CN115605590A - Method for preparing site-directed modified long-chain DNA - Google Patents

Method for preparing site-directed modified long-chain DNA Download PDF

Info

Publication number
CN115605590A
CN115605590A CN202180001883.6A CN202180001883A CN115605590A CN 115605590 A CN115605590 A CN 115605590A CN 202180001883 A CN202180001883 A CN 202180001883A CN 115605590 A CN115605590 A CN 115605590A
Authority
CN
China
Prior art keywords
dna
strand
chain
group
long
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202180001883.6A
Other languages
Chinese (zh)
Inventor
刘冬生
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Tsinghua University
Original Assignee
Tsinghua University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Tsinghua University filed Critical Tsinghua University
Publication of CN115605590A publication Critical patent/CN115605590A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA

Landscapes

  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • Organic Chemistry (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Biochemistry (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Molecular Biology (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

Provided is a method for preparing a long-chain DNA, comprising: a synthesis step, an annealing step, and a ligation step. According to the method, through the design of the DNA fragments in the first chain and the second chain, chemical modification of any precise site in the long-chain DNA can be realized, so that the long-chain DNA obtains performances such as improved stability and immunogenicity. The method can obtain the double-stranded DNA assembly formed by complementing the continuous single-stranded DNA and the fragmented single-stranded DNA, and the double-stranded DNA assembly can obtain the single-stranded long-stranded DNA only by simple denaturation, thereby effectively simplifying the conventional long-stranded DNA synthesis steps, improving the synthesis efficiency and being suitable for industrial large-scale preparation.

