER2-CD28 TM + ICD-CD3z fragment, so that the normal cell membrane expression and function of the target fragment HER2 are ensured, and the normal release and expression of sGP130 are also ensured.

Compared with the prior art, the invention has the following beneficial effects:

1. according to the invention, the CAR-T cells are simultaneously used in combination with sGP, so that the killing effect on solid tumors is improved, and the in-vivo safety of the CAR-T cells is improved.

2. The test shows that: infecting NK92 cells with the lentivirus obtained by the invention, wherein the expression rate of GFP in sGP-HER 2-CAR cells is about 87.9%, and the expression rate of GFP in CAR-T cells is about 40.4%; the modified sGP-HER 2-CAR-NK92 cell highly expresses HER2 and can be used for treating HER2 related tumors. ELISA detects the expression of sGP130 in the modified cell supernatant, and the sGP content is higher, about 50ng/ml; the combination of IL-6 and a receptor thereof is blocked, and the in vivo safety of the composition is improved; moreover, in vitro cytotoxicity assays showed that sGP-HER 2-CAR-NK92 cells enhanced the killing effect of CAR-T cells on JIMT-1 cells by about 2 times that of CAR-T cells.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, it is obvious that the drawings in the following description are only some embodiments of the present invention, and for those skilled in the art, other drawings can be obtained according to the drawings without creative efforts.

FIG. 1a is a pCDH-CMV-MCS-P2A-EGFP-T2A-Puro lentiviral vector;

FIG. 1b is a schematic diagram of the structure of a nucleic acid construct;

FIG. 2 is a graph showing the results of detection of 293T cells transfected by lentiviruses for 72 hours, wherein a is an inverted microscope observation image, and b is a fluorescence microscope observation image;

FIG. 3 is a graph showing the results of detection of a chimeric antigen receptor by screening a stably expressing cell line by viral transfection of NK92 cells, wherein a is an observation image by an inverted microscope and b is an observation image by a fluorescence microscope;

FIG. 4a is a graph showing the results of detection after lentivirus infects NK92 cells, wherein the dotted line is the parental NK92 cell, and the solid line is sGP-HER 2-CAR-NK92 cell; the abscissa represents the GFP fluorescence intensity (logarithmic value), and the ordinate represents the number of cells;

FIG. 4b is a graph of the results of a test after T cell infection with lentivirus, wherein the dotted line is a parental NK92 cell and the solid line is a HER2-CAR-T cell; the abscissa represents the GFP fluorescence intensity (logarithmic value), and the ordinate represents the number of cells;

FIG. 5 is a graph showing the results of Western-blot detection of HER2-CAR-NK92 and sGP-HER 2-CAR-NK92 cell expression in HER2-FLAG with parental NK92 cell;

FIG. 6 is a graph showing the results of ELISA detection of the expression of sGP in the supernatant of sGP-HER 2-CAR cells and parental NK92 cells;

FIG. 7 is a graph showing the results of measurement of HER2 expression in JIMT-1 cells, wherein the dotted line represents the parent JIMT-1 cell and the solid line represents the JIMT-1 cell of the APC-labeled mouse anti-human HER2 monoclonal antibody;

FIG. 8 is a graph of the effect of sGP on breast cancer JIMT-1 cell P-STAT 3;

FIG. 9 is a graph of the cytotoxicity test results of sGP-HER 2-CAR-NK92 cells in combination with parental NK92 cells CAR-T cells.

Detailed Description

In order to make the objects, technical solutions and advantages of the present invention more apparent, the technical solutions of the present invention will be described in detail below. It should be apparent that the described embodiments are only some embodiments of the present invention, and not all embodiments. All other embodiments, which can be derived by a person skilled in the art from the examples given herein without making any creative effort, shall fall within the protection scope of the present invention.

The reagents or starting materials used in the present invention are commercially available unless otherwise specified.

In some more specific embodiments, a nucleic acid construct encoding a fusion polypeptide for modifying an immune cell, said nucleic acid construct comprising, in sequential linkage: extracellular antigen binding region coding sequence, transmembrane region coding sequence, intracellular signal transduction region coding sequence, and sGP or fusion protein coding sequence thereof.

The fusion protein of soluble GP130 includes but is not limited to: fusion peptide of soluble sGP with Fc, or fusion peptide of soluble sGP with CH3 domain.

Further, the coding sequence of extracellular antigen binding region, transmembrane region and intracellular signal transduction region constitute the coding sequence of the CAR molecule, and the sGP or its fusion protein coding sequence and the coding sequence of the CAR molecule are connected by a cleavage peptide, wherein the cleavage peptide comprises: F2A, T2A, E2A or P2A.

Further, the sGP has an amino acid sequence shown in SEQ ID NO 1; preferably, the nucleotide sequence of the sGP coding gene is shown as SEQ ID NO. 2.

A vector comprising said nucleic acid construct.

An immune cell comprising said nucleic acid construct; the immune cell is an immune effector cell modified by a chimeric antigen receptor and can over-express sGP.

Further, the immune cell is modified with one or more than two CAR molecules.

Preferably, the NK cells include NK cells, memory NK cells and NK cell lines induced in vitro by NK cells or stem cells removed from a human; the T cells include T cells removed from a human or stem cells induced in vitro.

The technical solution of the present invention will be described in further detail below by way of examples with reference to the accompanying drawings. However, the examples are chosen only for the purpose of illustrating the invention and are not to be construed as limiting the scope of the invention.

Example 1 construction of chimeric antigen receptor sGP-HER 2-CAR

Firstly, using PCR to design a primer by taking pACgp67B-Her2 plasmid as a template, and amplifying to obtain an Anti-HER2 ScFv fragment; designing a primer, and obtaining a signal peptide CD8a Leader and a FLAG tag in front of the Anti-HER2 ScFv fragment by multi-step overlap extension PCR. Primers were designed and the transmembrane and intracellular domains of CD28 TM + ICD, CD3 zeta domain were amplified using PCR with human cDNA as template. The CD8 alpha Linker in front of the CD28 TM + ICD is obtained by multi-step overlap extension PCR, then, the CD8 alpha Linker + CD28 TM + ICD and CD3 zeta are taken as templates by overlap extension PCR through an overlap lamp to obtain the CD8 alpha Linker + CD28 TM + ICD + CD3 zeta, and the HER2-CAR fragment is obtained by the overlap extension PCR by taking the CD8a leader + FLAG + Anti-HER2 ScFv and the CD8 alpha Linker + CD28 TM + ICD + CD3 zeta as templates. Designing a primer, amplifying to obtain the extracellular region sGP of GP130 by using human cDNA as a template through PCR, designing the primer, and obtaining the F2A self-cleavage peptide at the front end of the extracellular region of GP130 through multi-step overlap extension PCR. This gave F2A-sGP fragment. Performing overlap extension PCR by using HER2-CAR fragment and F2A-sGP fragment as templates through overlap lamp to obtain sGP-HER 2-CAR fragment, wherein the nucleotide sequence is shown as SEQ ID NO: 3; the total length is 3487bp.