Description

Method for preparing site-directed modified long-chain DNA Technical Field
The disclosure belongs to the field of molecular biology and synthetic biology, and particularly relates to a method for preparing long-chain DNA and the prepared long-chain DNA.
Background
DNA molecules play a crucial role in the field of life sciences as carriers of genetic information. Most biological studies and bioengineering require the involvement of DNA molecules of varying lengths, including oligonucleotides and longer constructs, such as synthetic genes, chromosomes, and the like [1,2] . In addition, DNA molecules can be used for supramolecular polymerization [3] Nano technology [4] And information storage [5] And the like. Therefore, the economical and efficient synthesis of DNA molecules is an important issue in the field of life sciences.
The vast majority of the current commercial DNA synthesis is based on solid phase phosphoramidite synthesis [6,7] The method comprises four steps of deprotection, coupling, capping and oxidation to form a cycle, and DNA single strands with specific sequences can be obtained by adding different four monomers in each cycle. However, due to the limitation of chemical reaction efficiency, the synthesis yield of DNA decreases with the increase of the number of bases, and when the number of bases is large, the flexibility of DNA chains increases to cause chain entanglement, which further decreases the synthesis efficiency, and the limit of the current solid phase phosphoramidite synthesis method is 200-300 bases [8] . In addition, the method takes a long time, and each base is added with four steps of deprotection, coupling, capping and oxidation, and the reaction of each step needs about 10 minutes.
To achieve the synthesis of long strands of DNA, scientists have developed two commonly used methods: one is the synthesis of long DNA strands by amplification with a related polymerase, e.g., polymerase Chain Reaction (PCR) [9] The double-stranded DNA can be rapidly amplified and synthesized by taking single-stranded or double-stranded DNA as a template, but the DNA cannot be synthesized into a DNA with a customized sequence depending on the sequence of the template; again, for example, rolling Circle Amplification (RCA) [10] The method can quickly synthesize tens of thousands of DNA single chains, but only can synthesize long DNA chains with repetitive sequences, and the synthesized sequences have non-uniform length and uncontrollable sequences; secondly, the synthesis of long-chain DNA by an extracellular assembly method mainly depends on assembly of restriction endonucleases, ligases and polymerases of terminal complementary sequences, such as iBrick based on restriction endonucleases [11] And BglBrick [12] When a plurality of DNA fragments are assembled by the methods, a proper enzyme cutting site is difficult to find, base residues are introduced, and a completely correct base sequence is difficult to obtain; the ligase-based approach can splice short-chain DNA into long-chain DNA by a stepwise splicing approach [13,14] The method needs to be carried out in multiple steps, purification is needed before splicing each time, the operation is complex, the cost is high, and the yield is small; another ligase-based approach is the Ligase Chain Reaction (LCR) [15] It relies on the more expensive thermostable DNA ligase, the product entrainment is more severe, and the target DNA double strand needs to be obtained by PCR amplification; in addition, polymerase-based assembly methods include overlap extension polymerase chain reaction (OE-PCR) [16–18] Polymerase progressive assembly (PCA) [19] And circular polymerase extension method (CPEC) [20] The method is characterized in that long double strands of DNA are prepared, the assembly reaction of polymerase generally depends on high-fidelity DNA polymerase in order to ensure the correctness of a target sequence, in addition, the design of primers can influence the fidelity of the target sequence to a great extent, if the denaturation of the DNA strand is incomplete, errors are easy to occur in the amplification of the DNA, and the method cannot realize the precise modification of a specific site and limits the universality of the application of the method.
Most of the methods for preparing long-chain DNA described above relate to a method for synthesizing a long DNA double strand, and the method for synthesizing a long single-chain of DNA having a custom sequence is relatively limited, and at present, it is possible to synthesize a single-chain DNA from a double-chain DNAHowever, all have certain disadvantages, and there are three main methods: binding of magnetic beads modified by streptavidin to biotin-modified DNA single strands [21] And a single-stranded DNA complementary thereto is obtained by denaturation, but the method is generally applicable to obtaining a short single-stranded DNA, the binding constant of the biotin-modified long double-stranded DNA to magnetic beads is significantly reduced, which significantly increases the amount of magnetic beads, and the long double-stranded DNA is easily renatured, resulting in a significant reduction in purification efficiency [22] (ii) a Secondly, a primer with a 5 'end modified with phosphate is introduced in the PCR amplification, and then Lambda exonuclease is used for selectively digesting a single-stranded DNA with 5' phosphate modification in the double-stranded DNA to obtain the complementary single-stranded DNA without phosphate modification [23] However, this method has the disadvantage of incomplete digestion of single-stranded DNA and is more severe as the length of the DNA strand increases; thirdly, gel cutting purification is carried out through denaturing polyacrylamide gel electrophoresis (PAGE), in the method, one primer is modified during double-strand amplification, such as cleavable ribose residue and pH unstable clips are introduced, so that the two amplified single strands have different speeds during electrophoresis, and gel cutting can be carried out; however, this method makes it more difficult to denature the double strand as the length of the DNA strand increases, and the resolution of PAGE for two DNA strands decreases, making it difficult to obtain a single DNA strand of high purity. Furthermore, all of the above-described methods have difficulty in introducing a modification at a specific position of a single-stranded DNA or a double-stranded DNA.
The modification of DNA is various and generally includes modification of a base, a phosphodiester bond and deoxyribose [24-29] (ii) a At present, for DNA modified at a specific site, only a modified monomer can be introduced by chemical synthesis, and only short-chain DNA can be modified, so how to synthesize single-chain long-chain DNA with high efficiency and further precisely modify any site of long-chain DNA is a technical problem to be solved in the art.
Cited documents:
[1]Gibson D G,Glass J I,Lartigue C,et al.Creation of a bacterial cell controlled by a chemically synthesized genome[J].Science,2010,329(5987):52–56.
[2]Richardson S M,Mitchell L A,Stracquadanio G,et al.Design of a synthetic yeast genome[J].Science,2017,355(6329):1040–1044.
[3]Shi J,Jia H,Chen H.Concentration Insensitive Supramolecular Polymerization Enabled by Kinetically Interlocking Multiple-Units Strategy[J].CCS Chemistry,2019(1):296–303.
[4]Seeman N C,Sleiman H F.DNA nanotechnology[J].Nature Reviews Materials,2017,3.
[5]Ceze L,Nivala J,Strauss K.Molecular digital data storage using DNA[J].Nature Reviews Genetics,Springer US,2019,20(8):456–466.
[6]Horvath S J,Firca J R,Hunkapiller T,et al.An Automated DNA Synthesizer Employing Deoxynucleoside 3′-Phosphoramidites[J].Methods in Enzymology,1987,154(C):314–326.
[7]Gerald Z,Kathleen A.G,Carrie J.S.Analytical studies of“mixed sequence”oUgodeoxyribonudeotides synthesized by competitive coupling of either methyl-or0-cyajwethyl-A^-diisopropylamlno phosphoramidite reagents,including 2’-deoxyinosine[J].Nucleic Acids Research,1985,13:8181–8196.
[8]Caruthers M H.The chemical synthesis of DNA/RNA:Our gift to science[J].Journal of Biological Chemistry,
Figure PCTCN2021098430-APPB-000001
2013ASBMB.Currently published by Elsevier Inc；originally published by American Society for Biochemistry and Molecular Biology.,2013,288(2):1420–1427.
[9]Saiki R K,Scharf S,Faloona F,et al.Enzymatic amplification of beta-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia.[J].Science,1992,230(4732):1350–1354.
[10]Amiram M,Quiroz F G,Callahan D J,et al.A highly parallel method for synthesizing DNA repeats enables the discovery of smartg protein polymers[J].Nature Materials,Nature Publishing Group,2011,10(2):141–148.
[11]Liu J K,Chen W H,Ren S X,et al.IBrick:A new standard for iterative assembly of biological parts with homing endonucleases[J].PLoS ONE,2014,9(10):1–10.
[12]Anderson J C,Dueber J E,Leguia M,et al.BglBricks:A flexible standard for biological part assembly[J].Journal of Biological Engineering,2010,4:1–12.
[13]Hamblin G D,Rahbani J F,Sleiman H F.Sequential growth of long DNA strands with user-defined patterns for nanostructures and scaffolds[J].Nature Communications,Nature Publishing Group,2015,6:7065.
[14]Khorana H G,Agarwal K L,Büchi H,et al.Total synthesis of the structural gene for an alanine transfer ribonucleic acid from yeast[J].Nature,1972,227:27–34.
[15]Au L C,Yang F Y,Yang W J,et al.Gene synthesis by a LCR-based approach:High-level production of leptin-L54 using synthetic gene in Escherichia coli[J].Biochemical and Biophysical Research Communications,1998,248(1):200–203.
[16]Borovkov A Y,Loskutov A V.,Robida M D,et al.High-quality gene assembly directly from unpurified mixtures of microarray-synthesized oligonucleotides[J].Nucleic Acids Research,2010,38(19).
[17]Stemmer W P C,Crameri A,Ha K D,et al.Single-step assembly of a gene and entire plasmid from large numbers of oligodeoxyribonucleotides[J].Gene,1995,164(1):49–53.
[18]Xiong A S,Yao Q H,Peng R H,et al.A simple,rapid,high-fidelity and cost-effective PCR-based two-step DNA synthesis method for long gene sequences.[J].Nucleic acids research,2004,32(12).
[19]Kodumal S J,Patel K G,Reid R,et al.Total synthesis of long DNA sequences:Synthesis of a contiguous 32-kb polyketide synthase gene cluster[J].Proceedings of the National Academy of Sciences of the United States of America,2004,101(44):15573–15578.
[20]Quan J,Tian J.Circular polymerase extension cloning of complex gene libraries and pathways[J].PLoS ONE,2009,4(7).
[21]Wilson R.Preparation of single-stranded DNA from PCR products with streptavidin magnetic beads[J].Nucleic Acid Therapeutics,2011,21(6):437–440.
[22]Holmberg A,Blomstergren A,Nord O,et al.The biotin-streptavidin interaction can be reversibly broken using water at elevated temperatures[J].Electrophoresis,2005,26(3):501–510.
[23]Kujau M J,
Figure PCTCN2021098430-APPB-000002
S.Efficient Preparation of Single-Stranded DNA for in Vitro Selection[J].Applied Biochemistry and Biotechnology-Part B Molecular Biotechnology,1997,7(3):333–335.
[24]Ratel D,Ravanat J L,Berger F,et al.N6-methyladenine:The other methylated base of DNA[J].BioEssays,2006,28(3):309–315.
[25].Barciszewski J,Barciszewska M Z,Siboska G,et al.Some unusual nucleic acid bases are products of hydroxyl radical oxidation of DNA and RNA[J].Molecular Biology Reports,1999,26(4):231–238.
[26]Shin Y A,Eichhorn G L.Formation ofΨ(+)andΨ(-)DNA[J].Biopolymers,1984,23:325–335.
[27]Janulaitis A,
Figure PCTCN2021098430-APPB-000003
S,
Figure PCTCN2021098430-APPB-000004
M,et al.Cytosine modification in DNA by BcnI methylase yields N4-methylcytosine[J].FEBS Letters,1983,161(1):131–134.
[28]Taylor J W,Schimidt W,Cosstick R,et al.The use of phospborothioate-modifled DNA in restriction enzyme reactions to prepare nicked DNA[J].Nucleic Acids Research,1985,13:8749–8764.
[29]Rozners E,Moulder J.Hydration of short DNA,RNA and 2’-Ome oligonucleotides determined by osmotic stressing[J].Nucleic Acids Research,2004,32(1):248–254.
disclosure of Invention
Problems to be solved by the invention
In view of the problems in the prior art, for example, the method for synthesizing long-chain DNA by solid phase synthesis has low yield, high cost and high error rate when the chain length is long, and the method for synthesizing long-chain DNA by DNA polymerase depends on high fidelity polymerase and can not realize precise modification of specific base.
In some embodiments, the present disclosure provides a method for preparing long-chain DNA, which is capable of synthesizing long-chain DNA having an arbitrary sequence, independent of DNA polymerase.
In other embodiments, the methods provided by the present disclosure are suitable for precise modification of a specific site of a long-chain DNA, and have the advantages of low synthesis difficulty, high accuracy and low cost.
In other embodiments, the methods provided by the present disclosure can obtain single-stranded long-chain DNA modified at any site, and the long-chain DNA has high synthesis efficiency and high purity, and is suitable for synthesis of single-stranded DNA of 60nt or more, particularly in the range of 60-1000nt.
Means for solving the problems
The present disclosure provides a method for preparing long-chain DNA, comprising the steps of:
the synthesis steps are as follows: synthesizing a first-strand DNA fragment group and a second-strand DNA fragment group, wherein the first-strand DNA fragment group comprises a DNA fragment n i And DNA fragment n i+1 The DNA fragment group of the second strand comprises a DNA fragment m i ；iA positive integer selected from 1 or more; wherein, the DNA fragment m i 5' terminal sequence of (3) and DNA fragment n i+1 The 5' terminal sequence of (a) is a complementary sequence, a DNA fragment m i The 3' terminal sequence of (A) and the DNA fragment n i The 3' terminal sequence of (a) is a complementary sequence;
and (3) annealing: mixing the DNA fragment group of the first chain and the DNA fragment group of the second chain in the same reaction system, and annealing to form an assembly precursor of double-stranded DNA; wherein a connecting port exists between two adjacent DNA fragments in the first strand, and a connecting port exists between two adjacent DNA fragments in the second strand; the connecting ports between the adjacent DNA fragments in the first strand DNA fragment group and the connecting ports between the adjacent DNA fragments in the second strand DNA fragment group are staggered;
a connection step: connecting the connecting ports of the single-stranded DNAs of the first strand and the second strand to obtain an assembly of double-stranded DNAs formed by complementing the continuous single-stranded DNAs and the fragmented single-stranded DNAs.
In some embodiments, the method for preparing long-chain DNA according to the present disclosure further comprises the following steps:
a denaturation step: performing denaturation treatment on the assembly of the double-stranded DNA to obtain continuous single-stranded DNA;
optionally, the method further comprises a purification step: purifying the continuous single-stranded DNA from the reaction system.
In some embodiments, the method of preparing long-chain DNA according to the present disclosure, wherein the DNA segment n i+1 Is complementary to the 3' terminal sequence of the other DNA fragment of the second strand;
alternatively, the DNA fragment n i+1 The 3' terminal sequence of (A) and the DNA fragment m i+1 The 3' terminal sequence of (a) is a complementary sequence, the DNA fragment m i+1 Is complementary to other DNA fragments of the first strand DNA fragment set or is an unpaired sequence.
In some embodiments, the method for preparing a long-chain DNA according to the present disclosure, wherein the length of the continuous single-stranded DNA is 60nt or more, preferably 80nt or more, preferably 100nt or more, more preferably 60 to 1000nt, more preferably 80 to 600nt, more preferably 100 to 400nt, and most preferably 120 to 360nt.
In some embodiments, the method for preparing long-chain DNA according to the present disclosure, wherein the length of any one DNA fragment of the group of DNA fragments of the first strand and the group of DNA fragments of the second strand is 8 to 120nt, preferably 10 to 80nt, more preferably 15 to 40nt, and most preferably 20 to 30nt.
In some embodiments, the method for preparing a long-chain DNA according to the present disclosure, wherein the length of the 5' -end sequence of any one DNA fragment of the group of DNA fragments of the first strand and the group of DNA fragments of the second strand is 4nt or more, preferably 4 to 50nt, more preferably 6 to 30nt, and most preferably 10 to 20nt; or,
the length of the 3' end sequence of any one DNA fragment in the first strand DNA fragment group and the second strand DNA fragment group is more than 4nt, preferably 4-50nt, more preferably 6-30nt, and most preferably 10-20nt.
In some embodiments, the method for preparing a long-chain DNA according to the present disclosure, wherein any DNA fragment of the set of DNA fragments of the first chain comprises a phosphate group at the 5 'end, and a hydroxyl group at the 3' end; in the connecting step, phosphate groups and hydroxyl groups on two sides of the connecting port are connected to form phosphodiester bonds;
optionally, adjacent phosphate groups and hydroxyl groups in the first strand are joined as phosphodiester linkages with enzymatic or chemical ligation.
In some embodiments, the method for preparing a long-chain DNA according to the present disclosure, wherein any DNA fragment of the group of DNA fragments of the second chain comprises a phosphate group at the 5 'end, and a hydroxyl group at the 3' end; in the connecting step, phosphate groups and hydroxyl groups on two sides of the connecting port are connected to form phosphodiester bonds;
optionally, adjacent phosphate groups and hydroxyl groups in the second strand are joined as phosphodiester linkages by enzymatic or chemical ligation.
In some embodiments, the method for preparing a long-chain DNA according to the present disclosure, wherein one or more positions of any one of the DNA fragments of the first-strand DNA fragment set and the second-strand DNA fragment set comprise a modified base, and the base at a position adjacent to the junction port is an unmodified base;
alternatively, the modification is selected from m 6 A、Ψ、m 1 A、m 5 A、ms 2 i 6 A、i 6 A、m 3 C、m 5 C、ac 4 C、m 7 G、m2,2G、m 2 G、m 1 G、Q、m 5 U、mcm 5 U、ncm 5 U、ncm 5 Um、D、mcm 5 s 2 U、Inosine(I)、hm 5 C、s 4 U、s 2 U, azobenzene, cm, um, gm, t 6 A、yW、ms 2 t 6 A or a derivative thereof.
In some embodiments, the method for preparing a long-chain DNA according to the present disclosure, wherein one or more positions of any one of the DNA fragment group of the first strand and the DNA fragment group of the second strand comprise a modified deoxyribose sugar, and the deoxyribose sugar at a position adjacent to the connection port is an unmodified deoxyribose sugar;
optionally, the modification is selected from LNA, 2' -OMe, 3' -OMe u, vmoe, 2' -F or 2' -OBn (2 ' -O-benzyl group) or a derivative thereof.
In some embodiments, the method for preparing a long-chain DNA according to the present disclosure, wherein one or more positions of any one of the DNA fragment group of the first strand and the DNA fragment group of the second strand comprise a modified phosphodiester bond, and the phosphodiester bond at a position adjacent to the connection port is an unmodified phosphodiester bond;
optionally, the modification is selected from Phosphothioate (PS).
In some embodiments, the method for preparing long-chain DNA according to the present disclosure, wherein in the annealing step, after incubating the group of DNA fragments of the first strand and the group of DNA fragments of the second strand, the temperature is decreased to form an assembly precursor of double-stranded DNA;
optionally, the incubation temperature is any temperature of 0-100 ℃, preferably any temperature of 10-85 ℃, more preferably any temperature of 20-65 ℃, and the incubation time is any desired time;
the cooling speed is any speed, and the temperature is reduced to any temperature for hybridizing the DNA fragments in the reaction system to form the assembly precursor of the double-stranded DNA.
In some embodiments, the method for preparing long-chain DNA according to the present disclosure, wherein in the annealing step, the group of DNA fragments of the first strand and the group of DNA fragments of the second strand are dissolved in the same solvent to obtain the reaction system.
In some embodiments, the method for preparing long-chain DNA according to the present disclosure, wherein the pH of the reaction system is 3 to 11, preferably 4 to 10, more preferably 5 to 9, and most preferably 6 to 8.
In some embodiments, the method for preparing long-chain DNA according to the present disclosure, wherein in the reaction system, the molar ratio of any two DNA fragments in the first strand DNA fragment group and the second strand DNA fragment group is 1: (0.1-10), preferably 1: (0.5-1), most preferably 1:1.
the present disclosure also provides a long-chain DNA, wherein the long-chain DNA is made by the method according to the present disclosure, the long-chain DNA being a single-stranded long-chain DNA;
preferably, the long-chain DNA comprises a modified base, ribose, or phosphodiester linkage at one or more positions.
ADVANTAGEOUS EFFECTS OF INVENTION
In some embodiments, the method for preparing long-chain DNA provided by the present disclosure can prepare long-chain DNA of any sequence, and realize accurate modification of any site in the long-chain DNA, and the method for preparing long-chain DNA takes raw material DNA as a template, does not depend on Lai Waiyuan DNA, does not depend on DNA polymerase, and the like, has the advantages of low cost, low synthesis difficulty, high yield, and high sequence accuracy, and is suitable for large-scale popularization and promotion.
In some embodiments, the present disclosure provides a method for preparing a long-chain DNA, by preparing an assembly of a double-stranded DNA formed by complementing a continuous single-stranded DNA and a fragmented single-stranded DNA, the assembly of the double-stranded DNA can obtain a target long-chain DNA only by a simple denaturation process, and the assembly of the double-stranded DNA has a low denaturation difficulty compared to a double-stranded DNA formed by two continuous single strands; moreover, after the preparation of the non-target single-stranded DNA, the DNA fragments are dispersed in the reaction system, and the re-treatment of shearing, effect and the like is not needed, so that the preparation steps of the single-stranded long-chain DNA are effectively simplified, and the preparation efficiency and the synthesis purity of the single-stranded long-chain DNA are improved.
In some embodiments, the method for preparing long-chain DNA provided by the present disclosure, in which the precise insertion of the modified base at any site is achieved, solves the problem that the precise modification of a specific site cannot be achieved in the current synthesis method of long-chain DNA.
In some embodiments, the long-chain DNA provided by the present disclosure is a single-chain long-chain DNA, and is prepared by the above preparation method, the sequence accuracy is high, and the properties such as improved stability and immunogenicity can be obtained by modification of any site, and the long-chain DNA has a wide application prospect in aspects of drug development, clinical treatment, and the like.
Drawings
FIG. 1 shows a schematic diagram of a process for preparing long-chain DNA;
FIG. 2 shows a schematic diagram of the assembly of 100/80bp DNA;
FIG. 3 shows the results of gradient native polyacrylamide gel electrophoresis characterization of DNA100/80 bp assemblies;
FIG. 4 shows the results of denaturing polyacrylamide gel electrophoresis characterization of 100nt DNA single strands;
FIG. 5 shows the results of characterization of native vs. denaturing polyacrylamide gel electrophoresis of DNA100/80 bp assemblies without ligation;
FIG. 6 shows the results of native polyacrylamide gel electrophoresis characterization and fragment analysis characterization of the extended length double stranded DNA assemblies.
Detailed Description
Hereinafter, the present disclosure will be described in detail. The technical features described below are explained based on representative embodiments and specific examples of the present disclosure, but the present disclosure is not limited to these embodiments and specific examples. It should be noted that:
in the present disclosure, the numerical range represented by "numerical value a to numerical value B" means a range including an endpoint numerical value A, B.
In the present disclosure, "more" of "plural", and the like means a numerical value of 2 or more, unless otherwise specified.
In the present disclosure, the term "substantially", "substantially" or "essentially" means an error of less than 5%, or less than 3% or less than 1% compared to the relevant perfect or theoretical standard.
In the present disclosure, "%" denotes mass% unless otherwise specified.
In the present disclosure, the meaning of "may" includes both the case where a certain process is performed and the case where no process is performed.
In this disclosure, although the disclosure supports the definition of the term "or", "or" as merely alternatives and "and/or", the term "or", "or" means "and/or" in the claims unless expressly indicated to be only an alternative or an exclusion of one another.
In the present disclosure, "optional" or "optionally" means that the subsequently described event or circumstance may or may not occur, and that the description includes instances where the event occurs and instances where it does not.
As used in this disclosure, "water" includes any feasible water such as tap water, deionized water, distilled water, double distilled water, purified water, ion-exchanged water, and the like.
In the present disclosure, "assembly of double-stranded DNA" and "double-stranded DNA" have the same meaning and may be substituted for each other.
In the present disclosure, a "connecting port," also called a nick (nick), exists between two adjacent deoxyribonucleotides of a single-stranded DNA, and is generated because a phosphodiester bond is not formed between the two adjacent deoxyribonucleotides.
First aspect
A first aspect of the present disclosure provides a method for preparing long-chain DNA, as shown in fig. 1, comprising the steps of:
the synthesis steps are as follows: synthesizing a first-strand DNA fragment group and a second-strand DNA fragment group, wherein the first-strand DNA fragment group comprises a DNA fragment n i And DNA fragment n i+1 The DNA fragment group of the second strand comprises a DNA fragment m i (ii) a i is selected from positive integers of more than 1; wherein, the DNA fragment m i 5' terminal sequence of (1) and DNA fragment n i+1 The 5' terminal sequence of (a) is a complementary sequence, a DNA fragment m i The 3' terminal sequence of (A) and the DNA fragment n i The 3' terminal sequence of (a) is a complementary sequence;
and (3) annealing: mixing the DNA fragment group of the first chain and the DNA fragment group of the second chain in the same reaction system, and annealing to form an assembly precursor of double-stranded DNA; wherein a connecting port exists between two adjacent DNA fragments in the first strand, and a connecting port exists between two adjacent DNA fragments in the second strand; the connecting ports between the adjacent DNA fragments in the first strand DNA fragment group and the connecting ports between the adjacent DNA fragments in the second strand DNA fragment group are staggered;