sGP130 has the amino acid sequence shown in SEQ ID NO: 1:

SEQ ID NO:1

PRT: 558

MLTLQTWLVQ ALFIFLTTES TG

ELLDPCGYIS PESPVVQLHS NFTAVCVLKE KCMDYFHVNA NYIVWKTNHF TIPKEQYTII NRTASSVTFT DIASLNIQLT CNILTFGQLE QNVYGITIIS GLPPEKPKNL SCIVNEGKKM RCEWDGGRET HLETNFTLKS EWATHKFADC KAKRDTPTSC TVDYSTVYFV NIEVWVEAEN ALGKVTSDHI NFDPVYKVKP NPPHNLSVIN SEELSSILKL TWTNPSIKSV IILKYNIQYR TKDASTWSQI PPEDTASTRS SFTVQDLKPF TEYVFRIRCM KEDGKGYWSD WSEEASGITY EDRPSKAPSF WYKIDPSHTQ GYRTVQLVWK TLPPFEANGK ILDYEVTLTR WKSHLQNYTV NATKLTVNLT NDRYLATLTV RNLVGKSDAA VLTIPACDFQ ATHPVMDLKA FPKDNMLWVE WTTPRESVKK YILEWCVLSD KAPCITDWQQ EDGTVHRTYL RGNLAESKCY LITVTPVYAD GPGSPESIKA YLKQAPPSKG PTVRTKKVGK NEAVLEWDQL PVDVQNGFIR NYTIFY

sGP130 has the nucleotide sequence shown in SEQ ID NO: 2:

SEQ ID NO:2

DNA: 1674 bp

atgttga cgttgcagac

301 ttggctagtg caagccttgt ttattttcct caccactgaa tctacaggtg aacttctaga

361 tccatgtggt tatatcagtc ctgaatctcc agttgtacaa cttcattcta atttcactgc

421 agtttgtgtg ctaaaggaaa aatgtatgga ttattttcat gtaaatgcta attacattgt

481 ctggaaaaca aaccatttta ctattcctaa ggagcaatat actatcataa acagaacagc

541 atccagtgtc acctttacag atatagcttc attaaatatt cagctcactt gcaacattct

601 tacattcgga cagcttgaac agaatgttta tggaatcaca ataatttcag gcttgcctcc

661 agaaaaacct aaaaatttga gttgcattgt gaacgagggg aagaaaatga ggtgtgagtg

721 ggatggtgga agggaaacac acttggagac aaacttcact ttaaaatctg aatgggcaac

781 acacaagttt gctgattgca aagcaaaacg tgacaccccc acctcatgca ctgttgatta

841 ttctactgtg tattttgtca acattgaagt ctgggtagaa gcagagaatg cccttgggaa

901 ggttacatca gatcatatca attttgatcc tgtatataaa gtgaagccca atccgccaca

961 taatttatca gtgatcaact cagaggaact gtctagtatc ttaaaattga catggaccaa

1021 cccaagtatt aagagtgtta taatactaaa atataacatt caatatagga ccaaagatgc

1081 ctcaacttgg agccagattc ctcctgaaga cacagcatcc acccgatctt cattcactgt

1141 ccaagacctt aaacctttta cagaatatgt gtttaggatt cgctgtatga aggaagatgg

1201 taagggatac tggagtgact ggagtgaaga agcaagtggg atcacctatg aagatagacc

1261 atctaaagca ccaagtttct ggtataaaat agatccatcc catactcaag gctacagaac

1321 tgtacaactc gtgtggaaga cattgcctcc ttttgaagcc aatggaaaaa tcttggatta

1381 tgaagtgact ctcacaagat ggaaatcaca tttacaaaat tacacagtta atgccacaaa

1441 actgacagta aatctcacaa atgatcgcta tctagcaacc ctaacagtaa gaaatcttgt

1501 tggcaaatca gatgcagctg ttttaactat ccctgcctgt gactttcaag ctactcaccc

1561 tgtaatggat cttaaagcat tccccaaaga taacatgctt tgggtggaat ggactactcc

1621 aagggaatct gtaaagaaat atatacttga gtggtgtgtg ttatcagata aagcaccctg

1681 tatcacagac tggcaacaag aagatggtac cgtgcatcgc acctatttaa gagggaactt

1741 agcagagagc aaatgctatt tgataacagt tactccagta tatgctgatg gaccaggaag

1801 ccctgaatcc ataaaggcat accttaaaca agctccacct tccaaaggac ctactgttcg

1861 gacaaaaaaa gtagggaaaa acgaagctgt cttagagtgg gaccaacttc ctgttgatgt

1921 tcagaatgga tttatcagaa attatactat attttat

the amino acid sequence of Anti-HER2 ScFv is shown in SEQ ID NO: 3:

SEQ ID NO:3

PRT: 263

1 Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly

16 Glu Ser Leu Lys Ile Ser Cys Lys Gly Ser Gly Tyr Ser Phe Thr

31 Ser Tyr Trp Ile Ala Trp Val Arg Gln MET Pro Gly Lys Gly Leu

46 Glu Tyr MET Gly Leu Ile Tyr Pro Gly Asp Ser Asp Thr Lys Tyr

61 Ser Pro Ser Phe Gln Gly Gln Val Thr Ile Ser Val Asp Lys Ser

76 Val Ser Thr Ala Tyr Leu Gln Trp Ser Ser Leu Lys Pro Ser Asp

91 Ser Ala Val Tyr Phe Cys Ala Arg His Asp Val Gly Tyr Cys Ser

106 Ser Ser Asn Cys Ala Lys Trp Pro Glu Tyr Phe Gln His Trp Gly

121 Gln Gly Thr Leu Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly

136 Gly Gly Gly Ser Gly Gly Gly Gly Ser Gln Ser Val Leu Thr Gln

151 Pro Pro Ser Val Ser Ala Ala Pro Gly Gln Lys Val Thr Ile Ser

166 Cys Ser Gly Ser Ser Ser Asn Ile Gly Asn Asn Tyr Val Ser Trp

181 Tyr Gln Gln Leu Pro Gly Thr Ala Pro Lys Leu Leu Ile Tyr Asp

196 His Thr Asn Arg Pro Ala Gly Val Pro Asp Arg Phe Ser Gly Ser

211 Lys Ser Gly Thr Ser Ala Ser Leu Ala Ile Ser Gly Phe Arg Ser

226 Glu Asp Glu Ala Asp Tyr Tyr Cys Ala Ser Trp Asp Tyr Thr Leu

241 Ser Gly Trp Val Phe Gly Gly Gly Thr Lys Leu Thr Val Leu Gly

256 Ala Ala Ala Gly Gly Gly Gly Ser

the nucleotide sequence of Anti-HER2 ScFv is shown in SEQ ID NO. 4:

SEQ ID NO:4

DNA: 789 bp

1 CAGGTGCAGC TGGTGCAGTC TGGGGCAGAG GTGAAAAAGC CCGGGGAGTC TCTGAAGATC

61 TCCTGTAAGG GTTCTGGATA CAGCTTTACC AGCTACTGGA TCGCCTGGGT GCGCCAGATG

121 CCCGGGAAAG GCCTGGAGTA CATGGGGCTC ATCTATCCTG GTGACTCTGA CACCAAATAC

181 AGCCCGTCCT TCCAAGGCCA GGTCACCATC TCAGTCGACA AGTCCGTCAG CACTGCCTAC

241 TTGCAATGGA GCAGTCTGAA GCCCTCGGAC AGCGCCGTGT ATTTTTGTGC GAGACATGAC

301 GTGGGATATT GCAGTAGTTC CAACTGCGCA AAGTGGCCTG AATACTTCCA GCATTGGGGC

361 CAGGGCACCC TGGTCACCGT CTCCTCAGGT GGAGGCGGTT CAGGCGGAGG TGGCTCTGGC

421 GGTGGCGGAT CGCAGTCTGT GTTGACGCAG CCGCCCTCAG TGTCTGCGGC CCCAGGACAG

481 AAGGTCACCA TCTCCTGCTC TGGAAGCAGC TCCAACATTG GGAATAATTA TGTATCCTGG

541 TACCAGCAGC TCCCAGGAAC AGCCCCCAAA CTCCTCATCT ATGATCACAC CAATCGGCCC

601 GCAGGGGTCC CTGACCGATT CTCTGGCTCC AAGTCTGGCA CCTCAGCCTC CCTGGCCATC

661 AGTGGGTTCC GGTCCGAGGA TGAGGCTGAT TATTACTGTG CCTCCTGGGA CTACACCCTC

721 TCGGGCTGGG TGTTCGGCGG AGGAACCAAG CTGACCGTCC TAGGTGCGGC CGCCGGCGGA

781 GGAGGATCT

the amino acid sequence of the CD8a Leader is shown as SEQ ID NO: 5:

SEQ ID NO:5

PRT: 21

1 MET Ala Leu Pro Val Thr Ala Leu Leu Leu Pro Leu Ala Leu Leu

16 Leu His Ala Ala Arg Pro

the nucleotide sequence of the CD8a Leader is shown as SEQ ID NO:

SEQ ID NO:6

DNA: 63 bp;

1 ATGGCCTTAC CAGTGACCGC CTTGCTCCTG CCGCTGGCCT TGCTGCTCCA CGCCGCCAGG

61 CCG

the amino acid sequence of the CD8 alpha linker is shown as SEQ ID NO: 7:

SEQ ID NO:7

PRT: 45

1 Thr Thr Thr Pro Ala Pro Arg Pro Pro Thr Pro Ala Pro Thr Ile

16 Ala Ser Gln Pro Leu Ser Leu Arg Pro Glu Ala Cys Arg Pro Ala

31 Ala Gly Gly Ala Val His Thr Arg Gly Leu Asp Phe Ala Cys Asp

the nucleotide sequence of the CD8 alpha linker is shown as SEQ ID NO. 8:

SEQ ID NO:8

DNA: 135 bp;

1 ACCACGACGC CAGCGCCGCG ACCACCAACA CCGGCGCCCA CCATCGCGTC GCAGCCCCTG

61 TCCCTGCGCC CAGAGGCGTG CCGGCCAGCG GCGGGGGGCG CAGTGCACAC GAGGGGGCTG

121 GACTTCGCCT GTGAT

the amino acid sequence of CD28 TM + ICD is shown in SEQ ID NO: 9:

SEQ ID NO:9

PRT: 68

1 Phe Trp Val Leu Val Val Val Gly Gly Val Leu Ala Cys Tyr Ser

16 Leu Leu Val Thr Val Ala Phe Ile Ile Phe Trp Val Arg Ser Lys

31 Arg Ser Arg Leu Leu His Ser Asp Tyr MET Asn MET Thr Pro Arg

46 Arg Pro Gly Pro Thr Arg Lys His Tyr Gln Pro Tyr Ala Pro Pro

61 Arg Asp Phe Ala Ala Tyr Arg Ser

the nucleotide sequence of CD28 TM + ICD is shown in SEQ ID NO: 10:

SEQ ID NO:10

DNA: 204 bp;

1 TTTTGGGTGC TGGTGGTGGT TGGTGGAGTC CTGGCTTGCT ATAGCTTGCT AGTAACAGTG

61 GCCTTTATTA TTTTCTGGGT GAGGAGTAAG AGGAGCAGGC TCCTGCACAG TGACTACATG

121 AACATGACTC CCCGCCGCCC CGGGCCCACC CGCAAGCATT ACCAGCCCTA TGCCCCACCA

181 CGCGACTTCG CAGCCTATCG CTCC

the amino acid sequence of CD3 zeta is shown in SEQ ID NO: 11:

SEQ ID NO:11

PRT: 113

1 Arg Val Lys Phe Ser Arg Ser Ala Asp Ala Pro Ala Tyr Gln Gln

16 Gly Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu Gly Arg Arg Glu

31 Glu Tyr Asp Val Leu Asp Lys Arg Arg Gly Arg Asp Pro Glu MET

46 Gly Gly Lys Pro Gln Arg Arg Lys Asn Pro Gln Glu Gly Leu Tyr

61 Asn Glu Leu Gln Lys Asp Lys MET Ala Glu Ala Tyr Ser Glu Ile

76 Gly MET Lys Gly Glu Arg Arg Arg Gly Lys Gly His Asp Gly Leu

91 Tyr Gln Gly Leu Ser Thr Ala Thr Lys Asp Thr Tyr Asp Ala Leu

106 His MET Gln Ala Leu Pro Pro Arg

the nucleotide sequence of CD3 zeta is shown in SEQ ID NO: 12:

SEQ ID NO:12

DNA: 339 bp

1 AGAGTGAAGT TCAGCAGGAG CGCAGACGCC CCCGCGTACC AGCAGGGCCA GAACCAGCTC

61 TATAACGAGC TCAATCTAGG ACGAAGAGAG GAGTACGATG TTTTGGACAA GAGACGTGGC

121 CGGGACCCTG AGATGGGGGG AAAGCCGCAG AGAAGGAAGA ACCCTCAGGA AGGCCTGTAC

181 AATGAACTGC AGAAAGATAA GATGGCGGAG GCCTACAGTG AGATTGGGAT GAAAGGCGAG

241 CGCCGGAGGG GCAAGGGGCA CGATGGCCTT TACCAGGGTC TCAGTACAGC CACCAAGGAC

301 ACCTACGACG CCCTTCACAT GCAGGCCCTG CCCCCTCGC

the amino acid sequence of F2A is shown in SEQ ID NO: 13:

SEQ ID NO:13

PRT: 25

1 Gly Ser Gly Val Lys Gln Thr Leu Asn Phe Asp Leu Leu Lys Leu

16 Ala Gly Asp Val Glu Ser Asn Pro Gly Pro

the nucleotide sequence of F2A is shown in SEQ ID NO: 14:

SEQ ID NO:14

DNA: 75 bp

1 GGAAGCGGAG TGAAACAGAC TTTGAATTTT GACCTTCTCA AGTTGGCGGG AGACGTGGAG

61 TCCAACCCTG GACCT

the amino acid sequence of FLAG is shown in SEQ ID NO: 15:

SEQ ID NO:15

PRT: 8

DYKDDDDK

the nucleotide sequence of FLAG is shown as SEQ ID NO: 16:

SEQ ID NO:16

DNA:24bp

1 GACTACAAAG ACGATGACGA CAAG

the nucleotide sequence of HER2-CAR is shown in SEQ ID NO: 17:

SEQ ID NO:17

DNA: 1575

GCTCTAGAGCCACCATGGCCTTACCAGTGACCGCCTTGCTCCTGCCGCTGGCCTTGCTGCTCCACGCCGCCAGGCCGGACTACAAAGACGATGACGACAAGCAGGTGCAGCTGGTGCAGTCTGGGGCAGAGGTGAAAAAGCCCGGGGAGTCTCTGAAGATCTCCTGTAAGGGTTCTGGATACAGCTTTACCAGCTACTGGATCGCCTGGGTGCGCCAGATGCCCGGGAAAGGCCTGGAGTACATGGGGCTCATCTATCCTGGTGACTCTGACACCAAATACAGCCCGTCCTTCCAAGGCCAGGTCACCATCTCAGTCGACAAGTCCGTCAGCACTGCCTACTTGCAATGGAGCAGTCTGAAGCCCTCGGACAGCGCCGTGTATTTTTGTGCGAGACATGACGTGGGATATTGCAGTAGTTCCAACTGCGCAAAGTGGCCTGAATACTTCCAGCATTGGGGCCAGGGCACCCTGGTCACCGTCTCCTCAGGTGGAGGCGGTTCAGGCGGAGGTGGCTCTGGCGGTGGCGGATCGCAGTCTGTGTTGACGCAGCCGCCCTCAGTGTCTGCGGCCCCAGGACAGAAGGTCACCATCTCCTGCTCTGGAAGCAGCTCCAACATTGGGAATAATTATGTATCCTGGTACCAGCAGCTCCCAGGAACAGCCCCCAAACTCCTCATCTATGATCACACCAATCGGCCCGCAGGGGTCCCTGACCGATTCTCTGGCTCCAAGTCTGGCACCTCAGCCTCCCTGGCCATCAGTGGGTTCCGGTCCGAGGATGAGGCTGATTATTACTGTGCCTCCTGGGACTACACCCTCTCGGGCTGGGTGTTCGGCGGAGGAACCAAGCTGACCGTCCTAGGTGCGGCCGCCGGCGGAGGAGGATCTACCACGACGCCAGCGCCGCGACCACCAACACCGGCGCCCACCATCGCGTCGCAGCCCCTGTCCCTGCGCCCAGAGGCGTGCCGGCCAGCGGCGGGGGGCGCAGTGCACACGAGGGGGCTGGACTTCGCCTGTGATTTTTGGGTGCTGGTGGTGGTTGGTGGAGTCCTGGCTTGCTATAGCTTGCTAGTAACAGTGGCCTTTATTATTTTCTGGGTGAGGAGTAAGAGGAGCAGGCTCCTGCACAGTGACTACATGAACATGACTCCCCGCCGCCCCGGGCCCACCCGCAAGCATTACCAGCCCTATGCCCCACCACGCGACTTCGCAGCCTATCGCTCCAGAGTGAAGTTCAGCAGGAGCGCAGACGCCCCCGCGTACCAGCAGGGCCAGAACCAGCTCTATAACGAGCTCAATCTAGGACGAAGAGAGGAGTACGATGTTTTGGACAAGAGACGTGGCCGGGACCCTGAGATGGGGGGAAAGCCGCAGAGAAGGAAGAACCCTCAGGAAGGCCTGTACAATGAACTGCAGAAAGATAAGATGGCGGAGGCCTACAGTGAGATTGGGATGAAAGGCGAGCGCCGGAGGGGCAAGGGGCACGATGGCCTTTACCAGGGTCTCAGTACAGCCACCAAGGACACCTACGACGCCCTTCACATGCAGGCCCTGCCCCCTCGCGAATTCC

sGP130-HER2-CAR the nucleotide sequence is shown in SEQ ID NO: 18:

SEQ ID NO:18

DNA: 3324

GCTCTAGAGCCACCATGGCCTTACCAGTGACCGCCTTGCTCCTGCCGCTGGCCTTGCTGCTCCACGCCGCCAGGCCGGACTACAAAGACGATGACGACAAGCAGGTGCAGCTGGTGCAGTCTGGGGCAGAGGTGAAAAAGCCCGGGGAGTCTCTGAAGATCTCCTGTAAGGGTTCTGGATACAGCTTTACCAGCTACTGGATCGCCTGGGTGCGCCAGATGCCCGGGAAAGGCCTGGAGTACATGGGGCTCATCTATCCTGGTGACTCTGACACCAAATACAGCCCGTCCTTCCAAGGCCAGGTCACCATCTCAGTCGACAAGTCCGTCAGCACTGCCTACTTGCAATGGAGCAGTCTGAAGCCCTCGGACAGCGCCGTGTATTTTTGTGCGAGACATGACGTGGGATATTGCAGTAGTTCCAACTGCGCAAAGTGGCCTGAATACTTCCAGCATTGGGGCCAGGGCACCCTGGTCACCGTCTCCTCAGGTGGAGGCGGTTCAGGCGGAGGTGGCTCTGGCGGTGGCGGATCGCAGTCTGTGTTGACGCAGCCGCCCTCAGTGTCTGCGGCCCCAGGACAGAAGGTCACCATCTCCTGCTCTGGAAGCAGCTCCAACATTGGGAATAATTATGTATCCTGGTACCAGCAGCTCCCAGGAACAGCCCCCAAACTCCTCATCTATGATCACACCAATCGGCCCGCAGGGGTCCCTGACCGATTCTCTGGCTCCAAGTCTGGCACCTCAGCCTCCCTGGCCATCAGTGGGTTCCGGTCCGAGGATGAGGCTGATTATTACTGTGCCTCCTGGGACTACACCCTCTCGGGCTGGGTGTTCGGCGGAGGAACCAAGCTGACCGTCCTAGGTGCGGCCGCCGGCGGAGGAGGATCTACCACGACGCCAGCGCCGCGACCACCAACACCGGCGCCCACCATCGCGTCGCAGCCCCTGTCCCTGCGCCCAGAGGCGTGCCGGCCAGCGGCGGGGGGCGCAGTGCACACGAGGGGGCTGGACTTCGCCTGTGATTTTTGGGTGCTGGTGGTGGTTGGTGGAGTCCTGGCTTGCTATAGCTTGCTAGTAACAGTGGCCTTTATTATTTTCTGGGTGAGGAGTAAGAGGAGCAGGCTCCTGCACAGTGACTACATGAACATGACTCCCCGCCGCCCCGGGCCCACCCGCAAGCATTACCAGCCCTATGCCCCACCACGCGACTTCGCAGCCTATCGCTCCAGAGTGAAGTTCAGCAGGAGCGCAGACGCCCCCGCGTACCAGCAGGGCCAGAACCAGCTCTATAACGAGCTCAATCTAGGACGAAGAGAGGAGTACGATGTTTTGGACAAGAGACGTGGCCGGGACCCTGAGATGGGGGGAAAGCCGCAGAGAAGGAAGAACCCTCAGGAAGGCCTGTACAATGAACTGCAGAAAGATAAGATGGCGGAGGCCTACAGTGAGATTGGGATGAAAGGCGAGCGCCGGAGGGGCAAGGGGCACGATGGCCTTTACCAGGGTCTCAGTACAGCCACCAAGGACACCTACGACGCCCTTCACATGCAGGCCCTGCCCCCTCGCGGAAGCGGAGTGAAACAGACTTTGAATTTTGACCTTCTCAAGTTGGCGGGAGACGTGGAGTCCAACCCTGGACCTATGTTGACGTTGCAGACTTGGCTAGTGCAAGCCTTGTTTATTTTCCTCACCACTGAATCTACAGGTGAACTTCTAGATCCATGTGGTTATATCAGTCCTGAATCTCCAGTTGTACAACTTCATTCTAATTTCACTGCAGTTTGTGTGCTAAAGGAAAAATGTATGGATTATTTTCATGTAAATGCTAATTACATTGTCTGGAAAACAAACCATTTTACTATTCCTAAGGAGCAATATACTATCATAAACAGAACAGCATCCAGTGTCACCTTTACAGATATAGCTTCATTAAATATTCAGCTCACTTGCAACATTCTTACATTCGGACAGCTTGAACAGAATGTTTATGGAATCACAATAATTTCAGGCTTGCCTCCAGAAAAACCTAAAAATTTGAGTTGCATTGTGAACGAGGGGAAGAAAATGAGGTGTGAGTGGGATGGTGGAAGGGAAACACACTTGGAGACAAACTTCACTTTAAAATCTGAATGGGCAACACACAAGTTTGCTGATTGCAAAGCAAAACGTGACACCCCCACCTCATGCACTGTTGATTATTCTACTGTGTATTTTGTCAACATTGAAGTCTGGGTAGAAGCAGAGAATGCCCTTGGGAAGGTTACATCAGATCATATCAATTTTGATCCTGTATATAAAGTGAAGCCCAATCCGCCACATAATTTATCAGTGATCAACTCAGAGGAACTGTCTAGTATCTTAAAATTGACATGGACCAACCCAAGTATTAAGAGTGTTATAATACTAAAATATAACATTCAATATAGGACCAAAGATGCCTCAACTTGGAGCCAGATTCCTCCTGAAGACACAGCATCCACCCGATCTTCATTCACTGTCCAAGACCTTAAACCTTTTACAGAATATGTGTTTAGGATTCGCTGTATGAAGGAAGATGGTAAGGGATACTGGAGTGACTGGAGTGAAGAAGCAAGTGGGATCACCTATGAAGATAGACCATCTAAAGCACCAAGTTTCTGGTATAAAATAGATCCATCCCATACTCAAGGCTACAGAACTGTACAACTCGTGTGGAAGACATTGCCTCCTTTTGAAGCCAATGGAAAAATCTTGGATTATGAAGTGACTCTCACAAGATGGAAATCACATTTACAAAATTACACAGTTAATGCCACAAAACTGACAGTAAATCTCACAAATGATCGCTATCTAGCAACCCTAACAGTAAGAAATCTTGTTGGCAAATCAGATGCAGCTGTTTTAACTATCCCTGCCTGTGACTTTCAAGCTACTCACCCTGTAATGGATCTTAAAGCATTCCCCAAAGATAACATGCTTTGGGTGGAATGGACTACTCCAAGGGAATCTGTAAAGAAATATATACTTGAGTGGTGTGTGTTATCAGATAAAGCACCCTGTATCACAGACTGGCAACAAGAAGATGGTACCGTGCATCGCACCTATTTAAGAGGGAACTTAGCAGAGAGCAAATGCTATTTGATAACAGTTACTCCAGTATATGCTGATGGACCAGGAAGCCCTGAATCCATAAAGGCATACCTTAAACAAGCTCCACCTTCCAAAGGACCTACTGTTCGGACAAAAAAAGTAGGGAAAAACGAAGCTGTCTTAGAGTGGGACCAACTTCCTGTTGATGTTCAGAATGGATTTATCAGAAATTATACTATATTTTATGAATTCC

example 2: preparation method of chimeric antigen receptor recombinant expression vector

The HER2-CAR fragment, sGP-HER 2-CAR fragment in example 1 were ligated to pCDH-CMV-MCS-P2A-EGFP-T2A-Puro lentiviral vectors via homologous recombination, respectively, to obtain recombinant lentiviral vectors HER2-CAR-pCDH and sGP-HER 2-CAR-pCDH.