a connection step: connecting the connecting ports of the single-stranded DNAs of the first strand and the second strand to obtain an assembly of double-stranded DNAs formed by complementing the continuous single-stranded DNAs and the fragmented single-stranded DNAs.
It should be noted that, in the current nucleic acid synthesis method, DNA is often synthesized by a solid phase synthesis method, because it is generally considered that it is difficult to assemble a large number of different fragment mixtures in one pot in a solution. There are also reports on long double-stranded DNA synthesis by short-fragment annealing, nick ligation and PCR amplification, but its dependence on high fidelity DNA polymerase is likely to result in increased cost and error rate. Patent document CN102876658a discloses a method for large-scale synthesis of long-chain nucleic acid molecules, which comprises the following specific steps: firstly, synthesizing short-chain nucleic acid molecule fragments; secondly, chemically modifying an end point; thirdly, connecting short-chain nucleic acid molecule fragments; step four, purifying the DNA double strand; and fifthly, amplifying the target long-chain DNA molecules by using a nucleic acid amplification technology. Although the above method enables the synthesis of long-chain DNA, it relies on PCR for amplification, and the long-chain DNA prepared is a double-stranded DNA formed by the complementation of two continuous single-stranded DNAs. On one hand, after the reaction process of PCR, the long-chain DNA cannot be modified at an advance site; on the other hand, in order to obtain a single-stranded long-chain DNA, it is necessary to denature a double strand, but it is difficult to denature a double-stranded DNA formed by two continuous long strands, and it is difficult to obtain a single-stranded long-chain DNA. Furthermore, even when a double-stranded long-chain DNA is denatured, a reaction system in which two continuous single-stranded DNAs are mixed is obtained, and the efficiency and purity of the target single-stranded DNA recovery are affected. In addition, the assembly purified by the method may have unsuccessful connection of a plurality of connecting ports, and only a small part of complete double-stranded DNA is formed, so that the yield of the double-stranded DNA is low.
According to the preparation method disclosed by the invention, the long-chain DNA is divided into a plurality of short DNA fragments, so that the synthesis difficulty of the long-chain DNA is greatly reduced. The method has the advantages of low cost, high yield and high sequence accuracy, does not need DNA polymerase in the process of synthesizing the long single-stranded DNA, effectively reduces the chemical synthesis difficulty of the long single-stranded DNA, can realize the modification of the basic group, deoxyribose or phosphodiester bond of any site in the long single-stranded DNA, and is low in cost.
In addition, the production method of the present disclosure connects the connecting ports of only one of the first strand and the second strand to obtain an assembly of double-stranded DNA formed by complementing the continuous single-stranded DNA and the fragmented single-stranded DNA. The preparation method also does not comprise an amplification step, avoids connecting connectors of fragmented single-stranded DNA in the assembly of the double-stranded DNA, realizes the preparation of the long-stranded DNA independent of the PCR amplification step, and can obtain higher yield.
The double-stranded DNA assembly can realize the recovery of the target long-stranded DNA only through simple denaturation treatment, and the preparation method does not comprise the steps of digestion, shearing and the like of the non-target single-stranded DNA, so that the preparation efficiency and the purity of the single-stranded long-stranded DNA are effectively improved, and the method is suitable for large-scale industrial application.
< segmentation of Long-chain DNA sequence >
Before preparing long-chain DNA, the sequence of the target long-chain DNA is divided. FIG. 2 shows a double-stranded long-chain DNA structure composed of a first strand and a second strand that are at least partially complementary, wherein the first strand or the second strand is the long-chain DNA to be synthesized. Dividing the nucleotide sequences of the first chain and the second chain respectively, so that the nucleotide sequences of the first chain and the second chain are divided into a plurality of short-chain DNA fragment sequences.
Wherein the DNA fragment group of the first strand comprises DNA fragments n i And DNA fragment n i+1 The DNA fragment set of the second strand includes a DNA fragment m i . DNA fragment m i 5' terminal sequence of (3) and DNA fragment n i+1 The 5' terminal sequence of (a) is a complementary sequence, a DNA fragment m i The 3' terminal sequence of (3) and the DNA fragment n i The 3' terminal sequence of (a) is a complementary sequence. DNA fragment n i The 5 'terminal sequence of (a) is complementary to the 5' terminal sequence of the other DNA fragment of the second strand or is an unpaired sequence, and the DNA fragment n i+1 Is complementary to the 3' end sequence of the other DNA fragment of the second strand or is an unpaired sequence. The sequence division of the double-stranded DNA containing the target long-chain DNA sequence is realized by the sequence division of the DNA fragments of the first strand and the second strand.
Further, the DNA fragment set of the first strand may further include other DNA fragments, and exemplarily, the DNA fragment set of the first strand includes at least x DNA fragments, and x is a positive integer greater than 2. For example, x is 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, etc., which the disclosure is not exhaustive.
In some embodiments, the firstThe DNA fragment group of the strand comprises a DNA fragment n i DNA fragment n i+1 And DNA fragment n i+2 . In some embodiments, the set of DNA fragments of the first strand comprises DNA fragment n i DNA fragment n i+1 And DNA fragment n i+2 DNA fragment n i+3 . In some embodiments, the set of DNA fragments of the first strand comprises DNA fragment n i DNA fragment n i+1 DNA fragment n i+2 DNA fragment n i+3 DNA fragment n i+4 . By analogy, the set of DNA fragments of the first strand may also comprise other numbers of DNA fragments, which the present disclosure is not exhaustive.
Further, the set of DNA fragments of the second strand may also include other DNA fragments, and illustratively, the set of DNA fragments of the first strand includes at least y DNA fragments, and y is a positive integer greater than 1. For example, y has values of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, etc., which the disclosure is not exhaustive.
In some embodiments, the set of DNA fragments of the second strand comprises DNA fragment m i DNA fragment m i+1 . Wherein, the DNA fragment m i 5' terminal sequence of (3) and DNA fragment n i+1 The 5' terminal sequence of (a) is a complementary sequence, a DNA fragment m i The 3' terminal sequence of (3) and the DNA fragment n i The 3' terminal sequence of (a) is a complementary sequence; DNA fragment m i+1 The 3' terminal sequence of (3) and the DNA fragment n i+1 The 3' terminal sequence of (a) is a complementary sequence, a DNA fragment m i+1 The 5' end sequence of (a) is related to a DNA fragment n i+2 The 5' terminal sequence of (a) is a complementary sequence or an unpaired sequence.
In some embodiments, the set of DNA fragments of the second strand comprises DNA fragment m i DNA fragment m i+1 DNA fragment m i+2 . Wherein, the DNA fragment m i 5' terminal sequence of (3) and DNA fragment n i+1 The 5' terminal sequence of (a) is a complementary sequence, a DNA fragment m i The 3' terminal sequence of (3) and the DNA fragment n i The 3' terminal sequence of (A) is a complementary sequenceColumns; DNA fragment m i+1 The 3' terminal sequence of (A) and the DNA fragment n i+1 The 3' terminal sequence of (a) is a complementary sequence, a DNA fragment m i+1 The 5' end sequence of (a) is related to a DNA fragment n i+2 The 5' terminal sequence of (a) is a complementary sequence; DNA fragment m i+2 The 3' terminal sequence of (A) and the DNA fragment n i+2 The 3' terminal sequence of (a) is a complementary sequence, a DNA fragment m i+2 The 5' end sequence of (a) is related to a DNA fragment n i+3 The 5' terminal sequence of (a) is a complementary sequence or an unpaired sequence.
In some embodiments, the set of DNA fragments of the second strand comprises DNA fragment m i DNA fragment m i+1 DNA fragment m i+2 DNA fragment m i+3 . Wherein, the DNA fragment m i 5' terminal sequence of (1) and DNA fragment n i+1 The 5' terminal sequence of (a) is a complementary sequence, a DNA fragment m i The 3' terminal sequence of (A) and the DNA fragment n i The 3' terminal sequence of (a) is a complementary sequence; DNA fragment m i+1 The 3' terminal sequence of (A) and the DNA fragment n i+1 The 3' terminal sequence of (a) is a complementary sequence, a DNA fragment m i+1 The 5' end sequence of (a) is related to a DNA fragment n i+2 The 5' terminal sequence of (a) is a complementary sequence; DNA fragment m i+2 The 3' terminal sequence of (A) and the DNA fragment n i+2 The 3' terminal sequence of (a) is a complementary sequence, a DNA fragment m i+2 The 5' terminal sequence of (2) is related to DNA fragment n i+3 The 5' terminal sequence of (a) is a complementary sequence; DNA fragment m i+3 The 3' terminal sequence of (A) and the DNA fragment n i+3 The 3' terminal sequence of (a) is a complementary sequence, a DNA fragment m i+3 The 5' end sequence of (a) is related to a DNA fragment n i+4 The 5' terminal sequence of (a) is a complementary sequence or an unpaired sequence. By analogy, the set of DNA fragments of the second strand may also comprise other numbers of DNA fragments, which the present disclosure is not exhaustive.
In the present disclosure, the 5 'terminal sequence and the 3' terminal sequence refer to division of the nucleotide fragment in the 5 'to 3' direction such that the nucleotide fragment is divided into two regions. The sequence of one region near the 5 '-end is referred to as the 5' -end sequence, and the sequence of the other region near the 3 '-end is referred to as the 3' -end sequence.
In the present disclosure, the 5' terminus is one nucleotide located at the 5' endmost position in the nucleotide chain in the 5' to 3' direction, which generally has a phosphate group at the 5' terminus. The 3' terminus is a nucleotide located at the 3' endmost position in the nucleotide chain in the 5' to 3' direction, which typically has a hydroxyl group at the 3' terminus.
In addition, the number of the DNA fragments in the first strand DNA fragment group or the second strand DNA fragment group can be increased or decreased according to actual needs. By the increase or decrease of the DNA fragments, the division of DNA chains with different lengths can be realized. Specifically, whether the set of DNA fragments of the first strand or the set of DNA fragments of the second strand includes other DNA fragments, and the number of other DNA fragments included are determined by the sequence of the target long-chain DNA that is desired to be synthesized. By the above design, a long-chain DNA of any of the above-described lengths and desired sequences can be synthesized.
Further, after the division of the nucleotide sequences of the first strand and the second strand is completed, a connecting port exists between the two DNA fragments connected. For example, the DNA fragment n in the first strand i And DNA fragment n i+1 A connecting port exists between the DNA fragment m in the second strand i And DNA fragment m i+1 With a connection port therebetween. In order to obtain relatively good stability of the assembly precursor of the double-stranded DNA obtained after annealing, the connection ports between the adjacent DNA fragments in the group of DNA fragments of the first strand and the connection ports between the adjacent DNA fragments in the group of DNA fragments of the second strand are staggered when the target long-stranded DNA is subjected to sequence division.
Further, when the target long-chain DNA is subjected to sequence division, the melting temperatures (T) of the DNA fragments in the group of DNA fragments of the first strand and the group of DNA fragments of the second strand are adjusted m ) Should be as close as possible and avoid the presence of multiple higher order structures within the strand to reduce the difficulty of annealing the DNA fragments to form an assembly precursor of double-stranded DNA.
In some embodiments, the length of the 5' end sequence of any one of the DNA fragment set of the first strand and the DNA fragment set of the second strand is 4nt or more, preferably 4 to 50nt, more preferably 6 to 30nt, and most preferably 10 to 20nt. For example, the length of the 5' end sequence of any DNA fragment is 4nt, 6nt, 8nt, 10nt, 12nt, 14nt, 16nt, 18nt, etc.
In some embodiments, the length of the 3' terminal sequence of any one of the DNA fragment set of the first strand and the DNA fragment set of the second strand is 4nt or more, preferably 4 to 50nt, more preferably 6 to 30nt, and most preferably 10 to 20nt. For example, the length of the 3' -end sequence of any one DNA fragment is 4nt, 6nt, 8nt, 10nt, 12nt, 14nt, 16nt, 18nt, etc.