The structure is shown in figure 1, the complete lentivirus plasmid is sequenced, and the sequencing result proves that the sequence is correct and is consistent with the expected sequence of each fragment. The lentiviral vector starts all target fragments at the downstream by the CMV promoter, and the condition of uneven gene expression does not exist. The expression of GFP, the tolerance of puromycin to be screened and the expression of target genes are basically consistent.

Example 3: preparation method of high-cytotoxicity anti-tumor NK92 cells

In this example, highly cytotoxic anti-tumor NK92 cells were obtained by a lentivirus infection method, which was prepared by the following steps:

1. lentivirus packaging plasmid and transformation and extraction of target plasmid

Mu.g each of the recombinant lentiviral vector obtained in example 2, the helper vector psPAX2 and the helper vector pMD2.G was added to the competent cell DH 5. Alpha. And mixed well, followed by incubation with ice for 30min, heat shock at 42 ℃ for 90s, and ice bath for 2min. Then, 500. Mu.L of LB medium was added thereto, and shaking culture was carried out at 37 ℃ for 40min at 220 rpm. After the culture is finished, 200 mu L of bacterial liquid is taken and respectively coated on LB solid medium (containing 50 mu g/mL ampicillin solution, added according to the proportion of 1: 1000), the mixture is placed upright for 10min, inverted and cultured in a constant temperature incubator at 37 ℃ for 8-16 h, and the growth condition of bacterial colonies is observed in the period.

The single colony in the LB solid medium was picked up, inoculated into 5mL LB medium (containing 5 u L50 u g/mL ampicillin solution), placed in 37 ℃ shaking table, and cultured for 8h with 220rpm/min shaking, the bacterial liquid was turbid. Respectively taking 200 mu L of bacterial liquid, respectively inoculating the bacterial liquid into 200mL of LB culture medium (containing 200 mu L of ampicillin solution with the concentration of 50 mu g/mL), placing the bacterial liquid in a shaking table at 37 ℃, carrying out shaking culture at 220rpm/min for 12-16h, detecting the OD value of the bacterial liquid by using a spectrophotometer, extracting plasmids by using an OMEGA endotoxin-free plasmid large-extraction kit (purchased from Omega biotech company in America and with the product model of D6926-03) after the OD value of the bacterial liquid is between 1.5 and 2, and determining the concentration and purity of target plasmids and packaging plasmids, and storing at-20 ℃.

2. Lentiviral packaging

When 293T cells were cultured to reach a density of 80% -90%, the recombinant lentiviral vector, the helper vector psPAX2, and the helper vector pmd2.G were transfected into 293T cells at a mass ratio of 4. Viral supernatants were collected from transfections for 48h and 72 h. The expression of GFP under a fluorescence microscope is shown in FIG. 2, where a is a white light map and b is a fluorescence map. The white light a picture shows that the cell state is good, and the fluorescence picture b shows that the slow virus packaging efficiency is high and the fluorescence expression is good. All the collected virus supernatants were centrifuged at 4 ℃ for 4000g and 10min to remove cell debris, and then filtered through a 0.45 μm sterile filter, and sterilized PEG8000 (supernatant volume: PEG8000 volume = 4:1) was added thereto, mixed well, and left overnight at 4 ℃. The next day, concentration was carried out by centrifugation at 4 ℃ and 4000g for 30min, the supernatant was discarded, precooled PBS was added, the virus was resuspended, split-packaged and stored at-80 ℃ and during the lentivirus production process, the whole process was completed on ice.

3. Lentiviral infection of NK92 cells

Taking 3-5X 10 ⁵ And inoculating each hole of NK92 cells into a 24-hole plate, adding concentrated virus solution 10 mu l/hole (MOI = 80), adding polybrene with the final concentration of 8 mu g/mL into each hole, uniformly mixing, placing in an incubator at 37 ℃ for culture, centrifuging after 12-15h, and replacing a fresh culture medium for continuous culture. And after infection for 72h, observing fluorescence under a fluorescence microscope, after the fluorescence is normally expressed, adding puromycin (500-1500 ng/ml) in gradient along with subsequent culture, and screening for 2 weeks to obtain a cell strain stably expressing the target gene. The expression of GFP was observed under a fluorescent microscope.

The results are shown in FIG. 3, where a is a white light map and b is a fluorescence map. As can be seen from the white light image a, the NK92 cells are in a clustering state, which indicates that the cell state is good, and as can be seen from the fluorescence image b, basically 80-90% of the cells express fluorescence, which indicates that the construction of the stable transgenic cell strain stably expressing the target gene is successful.

Example 4: preparation method of high-cytotoxicity anti-tumor CAR-T cell

1. Preparation of T cells

Firstly, taking 5-10ml of peripheral blood, diluting the blood sample with 1:1 by PBS in a 50ml centrifuge tube, taking 3ml of lymphocyte separating medium (protected from light) and adding the lymphocyte separating medium into a 15ml centrifuge tube, wherein the step needs to incline the centrifuge tube containing the lymphocyte separating medium by 45 degrees, slowly adding the blood sample diluted by the same volume along the tube wall, cutting the liquid level of the lymphocyte separating medium without breaking, slowly placing the blood sample into a horizontal centrifuge after adding, and centrifuging for 30min at room temperature and 500 g. After taking out, the liquid surface will be layered, carefully taking out the middle white membrane layer to a new 15ml centrifuge tube, adding 12ml PBS for resuspension, centrifuging for 10min at room temperature of 500g, discarding the supernatant, adding 10ml PBS again for resuspension, and centrifuging for 10min at room temperature of 500 g. Suspending the cells with a culture medium of 1640+10% fetal bovine serum to obtain a mononuclear cell suspension. Counting cells, taking 1 million mononuclear cells to a 24-well plate, adding 1000U IL2, adding 30 mu l/ml of Human T Activator CD3/CD28 TM + ICD magnetic beads, activating T cells, removing the magnetic beads by using a magnetic frame after the cells are activated for 2-3 days, adding 300U IL2, and performing amplification culture for subsequent experiments.

2. Preparation of CAR-T cells

2.1. Transformation and extraction of lentiviral packaging plasmids and plasmids of interest were as described in example 3, 1.

2.2. The lentivirus packaging procedure was as described in example 3, 2.

2.3. Lentiviral infection of T cells

Taking 5X 10 ⁵ Each well of T cells was seeded in a 24-well plate, and 30 μ l/well (MOI = 80) of concentrated HER2-CAR virus solution was added, and the culture was performed in an incubator at 37 ℃, centrifuged after 12 to 15 hours, and the culture was continued by replacing fresh medium. After 72h of infestation, fluorescence was observed under a fluorescence microscope. After fluorescent expression is normal, the resulting CAR-T cells can be used directly in subsequent experiments.

Example 5: flow cytometry detection of GFP expression in stably transfected NK92 cells and transfected T cells

The lentivirus obtained in example 3 was used to infect NK92 cells (sGP-HER 2-CAR) and parental NK92 cells, lentivirus-transfected T cells (CAR-T) and parental T cells, counted and cell density 1X 10 ⁶ And (4) washing the cells per ml for 2-3 times by using PBS (phosphate buffer solution) containing 2% fetal bovine serum, and then resuspending the cells by using 400 mu L of washing buffer solution to obtain cell suspension. And (6) performing detection on the machine.

The sGP-HER 2-CAR cell suspension and parental NK92 cell suspension, and CAR-T cell suspension and parental T cell suspension were respectively detected and analyzed by a flow cytometer, and the results are shown in fig. 4a and 4b, wherein the abscissa indicates GFP fluorescence intensity (logarithmic value) and the ordinate indicates the number of cells, fig. 4a is a detection result graph after NK92 cells are infected with lentiviruses, wherein the dotted line indicates the parental NK92 cells, and the solid line indicates sGP-HER 2-CAR-NK92 cells, and the detection result indicates that the expression rate of GFP in sGP-HER 2-CAR-NK92 cells is about 87.9%;

FIG. 4b is a graph showing the results of the assay after T cells are infected with lentivirus, wherein the dotted line is the parental NK92 cell and the solid line is HER2-CAR-T cell, and the assay shows that the expression of GFP in CAR-T cells is about 40.4%.

Example 6: western blot detection of expression of HER2 protein in stably transfected NK92 cells

1. Taking 1 million NK92 and sGP-HER 2-CAR-NK92 cell strains in logarithmic phase, adding precooled PBS to wash twice, adding 200 mu L of loading buffer to each hole, cracking for 30min on ice, collecting samples, and boiling for 15 min in boiling water.

2. And 8% of lower layer separation glue and 4% of lower layer concentrated glue are prepared.

3. Adding 6-8 μ L of cell protein sample into each well, performing electrophoresis detection by using protein marker as a control, transferring the protein onto an NC membrane, performing temperature blocking for 1h by using a quick blocking solution, performing overnight incubation at the primary antibody temperature of 4 ℃, washing for 5 times by using TBST (tert-butyl-tert-butyl ether) for 5min each time, performing room temperature incubation for 1h by using secondary antibody, and washing for 5 times by using TBST for 5min each time.

4. And (6) developing.

The detection results are shown in FIG. 5; as can be seen from the figure, compared with the parental NK92 cell and the empty vector, the HER2-FLAG is highly expressed on sGP-HER 2-CAR-NK92 cell and HER2-CAR-NK92 cell which are stably screened by antibiotics, and the over-expression of HER2 by the modified NK92 cell is successful; wherein sGP-HER 2-CAR-NK92 cells over-express HER2 with better effect, and have more obvious killing effect on tumor cells.

Example 7: ELISA detection of expression of sGP130 in modified cell supernatant

Taking NK92 and sGP-HER 2-CAR-NK92 cells in logarithmic growth phase, inoculating the cells into a 6-well plate, and ensuring that each well is 1 multiplied by 10 ⁶ Each cell, each cell provided with 2 auxiliary wells, placing in 5% CO ₂ And culturing in an incubator at 37 ℃ for 48 hours. After the culture, cell culture supernatant was collected.

Preparing a standard product: prepare 7 EP tubes of 1.5ml, numbered 1-7, aspirate 500. Mu.l of stock solution (16 ng/ml standard), add to tube 1, add 500. Mu.l of standard dilution to tube 2-7, aspirate 500. Mu.l of standard stock solution from tube 1 and add to tube 2, and so on, with tube 7 having a final concentration of 0 pg/ml. Seven concentrations of standard were provided with 2 secondary wells.

Preparing a washing Solution, adding 200 mu l of a pore plate, washing for 5 times, adding a standard substance and a sample into the pore plate at the same time, incubating at room temperature for 3 h, discarding liquid in the pore plate, washing the pore plate for 5 times by using a discharging gun, washing the pore plate for 5 times by 30 s each time, adding 200 mu l of Human sgp130 Conjugate into each pore, incubating at room temperature for 2h, discarding liquid in the pore plate, washing for 5 times, adding 200 mu l of Substrate Solution into each pore, incubating at room temperature in a dark place for 30min, discarding liquid in the pore plate, washing for 5 times, adding 50 mu l of stop Solution into each pore, immediately detecting on a machine, and measuring the light absorption value at the position of nm respectively.

The result is shown in figure 6, after 1 million cells are cultured for 48 hours, the content of sGP in the supernatant of sGP-HER 2-CAR-NK92 cells is about 50ng/ml, the combination of IL-6 and the receptor thereof is blocked more effectively, and cytokine storm (CRS) generated in the CAR-T cell treatment process is relieved; parental NK92 cells or unloaded cells were essentially free of release.

Example 8: flow cytometry detection of breast cancer cell JIMT-1 cell surface HER2 expression

Taking JIMT-1 cell strain of logarithmic growth phase, counting, and making cell density be 1 × 10 ⁶ And washing the cells/ml with PBS (phosphate buffer solution) containing 2% fetal calf serum for 2-3 times, adding the mouse anti-human HER2 monoclonal antibody marked by the APC (immunoglobulin C) under a 100 mu L system, incubating the cells on ice for 30min in a dark place, and washing the cells for 2-3 times by using wash buffer. Finally, 400. Mu.L of PBS is added to resuspend the cells, and the cells are tested on a machine.

The results are shown in fig. 7, with the abscissa representing HER2 fluorescence intensity (logarithmic value) and the ordinate representing the number of cells. The results of the examination showed that the HER2 expression rate on the surface of JIMT-1 cells was about 99.8%, and the expression was almost complete.