In some embodiments, the length of the continuous single-stranded DNA is 60nt or more, preferably 80nt or more, preferably 100nt or more, more preferably 60 to 1000nt, more preferably 80 to 600nt, more preferably 100 to 400nt, and most preferably 120 to 360nt. For example, the length of any single-stranded DNA is 60nt, 80nt, 90nt, 100nt, 120nt, 140nt, 160nt, 180nt, 200nt, 220nt, 240nt, 250nt, 260nt, 267nt, 270nt, 300nt, 320nt, 340nt, 360nt, 400nt, 500nt, 600nt, 700nt, 800nt, 900nt, 1000nt, etc.
In one embodiment, the present disclosure describes a method for preparing long-chain DNA, comprising the steps of:
the synthesis steps are as follows: synthesizing a first-strand DNA fragment group and a second-strand DNA fragment group, wherein the first-strand DNA fragment group comprises a DNA fragment n i And DNA fragment n i+1 The DNA fragment group of the second strand comprises a DNA fragment m i (ii) a i is selected from a positive integer of more than 1; wherein, the DNA fragment m i 5' terminal sequence of (3) and DNA fragment n i+1 The 5' terminal sequence of (a) is a complementary sequence, a DNA fragment m i The 3' terminal sequence of (A) and the DNA fragment n i The 3' terminal sequence of (a) is a complementary sequence;
and (3) annealing: mixing the DNA fragment group of the first chain and the DNA fragment group of the second chain in the same reaction system, and annealing to form an assembly precursor of double-stranded DNA; wherein a connecting port exists between two adjacent DNA fragments in the first strand, and a connecting port exists between two adjacent DNA fragments in the second strand; the connecting ports between the adjacent DNA fragments in the first strand DNA fragment group and the connecting ports between the adjacent DNA fragments in the second strand DNA fragment group are staggered;
a connection step: connecting the connecting ports of the single-stranded DNAs of the first strand and the second strand to obtain an assembly of double-stranded DNAs formed by complementing the continuous single-stranded DNAs and the fragmented single-stranded DNAs.
A denaturation step: and (3) performing denaturation treatment on the assembly of the double-stranded DNA to obtain continuous single-stranded DNA.
< synthetic DNA fragment >
After the sequence division of the target long-chain DNA is completed, the desired sequence and the number of DNA fragments are synthesized. The DNA fragment can be synthesized by a DNA synthesis method commonly used in the art, for example, chemical synthesis. The chemical synthesis method can prepare short-chain DNA fragments on a large scale and ensure the sequence accuracy of the DNA fragments.
In some embodiments, the length of any one of the DNA fragments in the first strand set of DNA fragments and the second strand set of DNA fragments is 8-120nt, preferably 10-80nt, more preferably 15-40nt, and most preferably 20-30nt. For example, the length of the DNA fragment is 22nt, 24nt, 26nt, 28nt, 30nt, 40nt, 50nt, 60nt, 70nt, 80nt, 90nt, 100nt, etc. The synthesis difficulty and cost of the DNA fragments are determined by the length of the DNA fragments, and the length of the DNA fragments is controlled to be 20-30nt, so that the synthesis difficulty of the DNA fragments can be effectively reduced, and the synthesis cost can be controlled.
In some embodiments, the modified base is included at one or more positions on any one of the set of DNA fragments of the first strand and the set of DNA fragments of the second strand. For example, modified bases are included at 1, 2, 3, 4, etc. positions of the DNA fragment. Methods for base modification can employ methods commonly used in the art, for example, modified bases are introduced during chemical synthesis of short-chain DNA fragments. Modified base is introduced in the process of synthesizing DNA fragments, base modification on any site can be realized, and long-chain DNA capable of accurately modifying the base of any site can be obtained after the DNA fragments are assembled into long-chain DNA so as toThe modification modes are all abbreviations of common modification modes, and specific modification methods can be referred to in reference documents [24-29] 。
Specifically, the modification mode of the base at any position in the DNA fragment may be selected from m 6 A、Ψ、m 1 A、m 5 A、ms 2 i 6 A、i 6 A、m 3 C、m 5 C、ac 4 C、m 7 G、m2,2G、m 2 G、m 1 G、Q、m 5 U、mcm 5 U、ncm 5 U、ncm 5 Um、D、mcm 5 s 2 U、Inosine(I)、hm 5 C、s 4 U、s 2 U, azobenzene, cm, um, gm, t 6 A、yW、ms 2 t 6 A or a derivative thereof.
In some embodiments, the modified deoxyribose sugar is contained at one or more positions of any one of the set of DNA fragments of the first strand and the set of DNA fragments of the second strand. For example, a modified deoxyribose sugar is contained at 1, 2, 3, 4, etc. positions of the DNA fragment. The deoxyribose modification method can adopt a method commonly used in the field, for example, modified deoxyribose is introduced in the process of chemically synthesizing short-chain DNA fragments. Modified deoxyribose is introduced in the process of synthesizing the DNA fragment, deoxyribose modification on any position can be realized, and long-chain DNA capable of accurately modifying deoxyribose on any position can be obtained after the DNA fragment is assembled into long-chain DNA.
Specifically, the modification mode of deoxyribose at any position of the DNA fragment may be selected from LNA, 2' -OMe, 3' -OMeU, vmoe, 2' -F, 2' -OBn (2 ' -O-benzyl group) or derivatives thereof.
In some embodiments, the set of DNA fragments of the first strand and the set of DNA fragments of the second strand comprise a modified phosphodiester bond at one or more positions of either DNA fragment, the phosphodiester bond being formed between two adjacent deoxyribonucleotides of the short-chain DNA fragment. For example, modified phosphodiester bonds are included at 1, 2, 3, 4, etc. positions of the DNA fragment. The phosphodiester bond modification method can employ a method commonly used in the art, for example, introducing a modified phosphodiester bond during chemical synthesis of a short-chain DNA fragment. Modified phosphodiester bonds are introduced in the process of synthesizing DNA fragments, so that phosphodiester bond modification of any site can be realized, and long-chain DNA capable of accurately modifying the phosphodiester bonds of any site can be obtained after the DNA fragments are assembled into long-chain DNA.
Specifically, the modification mode of the phosphodiester bond at any position in the DNA fragment may be selected from Phosphothioate (PS).
In some preferred embodiments, modifications to the bases, deoxyribose, and phosphodiester linkages should avoid bases, deoxyribose, and phosphodiester linkages at locations immediately adjacent to the attachment port to avoid modifications at the first strand or second strand junction that may affect attachment port connections in the assembly precursor of the subsequent double-stranded DNA.
Through modification of at least one of a base, ribose and a phosphodiester bond of any one or more sites in the DNA fragment, the modified DNA fragment is applied to synthesis of the long-chain DNA in the disclosure, so that accurate modification of any site in the long-chain DNA can be realized, and the problem that the long-chain DNA accurately modified at a specific site is difficult to synthesize in the prior art is effectively solved. The modified long-chain DNA has improved biological performances such as stability, immunogenicity and the like, and has wide application in the field of biomedicine.
In some embodiments, any DNA fragment in the set of DNA fragments of the first strand comprises a phosphate group at the 5 'terminus, and a hydroxyl group at the 3' terminus. For example, the DNA fragment n i The 5 'end of (a) contains a phosphate group, and the 3' end contains a hydroxyl group; DNA fragment n i+1 The 5 'terminal of (A) contains a phosphate group, the 3' terminal contains a hydroxyl group, and a DNA fragment n i+2 The 5 'end of (a) contains a phosphate group, and the 3' end contains a hydroxyl group; DNA fragment n i+3 The 5 'terminal of (a) contains a phosphate group, and the 3' terminal contains a hydroxyl group; DNA fragment n i+4 The 5' end of (A) comprisesA phosphate group, the 3' end of which comprises a hydroxyl group; the linker in the first strand can be ligated by ligating the 5 'phosphate group and the 3' hydroxyl group on both sides of the linker into a phosphodiester bond, thereby obtaining an assembly of a double-stranded DNA formed by complementing a continuous single-stranded DNA (first strand) and a fragmented single-stranded DNA (second strand).
In some embodiments, any DNA fragment in the set of DNA fragments of the second strand comprises a phosphate group at the 5 'terminus, and a 3' hydroxyl group. For example, the DNA fragment m i The 5 'terminal of (a) contains a phosphate group, and the 3' terminal contains a hydroxyl group; DNA fragment m i+1 The 5 'terminal of (A) contains a phosphate group, the 3' terminal contains a hydroxyl group, and a DNA fragment m i+2 The 5 'terminal of (a) contains a phosphate group, and the 3' terminal contains a hydroxyl group; DNA fragment m i+3 The 5 'terminal of (2) contains a phosphate group, and the 3' terminal contains a hydroxyl group. After the DNA fragments of the first strand and the second strand are assembled to form an assembly precursor of a double-stranded DNA, the connection to the connection port in the second strand can be achieved by connecting the 5 'phosphate group and the 3' hydroxyl group on both sides of the connection port as phosphodiester bonds, thereby obtaining an assembly comprising a double-stranded DNA formed by complementing a continuous single-stranded DNA (second strand) and a fragmented single-stranded DNA (first strand).
Illustratively, the phosphate group at the 5 'end of the DNA fragment may be introduced by modification methods commonly used in the art, for example, the phosphate group may be introduced directly at the 5' end of the DNA fragment during the synthesis of the DNA fragment; or performing kinase treatment on the DNA fragment without introduced phosphate group to modify the 5' end of the DNA fragment with phosphate group.
By the design method, the 5 'phosphate group and the 3' hydroxyl group are added into the DNA fragments of the target single-stranded DNA in the first strand and the second strand, so that only the target single-stranded DNA is connected in the connection step to obtain continuous single-stranded DNA, and the DNA strand complementary to the target single-stranded DNA is still a fragmented DNA strand, thereby effectively overcoming the problems of difficult denaturation of the double-stranded long-stranded DNA and low purity and recovery rate of the denatured single-stranded DNA, and avoiding the need of digestion, shearing and other treatments on the complementary strand when the target single-stranded DNA is subsequently recovered.
< precursor of Assembly of double-stranded DNA >
Mixing the DNA fragment group of the first strand and the DNA fragment group of the second strand in the same reaction system, and annealing to obtain an assembly precursor of double-stranded DNA formed by at least partially complementing the first strand and the second strand; wherein a connecting port exists between two adjacent DNA fragments in the first strand, and a connecting port exists between two adjacent DNA fragments in the second strand; the connecting ports between adjacent DNA fragments in the first strand DNA fragment set and the connecting ports between adjacent DNA fragments in the second strand DNA fragment set are staggered.
The DNA molecule contains 4 different deoxyribonucleotides, which are adenine deoxyribonucleotide (A), guanine deoxyribonucleotide (G), cytosine deoxyribonucleotide (C) and thymine deoxyribonucleotide (T) depending on the base type. The bases can be connected with each other through hydrogen bonds, wherein the hydrogen bonds can be formed between A and T, C and G respectively. The precise complementary pairing capability between base pairs enables the formation of an accurate double-stranded structure between two reverse DNA single strands with complementary sequences to each other by means of hydrogen bonding.
Specifically, the first strand DNA fragment set and the second strand DNA fragment set are dissolved in the same solvent, and the two are sufficiently mixed to obtain a reaction system for preparing an assembly precursor of double-stranded DNA. The specific solvent is not particularly limited in the present disclosure, and may be a polar solvent commonly used in the art, for example: water, and the like. Regarding the molar ratio of the DNA fragments mixed in the reaction system, the molar ratio of any two DNA fragments in the DNA fragment group of the first strand and the DNA fragment group of the second strand is 1: (0.1-10), preferably 1: (0.5-1), most preferably 1:1. illustratively, the molar ratio of any two DNA fragments is 1. By setting the molar ratio of the DNA fragments, the efficiency of assembly of short-chain DNA fragments can be improved.
In order to further improve the assembly efficiency of the assembly precursor of the double-stranded DNA and the yield of the assembly of the double-stranded DNA, the pH of the reaction system is set to 3 to 11, preferably 4 to 10, more preferably 5 to 9, and most preferably 6 to 8. Illustratively, the reaction system has a pH of 6, 7, 8, 9, and so forth.
Further, in the annealing step for preparing the assembly precursor of the double-stranded DNA, the DNA fragment group of the first strand and the DNA fragment group of the second strand are incubated and then cooled to form the assembly precursor of the double-stranded DNA;
optionally, the incubation temperature is any temperature from 0 to 100 ℃, preferably any temperature from 10 to 85 ℃, more preferably any temperature from 20 to 65 ℃, for any desired time;