Example 9: western blot detection of influence of sGP130 on breast cancer JIMT-1 cell P-STAT3

1. 20 ten thousand JIMT-1 cell strains in the logarithmic growth phase are taken and planted into a 6-well plate, IL6 (10 ng/ml) and IL6/sIL6R (10 ng/ml) cytokines are added when the cells adhere to the wall, and 1ml of sGP130 supernatant (the final concentration is 25 ng/ml) is simultaneously added, and 24 h is co-cultured. 200 μ L of loading buffer was added to each well and lysed on ice for 30min, and samples were collected and boiled in boiling water for 15 min.

2. And preparing 8% of lower layer separation glue and 4% of lower layer concentrated glue.

4. And (6) developing.

The detection results are shown in FIG. 8; as can be seen from the figure, compared with NK 92-empty carrier supernatant, the sGP-HER 2-CAR-NK92 cell supernatant subjected to antibiotic stable screening contains sGP, which can inhibit the signal of the non-classical signal pathway of IL6/sIL6R from descending, and directly leads to the reduction of the phosphorylation level of downstream signal STAT 3. Thus, the cell culture supernatant containing sGP130 can obviously antagonize the down-transmission of IL6 signaling pathway.

Example 10: in vitro cytotoxicity assay

1. Cell preparation

Inoculating the breast cancer cell JIMT-1-Luc with transformed luciferase in logarithmic growth phase into a 96-well plate to ensure that each well is 1 × 10 ⁴ Each cell, each cell was provided with 3 subpores, was subjected to 5% CO ₂ And cultured overnight in an incubator at 37 ℃.

2. Experimental groups

The experimental groups are set to be 4 groups, 2 ten thousand CAR-T cells with the same concentration are added into each group, the first group is a blank group, 2 ten thousand NK92 cells are added into the second group, 2 ten thousand HER2-CAR-NK92 cells are added into the third group, and 2 ten thousand sGP-HER 2-CAR-NK92 cells are added into the fourth group. 3 sets of controls, target cell control wells, sample maximal enzyme activity control wells (target cell wells not treated with effector cells for subsequent lysis) were also set together, with a total volume of 100. Mu.L per well.

3. Luciferase assay

ONE-Glo was used in this experiment ^TM The Luciferase Assay System Promega performed the Assay. The effector cells and the target cells are placed in 5% CO ₂ And incubating for 6h in an incubator at 37 ℃. 1h before the predetermined time point, the 96-well plate was removed from the cell incubator, and lysine Solution (10X) was added to the "sample maximum enzyme activity control well" in an amount of 10% of the volume of the original culture Solution. Adding lysine Solution, repeatedly beating and uniformly mixing, and then continuously putting into an incubator for culture. After reaching the co-incubation time, adding the detection solutionAnd (4) detecting on a microplate reader. Cytotoxicity (%) = (RLU min-RLU sample)/(RLU min-RLU max) × 100.

The results obtained by calculation are shown in FIG. 9, and the killing effect of CAR-T cells on JIMT-1 cells is correspondingly enhanced after addition of NK92 cells, HER2-CAR-NK92 cells and sGP-HER 2-CAR-NK92 cells. Wherein sGP-HER 2-CAR-NK92 cells have the most obvious killing effect on JIMT-1 cells, and the killing effect of CAR-T cells on JIMT-1 cells is enhanced by about 2 times.

The above description is only for the specific embodiments of the present invention, but the scope of the present invention is not limited thereto, and any person skilled in the art can easily conceive of the changes or substitutions within the technical scope of the present invention, and all the changes or substitutions should be covered within the scope of the present invention. Therefore, the protection scope of the present invention shall be subject to the protection scope of the appended claims.

Claims

1. A nucleic acid construct comprising, in sequential association: extracellular antigen binding region coding sequence, transmembrane region coding sequence, intracellular signal transduction region coding sequence, and sGP or fusion protein coding sequence thereof.

2. The nucleic acid construct of claim 1, wherein the extracellular antigen-binding region coding sequence, the transmembrane region, and the intracellular signaling region coding sequence comprise a CAR molecule coding sequence, and wherein the sGP, or fusion protein coding sequence thereof, and the CAR molecule coding sequence are linked by a cleavage peptide comprising: F2A, T2A, E2A or P2A.

3. The nucleic acid construct of claim 2, wherein the extracellular antigen-binding region recognizes any tumor specific or associated antigen, including HER2, ephA2, GD2, epCAM, PD-1, PD-L1, leY, CEA, EGFR, GPC3, mesothelin, CD19, CD20, ASGPR1, EGFRvIII, de4EGFR, NY-ESO-1, mage4, cd19, caix, cd123, CD33, IL13R, LMP1, PLAC1, MUC16; the transmembrane region and the intracellular signal transduction region are selected from any one of CD8, CD28 TM + ICD, 4-1BB, DAP10, DAP12, NKG2D, DNAM and CD3 zeta or the combination of intracellular domains of at least two molecules.

4. The nucleic acid construct of any of claims 1-3, wherein sGP comprises amino acids 1-558aa, the amino acid sequence set forth in SEQ ID NO: 1; preferably, the nucleotide sequence of the sGP coding gene is shown as SEQ ID NO. 2.

5. The nucleic acid construct of claim 2 or 3, wherein a FLAG, his or HA tag is added to the coding sequence of the extracellular antigen-binding region to facilitate detection of expression of the gene of interest.

6. A vector comprising the nucleic acid construct of any one of claims 1-5.

7. An immune cell comprising the nucleic acid construct of any of claims 2-5, wherein the immune cell is modified with one or more CAR molecules; the immune cells overexpress sGP.

8. The immune cell of claim 1 or 2, wherein the immune cell is selected from any one of NK cells, T cells, B cells, macrophages, or a combination of at least two thereof; preferably, the NK cells include NK cells, memory NK cells and NK cell lines induced in vitro from NK cells or stem cells removed from a human; the T cells comprise T cells which are extracted from a human body or induced in vitro by stem cells; preferably, the T cells are CD4+ T cells, CD8+ T cells, NKT cells, and memory T cells.

9. A method of preparing an immune cell of claim 7 or 8, comprising: transferring the nucleic acid construct of any of claims 1-5 into an immune effector cell.

10. Use of a nucleic acid construct according to any of claims 1 to 5, a vector according to claim 6, an immune cell according to claim 7 or 8 for the preparation of a medicament for inhibiting tumor cells or for use in immunotherapy of tumor cells.