the cooling speed is any speed, and the temperature is reduced to any temperature for hybridizing the DNA fragments in the reaction system to form the assembly precursor of the double-stranded DNA.
< Assembly of double-stranded DNA >
The ligation is performed only on the linker present on the first strand, or only on the linker present on the second strand, to form an assembly of double-stranded DNA.
Specifically, the 5 'phosphate group and the 3' hydroxyl group on both sides of the connecting port are connected to form a phosphodiester bond. The ligation method may be an enzymatic ligation method in which ligation is performed by T4 DNA ligase, taq DNA ligase, pfU ligase, or a chemical ligation method. And connecting the connectors to obtain a complete double-stranded DNA assembly, thereby realizing the preparation of the long-chain DNA.
Further, the preparation method of the present disclosure further comprises a denaturation step. In the denaturation step, the assembly of the double-stranded DNA is denatured to obtain a continuous single-stranded DNA dispersed in the reaction system, that is, a target long-stranded DNA. The method of denaturation treatment may be a method of melting double-stranded DNA into single-stranded DNA, which is commonly used in the art. For example, the treatment at a temperature of 70 ℃ or the incubation at 50 ℃ in a solution containing 7M urea makes it possible to disentangle the continuous single-stranded DNA and the fragmented single-stranded DNA and disperse the continuous single-stranded DNA in the reaction system.
Further, the preparation method of the present disclosure further comprises a purification step. In the purification step, the continuous single-stranded DNA is purified from the reaction system, and the purification method is not particularly limited in the present disclosure, and may be various methods for efficiently recovering DNA from the reaction system. The long-chain DNA without other substances obtained after the purification step can be further applied to different fields of clinic, drug research and development, biological research and the like.
The preparation method disclosed by the disclosure has all the advantages of the conventional chemical synthesis method of DNA (including no need of a template chain, accurate fixed-point modification and the like), and simultaneously, by dividing the target long-chain DNA into a plurality of short single-chain DNA fragments, the difficulty of chemical synthesis is greatly reduced, and the high accuracy, high yield and fixed-point modification capability of the chemical synthesis method for preparing the short-chain DNA fragments are retained.
DNA fragments which can be easily prepared by a chemical synthesis method are recombined into an assembly precursor of double-stranded DNA with a target structure according to a specific sequence through the self-assembly capability of nucleic acid, and a connecting port of any single-stranded DNA in the assembly is recombined through a phosphodiester bond by using the technologies such as enzyme linkage or chemical linkage, so that the assembly of the double-stranded DNA formed by complementing the continuous single-stranded DNA and the fragmented single-stranded DNA is obtained. The assembly of double-stranded DNA is simply denatured to obtain single-stranded long-stranded DNA. Since the chemical synthesis process can achieve precise modification of an initial short-chain DNA fragment at an arbitrary site (except for bases immediately on both sides of the junction), the target long-chain DNA obtained also has the property of being capable of being modified at almost an arbitrary site.
Second aspect of the invention
A second aspect of the present disclosure provides a long-chain DNA that is a single-stranded long-chain DNA made by the method of the first aspect.
The long-chain DNA disclosed by the invention can realize accurate modification at any site, and the long-chain DNA and the modification have no sequence dependence, so that a foundation is provided for expanding the application of the long-chain DNA (especially the long-chain DNA with accurate modification) in the biomedical field.
Examples
Embodiments of the present disclosure will be described in detail below with reference to examples, but those skilled in the art will appreciate that the following examples are only illustrative of the present disclosure and should not be construed as limiting the scope of the present disclosure. The examples, in which specific conditions are not specified, were conducted under conventional conditions or conditions recommended by the manufacturer. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products commercially available.
The experimental techniques and experimental procedures used in this example are, unless otherwise specified, conventional techniques, e.g., those in the following examples, in which specific conditions are not specified, and generally according to conventional conditions such as Sambrook et al, molecular cloning: the conditions described in the Laboratory Manual (New York: cold Spring Harbor Laboratory Press, 1989), or according to the manufacturer's recommendations. The materials, reagents and the like used in the examples are commercially available from normal sources unless otherwise specified.
Materials and methods
The DNA sequences used in the examples were purchased from Oncki Kagaku, and were not additionally treated before use. All the water used for the experiments was ultrapure water produced by 18.2 M.OMEGA.cm Millipore. T4 DNA ligase and 10 Xligase buffer were purchased from Biotechnology engineering (Shanghai) Ltd. Other chemical reagents are analytically pure. The type of the fragment analyzer is as follows: fragment
Figure PCTCN2021098430-APPB-000005
Capillary electrophoresis system (sibo technologies (hong kong) limited).
Example 1.construction of 100/80bp DNA double-stranded Assembly
(1) A long-chain DNA (referred to as DNA 100/80) having a length of 100nt and 80nt for the first and second strands, respectively, was used as a target long chain, and the long chain was cleaved into 9 short-chain DNAs having a length of 20nt. Wherein D-n1, D-n2, D-n3, D-n4 and D-n5 are DNA fragments for synthesizing a first strand, and D-m1, D-m2, D-m3 and D-m4 are DNA fragments for synthesizing a second strand.
(2) 9 short DNA strands were prepared by chemical synthesis.
The specific sequences of the 9 strands used are shown in the following table:
TABLE 1 sequence information of 9 DNA short strands used for the preparation of the assemblies
Sequence name Sequence information nt SEQ ID NO
D-n1 AAAAGGAAAAGCGATGCTAT 20 SEQ ID NO：1
D-m1 TACGAATCCAATAGCATCGC 20 SEQ ID NO：2
D-n2 TGGATTCGTAGGACTGCCTG 20 SEQ ID NO：3
D-m2 CAAGTAGTTACAGGCAGTCC 20 SEQ ID NO：4
D-n3 TAACTACTTGTCACTCTCTT 20 SEQ ID NO：5
D-m3 TGTCGGTAAGAAGAGAGTGA 20 SEQ ID NO：6
D-n4 CTTACCGACAAAACCTAAAT 20 SEQ ID NO：7
D-m4 TGAACAGATAATTTAGGTTT 20 SEQ ID NO：8
D-n5 TATCTGTTCAAAAAGGAAAA 20 SEQ ID NO：9
(3) Mixing the above 9 DNA short chains at an equimolar ratio to 1 XTAE-Mg 2+ Heating the buffer solution at 70 ℃ for 5min, then gradually cooling the buffer solution to room temperature, and standing the buffer solution at 4 ℃ for 10min to obtain a target DNA assembly. The assembly was observed by native polyacrylamide gel electrophoresis, and the results are shown in FIG. 3.
As can be seen from FIG. 3, the target double-stranded DNA assembly precursor was produced with high efficiency under the conditions described above.
Example 2.100 nt DNA Single Strand Synthesis and gel electrophoresis characterization
(1) The 9 DNA fragments of example 1 were synthesized.
(2) In the 100/80 long target DNA referred to in example 1, the 5' -end phosphate group modification (no modification of the second strand in the 5' -3' direction) was performed on the 20nt short strand (D-n 1, D-n2, D-n3, D-n4, D-n 5) obtained by dividing the first strand (100 nt). The 5' terminal phosphate group modification can be introduced during the synthesis of the DNA fragment.
(3) An aqueous solution of the DNA100/80 assembly was obtained as in example 1, followed by the addition of a quantity of 10 XT 4 DNA ligase buffer, H according to the manufacturer's instructions 2 O and T4 DNA Ligase were enzymatically ligated at 37 ℃ for 1 hour to link 4 connectors in the first strand, so that 5 short strands of DNA fragments in the first strand formed a complete 100nt strand. The 100nt chain 1 was observed by polyacrylamide gel electrophoresis, and the results are shown in FIG. 4.
As can be seen from FIG. 4, the target 100nt DNA single strand was produced with high efficiency under the above conditions.
It should be noted that, as shown in fig. 5, as long as the short-chain DNA fragments form an assembly, the complete long double-chain structure can be characterized in native polyacrylamide gel electrophoresis (fig. 5 a) regardless of whether ligation is performed, but the native polyacrylamide gel electrophoresis shows that the DNA subjected to ligation treatment only can keep the complete long chain under the denaturing condition (such as lanes 2, 3, 5, and 6 in fig. 5 b), and the DNA long double-chain not subjected to ligation treatment can be redissolved into short chain under the denaturing condition (such as lanes 1 and 4 in fig. 5 b), which proves that successful characterization in native polyacrylamide gel electrophoresis cannot explain the formation of the target long-chain structure.
Example 3 preparation of longer DNA double stranded assemblies
To synthesize longer DNA sequences, the system was extended in example 3 to increase the amount of short-chain DNA. The method comprises the following specific steps:
(1) In the DNA252/240, long-chain DNAs (referred to as DNAs 252/240) having 252nt and 240nt and long-chain DNAs (referred to as DNAs 315/300) having 315nt and 300nt, respectively, of the first strand and the second strand are used as target long chains, and DNA fragments obtained by dividing the first strand (252 nt) include: d1-n1 to D1-n11; the DNA fragments obtained by dividing the second strand (240 nt) include: d1-m1 to D1-m12. In the DNA315/300, the DNA fragment into which the first strand (315 nt) is divided includes: d2-n1 to D2-n11; the DNA fragment obtained by dividing the second strand (300 nt) includes: d2-m1 to D2-m10. Specific choices of the foregoing sequences are shown in table 2.
The specific sequences of the DNA short chains used are shown in the following table:
TABLE 2 sequence information of DNA short strands used for preparing the assemblies
Sequence name Sequence information nt SEQ ID NO
D1-n1 ATGAGTAAAGGA 12 SEQ ID NO：10
D1-n2 GAAGAACTTTTCACTGGAGTTGTC 24 SEQ ID NO：11
D1-n3 CCAATTCTTGTTGAATTAGATGGT 24 SEQ ID NO：12
D1-n4 GATGTTAATGGGCACAAATTTTCT 24 SEQ ID NO：13
D1-n5 GTCAGTGGAGAGGGTGAAGGTGAT 24 SEQ ID NO：14
D1-n6 GCAACATACGGAAAACTTACCCTT 24 SEQ ID NO：15
D1-n7 AAATTTATTTGCACTACTGGAAAA 24 SEQ ID NO：16
D1-n8 CTACCTGTTCCATGGCCAACACTT 24 SEQ ID NO：17
D1-n9 GTCACTACTTTCGGTTATGGTGTT 24 SEQ ID NO：18
D1-n10 CAATGCTTTGCGAGATACCCAGAT 24 SEQ ID NO：19
D1-n11 CATATGAAACAGCATGACTTTTTC 24 SEQ ID NO：20
D1-m10 CTGTTTCATATGATCTGGGTATCT 24 SEQ ID NO：21
D1-m9 CGCAAAGCATTGAACACCATAACC 24 SEQ ID NO：22
D1-m8 GAAAGTAGTGACAAGTGTTGGCCA 24 SEQ ID NO：23
D1-m7 TGGAACAGGTAGTTTTCCAGTAGT 24 SEQ ID NO：24
D1-m6 GCAAATAAATTTAAGGGTAAGTTT 24 SEQ ID NO：25
D1-m5 TCCGTATGTTGCATCACCTTCACC 24 SEQ ID NO：26
D1-m4 CTCTCCACTGACAGAAAATTTGT 23 SEQ ID NO：27
D1-m3 GCCCATTAACATCACCATCTAATTC 25 SEQ ID NO：28
D1-m2 AACAAGAATTGGGACAACTCCAGT 24 SEQ ID NO：29
D1-m1 GAAAAGTTCTTCTCCTTTACTCAT 24 SEQ ID NO：30
D2-n1 ATGAGTAAAGGAGAA 15 SEQ ID NO：31
D2-n2 GAACTTTTCACTGGAGTTGTCCCAATTCTT 30 SEQ ID NO：32
D2-n3 GTTGAATTAGATGGTGATGTTAATGGGCAC 30 SEQ ID NO：33
D2-n4 AAATTTTCTGTCAGTGGAGAGGGTGAAGGT 30 SEQ ID NO：34
D2-n5 GATGCAACATACGGAAAACTTACCCTTAAA 30 SEQ ID NO：35
D2-n6 TTTATTTGCACTACTGGAAAACTACCTGTT 30 SEQ ID NO：36
D2-n7 CCATGGCCAACACTTGTCACTACTTTCGGT 30 SEQ ID NO：37
D2-n8 TATGGTGTTCAATGCTTTGCGAGATACCCA 30 SEQ ID NO：38
D2-n9 GATCATATGAAACAGCATGACTTTTTCAAG 30 SEQ ID NO：39
D2-n10 AGTGCCATGCCTGAAGGTTATGTACAGGAA 30 SEQ ID NO：40
D2-n11 AGAACTATATTTTTCAAAGATGACGGGAAC 30 SEQ ID NO：41
D2-m10 GAAAAATATAGTTCTTTCCTGTACATAACC 30 SEQ ID NO：42
D2-m9 TTCAGGCATGGCACTCTTGAAAAAGTCATG 30 SEQ ID NO：43
D2-m8 CTGTTTCATATGATCTGGGTATCTCGCAAA 30 SEQ ID NO：44
D2-m7 GCATTGAACACCATAACCGAAAGTAGTGAC 30 SEQ ID NO：45
D2-m6 AAGTGTTGGCCATGGAACAGGTAGTTTTCC 30 SEQ ID NO：46
D2-m5 AGTAGTGCAAATAAATTTAAGGGTAAGTTT 30 SEQ ID NO：47
D2-m4 TCCGTATGTTGCATCACCTTCACCCTCTCC 30 SEQ ID NO：58
D2-m3 ACTGACAGAAAATTTGTGCCCATTAACATC 30 SEQ ID NO：49
D2-m2 ACCATCTAATTCAACAAGAATTGGGACAAC 30 SEQ ID NO：50
D2-m1 TCCAGTGAAAAGTTCTTCTCCTTTACTCAT 30 SEQ ID NO：51
(2) An assembly of double-stranded DNA was synthesized in the manner described in example 1.
The assembly result is shown in fig. 6, in which fig. 6a shows the non-denaturing polyacrylamide gel electrophoresis characterization result, and fig. 6b shows the fragment analyzer characterization result. As can be seen from FIG. 6, by using this method, DNA252/240 and DNA315/300 can be efficiently assembled in one pot, providing a guarantee for the synthesis of the subsequent long sequences.
The above examples of the present disclosure are merely examples provided for clearly illustrating the present disclosure and are not intended to limit the embodiments of the present disclosure. Other variations and modifications will be apparent to persons skilled in the art in light of the above description. And are neither required nor exhaustive of all embodiments. Any modification, equivalent replacement, and improvement made within the spirit and principle of the present disclosure should be included in the protection scope of the claims of the present disclosure.

Claims (16)

  1. A method for preparing long-chain DNA, which comprises the following steps:
    the synthesis steps are as follows: synthesizing a first-strand DNA fragment group and a second-strand DNA fragment group, wherein the first-strand DNA fragment group comprises a DNA fragment n i And DNA fragment n i+1 The DNA fragment group of the second strand comprises a DNA fragment m i (ii) a i is selected from positive integers of more than 1; wherein, the DNA fragment m i 5' terminal sequence of (1) and DNA fragment n i+1 The 5' terminal sequence of (a) is a complementary sequence, a DNA fragment m i The 3' terminal sequence of (A) and the DNA fragment n i The 3' terminal sequence of (a) is a complementary sequence;
    and (3) annealing: mixing the DNA fragment group of the first chain and the DNA fragment group of the second chain in the same reaction system, and annealing to form an assembly precursor of double-stranded DNA; wherein a connecting port exists between two adjacent DNA fragments in the first strand, and a connecting port exists between two adjacent DNA fragments in the second strand; the connecting ports between the adjacent DNA fragments in the first strand DNA fragment group and the connecting ports between the adjacent DNA fragments in the second strand DNA fragment group are staggered;
    a connection step: connecting the connecting ports of the single-stranded DNAs of the first strand and the second strand to obtain an assembly of double-stranded DNAs formed by complementing the continuous single-stranded DNAs and the fragmented single-stranded DNAs.
  2. The method for preparing long-chain DNA according to claim 1, further comprising the steps of:
    a denaturation step: performing denaturation treatment on the assembly of the double-stranded DNA to obtain continuous single-stranded DNA;
    optionally, the method further comprises a purification step: purifying the continuous single-stranded DNA from the reaction system.
  3. The method for preparing long-chain DNA according to claim 1 or 2,
    the DNA fragment n i+1 3' terminal sequence of (1) andthe 3' terminal sequence of the other DNA fragment of the second strand is a complementary sequence;
    alternatively, the DNA fragment n i+1 The 3' terminal sequence of (3) and the DNA fragment m i+1 The 3' terminal sequence of (a) is a complementary sequence, the DNA fragment m i+1 Is complementary to other DNA fragments of the first strand DNA fragment set or is an unpaired sequence.
  4. The method for preparing long-chain DNA according to any one of claims 1 to 3, wherein the length of the continuous single-stranded DNA is 60nt or more, preferably 60 to 1000nt.
  5. The method for preparing long-chain DNA according to any one of claims 1 to 4, wherein the length of any one of the DNA fragments in the group of DNA fragments of the first strand and the group of DNA fragments of the second strand is 8 to 120nt, preferably 10 to 80nt, more preferably 15 to 40nt, and most preferably 20 to 30nt.
  6. The method for producing a long-chain DNA according to any one of claims 1 to 5, wherein the length of the 5' -end sequence of any one of the DNA fragments in the group of DNA fragments of the first strand and the group of DNA fragments of the second strand is 4nt or more, preferably 4 to 50nt, more preferably 6 to 30nt, most preferably 10 to 20nt; or,
    the length of the 3' end sequence of any one DNA fragment in the first strand DNA fragment group and the second strand DNA fragment group is more than 4nt, preferably 4-50nt, more preferably 6-30nt, and most preferably 10-20nt.
  7. The method for preparing a long-chain DNA according to any one of claims 1 to 6, wherein any one of the DNA fragments in the group of DNA fragments of the first chain comprises a phosphate group at the 5 'terminal, and a hydroxyl group at the 3' terminal; in the connecting step, phosphate groups and hydroxyl groups on two sides of the connecting port are connected to form phosphodiester bonds;
    optionally, adjacent phosphate groups and hydroxyl groups in the first strand are joined as phosphodiester linkages with enzymatic or chemical ligation.
  8. The method for preparing a long-chain DNA according to any one of claims 1 to 6, wherein any one of the DNA fragments in the group of DNA fragments of the second chain comprises a phosphate group at the 5 'terminal, and a hydroxyl group at the 3' terminal; in the connecting step, phosphate groups and hydroxyl groups on two sides of the connecting port are connected to form phosphodiester bonds;
    optionally, adjacent phosphate groups and hydroxyl groups in the second strand are joined as phosphodiester linkages by enzymatic or chemical ligation.
  9. The method for preparing a long-chain DNA according to any one of claims 1 to 8, wherein one or more positions of any one of the DNA fragments in the group of DNA fragments of the first strand and the group of DNA fragments of the second strand comprise a modified base, and the base at a position adjacent to the junction port is an unmodified base;
    alternatively, the modification is selected from m 6 A、Ψ、m 1 A、m 5 A、ms 2 i 6 A、i 6 A、m 3 C、m 5 C、ac 4 C、m 7 G、 m2,2G、m 2 G、m 1 G、Q、m 5 U、mcm 5 U、ncm 5 U、ncm 5 Um、D、mcm 5 s 2 U、Inosine(I)、hm 5 C、s 4 U、s 2 U, azobenzene, cm, um, gm, t 6 A、yW、ms 2 t 6 A or a derivative thereof.
  10. The method for preparing a long-chain DNA according to any one of claims 1 to 9, wherein the modified deoxyribose is contained at one or more positions of any one of the group of DNA fragments of the first strand and the group of DNA fragments of the second strand, and the deoxyribose at a position adjacent to the connection port is an unmodified deoxyribose;
    alternatively, the modification is selected from LNA, 2' -OMe, 3' -OMe u, vmoe, 2' -F or 2' -OBn (2 ' -O-benzyl group) or a derivative thereof.
  11. The method for producing a long-chain DNA according to any one of claims 1 to 10, wherein one or more positions of any one of the group of DNA fragments of the first strand and the group of DNA fragments of the second strand contain a modified phosphodiester bond, and the phosphodiester bond at a position adjacent to the connection port is an unmodified phosphodiester bond;
    optionally, the modification is selected from Phosphothioate (PS).
  12. The method for preparing a long-chain DNA according to any one of claims 1 to 11, wherein in the annealing step, the temperature is reduced after the incubation of the group of DNA fragments of the first chain and the group of DNA fragments of the second chain, so as to form an assembly precursor of a double-stranded DNA;
    optionally, the temperature of the incubation is any temperature from 0 to 100 ℃, preferably any temperature from 10 to 85 ℃, more preferably any temperature from 20 to 65 ℃.
  13. The method for producing a long-chain DNA according to any one of claims 1 to 12, wherein in the annealing step, the reaction system is obtained by dissolving the group of DNA fragments of the first strand and the group of DNA fragments of the second strand in the same solvent.
  14. The method for producing long-chain DNA according to claim 13, wherein the reaction system has a pH of 3 to 11, preferably a pH of 4 to 10, more preferably a pH of 5 to 9, and most preferably a pH of 6 to 8.
  15. The method for preparing long-chain DNA according to claim 13 or 14, wherein the molar ratio of any two DNA fragments in the group of DNA fragments of the first strand and the group of DNA fragments of the second strand in the reaction system is 1: (0.1-10), preferably 1: (0.5-1), most preferably 1:1.
  16. a long-chain DNA prepared by the method according to any one of claims 1 to 15, wherein the long-chain DNA is a single-stranded long-chain DNA;
    preferably, the long-chain DNA comprises a modified base, ribose, or phosphodiester linkage at one or more positions.
CN202180001883.6A 2021-02-10 2021-06-04 Method for preparing site-directed modified long-chain DNA Pending CN115605590A (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
CN2021101852507 2021-02-10
CN202110185250 2021-02-10
PCT/CN2021/098430 WO2022170707A1 (en) 2021-02-10 2021-06-04 Method for preparing site-directed modified long-chain dna

Publications (1)

Publication Number Publication Date
CN115605590A true CN115605590A (en) 2023-01-13

Family

ID=82837488

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202180001883.6A Pending CN115605590A (en) 2021-02-10 2021-06-04 Method for preparing site-directed modified long-chain DNA

Country Status (2)

Country Link
CN (1) CN115605590A (en)
WO (1) WO2022170707A1 (en)

Family Cites Families (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102321612B (en) * 2011-08-29 2013-05-15 苏州金唯智生物科技有限公司 Industrialized gene synthesis method
EP3578697B1 (en) * 2012-01-26 2024-03-06 Tecan Genomics, Inc. Compositions and methods for targeted nucleic acid sequence enrichment and high efficiency library generation
CN108531471B (en) * 2017-03-01 2020-08-07 南京金斯瑞生物科技有限公司 Long gene synthesis method
CN107190001A (en) * 2017-04-17 2017-09-22 武汉金开瑞生物工程有限公司 A kind of method for synthesizing gene
CN111349673A (en) * 2018-12-20 2020-06-30 江苏金斯瑞生物科技有限公司 Single-stranded DNA synthesis and error correction method
WO2020135651A1 (en) * 2018-12-28 2020-07-02 江苏金斯瑞生物科技有限公司 Single-chain dna synthesis method

Also Published As

Publication number Publication date
WO2022170707A1 (en) 2022-08-18

Similar Documents

Publication Publication Date Title
CN105121655B (en) Novel ligase activity
CA2948951C (en) Synthesis of double-stranded nucleic acids
JP3867926B2 (en) Nucleic acid amplification method
KR20090037118A (en) Method of amplifying target nucleic acids by rolling circle amplification in the presence of ligase and endonuclease
WO2000060121A1 (en) Pcr genome walking with synthetic primer
EP3837381A1 (en) Compositions and methods for improving library enrichment
CA2476564A1 (en) Polynomial amplification of nucleic acids
WO2013074833A1 (en) Capture probe and assay for analysis of fragmented nucleic acids
EP4150106A2 (en) Methods for ligation-coupled-pcr
CN111542532B (en) Method and system for synthesizing oligonucleotide by enzyme method
US7727745B2 (en) Synthesis of single-stranded DNA
US9695417B2 (en) Method for large-scale synthesis of long-chain nucleic acid molecule
EP1624059A2 (en) Method of producing nucleic acid molecules with reduced secondary structure
WO2008112683A2 (en) Gene synthesis by circular assembly amplification
CN115605590A (en) Method for preparing site-directed modified long-chain DNA
EP4359557A1 (en) Methods and compositions for combinatorial indexing of bead-based nucleic acids
JP7348197B2 (en) Systems and methods for preparing nucleic acid libraries through template switching mechanisms
KR101940900B1 (en) Method for producing target nucleic acid molecules and composition therefor
Hoff et al. Rapid and dynamic nucleic acid hybridization enables enzymatic oligonucleotide synthesis by cyclic reversible termination: A novel mechanism for enzymatic DNA synthesis
EP3309252A1 (en) On-array ligation assembly
WO2019090482A1 (en) Second-generation high-throughput sequencing library construction method
WO2018009677A1 (en) Fast target enrichment by multiplexed relay pcr with modified bubble primers
RU2809771C2 (en) Compositions and methods of improving library enrichment
CN107937389B (en) Connection assembly on array
CN115667511A (en) On-demand synthesis of polynucleotide sequences

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination